protein expression and genetic alterations of p53 and ras in intrahepatic cholangiocarcinoma

Protein expression and genetic alterations of p53 and ras inintrahepatic cholangiocarcinoma

S Furubo, K Harada, T Shimonishi, K Katayanagi, W Tsui1 & Y NakanumaDepartment of Pathology (II), Kanazawa University School of Medicine, Kanazawa, Japan and 1Department of Pathology,

Caritas Medical Centre, Kowloon, Hong Kong

Date of submission 1 September 1998Accepted for publication 21 January 1999

Furubo S, Harada K, Shimonishi T, Katayanagi K, Tsui W & Nakanuma Y

(1999) Histopathology 35, 230±240

Protein expression and genetic alterations of p53 and ras in intrahepatic cholangiocarcinoma

Aims: The signi®cance of molecular and geneticalterations of p53 and ras in the development andprogression as well as the histological differentiation ofintrahepatic cholangiocarcinoma (ICC) was evaluated.Methods and results: We examined immunohisto-chemically ras p21 protein and p53-related products(p53 protein, WAF-1 and mdm-2) in 43 cases of ICC. Inaddition, point mutations of ras and p53 were examinedgenetically in selected ICC cases by polymerase chainreaction-restriction fragment length polymorphism(PCR-RFLP) and direct sequence analysis. Point muta-tion of K-ras gene codon 12 was detected in three of 14cases and one of 15 cases by PCR-RFLP and directsequence analysis, respectively. Immunoreactivity of rasp21 protein was not detected. Point mutation of p53was detected in three of 15 cases. p53 protein wasimmunohistochemically detectable in 33 of 43 cases.

Immunoreactivity of p53 was more frequent in well-differentiated and less frequent in poorly differentiatedcases. Immunoreactivity of WAF-1 and mdm-2 was seenin 16 and eight of 43 cases, respectively. Both proteinswere frequently detected in the cases positive for p53protein.Conclusion: These results suggest that dysregulation ofras is involved in at least 20% of ICC and expression ofp53 protein is more signi®cantly involved in ICC,particularly in the well and moderately differentiatedcases. While some cases of p53 expression may beexplainable by point mutation of p53, there may besome epigenetic phenomena that stabilize p53 proteinin ICC. That is, wild type p53 may be stabilized and thendetectable by forming complexes with other moleculesof p53 downstream effector genes, such as WAF-1 andmdm-2.

Keywords: direct sequencing, immunohistochemistry, intrahepatic cholangiocarcinoma, p53, point mutation, ras

Introduction

Intrahepatic cholangiocarcinomas (ICC) are now beingevaluated in terms of accumulation of damage to criticalregulatory genes in a multistage manner.1,2 Amongcandidates for genetic alterations in general, ras proto-oncogene and p53 tumour suppressor gene are the beststudied.3

The three kinds of ras genes (H-ras, K-ras and N-ras)are converted into active oncogenes by point mutationsat either codon 12, 13, 18 or 61.4±6 Point mutationsin the K-ras gene result in uncontrolled stimulation of

ras-related functions caused by the altered p21 rasprotein-related pathway and this is followed by uncon-trolled cell proliferation.7 In neoplastic tissues, morethan 90% of K-ras mutations occurred in codon 12.8 Inaddition, the expression of ras p21 protein is known inseveral malignant tumours.9,10

Wild-type p53 and wild-type p53-activated fragment1 (WAF-1) are important in cell-cycle regulation, andthese proteins are found physiologically in the nucleusat low levels. The WAF-1 gene product is found in acomplex involving cyclins, cyclin-dependent kinase(CDK) and proliferating cell nuclear antigen in normalcells and appears to be a universal inhibitor of CDKactivity.11,12 Inactivation of p53 gene occurs in mosthuman malignancies either by point mutation or by the

Histopathology 1999, 35, 230±240

q 1999 Blackwell Science Limited.

Address for correspondence: Dr Y Nakanuma, Second Department ofPathology, Kanazawa University School of Medicine, Kanazawa 920±

8640, Japan.

binding of oncogenic proteins to wild p53 protein, andallows progression through the cell cycle without aphysiological checkpoint, resulting in a selective growthadvantage for cancer cells.13,14 In both situations, p53protein may accumulate in the nucleus and can bedetected immunohistochemically.13,14 In the latter, theexpression of wild-type p53 may be either pathological(non-functional, by forming complexes with othermolecules or mutation of p53 downstream effectorgenes, such as WAF-1, with loss of feedback control) orphysiological (functional p53 activated in DNA-damagingconditions). The mouse double minute 2 (mdm-2) geneis oncogenic upon ampli®cation and tumorigenic whenoverexpressed, and this protein forms a stable complexwith p53 and inhibits sequence-speci®c DNA binding byp53 protein.15 There is need for a precise molecularstudy to investigate the above possibilities in ICC cases.

The genetic changes of p53 and ras, as well asoverexpression of the p53 and other oncogene-relatedproteins in ICC, have already been studied severaltimes,2,16±19 although the rarity of ICC cases makes theanalysis of the relationship between the alteration ofcancer-related genes and their products dif®cult toaddress in this disease.

In this study, we examined the relationship betweenthe point mutation of ras and p53 and their relatedproteins such as ras p21 protein and p53 protein, WAF-1 and mdm-2 in ICC, by the methods applicable toarchival, formalin-®xed, paraf®n-embedded tissue.

Materials and methods

I N T R A H E PAT I C C H O L A N G I O C A RC I N O M A A N D C O N T RO L

T I S S U E S P E C I M E N S

More than eight thin sections, 4 mm thick, were cutfrom formalin-®xed, paraf®n-embedded tissue blocksfrom 43 ICC patients (average age 65 years; male/female 26/17) which were retrieved from the archives ofour laboratory, including consultation cases (Table 1).One case was complicated with hepatolithiasis andthree cases of combined ICC and hepatocellularcarcinoma were associated with cirrhosis related tohepatitis C viral infection. In addition, more than eightfrozen sections were cut from one surgically resectedcase of ICC which was also included in the paraf®nsection study. According to Okuda et al.20 the 43 ICCcases were largely divided into 23 hilar and 14peripheral types, while the remaining six cases withextensive spread were dif®cult to subclassify. Histo-logical sections were reviewed and each case wasclassi®ed by the predominant growth pattern accordingto the histological classi®cation proposed by the

Japanese Biliary Tract Committee: well-differentiatedadenocarcinoma including papillary adenocarcinoma,nine cases; moderately differentiated adenocarcinoma,18 cases; poorly differentiated adenocarcinoma, 12cases; mucinous carcinoma, two cases; and adenocar-cinoma elements of combined ICC and hepatocellularcarcinoma, two cases.

For positive controls for mdm-2 and p53 immuno-staining, one case of cutaneous angiosarcoma (male,60 years) and one case of gastric leiomyosarcoma(female, 70 years) were used.21,22 For positive controlof WAF-1 immunostaining, normal small intestinalmucosa (male, 45 years) was used, because normalsmall intestinal mucosal epithelial cells were positive forWAF-1.23,24 For positive control for point mutations ofras and p53 the above-mentioned two cases of sarcomas,in which point mutations are well known to occur, wereused.

I M M U N O H I S T O C H E M I S T RY

The deparaf®nized sections were microwaved in10 mmol/l citrate buffer (pH 6.0) for 20 min in an800 W microwave oven for the pretreatment of tissueprior to staining. Following endogenous peroxidaseblocking and incubation in normal goat serum (diluted1:10; Vector Lab, Burlingame, CA) for 20 min, thesesections were incubated at 48C overnight with themouse monoclonal antibody to human ras p21 (pan-rasAb1 which is known to be broadly reactive with the p21translational products of the H-, K- and N-ras humanoncogenes; Oncogene Science, Unionale, NY), mousemonoclonal antibody to p53 (clone DO-7; Dako,Glostrup, Denmark), mouse monoclonal antibody tomdm-2 (Ab-1; Oncogene Science), or mouse mono-clonal antibody to human WAF-1 (Ab-1; Calbiochem-Navabiochem International, Cambridge, MA). Themonoclonal antibody DO-7 against human p53 isknown to detect mutant as well as wild p53 proteinimmunohistochemically in routinely processed paraf®nsections. These sections were then incubated for 30 minwith goat anti-mouse immunoglobulins conjugated toperoxidase-labelled dextran polymer (EnvisonTM; Dako).After benzidine reaction, sections were weakly counter-stained with haematoxylin. As negative controls ofimmunohistochemistry, non-immune serum was usedfor the primary antibodies. This procedure consistentlyresulted in no staining. Moreover, tissue specimens ofnormal human colon and soft tissue sarcomas wereused as positive controls for WAF-1 and mdm-2.17,25 rasp21 protein is expressed on the cytoplasm, while p53protein, mdm-2 and WAF-1 are expressed on thenuclei.10,19,25 It is also well known in formalin-®xed

p53 and ras in cholangiocarcinoma 231

q 1999 Blackwell Science Ltd, Histopathology, 35, 230±240.

tissue sections that, while mutant p53 protein isdetectable, functional p53 of wild type is not.13,14

Positive sarcoma controls showed strong immunostain-ing of p53 and mdm-2, respectively, and normal adultintestinal mucosa also showed strong positive reactionof WAF-1.

Immunohistochemical reactions were semiquanti®edon a scale of ÿ to �� as follows: ÿ, negative or <10%positive nuclei in all carcinoma cell nuclei; �, 10±50%positive nuclei; ��, 50±75% positive nuclei; and��, over 75% positive nuclei.

G E N E T I C S T U DY

Carcinoma tissues were carefully scratched from thedeparaf®nized sections of 15 cases and frozen sectionsof one case under a light microscope. The latter casewas included among the former 15 cases (one casewas associated with hepatolithiasis and three caseswith liver cirrhosis) (Table 2). Haematoxylin and eosin-stained sections were reviewed concomitantly tofacilitate accurate identi®cation of the lesions. Non-neoplastic tissues were not included in these scratches.DNA was then extracted from dispatched tissue sectionsusing the DEXPAT (Takara Shuzo Co., Tokyo, Japan).

Detection of ras and p53 point mutations by direct sequenceanalysisPoint mutations of p53 (exons 5±8) and ras (K-rascodon 12 and 61, N-ras codon 12 and 61 and H-rascodon 12 and 61) were analysed by direct sequenceanalysis of DNA.26 DNA extracted from carcinomatissue was ampli®ed by polymerase chain reaction(PCR) using the primer of ras (K-ras codon 12 and 61,N-ras codon 12 and 61 and H-ras codon 12 and 61)(Table 3). Polymerase chain reaction products weresubsequently analysed by direct cycle sequencingusing an auto-sequencer (ABI, PRISM377; PE AppliedBiosystem, Norwalk, CT).

Two of two positive control cases (angiosarcoma andleiomyosarcoma) showed point mutation of p53 andone of them showed point mutations in K-ras codon 12(Table 2).

Detection of ras point mutations by polymerase chainreaction/restriction fragment length polymorphismPrimers and conditions for the PCR ampli®cations anddigestions with each restriction enzyme were asdescribed by Kahn et al.27 and Whetsell et al.28 DNAextracted from carcinoma samples was analysed for thepresence of point mutations of K-ras codon 12, N-rascodon 12 and H-ras codon 12 and 61. This methodemploys nucleotide substitution in PCR primers

(Table 3) to create different endonuclease restrictionpatterns in mutated and normal alleles or to takeadvantage of naturally occurring differential restrictionenzyme sites. Point mutations were then analysed bysubsequent sequence analysis by direct cycle sequencingusing an auto-sequencer.

An angiosarcoma case and a leiomyosarcoma case(control case) were found to show point mutations ofp53 and ras by this method (Table 2).

S TAT I S T I C S

Intergroup comparison was examined by the chi-squared test and Fisher's exact test, and P-values lessthan 0.05 were regarded as statistically signi®cant.Correlation between the degree of p53 expression andthat of WAF-1 or mdm-2 was examined by Spearman'srank correlation test.

Results

E X P R E S S I O N O F R A S P 2 1 P RO T E I N A N D P O I N T M U TAT I O N S

O F R A S

Immunohistochemistryras p21 protein was not detectable in carcinoma tissueof 43 ICC cases examined.

Genetic studyBy PCR-restriction fragment length polymorphism(RFLP) analysis, point mutation of K-ras codon 12(Figure 1) was detected in three (20%) of 15 ICCcases examined (Table 2). Point mutations were notseen in H-ras codon 12 and 61 and N-ras codon 12.

By direct sequence analysis, point mutation of K-rascodon 12 (GGT!TGT (Gly!Cys)) was detected in onlyone case of ICC which also showed point mutation byPCR-RFLP analysis (Table 2). In the other 14 cases,including two showing point mutation by PCR-RFLP,point mutation was not detected in codon 12, 13 and61 of K-ras or N- and H-ras codon 12 and 61.

E X P R E S S I O N O F p 5 3 - R E L AT E D P RO T E I N S A N D P O I N T

M U TAT I O N S O F p 5 3

Immunohistochemistryp53 protein, which was detectable on nuclei ofcarcinoma cells of ICC (Figure 2), was overexpressedin 33 (76.7%) of the 43 cases examined. This expressionwas seen in all cases of well-differentiated adenocarcin-oma, in 15 (83.3%) of the 18 cases of moderatelydifferentiated adenocarcinoma and in six (50%) ofthe 12 cases of poorly differentiated adenocarcinoma

232 S Furubo et al.



Table 1. Clinicopathological features of cases with intrahepatic cholangiocarcinoma and immunohistochemical expression of p53protein, WAF-1 protein and mdm-2 protein

Immunohistochemicalexpression

Histological type Location of Association ofCase Age/sex of carcinoma carcinoma hepatolithiasis p53 WAF-1 mdm-2

1 52/F Papillary adenocarcinoma u.d. ÿ � ÿ ��

2 64/M Papillary adenocarcinoma H � � � ÿ

3 87/M Papillary adenocarcinoma H ÿ � ÿ ÿ

4 66/F Papillary adenocarcinoma H ÿ � � ÿ

5 56/F Well-diff. adenoca. H ÿ �� ÿ

6 79/M Well-diff. adenoca. H ÿ ��

7 52/F Well-diff. adenoca. P ÿ �� ÿ

8 67/M Well-diff. adenoca. P ÿ ��

9 76/F Well-diff. adenoca. P ÿ �� ÿ ÿ

10 63/M Mod-diff. adenoca. u.d. n.a. �� ÿ ÿ

11 65/F Mod-diff. adenoca. H ÿ ��

12 57/F Mod-diff. adenoca. P ÿ � � �

13 59/F Mod-diff. adenoca. P ÿ � ÿ ÿ

14 77/M Mod-diff. adenoca. P ÿ �� ÿ ÿ


16 69/M Mod-diff. adenoca. P ÿ ÿ ÿ ÿ

17 71/M Mod-diff. adenoca. P ÿ � ÿ ÿ


19 76/M Mod-diff. adenoca. P ÿ ÿ � ÿ

20 54/M Mod-diff. adenoca. P ÿ ÿ ÿ ÿ

21 64/M Mod-diff. adenoca. H ÿ � ÿ ÿ



24 83/M Mod-diff. adenoca. H ÿ � ÿ �

25 57/M Mod-diff. adenoca. H ÿ � ÿ �

(Table 1). Two cases of mucinous carcinoma and oneof two combined carcinoma cases (adenocarcinomaelements) were also positive for p53 protein, respec-tively. While 15 of the 19 hilar ICC and 14 of the 19peripheral ICCs were positive for p53 (P >0.05),respectively, moderate to marked expression wasrather more common in the peripheral type than inthe hilar type.

WAF-1 and mdm-2, both of which were alsodetectable on the nuclei of carcinoma cells (Figures 3and 4), were present in 16 (37.2%) and eight (18.6%) ofthe 43 ICC cases examined, respectively (six and threecases of the nine well-differentiated cases; four and fourcases of 18 moderately differentiated cases and two andno cases of the 12 poorly differentiated cases). Twomucinous and combined carcinoma cases were positive

234 S Furubo et al.


Table 1. (continued)

Immunohistochemicalexpression

Histological type Location of Association ofCase Age/sex of carcinoma carcinoma hepatolithiasis p53 WAF-1 mdm-2

26 52/F Mod-diff. adenoca. H ÿ � ÿ ÿ

27 75/M Mod-diff. adenoca. H ÿ � � ÿ

28 65/F Poorly diff. adenoca. u.d. n.a. � � ÿ

29 63/M Poorly diff. adenoca. P ÿ ÿ � ÿ

30 70/F Poorly diff. adenoca. P ÿ �� ÿ ÿ

31 44/F Poorly diff. adenoca. P ÿ � ÿ ÿ

32 57/F Poorly diff. adenoca. H ÿ � ÿ ÿ

33 69/M Poorly diff. adenoca. u.d. ÿ �� ÿ ÿ

34 61/M Poorly diff. adenoca. u.d. ÿ ÿ ÿ ÿ

35 67/F Poorly diff. adenoca. H ÿ ÿ ÿ ÿ

36 64/M Poorly diff. adenoca. H ÿ ÿ ÿ ÿ

37 60/F Poorly diff. adenoca. H ÿ � ÿ ÿ

38 75/F Poorly diff. adenoca. H ÿ ÿ ÿ ÿ

39 63/M Poorly diff. adenoca. H ÿ ÿ ÿ ÿ

40 68/M Comb P ÿ ÿ � ÿ

41 67/M Comb P ÿ �� ÿ

42 64/F Muc P ÿ � � ÿ

43 65/M Muc P ÿ ��

M, male; F, female; Comb, combined hepatocellular cholangiocellular carcinoma; Muc, mucinous carcinoma; H, hilar; P, peripheral;u.d., undetermined due to extensive growth; n.a., not available; semiquantitative evaluation of positive cells: ÿ, ,10%; �, 10±50%; ��, 50±75%; ��, >75%.

p53

and

ras

inch

olangiocarcin

oma

23

5

q1

99

9B

lack

well

Scien

ceL

td,

Histopath

ology,3

5,

23

0±

24

0.

Table 2. Immunohistochemical study of p53 protein, WAF-1 and mdm-2 and point mutation of p53 and K-ras of 15 cases of intrahepatic cholangiocarcinoma and twocontrol cases

Immunohistochemicalexpression p53 mutation K-ras codon 12 mutation

Case Histological type of carcinoma p53 WAF-1 mdm-2 Direct sequence PCR-RFLP Direct sequence

1 Pap � ÿ �� ÿ ÿ ÿ

2 Pap � � ÿ Exon 7 codon 252, CTC ! CTT (Leu ! Leu) ÿ ÿ

5 Well �� ÿ ÿ ÿ ÿ

6 Well �� ÿ ÿ ÿ

7 Well �� ÿ ÿ � ÿ

10 Mod �� ÿ ÿ ÿ ÿ ÿ

11 Mod �� ÿ ÿ ÿ

12 Mod � � � ÿ � GGT ! TGT (Gly ! Cys)

29 Por � � ÿ ÿ ÿ ÿ

33 Por �� ÿ ÿ Exon 7 codon 246, ATG ! ATA (Met ! Ile) ÿ ÿ

34 Por ÿ ÿ ÿ Exon 5 codon 157, GTC ! GAC (Val ! Asp) ÿ ÿ

40 Comb ÿ � ÿ ÿ � ÿ

41 Comb �� ÿ ÿ n.d. ÿ

42 Muc � � ÿ ÿ ÿ ÿ

43 Muc �� ÿ ÿ ÿ

PC1 Leiomyosarcoma �� n.d. �� Exon 5 codon 141, TGC ! CGC (Cys ! Arg) ÿ ÿ

PC2 Angiosarcoma �� n.d. �� Exon 6 codon 214, CAT ! CGT (His ! Arg) � CGT ! GAT (Gly ! Asp)

Semiquantitative evaluation of positive cells; ÿ, ,10%, �, 10±50%; ��, 50±75%; ��, >75%; Pap, papillary adenocarcinoma; Well, well-differentiatedadenocarcinoma; Mod, moderately differentiated adenocarcinoma; Por, poorly differentiated adenocarcinoma; Comb, combined hepatocellular cholangiocellularcarcinoma; Muc, mucinous carcinoma; PC, positive control; n.d., not done; PCR-RFLP, polymerase chain reaction-restriction fragment length polymorphism.

for WAF-1 and two and one mucinous and combinedcarcinoma cases were positive for mdm-2 (Table 1).Expression of these two proteins, particularly WAF-1,was more or less similar to that of p53 protein withrespect to histological types of ICC.

The relation between p53 expression and mdm-2expression, and that between p53 expression and WAF-1expression, is shown in Figure 5. WAF-1 was seen in 13

(81%) of 16 ICC cases positive for p53. The caseswith positive immunoreaction of mdm-2 and alsothose with positive immunoreaction of WAF-1 showedexpression of p53 protein. There was a considerablenumber of cases which expressed p53 protein but notWAF-1 or mdm-2. There was, however, no correlationbetween expression of p53 and that of WAF-1 or mdm-2(P > 0.05).

236 S Furubo et al.


Gene Primer Sequence (50±30)

Primers used for direct sequence analysisK-ras codon 12� 13 Sense gactgaatataaacttgtgg

Antisense cgtccacaaaatgattctca

K-ras codon 61 Sense ttcctacaggaagcaagtagAntisense gtcctcatgtactggtccct

N-ras codon 12� 13 Sense gactgagtacaaactggtggAntisense catctacaaagtggttctgg

N-ras codon 61 Sense tcttacagaaacaagtggtAntisense cctgtcctcatgtattggtc

H-ras codon 12� 13 Sense ggcaggagaccctgtaggagAntisense gtattcgtccacaaaatggttct

H-ras codon 61 Sense agacgtgcctgttggacatcAntisense cgcatgtactggtcccgcat

p53 Exon 5 Sense gtgccctgactttcaactctgAntisense ctgtcgtctctccagccccag

p53 Exon 6 Sense ggtccccaggcctctgattccAntisense cagacctcaggcggctcatag

p53 Exon 7 Sense gttatctcctaggttggctctgAntisense gtggctcctgacctggagtct

p53 Exon 8 Sense cctatcctgagtagtggtaaAntisense ctgcttgcttacctcgcttag

Primers used for PCR-RFLP analysisK-ras codon 12� 13 Sense atataacttgttggtagttgacct

Antisense cgtccacaaaatgattctga

N-ras codon 12� 13 Sense tacaaactggtggtggttggaccaAntisense catctacaaagtggttctgg

H-ras codon 12� 13 Sense ggcaggagaccctgtaggagAntisense gtattcgtccacaaaatggttct

H-ras codon 61 Sense agacgtgcctgttggacatcAntisense cgcatgtactggtcccgcat

Table 3. Primers used for p53and ras gene ampli®cation

Genetic studyPoint mutation of p53 was found in carcinoma tissue bydirect sequence analysis in three of the 15 casesexamined. Point mutations were identi®able in exon-5(case 34, codon 157, GTC!GAC (Val!Asp)) and exon-7(case 2, codon 252, CTC!CTT (Leu!Leu); case 33,codon 246, ATG!ATA (Met!Ile)) but not in exon 6and exon 8 (Table 2). There were no speci®c p53alterations with respect to histological subtypes orintrahepatic location of ICC.

Relation between genetic change of p53 andimmunohistochemical detection of p53-related proteinsTwo of three cases with p53 mutations also showed

immunohistochemical expression of p53, as did 11 of12 cases without p53 point mutations. WAF-1 waspositive in one of three cases with p53 point mutationand 10 of 12 cases without p53 point mutation. mdm-2was immunohistochemically positive in ®ve of 12 p53protein-positive cases without p53 point mutation andnegative in three cases with p53 point mutation. WAF-1was positive in one of three cases with p53 point mutationand 10 of 12 cases without p53 point mutation.

Discussion

To date, there have been several genetic and immuno-phenotypic studies on K-ras and p53 in ICC.18,29,30 As



Figure 1. Detection of k-ras mutation by polymerase chain reaction restriction fragment length polymorphism. Three cases show point

mutation (white arrows). M, a molecular weight marker; C1, DNA from normal liver after restriction enzyme (Mva I) treatment; C2, DNA

from normal liver without restriction enzyme treatment; MT, mutant type; WT, wild type.

Figure 2. p53 is expressed onsome nuclei of carcinoma cells

(arrows) in intrahepatic

cholangiocarcinoma cells

(immunohistochemistry(envision �) and

haematoxylin ´200).

for the genetic studies on ras genes, it was shown byusing PCR and direct sequencing and single-strandconformation polymorphism (SSCP) analysis that pointmutation of K-ras was detected in 33.3±66.7% of ICCcases.18,30,31 The incidence of this mutation in ICC waslow in Thai cases (8%) which were associated with liver¯uke infections.18 In the present study, almost all rasmutations occurred at codon 12 or 13 of the K-ras genein ICC and the point mutation of K-ras codon 12 wasfound in 20% of ICC cases by PCR-RFLP; the mutation

was GGT!TGT, which had already been reported inICCs.18 The presence of ras point mutation was notrelated to the particular histology or intrahepaticlocation of ICC in this study. The relatively low incidenceof K-ras mutation in this study may be due to themethod applied or to the ICC cases themselves, whichincluded one case associated with hepatolithiasis andthree cases with non-biliary liver cirrhosis.

Recently, there have been several reports that ras p21protein is frequently detectable immunohistochemically

238 S Furubo et al.


Figure 3. WAF-1 is expressedon some nuclei of carcinoma

cells (arrows) in intrahepatic

cholangiocarcinoma(immunohistochemistry for

WAF-1 (envision �) and

haematoxylin ´200).

Figure 4. mdm-2 is expressed

on some nuclei of carcinomacells (arrows) in intrahepatic

cholangiocarcinoma

(immunohistochemistry for

mdm-2 (envision �) andhaematoxylin ´200).

in premalignant and malignant cells of human tumoursand this protein seems to be associated with aggres-siveness of neoplastic growth and metastatic poten-tial.9,10 However, no such expression was seen in ICCcases including three cases with point mutation of ras inthis study using other monoclonal antibodies. Thediscrepancy of ras point mutation and ras p21 proteinexpression found in this study has also been pointedout in other malignancies, while the exact reasonsfor it remain unclear.9 Voravud et al.19 reported that75% of ICC cases were immunohistochemically positive

for c-ras by using monoclonal antibody Y13±259. Thisdifference in the positive ratio between two studies maybe due to the different monoclonal antibodies used.

The inactivation of the p53 gene occurs in mosthuman malignancies either by point mutation or by thebinding of oncogenic proteins to wild p53 protein.13,14

In human ICC, Kiba et al..18, using SSCP and directsequencing analyses, reported that the incidence of p53mutation was 33%. Mutated codons were constantlydetected in highly conserved regions (exons 5±8). In thepresent study, using direct sequence analysis, pointmutation was found in three of the 15 cases (20%) ofICC and two of these three cases were immunohisto-chemically positive for this protein. The mutation wasfound in exon 7 (codon 252 (CTC!CTT), codon 246(ATG!ATA)) and in exon 5 (codon 157 (GTC!GAC)).The p53 mutation was not related to the histology andintrahepatic location of ICC in this study.

Wild p53 protein, which is stabilized and inactivatedby forming complexes with other molecules, may be alsodetectable by p53 antibody (DO 7). For example, Olineret al. reported that, in human sarcoma, binding of mdm-2to p53 results in the inactivation of p53.15 This may bethe case in ICC. In the present study, ®ve cases whichwere positive for p53 protein but negative for pointmutation were positive for mdm-2. In these cases, mdm-2expression may be responsible for the stability andinactivation of p53. It was also found in this study thatWAF-1 was immunohistochemically detectable in 16 of43 ICC cases and immunoreactivity of WAF-1 wasrelated to histological differentiation of ICC. This ®ndingis compatible with a previous report23 that WAF-1 isrelated to histological maturation and differentiation ofnon-neoplastic as well as neoplastic tissue.23 Thepresence of other gene products of p53 downstreameffector gene, such as WAF-1, may modulate the p53gene to enhance p53 protein synthesis to a level thatcan be detected immunohistochemically. For example,ampli®cation, or possibly mutation, of WAF-1 may beintegrated in the process of immunohistochemicalexpression of wild p53 in ICC.31,32 In any case,overexpression of p53 protein is known to be associatedwith resistance to apoptosis.16,17 Dysregulation of apop-tosis and cell kinetics promotes malignant transformationof biliary epithelial cells and progression of ICC.

Harnois et al.33 reported that resistance to apoptosisby overexpression of bcl-2 may be a feature of ICCmediated by alterations in intracellular signallingcascades caused by disturbances in the quantity,composition and metabolism of cytotoxic and/or cyto-protective biliary constituents.34 The alterations of p53as well as ras of ICC found in the present study may alsobe caused or triggered by alterations of biliary



Figure 5. a, The relationship between immunohistochemical expres-sion of WAF-1 and p53 in intrahepatic cholangiocarcinoma. There

is no signi®cant correlation. b, The relationship between immuno-

histochemical expression of mdm-2 and p53 in intrahepatic

cholangiocarcinoma. There is no signi®cant correlation.

constituents. Further studies in ICCs should beperformed at several developmental stages of ICC,including biliary dysplasia and non-invasive ICC,1 toevaluate the development and progression of ICC.

References

1. Sasaki M, Nakanuma Y, Kim YS. Characterization of apomucin

expression in intrahepatic cholangiocarcinomas and their pre-cursor lesions: An immunohistochemical study. Hepatology 1996;

24; 1074±1078.

2. Watanabe M, Asaka M, Tanaka J, Kurosawa M, Kasai M,

Miyazaki T. Point mutation of K-ras gene codon 12 in biliarytract tumors. Gastroenterology 1994; 107; 1147±1153.

3. Levine AJ, Chang A, Dittmer D et al. The p53 tumor suppressor

gene. J. Lab. Clin. Med. 1994; 123; 817±23.

4. Rodenhuis S, Slebos RJ. The ras oncogene in human lung cancer.Am. Rev. Respir. Dis. 1990; 142 (6:2); S27±30.

5. Barbacid M. ras genes. Annu. Rev. Biochem. 1987; 56; 779±827.

6. Bos JL. The ras gene family and human carcinogenesis. MutantRes. 1988; 195(3); 255±271.

7. Janowski M. ras proteins and the ras related signal transduction

pathway. Radient. Environ. Biophys. 1991; 30; 185±189.

8. Urban T, Ricci S, Lacave R et al. Codon 12 ki-ras mutation in non-small-cell lung cancer: comparative evaluation in tumoural and

non-tumoural lung. Br. J. Cancer 1996; 74; 1051±1055.

9. Tong Y, Tucker SB, Smith MA. Expression of Hras-p21 and keratin

K13 in UVR-induced skin tumors in Sencar mice. J. Toxicol.Environ. Health 1998; 53; 439±453.

10. Garzetti GG, Giavattini A, Lucarini G et al. Ras p21 immuno-

staining in early stage squamous cervical carcinoma: relationshipwith lymph node involvement and 72kDa-metalloproteinase

index. Anticancer Res. 1998; 18; 609±613.

11. Harper JW, Adami GR, Wei N, Keyomarsi K, Elledge SJ. The p21

Cdk-interacting protein Cip 1 is a potent inhibitor of G1 cyclin-dependent kinases. Cell 1993; 75; 805±816.

12. Xiong Y, Hannon GJ, Zhang H, Casso F, Kobayashi T, Beach D.

p21 is a universal inhibitor of cyclin kinase. Nature 1993; 366;

701±704.13. Iggo R, Gatter K, Bartek J, Lane D, Harris AL. Increased expression

of mutant forms of p53 oncogene in primary lung cancer. Lancet

1990; 335; 675±679.14. Blagosklonny MV. Loss of function and p53 protein stabilization.

Oncogene 1997; 15; 1889±1893.

15. Oliner JD, Pietenpol JA, Thiagalingam S, Gyuris J, Kinzler KW,

Vogelstein B. Oncoprotein MDM2 conceals the activation domainof tumor suppressor p53. Nature 1993; 362; 857±860.

16. Shimamura A, Fisher DE. p53 in life and death. Clin. Cancer Res.

1996; 2; 435±440.

17. 0hashi K, Nakajima Y, Kanehiro H et al. Ki-ras mutations and p53expression in intrahepatic cholangiocarcinomas: relation to gross

tumor morphology. Gastroenterology 1995; 109; 1612±1617.

18. Kiba T, Tsuda H, Pairojkul C, Inoue S, Sugimrua T, Hirohashi S.

Mutations of the p53 tumor suppressor gene and the ras gene

family in intrahepatic cholangiocarcinomas in Japan and Thai-

land. Mol. Carcinogenesis 1993; 8; 312±318.19. Voravud N, Foster CS, Gilbertson JA, Sikora FK, Waxman J.

Oncogene expression in cholangiocarcinoma and in normal

hepatic development. Hum. Pathol. 1989; 20; 1163±1168.

20. Okuda K, Kubo Y, Okazaki N et al. Clincial aspects of intrahepaticbile duct carcinoma including hilar carcinoma. A study of 57

autopsy proven cases. Cancer 1977; 39; 232±246.

21. Hall KL, Teneriello MG, Taylor RR et al. Analysis of Ki-ras, p53,

and MDM2 genes in uterine leiomyomas and leiomyosarcomas.Gynecol. Oncol. 1997; 65; 330±335.

22. Cordon-Cardo C, Latres E, Drobnjak M et al. Molecular abnormali-

ties of mdm2 and p53 genes in adult soft tissue sarcomas. CancerRes. 1994; 54; 794±799.

23. Doglioni C, Pelosio P, Laurino L et al. p21/WAF1/CIP1 expression

in normal mucosa and in adenomas and adenocarcinomas of the

colon: its relationship with differentiation. J. Pathol. 1996; 179;248±253.

24. el-Deiry WS, Tokino T, Waldman T et al. Topological control of

p21WAF1/CIP1 expression in normal and neoplastic tissues.

Cancer Res. 1995; 55; 2910±2919.25. Doglioni C, Pelosio P, Laurino L et al. p21/WAF1/CIP1 expression

in normal mucosa and in adenomas and adenocarcinomas of the

colon: its relationship with differentiation. J. Pathol. 1996; 179;248±253.

26. Grif®n HG, Grif®n AM. DNA sequencing. Recent innovations

and future trends. Appl. Biochem. Biotechnol. 1993; 38; 147±

159.27. Kahn SM, Jiang W, Culbertson TA et al. Rapid and sensitive

nonradioactive detection of mutant k-ras genes via `enriched'

PCR ampli®cation. Oncogenes 1991; 6; 1079±1083.

28. Whetsell LH, Ringer DP, Schaefer FV. Molecular approach to rapidassessment of p53 tumor suppressor mutations in esophageal

tumors from stained histological studies. Diagn. Mol. Pathol.

1994; 53; 1747±1750.

29. Tsuda H, Satarug S, Bhudhisawasdi V, Kihana T, Sugimura T,Hirohashi S. Cholangiocarcinoma in Japanese and Thai patients:

difference in etiology and incidence of point mutation of the c-K-

ras proto-oncogene. Mol. Carcinogenesis 1992; 6; 266±269.30. Tada M, Omata M, Ohto M. High incidence of ras gene mutation

in intrahepatic choloangiocarcinoma. Cancer 1992; 69; 1115±1118.

31. Dix B, Robbins P, Carrello A, House A, Iacopetta B. Comparison of

p53 gene mutation and protein overexpression in colorectalcarcinomas. Br. J. Cancer 1994; 70; 585±590.

32. Fuchs B, O'Connor D, Fallis L, Schedtmann KH, Lu X. Comparison

p53 gene mutation and protein overexpression in colorectal

carcinomas. Br. J. Cancer 1994; 10; 599±601.33. Harnois DM, Que FG, Cell QA, LaRusso NF, Gores GJ. Bcl-2 is

overexpressed and alters the threshold for apoptosis in a

cholangiocarcinoma cell line. Hepatology 1997; 26; 884±890.34. Fang F, Grend G, Watanabe N, Hunter T, Ruoslahti D. Dependence

of cylin E-CDK2 kinase activity on cell anchorage. Science 1996;

271; 499±502.

240 S Furubo et al.


protein expression and genetic alterations of p53 and ras in intrahepatic cholangiocarcinoma

Documents