polypeptide variants of β-arrestin and arrestin3

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 268, No. 21, Issue of July 25, pp. 15640-15648, 1993 Printed in U. S . A.

Polypeptide Variants of ,&Arrestin and Arrestin3”

(Received for publication, January 11, 1993, and in revised form, April 13, 1993)

Rachel Sterne-MarrS, Vsevolod V. GurevichS, Paul Goldsmithe, Roger C. BodineS, Christa Sanders$, Larry A. DonosoT(1, and Jeffrey L. Benovie$** From the $Department of Pharmacology, Jefferson Cancer Institute and the (IResearch Division, Wills Eye Hospital and Jefferson Medical College, Thomas Jefferson University, Philadelphia, Pennsylvania 19107 and the SMolecular Pathophysiology Branch, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, Maryland 20892

Retinal arrestin (S-antigen) inactivates the phototransduction cascade by binding to light-activated phosphorylated rhodopsin and thereby ”arresting”coupling to the G protein transducin. &Arrestin (Barr), a ubiquitous arrestin homolog, acts analogously to desen- sitize the Bz-adrenergic receptor by disrupting G, receptor interaction. In an attempt to identify additional “arrestins” which might regulate the multitude of G protein-coupled receptors, we have isolated two bovine brain cDNAs which encode polypeptide variants of an arrestin homolog which we have designated arrestin3 (arr3). The open reading frames of these two cDNAs are identical except that the long form, arr3L, contains an 1 1-amino-acid insert between residues 361 and 362. Arr3 is more closely related to bovine Barr (78% identity) than to bovine visual arrestin (56% identity). Polymerase chain reaction amplification of RNA and immunoblotting of lysates with an arr3-specific antibody suggest that the short form, arr3S, is the major form of arr3 in all bovine tissues and that it is most abundant in the spleen. Furthermore, polymerase chain reaction amplification of Barr mRNA indicates that in several tissues (lung, liver, spleen, and pituitary), the major form of Barr lacks 8 amino acids which are present in brain Barr. Immunoblotting with an antibody which recognizes Barr and arr3 with equal sensitivity demonstrates that Barr (either the long or the short polypeptide) is the major arrestin in all (non- photoreceptor bearing) tissues examined. These observations suggest that in some tissues, as many as four arrestin homolog variants may play a role in the regulation of G protein-coupled receptors.

A ubiquitous property of visual and chemical transduction is the capacity of a cell to terminate as well as propagate a signal (1). Desensitization serves to regulate the magnitude of a response in the presence of the stimulus. In the family of membrane receptors in which signals are transduced by heterotrimeric G proteins, homologous, or receptor-targeted de-

Grants GM44944 and HL45964 (to J. L. B.) and EY5095 (to L. A. * This work was supported in part by National Institute of Health

D.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

to the GenBankTM/EMBL Data Bank with accession numberfs) The nucleotide sequencefs) reported in thispaper has been submitted

L14641. )I Recipient of a Senior Scientific Investigator award from Research

to Prevent Blindness, Inc. ** To whom correspondence should be addressed: Tel.: 215-955-

4607; Fax: 215-923-1098.

sensitization, plays a major role in signal termination. Ho- mologous desensitization occurs rapidly and is characterized by the uncoupling of the receptor from its G protein (2,3).

Two well characterized systems for the study of activation- specific desensitization are phototransduction via cGMP phosphodiesterase-coupled rhodopsin in retinal rod cells and hormonal transduction via adenylyl cyclase-coupled &adrenergic receptor (&AR)’ (4-6). In the retinal rods, the visual cascade is initiated by light-induced isomerization of rhodopsin to metarhodopsin 11. Sensing the conformational change of the receptor, the rod-specific G protein, transducin, then activates the effector cGMP-phosphodiesterase. This de- crease in cGMP promotes closing of cGMP-gated cation channels in the rod outer segment and generates an electrical signal which is propagated to other cells in the visual pathway. Uncoupling of rhodopsin and transducin is a two-step process. In a light activation-dependent reaction, a receptor-specific kinase, rhodopsin kinase, phosphorylates metarhodopsin I1 leading to a substantial reduction in the ability of the receptor to interact with transducin (7 , 8) and a dramatic increase in its capacity to bind a protein termed arrestin (S-antigen or 48-kDa protein) (8). Rhodopsin-arrestin interaction precludes rhodopsin-transducin coupling thereby terminating activation of cGMP-phosphodiesterase. In an analogous fashion, hormones and neurotransmitters alter cellular activity by stimulating receptor-regulated adenylyl cyclase. Binding of agonist to the &adrenergic receptor stimulates receptor- bound G protein G, to activate adenylyl cyclase. The increase in cyclic AMP activates cyclic AMP-dependent protein kinase, and the resultant protein phosphorylation promotes various responses in different cell types. pZAR/G, uncoupling is accomplished by binding of an arrestin homolog, p-arrestin (parr), to the receptor (9). P2AR/Parr interaction requires prior receptor phosphorylation by a hormone-stimulated receptor-specific kinase called the @-adrenergic receptor kinase (PARK) (9, 10).

The proteins involved in signal transduction and its regulation are members of large gene families. In mammals, over 70 G protein-coupled receptors (ll), 17 G, subunits (121, four GB subunits (12), seven G, subunits (13), five receptor kinases (14-18), and three arrestins (8, 19-22) have been reported. In addition, two receptor kinases (23) and two arrestins (24-26) have been identified in Drosophila. These receptors and G proteins regulate the activities not only of cGMP phosphodiesterase and adenylyl cyclase, but also of phospholipase cg , phospholipase A2, and voltage-gated ion channels (27, 28).

The abbreviations used are: p2AR, p-adrenergic receptor; PARK, p-adrenergic receptor kinase; parr, 0-arrestin; arr3, arrestin3; G proteins, heterotrimeric guanine nucleotide binding proteins; PCR, PO- lymerase chain reaction; bp, base pair(s); kb, kilobase(s); ORF, open reading frame.

15640

Arrestin Family Polypeptide Variants 15641

While rhodopsin kinase and arrestin are found predominantly in the retina and pineal (29-31), @ARK and parr are expressed in most tissues (9,14,15). The in uitro evidence demonstrating uncoupling of transducin/rhodopsin interaction and the abundance of rhodopsin kinase and arrestin in photoreceptor cells strongly suggests that these two proteins regulate phototransduction in uiuo. In contrast to rhodopsin in rod cells, most cells express a large variety of G protein-coupled receptors at much lower levels. Likewise, the concentrations of PARK and parr in most cells are much lower than rhodopsin kinase and arrestin in the specialized rod cell. These observations suggest that PARK and parr regulate multiple G protein-coupled receptors and/or that distinct receptor kinase and arrestin homologs are involved in receptor regulation as indicated by recent reports. For example, two receptors which upon stim- ulation lead to the inhibition of adenylyl cyclase, wadrener- gic receptor, and the M2 muscarinic receptor, are substrates for PARK in uitro (32, 33). In addition, agonists which stimulate (isoproterenol and prostaglandin El) or inhibit (so- matostatin) adenylyl cyclase, and an agonist which stimulates phospholipase C (platelet-activating factor) all activate PARK activity in membranes (34-36). Interestingly, one agonist which activates phospholipase C, phenylephrine, does not stimulate membrane PARK activity (34).

In an attempt to identify additional “arrestins” which might regulate the multitude of G protein-coupled receptors, we have isolated an arrestin homolog from a bovine brain cDNA library which we call arrestin3 (arr3). We found that arr3 mRNA is heterogeneous and could generate 409 and 420 amino acid polypeptides. We also found heterogeneity in the parr mRNA structure in various tissues. We used a general arrestin monoclonal antibody as well as arr3- and parr-specific polyclonal antibodies to monitor the expression of arrestin homologs and their polypeptide variants in several bovine tissues.

EXPERIMENTAL PROCEDURES

Materials-A bovine brain cDNA library, prepared by Dr. R. Dixon, was generously provided by R. Diehl (Merck). The bovine retinal arrestin cDNA was kindly provided by Dr. T. Shinohara (National Institutes of Hea l th ) . [ cY-~’P]~CTP and CY-~~S-~ATP were obtained from Du Pont-New England Nuclear. Oligonucleotides and Sequenase version 2.0 were obtained from Jefferson Cancer Institute Nucleotide Synthesis Facility and U. S. Biochemicals (Cleveland, OH), respectively. Taq polymerase was purchased from Promega (Madison, WI) while reverse transcriptase and all other enzymes used for recombinant DNA methodology were obtained from Boehringer Mannheim. The HDH peptide was synthesized at the Jefferson Cancer Institute Protein Chemistry Laboratory while the KEE peptide was synthesized at the Duke University Medical Center and kindly provided by Drs. R. J. Lef’kowitz and M. Lohse. Sulfosuccinim- idyl 4-(N-maleimidomethyl)cyclohexane-l-carboxylate and Sulfo- Link Coupling Gel were purchased from Pierce Chemical Co. Affi- Gel 15 was from Bio-Rad. The sources of reagents used for in vitro transcription and translation of cloned cDNAs have recently been described (37). Bovine tissues were obtained from a local slaughter- house or from Pel-Freez (Rogers, AR) while retinas were purchased from Hormel (Austin, MN). PARK was overexpressed and purified from Spodoptera frugiperda (Sfs) cells and generously provided by C. Kim (38). 11-&-Retinal was donated by Dr. R. K. Crouch (National Institutes of Health). Reagents used to prepare SDS-polyacrylamide gels and peroxidase-coupled antibodies were from Bio-Rad. Chemi- luminescence detection reagents were from Amersham Corp. and x- ray film was from Fuji (Japan). All other chemicals were purchased from Sigma.

Isolation of cDNA Encoding parr Homolog Using Low Stringency Hybridization-In order to obtain the Parr DNA for low stringency screening, a 600-bp fragment of the bovine parr gene amplified by PCR was radiolabeled with [ c Y - ~ * P ] ~ C T P by random hexamer priming (39) and used to probe a randomly primed size-selected (1-2 kb) bovine brain cDNA library in the phagemid XZAP (Stratagene, La

Jolla, CA). A 1.4-kb NotI/ApaI fragment containing the open reading frame (ORF) of p-arrestin cDNA was excised and subcloned into pBluescript KS (Stratagene, La Jolla, CA). The parr and retinal arrestin ORFs were then radiolabeled and incubated with duplicate nitrocellulose filters containing lo6 plaques (50,000 plaques/filter) of the above bovine brain cDNA library at 37 “C for 48 h in 25% formamide, 5 X saline sodium citrate (SSC), 5 x Denhardt’s solution, 1% SDS, 0.1% sodium pyrophosphate, and 100 pg/ml denatured salmon sperm DNA. Filters were washed initially a t low stringency (0.5 x SSC, 0.1% SDS, 60 “C) and subsequently a t higher stringency (0.2 x SSC, 0.1% SDS, 60 “C). Of the -60 clones detected under low stringency conditions, six failed to hybridize to the Barr and retinal arrestin probes at high stringency and were then purified by two rounds of replating and screening. Alternatively, after one round of replating, “in uiuo excision” was carried out to convert the XZAP phagemid to pBluescript SK plasmid using Escherichia coli SOLR cells and ExAssist helper phage (Stratagene). Cells harboring plas- mids with arrestin-related inserts were identified by colony hybridization (39) using 32P-labeled 0-arrestin ORF. Nucleotide sequences of plasmid inserts were determined by the dideoxynucleotide chain termination method using Sequenase version 2.0 with T3, T7, and insert-derived oligonucleotides as primers (40). Sequence compari- sons were carried out using the University of Wisconsin GCG package

PCR Analysis of Tissue RNA-Total RNA was isolated in guani- dium isothiocyanate from various bovine tissues and sedimented through CsCl (39). One-hundred ng of each RNA sample was denatured for 5 min at 70 “C, rapidly cooled on ice, and reverse transcribed for 60 min at 37 “C in 20-pl reactions containing 20 mM Tris, pH 8.3, 1.5 mM MgC12, 50 mM KCl, 100 pg/ml acetylated bovine serum albumin, 500 PM dNTPs, 5 mM dithiothreitol, 100 units/ml RNasin, and 100 units/ml reverse transcriptase from either avian myeloblas- tosis virus or Moloney murine leukemia virus (42). Transcription was primed with 50 pmol of the antisense oligodeoxynucleotides TCCTTCAGCCCCTTGAG (ARR23), AAGTCCTCAAACACAATG (ARR27), and GGTGGACAGGGAGGCCAGGAT (BACTZ), which represent nucleotides 1219-1235 (arr3L numbering), 1155-1163, and 1-21 (D-actin 3’ clone) for arr3S/arr3L, BarrSlparrL and p-actin reactions, respectively. “S” and “L” refer to short and long forms of arr3 and parr. Nucleotide 1 represents the A of the ATG start codon, except in the case of the @-actin gene in which only two noncontiguous partial cDNA fragments, the 5’ clone and the a’clone, have been reported (43). Five pl of the arr3S/arr3L reverse transcription reactions or 0.5 p1 of the parr and p-actin reactions were amplified by 30 rounds of cycling using a Hybaid thermocycler in 50 p1 containing 50 mM KC1, 10 mM Tris, pH 9, 1.5 mM MgC12, 0.1% Triton X-100, 100 p~ dNTPs, 100 nM sense and antisense primers, and 25 units/ml Taq polymerase. The antisense oligonucleotides used for PCR were the same as those used to prime reverse transcription (above), and the sense oligonucleotide primers used were TCAGCAACAACCGG GAG (ARR22, nucleotides 836-852), CACCCACCCACCCCCCCAC TCTCCTCC (RSM1, nucleotides 1073-1108 of arr3L), TGAAGAA GATCAAGATCTC (ARR26, nucleotides 683-701), and GACTTCG A G C A G G A G A T G G C T (BACT1, nucleotides 436-456 of the 5’ clone) for arrJS, arr3L, parr, and P-actin, respectively. Annealing temperatures were determined separately for each primer pair (42). PCR products were separated on 2% agarose gels, transferred to nylon membranes, and probed with the 1.2-kb EcoRI arr3L fragment, the 180-bp arr3L PCR product, the parr ORF cDNA, or the -400-bp p-actin PCR product, for arr3S, arrSL, parr, and p-actin PCR ampli- fications, respectively. The authenticity of PCR products was verified by 1) comigration of PCR products with products amplified from cloned cDNAs (for arr3S, arr3L, and parr), 2) dependence on reverse transcriptase, 3) dependence on the sense primer, and 4) specific hybridization to appropriate probes. Obtaining similar autoradiographic intensities required 120-fold longer exposure of the Southern blot for arr3 than for parr PCR products. Furthermore, 10-fold more of the mRNA-cDNA was utilized in the arr3 amplification reaction. This apparent -1200-fold abundance of parr relative to arr3 led us to investigate whether individual primer combinations amplified their targets with differing efficiencies. To quantify the relative abundance of the mRNAs, the coding regions of arr3S, arrSL, and parr (all -1.4- kb NcoI-Hind111 fragments) were subcloned into the uitro transcription vector, pG2S6-I (44), and RNAs were synthesized using SP6 polymerase as described (37). Serial dilutions of a known concentration of in vitro transcribed RNA were concurrently reverse transcribed, amplified by PCR, analyzed by Southern blotting, and auto- radiograms were quantitated by densitometry using a Pharmacia LKB

(41).

15642 Arrestin Family Polypeptide Variants Ultrascan XL densitometer. Again, obtaining autoradiographic exposures in the linear range of the film required 100-fold longer exposure of the Southern blot of arr3 than for parr PCR products. Taking exposure time and intensity into consideration, various concentrations of parr mRNA were amplified on average 60-fold (range 34-97-fold) more efficiently than the same concentrations of arr3 mRNAs. In contrast, arr3S and arr3L were amplified with similar efficiencies.

Preparation and Affinity Purification of HDH and KEE Anti- serum-The peptide HDHIALPRPQSA (abbreviated HDH), which represents residues 350-361 of arr3, was synthesized with a carboxyl- terminal cysteine, coupled to either keyhole limpet hemocyanin or bovine serum albumin, and used to immunize male New Zealand White rabbits. Briefly, -1 mg of peptide was reduced by incubation for 1 h at room temperature with a 5-10-fold molar excess of dithiothreitol in 0.5 ml of 50 mM sodium phosphate, pH 8. Glacial acetic acid was added to a final concentration of 5%, and the mixture was filtered through a Sephadex G-10 column developed in 5% acetic acid. The peptide peak, determined by Ellman reaction, was taken to dryness in a Jouan centrifugal lyophilizer and resuspended in 50 pl of 0.1 M sodium phosphate, pH 6.5, immediately prior to coupling. The carrier proteins, 8 mg/ml in 0.5 ml of 10 mM sodium phosphate, pH 7.6, were activated by incubation for 1 h a t 30 "C with a 20-50- fold molar excess of the water-soluble heterobifunctional cross-linker sulfosuccinimidyl 4-(N-maleimidomethyl)cyclohexane-l-carboxylate, separated from unreacted cross-linker by filtration over a 20-ml Sephadex G-25 column developed in 0.1 M sodium phosphate, pH 6.5, immediately mixed with the reduced peptide, and allowed to couple overnight while mixing at 4 "C. The conjugate was emulsified with an equal volume of either complete Freund's adjuvant (first injection) or incomplete adjuvant (all booster injections), and injected subcu- taneously (-1 mg conjugate/rabbit) into several sites on the scruff of the neck initially at 2 week intervals and subsequently at monthly intervals. Rabbits were bled from the marginal ear vein 1 week after injection. To purify the antiserum, the peptide HDH was reduced as described above and immobilized by conjugation via the sulfhydryl group to SulfoLink Coupling Gel according to the manufacturer's instructions. One milliliter of serum was diluted 3-fold in immuno- precipitation buffer (IPB) (20 mM Tris, pH 7.8, 1% Triton X-100, 500 mM NaC1, 0.5 mM phenylmethylsulfonyl fluoride, 10 pg/ml leupeptin, 20 pg/ml benzamidine, 2 mM EDTA), passed over the peptide resin five or six times, and eluted with 4 ml of 0.1 M glycine pH 2.8. Fractions were neutralized with 1.5 M Tris, pH 9, and bovine serum albumin was added at a final concentration of 1 mg/ml. Active fractions were identified by their ability to immunoprecipitate [3H] leucine-labeled arr3S which had been translated in uitro in rabbit reticulocyte lysate (described below). Briefly, arr3S (-1 x lo5 counts/ min) was mixed with 40 pl of affinity purified antibodies in 0.5 ml of IPB and mixed overnight at 4 "C. Immune complexes were collected by binding to 10 pl of a 50% slurry of Protein A-Agarose (Boehringer Mannheim) for 1 h at room temperature and washed two times with 1 ml of IPB. Antigens were released by incubation in 8% SDS- polyacrylamide gel sample buffer for 10 min at 37 "C, fractionated on 10% SDS-polyacrylamide gels, and visualized by fluorography with diphenyloxazole (45).

The peptide KEEEEDGTGSPRLNDR (abbreviated KEE) was conjugated to keyhole limpet hemocyanin with glutaraldehyde, and injected into rabbits as published (46). Antisera were affinity-purified on an Affi-Gel15 column containing the immobilized cognate peptide (46).

In Vitro Tramslation-cDNAs for arrestin, parrL, parrs, arr3S, and arr3L were subcloned into the in vitro transcription/translation vector, pG2S6-I (44), and RNAs were synthesized in vitro using SP6 polymerase following linearization with HindIII. 3H-Labeled visual arrestin, parrL, parrs, arr3S, and arr3L proteins were then translated in the presence of [3H]leucine as described (37).

Inrnunoblotting-For immunoblotting, extracts of various bovine tissues were prepared by polytron (Brinkman) lysis in 20 mM Tris, pH 7.5, 5 mM EDTA, 0.5 mM phenylmethylsulfonyl fluoride, 10 pg/ ml leupeptin, 20 pg/ml benzamidine, 1 pg/ml aprotinin. Soluble fractions were obtained by centrifugation of the 45,000 X g superna- tant fraction at 300,000 X g for 60 min. Arrestins from each tissue were isolated by binding to phosphorylated and light-activated rhodopsin in rod outer segments' (48). Briefly, -1 mg of protein from the supernant fraction was incubated with 1.5 pg of phosphorylated

* R. Sterne-Marr, R. C. Bodine, and J. L. Benovic, unpublished observations.

rhodopsin (carried out as described (37)) for 5 min at 37 "C in a final concentration of 50 mM Tris, 7 mM MgC12, 5 mM EDTA, 150 mM KOAc, 1.5 mM dithiothreitol, pH 7.5. The mixture was chilled and sedimented through 0.1 M sucrose in 20 mM Tris, 5 mM EDTA, pH 7.5. Pellets were resuspended in sample buffer containing 8% SDS, fractionated by electrophoresis through 10% SDS-polyacrylamide gels, and transferred to nitrocellulose (Micron Separations, Westboro, MA). Immunoblotting was carried out in 20 mM Tris, 500 mM NaCl, 0.05% Tween in 5% nonfat dry milk using 1) a monoclonal antibody MAbF4C1 (49) which recognizes the epitope DGVVLVD present in visual arrestin, parrL, parrs, arr3S and arr3L, 2)a monoclonal antibody MAbA2G5 (50) which recognizes the visual arrestin-specific epitope PEDPDTAKE, 3) the anti-HDH polyclonal serum which specifically recognizes arr3S and arr3L, or 4) the polyclonal antiserum KEE which only recognizes 0-arrL and P-arrS. The blots were incubated with horseradish peroxidase-conjugated secondary antibody before development by chemiluminescence. To distinguish specific from nonspecific immunoadsorbtion, primary antibody incubations were also carried out with antibody which had been preincubated 30 min at room temperature with 30 pg/ml peptide (either HDH or KEE).

RESULTS

Cloning of a Third Member of the Vertebrate Arrestin Fam- ily-Low stringency hybridization was used to identify an additional member of the arrestin gene family from a bovine brain cDNA library. Six phage plaques were isolated which hybridized with visual arrestin and parr probes at low stringency, but not at high stringency, and carried overlapping inserts. One phage, XBB2, contained an 1227-bp ORF predicted to encode a protein of 409 amino acids. Two of the other five partial clones, XBB3 and XBB4, contained a 33-bp insert which would encode the amino acid sequence THPPTLLPSAV between residues 361 and 362 of the XBB2 ORF (Fig. 1).

The protein encoded by XBB2 is more closely related to bovine p-arrestin (78% identity, 88% similarity) than to bovine visual arrestin (56% identity, 74% similarity). The carboxyl-terminal 100 residues of the protein are the most diver- gent portions when compared to other members of the arrestin family. During the course of our studies, two other novel arrestins, @-arrestin2 and hTHY-ARRX, were isolated from rat brain and human thyroid cDNA libraries, respectively (21, 22). The predicted proteins show striking identity to each other (97%) and to the novel bovine brain arrestin reported here (Fig. 1). When conservative amino acid replacements are taken into consideration, these proteins share -99% similarity. This is significantly higher than the degree of homology between human, bovine, and mouse visual arrestins (84%) (51). It is not known whether this novel arrestin regulates p- adrenergic receptors exclusively nor is this protein unique to thyroid tissue (see below). Because it is the third identified member of the family of vertebrate arrestins, we propose to call this protein arrestin3 (arr3) until an accurate functional name can be ascribed.

PCR Analysis of Tissue RNA Reveals Two Variant Forms of arr3"To determine whether the 33-bp insert found in XBB3 and XBB4 was due to heterogeneity in the mRNA and to assess the tissue variability of expression of the arr3 gene, we amplified tissue RNA by PCR using one of two sense primers which hybridized either on the 5' side of the insert (ARR22) or within the putative insert region (RSM1). The same antisense primer (which hybridized on the 3' side of the putative insert) was used for both reactions (ARR23). The PCR products were analyzed by Southern blotting as described under "Experimental Procedures" (Fig. 2). The arr3S mRNA was more abundant in brain tissues, cortex, cerebellum, striatum, pineal, and retina than in the peripheral tissues, heart, kidney, lung, and liver. The levels of arr3 in the


bovine arr3L human THY-ARRX rat Barrest in2


bovine arr3b human THY-ARRX rat Barrestin2


bovine arr3L human THY-ARRX rat B .rrast in2

bovine arr3L human THY-ARRX rat Barrestin2

bovine arr3L

rat Barrest in2 human THY-ARRX

bovine arr3L human THY-ARRX rat Barrestin2


bovine arr3L human THY-ARRX rat Barreatin2

bovine arr3L h m n THY-ARRX rat Barreatin2

gcgggctaggaggctgtgagctatccgcgaaccgggcgggcggcgggcgcgcgcaccatgggggagaaacccgggaccagggtcttcaaqaaatcgagtcctaactgcaagctcacc~g 120 M G E K P G T R V F K K S S P N C K L T V 21

tacctgggcaagcgggactttgtggaccacctggacaaagtggatcctgtagatggtgtg~gctagtqgacccggactacttgaaggaccgcaaagtgtttgtgaccctcaCctgcgcc 240 Y L G K R D F V D H L D K V D P V D G V V L V D P D Y L K D R K V F V T L T C A 61

tttcgctatqgcc9cgaagacctggacgtgctgggcttgtccttccgcaaagacctgttcatcgccaactaccaggccttccccccaacacccaacccaccccggccccccacccgcctg 360 F R Y G R E D L D V L G L S F R K D L F I A N Y Q A F P P T P N P P R P P T R L 101

T V T M

caggagcggctg~gaggaagctgggccagcatgcccaccccttttttttcaca~taccccaga~cctgccctgctccgtcaccctgcagccaggcccagaggatacggggaaggcctgc 480 Q E R L L R R L G Q H A H P F F F T I P Q N L P C S V T L Q P G P E D T G K A C 141 D D

ggggtagactttgagattcgagccttctgcgccaaatcactagaagagaaaaqccacaaacggaactctgtgcqtctgqtqatccqaaaqgtq~agtttgccccaqagaaac~gq~cc 600 G V D F E I R A F C A K S L E E K S H K R N S V R L V I R K V Q F A P E K ~ G P 181

I I T

cagccttcagctgaaaccacacgccacttcctcatgtctgaccg~ccctgcaccttgaggcttcactggacaaggagctgtactaccatggggagcccctcaatgtcaatgtccac~c 120 Q P S A E T T R H F L M S D R S L H L E A S L D K E L Y Y H G E P L N V N V H V 221

P

accaataactccaccaagactgtcaaqaagatcaaa~ctctqtqagacagtacqccgacatctgcctcttcagcaccgcccagtacaagtgccccgtqgctcagqtcgaacaagatgac 840 T N N S T K T V K K I K V S V R Q Y A D I C L F S T A Q Y K C P V A Q V E Q D D 261

L A R L

caggtgtcgcccagttccacgttctgtaaggtgtacaccataaccccgctgctcagcaacaaccgggagaagcgcggcctcgctctggatgggaagctcaaqcacgaggaceccaacctq 960 Q V S P S S T F C K V Y T I T P L L S N N R E K R G L A L D G K L K H E D T N L 301

D D Q

gcgtccagcaccattgtgaaggagggtgccaacaaggag~tgctqgggatcctggtgtcctacagqgtcaaggtqaagctggtg~gtctcgaggcggggacgtctcagtggagctgcca lOB0 A S S T I V K E G A N K E V L G I L V S Y R V K V K L V V S R G G U V S V E L P 341

tttgttctcatgcaccccaagccccatgatcacatcgcccttcccaggccccaqtcagcacccacccacccccccactctcctcccctcagctgttcctgaaacagatgcccccgtggac 1200 F V L M H P K P I D I I A L P R P Q S A P T H P P T L L P S A V P E T D A P V D 381

P A * . * * . ” ” * * V T * . * * . . . . * * * R I I

accaacctcattgaattcgaaaccaactatgccacagacgacgacatcgtgtttg~ggactttgcc~ggctgcggctcaaggggctgaaggacgaggactatgacgaccagttctgctag 1320 T N L I E F E T N Y A T D D D I V F E D F A R L R L X G L K D E D Y D D Q F C 421

D M D L D M D C

gaagggaggctggaagaagggagtggatggcggggcgggggacaggtggaggcaggaccaagacccccactgtcactgagggggatcccagtccctcttcccttcccctccacccaccag 1440 CttCCtCgacCaaCccctccccccctccctgccctacccccccaccagatacgcactggacccagctcttgtggaacatgggcattaattttttgactttagctgtgcttccccaatccc 1560 ccagtgggtggcaagctgtgttcacacctc.attttttggagggggagccgaagaggagtgataqtaggaaaagagggggaaag 1644

FIG. 1. Nucleotide and predicted amino acid sequence of bovine brain arr3, and comparison to human and rat homologs. The 1644-bp cDNA sequence shown was determined from the XBBZ, XBB3, and XBB4 clones. XBBS contains an open reading frame but lacks the 33-bp insert at nucleotide 1141 which is present in XBBS and XBB4. XBB4 provided additional 5’ noncoding sequence. The predicted protein sequence of arr3L is displayed in single amino acid code and compared to its human and rat counterparts below. Only amino acid differences are shown. The rat homolog encodes an additional arginine between residues 196 and 197. The dodecapeptide sequence used to generate specific arr3 antibodies is shown in boldface type. Asterisks show residues in arr3L which are not found in arr3S, human THY- ARRX, or rat OarrestinZ.

spleen, however, were comparable to expression in some of the brain tissues. We use the designations arr3S and arr3L to indicate the short and long forms of arr3, respectively. The tissue-specific variability in apparent abundance of PCR products was not due to differences in total RNA in the reaction because amplification of 0-actin RNA yielded similar quantities of product from each tissue assayed. Analysis of @- actin PCR products did suggest that the PCR contained less mRNA from the heart than from other tissues.

While PCR amplification of XBB2 and XBB3 cDNA inserts using ARR22 and ARR23 primers yielded separable products on 2% agarose gels (data not shown), amplification of tissue RNA with these primers revealed only the XBB2-sized product. However, when RSMI, which hybridizes within the putative insert, was used as the sense primer, the expected 180- bp product is clearly observed indicating that some mRNA species contain the 33-base insert. Arr3L is most abundant in the cortex, pituitary, pineal, and lung, and relatively inabundant in the other tissues examined. However, arr3L is significantly less abundant than arr3S in all tissues.

We also used PCR to assess the expression of parr mRNA using a primer pair which amplified the 3‘ end of the Parr ORF. In contrast to arr3, parr expression was significant in all tissues examined. Cerebellum and pineal appeared to have the highest levels of the PCR product. The apparent con- stancy of parr PCR products (the abundance varied by only -4-fold as determined by densitometry) in different tissues is not due to limiting conditions in the PCR reaction because amplification of Parr cDNA yielded even higher levels of PCR products (data not shown).

By amplifying known concentrations of in vitro translated arr3S, arrSL, and parr mRNA, we were able to roughly compare the levels of Parr and arr3 mRNA in different tissues (see “Experimental Procedures”). From this analysis it is clear that Parr mRNA is at least 12-fold more abundant than either form of arr3 mRNA in tissues such as the cerebral cortex, cerebellum, and spleen. In pituitary, heart, lung, and liver, the ratio of parr to arr3 mRNA is likely to be much greater than 12. Two possible exceptions are the striatum and the retina where the levels of parr and arr3 mRNA are likely to differ by only 3-4-fold.

15644 Arrestin Family Polypeptide Variants

A Novel Short Form of Barr mRNA-Ethidium bromide staining of agarose gels separating Parr PCR products revealed the presence of a second species of slightly faster mobility in pituitary, lung, spleen, liver, and kidney. T o investigate the molecular nature of this heterogeneity, PCR products from lung and spleen were subcloned and sequenced. Five of five independently isolated clones derived from lung mRNA and three out of four from spleen mRNA encoded a form of Barr which lacked 24 nucleotides which are present in the brain Parr cDNA. When translated, this deletion would generate a form of Barr which lacks the sequence LLGDLASS which represents residues 334-341 in bovine Barr (9). Interestingly, these nucleotides encode 8 amino acids which are present in visual arrestin but absent in this newly described arr3 (Fig. 3). Furthermore, in the human retinal arrestin gene, these homologous nucleotides represent exon 13 (52), suggesting that the heterogeneity in the parr polypeptide is generated by alternative splicing.

Fortuitously, the longer Barr cDNA sequence contains a BglII restriction enzyme site which is not present in the parr cDNA lacking the 24 nucleotides. Thus, the sensitivity of PCR product from various tissues to digestion by BglII is indicative of the relative abundance of the two forms of parr mRNAs. Therefore, PCR products from several tissues were treated in the absence or presence of BglII and visualized by Southern blotting. For each tissue, the difference in the intensity of the 480-bp band from the treated and untreated sample was used to estimate the relative abundance of the longer Barr mRNA. This analysis suggests that brain, cerebellum, striatum, retina, and pineal express predominantly the 418 amino acid Barr, while lung, liver, spleen, kidney, and pituitary encode the shorter 410 amino acid form (Fig. 4). We

FIG. 2. Southern blot analysis of PCR-amplified tissue mRNA. RNA from various bovine tissues was reverse-transcribed with antisense primers which hybridized with either arr3, parr, or pactin mRNA. Five pl of the arr3 reverse transcription reaction was amplified using either a sense primer which hybridized on the 5' side of the putative insert (arr3S) or within the putative insert (arr3.L). Half of a microliter of the reverse transcription reaction was used to amplify Barr and pactin mRNA. PCR was carried out for 30 cycles using annealing temperatures 4 "C below T,. Products were separated by agarose gel electrophoresis, transferred to nylon membranes, and detected with specific probes as described under "Experimental Pro- cedures." Exposure time and temperatures were 20 h/room temperature, 20 h/-80 "C, 10 min/room temperature, and 3 h/room temperature for arr3S, arr3L. parr, and pactin, respectively.

propose to call the predicted 418 and 410 amino acid forms of parr, BarrL, and parrs, respectively.

Antibodies Identify Two Variants of Barr and arr3 Pro- teins"arr3- and Barr-specific antibodies were prepared to ascertain whether the variability predicted by the cDNA and/ or PCR analysis of the mRNA extended to the expressed protein. Specific antisera was generated against peptide sequences derived from either arr3 or Barr which are not present in other known bovine arrestins. To test the specificity of the antisera, visual arrestin, the two forms of Barr, and the two forms of arr3 were prepared in vitro by translation in the presence of [3H]leucine in rabbit reticulocyte lysate. The upper panel of Fig. 5 shows the relative mobilities of these five members of the vertebrate arrestin family when fractionated on a polyacrylamide gel and visualized by fluorography. The mobility of arr3S (51 kDa) is similar to that of visual arrestin, while arr3L (52.5 kDa) migrates similarly t o B a d . Immunoblotting was used to characterize the reactivity of various antibodies toward the five members of the arrestin family. As expected, the general arrestin antibody recognized all five arrestins while the specific antibodies uniquely detected arr3L/S BarrL/S, or retinal arrestin (Fig. 5). An apparent endogenous rabbit reticulocyte "arrestin" comigrates with visual arrestin and arr3S, but only reacts strongly with the general arrestin antibody. This reticulocyte arrestin also reacts weakly with the Barr-specific antibody (data not shown).

In order to reproducibly visualize arr3 from various bovine tissues, we found that it was necessary to prepare a tissue fraction enriched in arrestins. We took advantage of the ability of members of the arrestin family to bind to light- activated phosphorylated rhodopsin (48): In this way, we were able to analyze arrestins isolated from as much as -0.5 mg of protein from several bovine tissues on each immunoblot. By incubating blots with the arr3-specific antibody, we found that arr3S was most prevalent in the spleen, slightly less abundant in the prostate, and relatively inabundant in the pineal, pituituary, heart, and lung (Fig. 6A). Unfortunately, a major cortex-specific protein which comigrates with arr3 is also enriched during the rhodopsin-binding procedure. This protein alters the migration and perhaps the immunodetec- tion of arr3S. Preliminary studies suggest that arr3L binds to phosphorylated light-activated rhodopsin -65% as well as arr3S2; therefore, the level of arr3L may be slightly underes- timated using the enrichment procedure. Longer exposures of immunoblots indicate that in tissues which express significant levels of arr3, arr3L is also present. However, arr3L represents no more than 10% of the immunoreactive arr3 (data not shown). In the spleen and prostate, a third species of faster mobility and unknown molecular identity is also detected. This -49.5 kDa form may represent a novel arrestin, post- translationally modified arr3, a third polypeptide variant of

V. V. Gurevich, R. Sterne-Marr, and J. L. Benovic, unpublished observations.

human a r r e s t i n . . .I 12 intron 12 FIG. 3. Region of Barr variability gene

coincides with exon 13 of human retinal arrestin gene. Schematic dia- human . . .VS--G PLGELTSS EVA.. . gram representing a portion of the human visual arrestin gene. Exon 13 is 24 bovine . . .VS--G LLGELTSS EVA.. . nucleotides in length and encodes the 8 amino acids which are present in bovine bovine parrL . . .VSRGG LLGDLASS DVA.. . arrestin and parrL, but absent in parrs, arr3S, and arr3L. bovine BarrS . . .VSRGG DVA.. .

exon 14 . . .

""""

bovine arr3L/S . . .VSRGG """" DVA.. .


E

- + - + - + - + - + - + - + - + - + - + - + J 480 bp - 314 bp

\I66 bp

FIG. 4. Variants of Barr in bovine tissues. parr PCR products (2.5 pl ) were treated in the absence (-) or presence (+) of the restriction enzyme BglII and detected as described in the legend to Fig. 1. (The long form, BarrL, but not the short form, parrs, of Barr is sensitive to BglII digestion).

in vitro translation

T"" I-.' - 80 kDa

- 49.5 kDa

antibody

a n general arr3-specific

"..-." - -

paV-Specif i i

ret arr-specific

FIG. 5. Specificity of arr3, Barr, and retinal arrestin antibodies. Upper panel, Arr, BarrL, parrs, arrBS, and arr3L cDNAs were subcloned into an in vitro transcription/translation vector. The corresponding proteins were translated in a rabbit reticulocyte lysate in the presence of ['Hlleucine, fractionated by SDS-PAGE, and visualized by fluorography. Lower panel, 50 fmol of each of the five translated proteins were separated on 10% acrylamide gels, transferred to nitrocellulose, probed with a general arrestin antibody, or with antibodies which specifically detect either arr3, parr, or retinal arrestin, and visualized by enhanced chemiluminescence.

FIG. 6. Detection of various arrestins in bovine tissues with specific antibodies. Arrestins from tissue lysates were concentrated by binding to light-activated phosphorylated rhodopsin, fractionated on polyacrylamide gels, and detected by immunoblotting using a general arrestin antibody or antibodies which recognize arr3 and Barr specifically. For comparison of migration and antibody reactivity, 10 fmol of the appropriate in vitro translated arrestins were also analyzed (in lanes I and 2). A, analysis of arr3 derived from 500 pg of protein from each tissue. B, analysis of parr isolated from 30 pg of cortex and pineal protein and 150 pg of protein from the other tissues. C, detection of all arrestins from 100 pg of cortex and pineal protein and 500 pg of protein from other tissues. The antibodies used in A and B were affinity purified, while the antibody used in C is a monoclonal.

arr3, or a proteolytic product. All three of these species are likely related to arr3 because they are enriched upon binding to phosphorylated light-activated rhodopsin and because preincubation of the antibody with the peptide immunogen completely inhibits their reactivity (data not shown).

We next examined the distribution of Barr in the same tissues using the parr-specific antibody. Barr was easily detected in all tissues assayed even though much less protein was analyzed on this blot (see the legend to Fig. 6). The rank order of parr abundance is cortex >pineal >prostate > spleen >> lung, heart, pituitary (Fig. 6B). The mobility differences between ParrL and parrs are quite subtle. However, it is evident that parr from the pituitary migrates more rapidly than parr from the pineal. This is consistent with the PCR analysis of parr mRNA from these tissues; pituitary contains mostly BarrS mRNA while pineal contains mostly parrL mRNA. The mobility differences are more clearly demonstrated in Fig. 6C. The form of Barr in cortex, pineal, and heart migrates more slowly than parr from the pituitary, lung, prostate, and spleen. The inability to more clearly detect parrs or BarrL in each tissue may be due to the presence of both forms. Indeed, when Parrs and BarrL are mixed and fractionated using this gel system, they do not resolve well (data not shown). Antibodies which react uniquely with each variant may be necessary to confirm the tissue localization of these proteins. Both the faster and slower migrating proteins which react with the parr-specific antisera likely represent forms of Barr, since neither of them is detected when the activity of the antibody is inhibited by preincubation with the KEE peptide (data not shown).

To directly evaluate the relative abundance of Barr and arr3, the general arrestin antibody, which is equally sensitive to both proteins (Fig. 5), was used to probe immunoblots. Consistent with the PCR results, Barr is the major arrestin found in most tissues (Fig. 6C). In fact, arr3S is only barely detectable in the spleen, prostate, and cortex while the signal from parr overexposes the film. It is unlikely that the low level of arr3 detected is due to lower efficiency of binding to rhodopsin during the enrichment procedure. First, when the binding of tritiated arr3 and parr to phosphorylated light- activated rhodopsin is compared, arr3 actually binds -1.4 fold better.' Second, when cellular proteins are analyzed directly (ie. without rhodopsin enrichment), identical immunoblotting results are obtained except that arr3 polypeptides are barely detectable due to their low abundance (data not shown). I t is also unlikely that an unknown arrestin comigrates with Barr since the tissue distribution of Barr detected by the parr-specific antibody is virtually identical to the pattern of expression of the 53-kDa polypeptide revealed by probing with the general arrestin antisera.

When the film is overexposed, a minor 55-kDa species is detected by the general arrestin antibody in the pituitary, heart, and lung. This protein is not recognized by the Barr- and arr3-specific antibodies and may therefore represent an as yet uncharacterized arrestin family member.

Probing immunoblots with the general arrestin antibody reveals that the pineal gland expresses a major visual arrestin- sized species, while arr3S is not very abundant in this tissue (compare Fig. 6, A and C ) . To determine whether the major species is visual arrestin, immunoblots were probed with a retinal arrestin-specific antibody. The 51 kDa is recognized very well by this antibody (data not shown) as expected, since it has previously been reported that retinal arrestin is very abundant in the pineal (49).

DISCUSSION

We have cloned a third member of the vertebrate arrestin family from bovine brain and designated this novel arrestin, arr3. PCR amplification of tissue mRNA and immunoblotting with arr3-specific antibody indicate that this protein is most abundant in the spleen, prostate and brain. In brain, arr3

15646

arr3L ParrL ret arr

arr3L ParrL ret arr

arr3L ParrL ret arr

arr3L ParrL ret arr

arr3L @rrL ret arr

arr3L ParrL ret arr

arr3L f3arrL ret arr

arr3L ParrL ret arr

arr3L ParrL ret arr

FIG. 7. Comparison of bovine arrestin family members, arrBL, BarrL, and retinal arrestin. Residues of ParrL and retinal arrestin which are identical to the arr3L amino acid at each position are designated with an asterisk. Periods represent gaps in the alignment. Five regions of greatest variability between arrestin family members are underlined and numbered I d . The sequences which represent polypeptide variants in parr and arr3 in variable regions 3 and 4, respectively, are shown in lower-case boldface letters.

transcripts consist of two mRNAs which differ only by the absence (arr3S) or presence (arr3L) of 33 nucleotides in the 3' end of the ORF. Reverse transcription of mRNA from various bovine tissues demonstrates that arr3L is also present at low levels in the cerebellum, striatum, pituitary, pineal, spleen, and lung. Immunoblotting confirms the presence of arr3L protein primarily in the spleen and prostate. However, relative to arr3S, arr3L is the minor form of arr3 in tissues. The 11-amino-acid insert in arr3L is a proline-rich peptide in a region of arr3 which bears little homology to parr and visual arrestin and is therefore likely to play a role in the specificity with which arr3 interacts with various receptors or regulatory proteins.

To our surprise, parr also exists as two polypeptide variants. In spleen, lung, pituitary, and kidney, the major form of parr (BarrS) lacks 8 amino acids which are present in Parr (parrL) from cortex, cerebellum, striatum, pineal, retina, and heart. Thus, unlike the predominance of arr3S over arr3L in all

tissues, parrs and ParrL display tissue specificity. These 8 residues are also present in visual arrestin but absent in arr3. Furthermore, the 24 nucleotides which distinguish these two forms of parr cDNA are bracketed by splice junctions in the human retinal arrestin gene (52). This suggests, first, that heterogeneity in parr primary structure is likely generated by alternative splicing and, second, that retinal arrestin might also exist as two polypeptide variants. Alternative splicing generates multiple forms of some G, (Gas and Gao) subunits and G-protein coupled receptors (D2 and D4 dopamine receptors) (53-57).

When bovine retinal arrestin, parr, and arr3 are compared, there is a continuous stretch of 330 amino acids which shares 76% homology when conservative replacements are consid- ered. At least five regions stand out which may determine the specificity of each arrestin homolog (Fig. 7). The amino and carboxyl termini of these proteins are heterogeneous in both length and sequence. Interestingly, the two of the three other


islands of variability between arrestin homologs lie at regions where we have demonstrated polypeptide heterogeneity in Parr and arr3. At residue 334, ParrL and retinal arrestin contain 8 amino acids which are not present in parrs, arr3S, arr3L, or the Drosophila arrestins (variable region 3, Fig. 7) . The region between residue 363 and 370 of retinal arrestin (uariable region 4, Fig. 7) represents the largest stretch of variability between arrestin family members. Retinal arrestin, Parr, arr3S, and arr3L bear inserts of 9, 26,33 and 44 residues in length, respectively.

Recently, the cloning of human thyroid and rat brain homologs of arr3 have been reported (21, 22). Low stringency hybridization using human retinal arrestin and bovine Parr as probes was used to isolate novel arrestins called hTHY- ARRX and parrestin2, respectively. The bovine, rat, and human homologs of arr3 share 97% identity and 99% similarity when conservative substitutions are taken into consideration. Bovine and rat Parr are 99% identical at the protein level. In contrast, human, bovine, and mouse retinal arrestins share only 84% identity. Perhaps amino acid alterations can be counterbalanced by the high concentration of arrestin in retinal rod cells, and therefore less selective pressure is required to maintain a functional protein.

Amplification of mRNA and immunoblotting with specific antibodies were used to determine the distribution of arr3 and Parr in various tissues. Consistent with the findings of Attra- madal et al. (20), we found that Parr and arr3 mRNAs were most abundant in the brain and spleen. However, we observed greater tissue-to-tissue variability in the level of arr3 mRNA than for parr mRNA. In contrast to their observations, we found that Parr mRNA was at least 12-fold more prevalent than arr3 mRNA. More importantly, using an antibody which recognizes the same epitope present on both Parr and arr3 to probe blots containing lysates from various tissues, we found that parr is significantly more abundant than arr3 in all tissues examined. The predominance of Parr over arr3 is unlikely to be specific to bovine tissues because the ratio of arr3 to Parr cDNAs isolated from the bovine brain library (6/ 54) and the ratio of parr2 (arr3 homolog) to parr1 (Parr) clones found in the rat brain cDNA library (2/23) are similar and seem to reflect the relative abundance of these proteins in various tissues (22).

Our immunological analysis has also revealed the presence of either unidentified forms of the three known arrestins or additional novel arrestin family members. First, rabbit reticulocyte lysate contains a retinal arrestin-sized protein which reacts strongly with the general arrestin antibody but only weakly with the parr-specific antibody. This reticulocyte arrestin may represent a rabbit Parr which differs significantly from bovine parr at the COOH-terminal 16 residues (the region against which the KEE antibody was directed). In rat brain Parr, which is recognized by the KEE antibody,2 12 of the 16 COOH-terminal residues are identical to bovine Parr and the remaining 4 amino acids are conservative substitutions (20). If this 51-kDa reticulocyte protein is Parr, it may represent a third polypeptide variant since it is significantly smaller than bovine Parr (53 kDa). Trout and turkey eryth- rocytes express 55- and 45-kDa arrestins, but it is not clear which arrestin family member these proteins most closely resemble (48). Second, the general arrestin monoclonal antibody recognized a protein of -54 kDa which was not recognized by the parr- or arr3-specific antibodies. Third, and finally, the arr3-specific antibody recognizes a -49.5-kDa protein which may reflect post-translationally modified arr3, a novel arr3-related arrestin, or a proteolytic product of arr3. Studies are ongoing to identify novel arrestin family members

and potential polypeptide variants and to determine their functional significance.

Acknowledgments-We are very grateful to Dr. A. Speigel for the gift of the KEE antiserum. We also thank Dr. R. Dixon and R. Diehl for the bovine brain cDNA library, Dr. T. Shinohara for the bovine retinal arrestin cDNA, Dr. E. Elgin (Stratagene) for the use of ExAssist helper phage and SOLR cells prior to their commercial release, Drs. R. 3. Lefkowitz and M. Lohse for the gift of the KEE peptide, Dr. R. K. Crouch for 11-cis retinal, and C . Kim for purified BARK.

REFERENCES 1. Dohlman, H. G., Thorner, J., Caron, M. G., and Lefkowitz, R. J. (1991)

2. Hausdorff, W. P., Caron, M. G., and Lefkowitz, R. J. (1990) FASEB J . 4,

3. Benovic, J. L., Bouvier, M., Caron, M. G., and Lefkowitz, R. J. (1988)

4. Kuhn, H. (1984) Prog. Retinal Res. 3, 123-156 5. Stryer, L. (1986) Annu. Rev. Neurosci. 9,87-119 6. Gilman, A. G. (1987) Annu. Reo. Biochem. 56,615-649 7. Bownds, D., Dawes, J., Miller, J., and Stahlman (1972) Nature 237 , 125-

Annu. Rev. Biochem. 60,653-688

288-2889

Annu. Rev. Cell Biol. 4, 405-428

. 8. Wilden, U., Hall, S. W., and Kiihn, H. (1986) Proc. Natl. Acad. Sei. U. S. A.

IZ 1

83. 1174-1178 9. Lohse. M. J.. Benovic. J. L.. Codina. J.. Caron. M. G.. and Lefkowitz. R. J.

~~ ~

(1990) Science 248; 1547-1550

(1992) Biochemistry 31,3193-3197

. ,

10. Pitcher, J., Lohse, M. J., Codina, J., Caron, M. G., and Lefkowitz, R. J.

11. Prohst, W. C., Snyder, L. A., Schuster, D. I., Brosius, J., and Sealfon, S. C. (19921 DNA Cell Riol. 11. 1-20

12. Simon, M . - I . , Strathmann,'M.P., and Gautam, N. (1991) Science 252, ~ ~~~

~ n 3 - 8 0 ~ 13. Cali, J. J., Balcueva, E. A,, Ryhalkin, I . , and Robishaw, J. D. (1992) J. Biol.

14. Benovic, J. L., DeBlasi, A,, Stone, W. C., Caron, M. G., and Lefkowitz, R.

"_ "_ Chem. 267, 24023-24027

J. (19891 Science 246. 235-240 15. Benovicl J: L., Onorato, J. J., Arriza, J. L., Stone, W. C., Lohse, M., Jenkins,

N. A., Gilbert, D. J., Copeland, N. G., Caron, M. G., and Lefkowitz, R. J. (1991) J. Bid. Chem. 266. 14939-14946

16. Lorenz, W., Inglese, J., Palczewski, K., Onorato, J. J., Caron, M. G., and Lefkowitz, R. J. (1991) Proc. Natl. Acad. Sci. U. S. A. 8 8 , 8715-8719

17. Ambrose, C., James, M., Barnes, G., Lin, C., Bates, G., Altherr, M., Duyao, M., Groot, N., Church, D., Wasmuth, J. J., Lehrach, H., Housman, D., Buckler, A., Gusella, J. F., and MacDonald, M. E. (1992) Hum. Mol. Genet. 1,697-703

18. Kunapuli, P., and Benovic, J. L. (1993) Proc. Natl. Acad. Sci. U. S. A,, in mess

_~., ~. ~

19. Yimaki, K., Takahashi, Y., and Sakuragi, S. (1987) Biochem. Biophys. Res.

20. Shinohara, T., Donoso, L., Wistow, G., Dietzschold, B., Craft, C., and Tao, Commun. 142,904-910

R. (1987) Jon. J. ODhthalmol. 31. 197-206 21. Rapoport,, B.,. Kaufman, K. D., and Chazenbalk, G. D. (1992) Mol. Cell.

22. Attramadal, H., Arriza, J. L., Aoki, C., Dawson, T., Codina, J., Kwatra, M. Endocrmol. 84, R39-R43

M., Snyder, S. H., Caron, M. G.. and Lefkowitz, R. J. (1992) J. Biol. Chem. 267 , 17882-17890

23. Cassill, J. A,. Whitney, M., Joazeiro, C. A. P., Becker, A., and Zuker, C. S. (1991) Proc. Natl. Acad. Sci. U. S. A. 8 8 , 11067-11070

24. Hyde, D. R., Mecklenhurg, K. L., Pollock, J. A,, Vihtelic, T. S., and Benzer, S. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 1008-1012

25. Smith, D. P., Shieh, B.-H., and Zuker, C. S. (1990) Proc. Natl. Acad. Sci. ci. S. A. 8 7 , 1004-1007

26. Yamada, T., Takeuchi, Y., Komori, N., Kohayashi, H., Sakai, Y., Hotta, Y . , and Matsumoto, H. (1990) Science 248,483-486

27. Birnhaumer, L., Abramowitz, J., and Brown, A. M. (1990) Riochim. Biophys. Acta 1031, 163-224

28. Berstein, G., Blank, J. L., Smrcka, A. V., Higashijima, T., Sternweis, P. C., Exton, J. H., and Ross, E. M. (1992) J. Biol. Chem. 267,8081-8088

29. Donoso, L. A., Merryman, C. F., Edelberg, K. E., Naids, R., and Kalsow, C. (1985) Inuest. Ophthalmol. & Visual. Sci. 26,561-567

30. Somers, R., and Klein, D. C. (1984) Science 226 , 182-184 31. Broekhuyse, R. M., Tolhuizen, E. F. J., Janssen, A. P. M., and Winkens,

32. Benovic, J. L., Regan, J. R., Matsui, H., Mayor, F., Jr., Cotecchia S. Leeb- H. J. (1985) Curr. Eye Res. 4, 613-618

Lundberg, L. M. F., Caron, M. G., and Lefkowitz, R. J. (198;) i. Bid. Chem. 262,17251-17253

33. Kwatra, M. M., Benovic, J. L., Caron, M. G., Lefkowitz, R. J., and Hosey, H. H. (1989) Biochemistry 28,4543-4547

34. Strasser, R. H., Benovic, J. L., Caron, M. G., and Lefkowitz, R. J. (1986) Proc Natl. Acad. Sci. U. S. A. 83, 6362-6366

35. Mayor, F., Jr., Benovic, J. L., Caron, M. G., and Lefkowitz, R. J. (1987) J . Biol. Chem. 262,6468-6471

36. Chuang, T. T., Sallese, M., Amhrosini, G., Parruti, G., and De Blasi, A. (1992) J . Bid. Chem. 267,6886-6892

37. Gurevich, V. V., and Benovic, J. L. (1992) J. Biol. Chem. 267,21919-21923 38. Kim, C. M., Dion, S. D., Onorato, J. J., and Benovic, J. L., (1993) Receptor,

39. Samhrook, J., Fritsch, E. F., and Maniatus, T. (1989) Molecular Cloning:A in press

Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor. NY

, .. .

40. Sanger, F:, Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. A C ~ . Sci. CJ. S. A . 74, 5463-5467

15648 Arrestin Family Polypeptide Variants 41. Devereux, J., Haeberli, P., and Smithies, 0. (1984) Nucleic Acids Res. 12,

387-395 42. Innis, M. A., Gelfand, D. H., Sninsky, J. J., and White, T. J. (eds) (1990)

PCR Protocols: A Guide to Methods and Applications, Academic Press,

43. Degen, J. L., Neubauer, M.,G., Friezner-Degen, S. J., Seyfried, C. E., and Inc., San Diego, CA

44. Zozulya, S. A,, Gurevich, V. V., Zvyaga, T. A., Shirokova, E. P., Dumler, I. Morris, D. R. (1983) J. Btol. C h e n . 2 5 8 , 12153-12162

L., Garnovskaya, M. N., Natochin, M. Y., Shmukler, B. E., and Badalor, P. R. (1990) Protein Eng. 3,453-458

45. Bonner, W. M., and Laskey, R. A. (1974) Eur. J . Biochem. 46,83-91 46. Goldsmith, P., Gierschik, P., Milligan, G., Unson, C. G., Vinitsky, R.,

47. Simonds, W. F., Goldsmith, P., Codina, J., Unson, C. G., and Spiegel, A. Malech, H., and Spiegel, A. M. (1987) J. Biol. Chern. 2 6 2 , 14683-14688

48. Scheuring, U., Franco, M., Fievet, B., Guizouarn, H., Mirshahi, M., Faure, M. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 7809-7813

49. Dua, H. S., Lee, R. H., Lolley, R. N., Barrett, J. A,, Abrams, M., Forrester, J. P., and Motais, R. (1990) FEBS Lett. 276 , 192-196

50.

51.

52.

53.

54.

55.

56.

57.

Knopse, V., Donoso, L. A., Banga, J. P., Yue, S., Kasp, E,, and Gregerson,

Shinohara, T., Donoso, L., Tsuda, M., Yamaki, K., and Singh, U. K. (1989)

J. V., and Donoso, L. A. (1992) Curr. Eye Res. 11 (suppl.) 107-111

D. S. (1988) Cum. Eye Res. 7, 1137-1147

Yamaki, K., Tsuda M. Kikuchi, T., Chen, K. H., Huang, K. P., and Prog. Ret. Res. 8, 51-66

Bray, P., Carter, A. Simons, C., Guo V., Puckett, C. Kamholz J. Spiegel Shinohara, T. (19bO) j. Biol. Chem. 265,20757-20762

A., and Nirenbeig, M. (1986) Pric. Natl. Acad. Sbi. U. S. AI 8 3 , 88931 8897

Kizasa, T., Itoh, H., Tsukamoto, T., and Kaziro, Y. (1988) Prw. Natl.

Bertrand, P., Sanford, J., Rudolph, U., Codina, J., and Birnbaumer, L.

Strathmann, M., Wilkie, T. M., and Simon, M. I. (1990) Proc. Null. Acad.

Acad. Sci. U. S. A. 85,2081-2085

(1990) J. Biol. Chem. 2 6 5 , 18576-18580

L%-i. I J . S . A. 87. fi477-fi481 .. . .~ .

Van Til, H. H. M., Wu, C. M., Guan, H. C., Ohara, K., Bunzow, J. R., Civelli, O., Kennedy, J., Seeman, P., Niznik, H. B., and Jovanovic, V. (1992) Nature 368 , 149-152

-, ""

polypeptide variants of β-arrestin and arrestin3

Documents