AD_________________ Award Number: W81WXH-07-1-0263 TITLE: NKX3.1 Genotype and IGF-1 Interact in Prostate Cancer Risk PRINCIPAL INVESTIGATOR: Edward P. Gelmann, MD CONTRACTING ORGANIZATION:

Columbia University New York, New York 10032-3702

REPORT DATE: May 2010 TYPE OF REPORT: Final

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland 21702-5012 DISTRIBUTION STATEMENT:

X Approved for public release; distribution unlimited The views, opinions and/or findings contained in this report are those of the author(s) and should not be construed as an official Department of the Army position, policy or decision unless so designated by other documentation.

REPORT DOCUMENTATION PAGE Form Approved

OMB No. 0704-0188 Public reporting burden for this collection of information is estimated to average 1 hour per response, including the time for reviewing instructions, searching existing data sources, gathering and maintaining the data needed, and completing and reviewing this collection of information. Send comments regarding this burden estimate or any other aspect of this collection of information, including suggestions for reducing this burden to Department of Defense, Washington Headquarters Services, Directorate for Information Operations and Reports (0704-0188), 1215 Jefferson Davis Highway, Suite 1204, Arlington, VA 22202-4302. Respondents should be aware that notwithstanding any other provision of law, no person shall be subject to any penalty for failing to comply with a collection of information if it does not display a currently valid OMB control number. PLEASE DO NOT RETURN YOUR FORM TO THE ABOVE ADDRESS. 1. REPORT DATE (DD-MM-YYYY) 01-05-2010

2. REPORT TYPE Final

3. DATES COVERED (From - To) 1 May 2007 – 30 Apr 2010

4. TITLE AND SUBTITLE NKX3.1 Genotype and IGF-1 Interact in Prostate Cancer

5a. CONTRACT NUMBER

5b. GRANT NUMBER W81XWH-07-1-0263

5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S)

Edward P. Gelmann, MD

5d. PROJECT NUMBER

5e. TASK NUMBER

email: gelmanne@columbia.edu

5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) 8. PERFORMING ORGANIZATION REPORT NUMBER

Columbia University

New York, New York 10032-3702

9. SPONSORING / MONITORING AGENCY NAME(S) AND ADDRESS(ES) 10. SPONSOR/MONITOR’S ACRONYM(S) U.S. Army Medical Research and Material Command Fort Detrick, Maryland 21702-5012

11. SPONSOR/MONITOR’S REPORT NUMBER(S) 12. DISTRIBUTION / AVAILABILITY STATEMENT a) Approved for public release; distribution unlimited 13. SUPPLEMENTARY NOTES 14. ABSTRACT NKX3.1 is a prostate-specific homeobox gene that maps to chromosome 8p21, the most frequ ent target for loss of heterozygosit y in prostate cancer. NKX3.1 is a haploin sufficient tumor supp ressor in the prostate. We found tha t IGFBP-3expreession was activated 10 -fold by NKX3.1 in cell lines and tissues. IGFBP-3 is an inhibito r of IGF -1, a serum c omponent that when ele vated is a risk facto r for prostate cancer. NKX3.1 expression inhibits IGFIR signaling and diminishes IRS -1 phosphorylation. Knock down of IGFBP-3 attenuates the growth suppressive effects of NKX3.1. NKX3.1 C154T is a poly morphic allele present in ~10% of th e population. The polymorphic allele codes for a variant protei n that replaces arginine 52 with cyst eine. NXK3.1 C154T confers a minimally inc reased risk for prost atic enlargement and for prostate cancer. In a cohort of cases and controls with known NKX3.1 genotype we found that the effect of serum IGF-1 on prostate cancer risk was seen only in men with at least one polymorphic NKX3.1 allele. Consistent wi th its apparent inter action with IGF -1 in prostate cancer risk , NKX3.1 R52C protein is attenuated in activation of IGFBP -3. The data therefore show that the two pr ostate cancer risk factors, NKX3.1 R52C and circulating IGF-1 interact. NKX3.1 R52C activates less IGFBP-3 expression than its wild type counterpart and thereby predisposes prostate epithelial cells to the proliferative and antiapoptotic effects of IGF-1, increasing the risk for prostate cancer.

15. SUBJECT TERMS Prostate cancer, NKX3.1, IGF-1, IGFBP-3,

16. SECURITY CLASSIFICATION OF: U

17. LIMITATION OF ABSTRACT

18. NUMBER OF PAGES

19a. NAME OF RESPONSIBLE PERSON USAMRMC

a. REPORT U

b. ABSTRACT U

c. THIS PAGE U

UU

19b. TELEPHONE NUMBER (include area code)

Standard Form 298 (Rev. 8-98) Prescribed by ANSI Std. Z39.18

Table of Contents

Page Introduction…………………………………………………………….………..….. 4 Body………………………………………………………………………………….. 4 Key Research Accomplishments………………………………………….…….. 14 Reportable Outcomes……………………………………………………………… 14 Conclusion…………………………………………………………………………… 14 References……………………………………………………………………………. 15 Appendices……………………………………………………………………………

4

INTRODUCTION: The NKX3.1 gene is not subject to somatic mutation in prostate cancer (1, 2). Gene targeting studies

in m ice s howed t hat Nkx3.1 haploinsufficiency c an pr edispose t o pr ostate e pithelial d ysplasia a nd c an cooperate with other oncogenic mutations to augment prostate carcinogenesis (3, 4). In gene-targeted mice haploinsufficiency of Nkx3.1 is accompanied by decreased expression of genes under the regulation of the Nkx3.l homeoprotein (5). We have shown that diminished levels of NKX3.1 expression in primary human prostate c ancer and i ntraepithelial n eoplasia co rrelated with t he d egree of gene i nactivation b y deletion, methylation, or bot h. T here i s now convincing e vidence t hat NKX3.1 is bot h a s uppressor pr otein and i s inactivated at t he e arliest s tages o f h uman p rostate can cer. N KX3.1 b inds t o D NA a nd s uppresses expression of genes downstream from cognate DNA binding sites (6). We have yet to identify a promoter that is transcriptionally activated by direct binding of NXK3.1 to its cognate DNA –TAAGTA- sequence. In fact, our experiments with reporter constructs containing NKX3.1 binding DNA suggest that NKX3.1 alone cannot in itiate a ssembly of a tr anscriptional complex (6). N KX3.1 is know n t o i nteract with ot her transcription f actors s uch a s s erum r esponse f actor ( SRF) and s erves as a s ynergistic co activator of promoters w ith s erum r esponse e lements s uch a s s mooth m uscle γ-actin (7). We ha ve s ought t o i dentify down stream transcription targets of NKX3.1 in order to understand the tumor suppressor properties of this transcription f actor. T his pr oject i s de signed t o c haracterize N KX3.1 a ctivation of IGFBP-3, a know n growth suppressor and down regulator of IGF-1 interaction with its receptor. Task 1. Determine IGFBP-3 expression in prostate specimens from men with different NKX3.1 genotype. Months 1-18

1. Establish baseline criteria for analysis of tissue microarrays from the Dana Farber- Harvard Prostate SPORE.

2. Analyze 40 specimens from Physicians Health Study, known to contain at least one NKX3.1 C154T allele for IGFBP-3, keratin, NKX3.1 and histone expression.

3. Analyze specimens with known NKX3.1 homozygous wild type genotype for IGFBP-3, keratin, NKX3.1 and histone expression by quantitative confocal immunomicroscopy.

We ha ve c ompleted bl inded a nalysis of e xpression of IGFBP-3 i n t issues f rom t he P HS. W e r eceived prostatectomy s amples f rom th e P hysicians H ealth S tudy. 3 3 s amples w ere f rom p atients w ith NKX3.1(C154T) heterozygous a nd 18 hom ozygous f or w ild t ype N KX3.1. In r egions of nonm alignant prostate epithelium IGFBP-3 and cytokeratin were measured by quantitative confocal microscopy (8). Data are s hown graphically i n F igure 1. The a verage r atio f or specimens w ith w ild t ype NKX3.1 w as 0.98 and f or specimens w ith on e va riant NKX3.1 allele w as 1 .46. T he difference b etween t he two w as highly s tatistically s ignificant. Our h ypothesis t hat NKX3.1 genotype i nfluenced t issue IGFBP-3 l evels w as not confirmed by these measurements as t he r elationship b etween genotype a nd IGFBP-3 l evels was the opposite of what we had

0 0.5 1 1.5 2 2.5 3

NK

X3

.1(C

15

4T)

+/-

NK

X3.

1

Ratio of IGFBP-3:cytokeratin

Fig 1. Ratios of IGFBP-3:cytokeratin expression in individual prostatectomy specimens.

5

predicted. In this sample set IGFBP-3 levels were lower in the wild type than in the variant tissues. Our in vitro and preclinical data do not contain results that explain this result. Task 2. Analyze serum IGF-1 and IGFBP-3 levels from a cohort of prostate cancer cases and controls that have been genotyped for NKX3.1. Months 1-18

1. Identify and aliquot sera from Australian case-control study of men with prostate cancer. 2. Batch and send samples to McGill University, Montreal, Canada. 3. Test samples and controls for IGF-1 with ELISA assay. 4. Statistical analysis of samples for correlation with NKX3.1 genotype at Columbia University.

We showed that NKX3.1(R52C) and a protein engineered for loss of the serine 48 phosphorylation

site N KX3.1(S48A) do not a ctivate e xpression of IGFBP-3. C onsistent w ith th is lo ss o f f unction w e hypothesize that the presence of the variant NKX3.1 protein may interact with circulating serum IGF-I to affect p rostate cancer r isk. D etermination o f NKX3.1 genotype i n t wo p opulations a nd a nalysis of s erum IGF-I in the same study subjects is shown.

Study Cohorts. Physicians H ealth S tudy: T he p articipants o f th e P hysicians H ealth S tudy w ho

comprised the prostate cancer cases and controls have been previously described in papers describing the effect of serum IGF-I (9) and NKX3.1 genotype (10) on prostate cancer risk. The current analysis includes 673 cases and 527 controls, using a prospective nested case control design. Of the cases, 398 ha d Gleason score < 7, 257 h ad Gleason score > 7 = and 18 cases had unknown Gleason scores. Among the cases, 536 were T 1/T2 an d 1 01 w ere l ocally advanced o r m etastatic at p resentation w ith t he r emaining 3 6 cas es o f unknown stage. Median age of cases at diagnosis was 70 years.

Risk Factors for Prostate Cancer S tudy: The Risk Factors for Prostate Cancer S tudy (RFPCS) i s a population-based case-control s tudy of p rostate cancer. P rior approval of the s tudy protocol was obtained from all r elevant hospital and cancer registry human research ethics committees in Melbourne and Perth. Eligible c ases comprised m ale r esidents of M elbourne a nd P erth di agnosed be tween 1994 a nd 1 997 a nd recorded i n t he popul ation-based cancer registries w ith a hi stopathology-confirmed di agnosis of adenocarcinoma of the prostate (International Classification of Diseases, 9th revision, rubric 185), excluding well-differentiated tumors (defined as low grade, i.e., those with Gleason scores <5). Cases had to be <70 years of age at diagnosis. Controls were randomly selected from men on the current state electoral rolls and were f requency m atched t o t he pr edicted a ge di stribution of t he c ases i n a r atio of one control p er c ase. Potential controls were matched against the cancer registries at the time of recruitment to exclude men with a known history of prostate cancer. Controls were identified and interviewed contemporaneously with the cases ove r t he pe riod 1 994 t o 1997. The c ohort i s c omprised > 95% of C aucasians. T he l ack of r acial diversity is n ot c ritical t o th is a nalysis s ince th e f requency o f th e NKX3.1 polymorphism doe s n ot va ry between r aces (10). A t otal of 798 c ases and 5 27 c ontrols w ere analyzed. O f t he t otal c ases 5 82 w ere described as moderate grade a nd 216 a s hi gh g rade ( Gleason s core > 7 or poor ly di fferentiated or undifferentiated tumors). Among the cases 545 were T1/T2 and 249 were locally advanced or metastatic at presentation with the remaining 4 cases of unknown stage. Median age for cases and controls was 62 years Serum IG F-I levels were determined by ELISA using reagents from Diagnostic Systems. All assays were performed in the laboratory of Michael Pollak.

Previously w e h ad s hown t hat a mong 1253 cases a nd c ontrols i n t he P HS NKX3.1(C154T) (rs2228013) that codes for NKX3.1(R52C) was a mild risk factor for prostate cancer (10). We expanded this sample s et t o i nclude c ases f rom t he P HS di agnosed m ore r ecently s o t hat w e now an alyzed NKX3.1 genotypes from 937 prostate cancer cases and 1087 age-matched controls. In this expanded sample set the NKX3.1(C154T) allele was related to prostate cancer risk to a similar degree as we had previously published (10) (Table 1). Importantly, among men with prostate cancer d iagnosed before age 70, the median age at diagnosis i n t he P HS, rs2228013 was s ignificantly associated w ith h igher r isk o f o verall p rostate can cer (RR=1.55; 95% CI: 1.04-2.31), Gleason <7 (RR=1.71; 95% CI: 1.10-2.65), stage T1/T2 (RR=1.67; 95% CI:

6

1.09-2.57), and a higher risk of lethal cancer (metastatic cancer at diagnosis or fatal cancer during follow-up (RR=2.15; 95% CI: 1.00-4.63) (Table 2). Table 1 Odds ratios of Prostate Cancer by NKX3.1 Genotype in the PHS

Genotype Case (n) Case (%)

Control (n) Control (%) Odds ratio

Overall C C 844 90.1 998 91.9 1.00

C T 91 9.7 84 7.7

T T 2 0.2 4 0.4

C T/T T 93 9.9 88 8.1 1.25 (0.92-1.71)

Dx 1982-1993 C C 481 90.4 998 91.9 1.00

C T/T T 51 9.6 88 8.1 1.21 (0.83-1.77)

Dx 1994-2007 C C 363 89.6 998 91.9 1.00

C T/T T 42 10.4 88 8.1 1.22 (0.77-1.94)

Since NKX3.1 r egulates I GFBP-3 e xpression and I GFBP-3 r egulates I GF-I signaling w e a sked whether NKX3.1 genotype influenced the effect of IGF-I on pr ostate cancer r isk. From participants in the Physicians H ealth S tudy w e a nalyzed 673 pr ostate c ancer c ases a nd 527 m atched c ontrols f or w hich w e were able to determine both NKX3.1 genotype and serum levels of IGF-I (Table 3). T he majority of cases (69%) in this cohort had been ascertained prior to 1994 and thus had been diagnosed prior to the widespread use of serum PSA for prostate cancer screening. Moreover, the blood samples were collected in 1982, prior to the diagnosis of prostate cancer in the cases. The frequency of rs2228013 among the control participants with IGF-I data was 6.83%, somewhat lower than the overall PHS controls (8.10%), and lower than the 11% we ha d or iginally f ound i n our pr evious s tudy (10). T able 4 shows t he f requency of c ases a nd c ontrols displayed b y NKX3.1 genotype a nd di stributed a cross t hree t ertiles of pl asma IGF-I l evels. A mong participants hom ozygous f or w ild t ype NKX3.1 there w as n o ef fect o f plasma IGF-I on p rostate c ancer occurrence. However, among participants with NKX3.1(C154T) we found a 2.5-fold higher risk of prostate cancer comparing the highest to the lowest tertile of plasma IGF-I levels. The positive trend was apparent only among prostate cancer cases d iagnosed before 1993, but not among cases diagnosed 1994 and after. NKX3.1 genotype and serum IGF-I levels did not have a statistically significant interaction even among this subset (p for interaction = 0.2673).

We analyzed NKX3.1 genotype and serum IGF-I in a second group of cases and controls from the

Risk Factors for Prostate Cancer S tudy conduct by the Victoria Cancer Council in Australia. These cases were di agnosed be tween 1994 a nd 1997 a nd a re t herefore c onsidered l argely s creen-detected. T he characteristics of this population are shown in the right column of Table 3. In this population rs2228013 was present in 10.4% of the participants. These screened cases had a trend toward a younger age of diagnosis, lower stage distribution and lower grade distribution than the PHS cohort. Among these participants there was n o ef fect o f NKX3.1 genotype on pr ostate cancer r isk. T here w as a lso no i nteraction w ith l evels of serum IGF-I (Table 5). However, the effect of serum IGF-I levels alone on prostate cancer risk was seen in this population.

7

Table 2 Odds ratios of Prostate Cancer by NKX3.1 Genotype Among Men With Age<70 yrs at Diagnosis: results from the PHS

Genotype Cases (%) Controls (%) Odds ratio

Overall C C 460 88.3 564 92.2 1.00

C T/T T 61 11.7 48 7.8 1.55 (1.04-2.31)

Gleason<7 C C 296 86.8 564 92.2 1.00

C T/T T 45 13.2 48 7.8 1.71 (1.10-2.65)

Gleason≥7 C C 156 91.2 564 92.2 1.00

C T/T T 15 8.8 48 7.8 1.14 (0.62-2.10)

Stage T1/T2 C C 324 87.3 564 92.2 1.00

C T/T T 47 12.7 48 7.8 1.67 (1.09-2.57)

Stage T3/T4/N1/M1 C C 110 91.7 564 92.2 1.00

C T/T T 10 8.3 48 7.8 1.12 (0.54-2.29)

Metastatic or fatal PCa

C C 62 86.1 564 92.2 1.00

C T/T T 10 13.9 48 7.8 2.15 (1.00-4.63)

Dx year 1982-1993 C C 259 90.2 564 92.2 1.00

C T/T T 28 9.8 48 7.8 1.30 (0.78-2.19)

Dx year 1994-2007 C C 201 85.9 564 92.2 1.00

C T/T T 33 14.1 48 7.8 1.80 (1.03-3.15)

8

Table 3 Characteristics of Two Study Populations for NKX3.1 and IGF-I

PHS (overall)

PHS (with IGF-I)

RFPCS

Participants 2023 1200 1325 Cases 937 673 798 Dx prior to 1994 532(56.78) 465(69.09) 0 Dx after 1994 405(43.22) 208(30.91) 798 Age at Diagnosis <55 21( 2.24) 17( 2.53) 110 (13.8%) 55-64 258(27.53) 204(30.31) 421 (52.8%) 65-69 242(25.83) 169(25.11) 267 (33.5%) 70-74

≥ 75 221(23.59) 195(20.81)

160(23.77) 123(18.28)

Stage T1/T2 647(69.05) 461(68.50) 545 (68.3%) T3/T4

N1/M1 150(16.01) 47( 5.02)

114(16.94) 39( 5.79)

249 (31.2%)

Missing 93(9.93) 59 (8.77) 4 (0.5%) Grade Gleason<7,Low/Med

Grade 580(61.90) 414(61.52) 582 (72.9%)

Gleason≥7, High Grade

334(35.64) 239 (35.51)

216 (27.1%)

Missing 23( 2.45) 20( 2.97) NKX3.1 codon 154

C/C 844 604 719 (90.1%)

C/T or T/T 93( 9.92) 69 (10.25%) 79 (9.9%) *There was a single determination of 21.57pmole/ml.

9

Table 4 Odds ratios of Prostate Cancer by NKX3.1 Genotype and IGF-I Level in the Physicians Health Study*

Adjusted for baseline age, smoking status, and follow-up duration; ** T – tertile

Table 5 NKX3.1 Genotype and Serum IGF-I Levels in Risk Factors for Prostate Cancer Study Participants

Genotype IGF-I Case/

Control Odds ratio* p-interaction Overall: CC T1** 197/ 162 1.00 ( ref) 0.24

T2 203/ 166 1.029 (0.77-1.38)

T3 204/ 163 1.07 (0.79-1.45)

C/T or T/T T1 12/ 12 0.82 (0.36-1.87)

T2 25/ 11 1.93 (0.92-4.05)

T3 32/ 13 2.04 (1.03-4.04)

Dx 1982-1993: CC T1 135/ 162 1.00 (ref.) 0.27

T2 144/ 166 1.23 (0.87-1.73)

T3 140/ 163 1.31 (0.92-1.85)

C/T or T/T T1 9/ 12 0.98 (0.38-2.55)

T2 14/ 11 1.63 (0.70-3.83)

T3 23/ 13 2.49 (1.16-5.32)

Dx 1993-2007: CC T1 62/ 162 1.00 (ref) 0.57

T2 59/ 166 0.56 (0.34-0.93)

T3 64/ 163 0.69 (0.42-1.14)

C/T or T/T T1 3/ 12 0.39 (0.09-1.65)

T2 11/ 11 2.68 (0.96-7.52)

T3 9/ 13 0.92 (0.31-2.75)

Genotype IGF-I (teriles) Case/

Control Odds ratio* p-interaction Overall: CC T1 216/161 1.00 ( ref) 0.18

T2 200/153 0.97 (0.72 - 1.33)

T3 303/154 1.39 (1.04 - 1.87)

C/T or T/T T1 25/22 0.76 (0.40 - 1.44)

T2 30/17 1.39 (0.72 - 2.69)

T3 24/20 0.86 (0.44 - 1.64)

10

Task 3. Determine the effect of NKX3.1 on prostate cancer cell growth and survival.

1. Establishment of PC-3 cells expressing NKX3.1. (Months 1-12) We will establish stable PC-3

transfected cells expressing NKX3.1, NKX3.1(R52C), NKX3.1(S48A), NKX3.1(N174Q), and the expression vector pcDNA3.1.

2. Determination of IGFBP-3 expression in derivative PC-3 cells. (Months 6-30). We will determine relative expression of IGFBP-3 in the different PC-3 cell clones by western blotting using β-actin as a control and LNCaP cell extracts as a reference.

3. IGFBP-3 mRNA (Months 13-36). We will analyze expression of IGFBP-3 mRNA in stable transfectants and transiently transfected PC-3 cells by real time RT-PCR, similar to our experiments with the mouse prostate tissues, but using primers for the human cDNA. We will analyze the level of IGFBP-3 message in stably transfected clones compared to internal controls of GAPDH and β-actin cDNA.

4. Effect of NKX3.1 expression on PC-3 cell growth (Months 12-36). We will assay growth of PC-3 derivative cell clones by MTT and by cell counting to compare doubling times to parental and control transfected cells (with expression vector pcDNA3.1).

5. Determine the effect of NKX3.1 expression on PC-3 apoptosis (Months 25-36). We will assay the derivative lines for apoptosis. Apoptosis will be assayed by in-situ end labeling (ISEL) as we have previously published and by immunohistochemical assay for activated caspase-3 and cleaved PARP.

6. IGFBP-3 knockdown in PC-3 cells (Months 23-36). We will engineer the expression of NKX3.1 and mutants of NKX3.1 in PC-3 prostate cancer cells to determine the effect of NKX.3.1 on PC-3 cell growth and apoptosis. We will validate these results with transient transfection assays and, if necessary, with conditional expression contracts.

See response to Task 4 below. Task 4. Determine the effect of NKX3.1 on IGFR-1 signaling pathways and define the role of IGFBP-3 in the interaction between NKX3.1 and IGFR-1. Months 19-36. Assay by western blotting the activation of downstream targets of IGFR-1 and determine the effects of NKX3.1. Targets to be analyzed include:

1. IGFR-1 phosphorylation will be assayed using monoclonal antibodies specific for insulin receptor that cross-react with IGFR-1 (P-Tyr1135/1136).

2. IRS-1 is phosphorylated on Y1173 by IGFR-1 and can be assayed by IP-western blotting with antiphosphotyrosine antibody (11) or by Novus antibody to mouse IRS-1(phosphoY1179) that cross reacts with human IRS-1.

3. Protein kinase B/AKT is recruited to the cell membrane to PIP3 that results in enzyme activation. We will analyze the effect of the NKX3.1 mutant transgenes and IGFBP-3 siRNA on AKT phosphorylation.

4. BAD is a proapoptotic BCL family member that is phosphorylated by AKT on serine 136 and by MAPK cascade at serine 112. We will determine the effects of NKX3.1 and IGFBP-3 siRNA on BAD phosphorylation to examine effects on this component of the intrinsic cell death pathway.

5. FOXO1 like other members of the forkhead family of transcription factors is affected by IGFR-1 activation. We will use the antiFOXO1(phosphoserine 256) from Cell Signaling to determine FOXO1 phosphorylation in the NKX3.1 expressing cells before and after IGFBP-3 siRNA treatment.

Tasks 3 and 4 have been largely completed and the data have been published as:

11

Muhlbradt, E ., A satiani, E ., O rtner, E ., W ang, A, a nd G elmann, E.P. N KX3.1 a ctivates e xpression of IGFBP-3 to mediate IGF-I signaling and cell proliferation. Cancer Research, 69:2615-22, 2009. The paper wais included as part of the 2008-09 progress report.

Amino acid 52 a ffected by rs2228013 is an arginine, located in a consensus motif that is a site for phosphorylation at serine 48. Replacement of arginine 52 with cysteine decreases phosphorylation at serine 48 by 70% (10). Thus a missense mutation at serine 48 potentially generates a protein with analogous, but more a bsolute, l oss o f s erine 48 phos phorylation c ompared t o N XK3.1(R52C). E xpression of NKX3.1(R52C) i n P C-3 c ells i nduced s ubstantially l ess IGFBP-3 mRNA t han di d w ild t ype N KX3.1 (Figure 1A). The mutant NKX3.1(S48A) protein was also a ttenuated in IGFBP-3 induction, perhaps to a greater de gree t han N KX3.1(R52C) ( Figure 1B ). W estern bl otting c onfirmed t hat, a s e xpected, ne ither NKX3.1(R52C) nor N KX3.1(S48A) i nduced IGFBP-3 pr otein expression i n P C-3 cel ls (Figure 1C).

NKX3.1 e xpression a ttenuated IGFR-I

activation in PC-3 cells via induced expression of IG FBP-3. The e ffect of NKX3.1 on IGFR-I activation was not seen when Long R-IGF-I, an IGFR-I l igand t hat doe s not bi nd t o I GFBP-3 was u sed, o r w hen cells w ere p retreated w ith IGFBP-3 siRNA (12). In co ntrast, n either NKX3.1(R52C) nor N KX3.1(S48A) h ad an effect on IGFR-I signaling (Figures 2A and B). Moreover, s ignaling do wnstream f rom IGFR-I to IR S-1 i s a ttenuated b y NKX3.1 e xpression, but not b y N KX3.1(R52C) or N KX3.1(S48A) (Figure 2C ). N KX3.1 s uppresses c ell proliferation in c ulture, a n e ffect th at is abrogated b y s iRNA t o IGFBP-3 (12). P C-3 cells have a doubling time of approximately 24 hrs that is extended to approximately 30 hr s by expression of NKX3.1. Neither NKX3.1(R52C) nor NKX3.1(S48A) affected PC-3 cell doubling time (Table 6) despite levels of NKX3.1 protein expression c omparable t o l evels of w ild t ype protein that suppressed proliferation.

β-actin

NKX3.1

IGFBP-3

HO 2

A1

72

LNC

aP

PC

-3

PC

-3(p

cDN

A3

.1)

PC

-3(N

KX

3.1

)

PC-3(NKX3.1) (R52C)

1 26 27

β-actin

NKX3.1

IGFBP-3

HO 2

A1

72

LNC

aP

PC

-3

PC

-3(p

cDN

A3.

1)

PC

-3(N

KX

3.1

)PC-3(NKX3.1) (S48A)

25 27 28

A

B

C

β-actin

NKX3.1

IGFBP-3

A1

72

PC

-3(p

cDN

A3

.1)

PC

-3(N

KX

3.1

)

PC-3(NKX3.1)

1 26 27(S48A) (R52C)

25 27 2850kDa-

Figure 2. The effect of NKX3.1 variant proteins on IGFBP-3 expression in PC-3 cell clones. A and B. RT-PCR analysis of 250ng total mRNA isolated from PC-3 cell clones. A172 is a positive control for IGFBP-3 mRNA expression and LNCaP is a positive control for NKX3.1 mRNA expression. C. Western blot analysis of 60g whole cell lysate from PC-3(pcDNA3.1), PC-3(NKX3.1), PC-3(NKX3.1 R52C), and PC-3(NKX3.1 S48A) cell clones. A172 cell line was used as a positive control for IGFBP-3 protein expression.

12

0

0.5

1.0

1.5

2.0

2.5p

hosp

hoI

GF-

IR Y

113

1:

T

otal

IG

F-IR

ββ-actin

NKX3.1

pIGF-IR Y1131

IGF-IRβ

Supplemented media

PC-3(pcDNA3.1)

PC-3(NKX3.1) (R52C)-1

PC-3(NKX3.1) (R52C)-26

-+

-

--

-

-+

-

--

-

-+

-

--

-

++

+

++

+

++

+Serum-free

IGF-I (100pM)

phos

ph

oIG

F-IR

Y1

131

:

T

ota

l IG

F-IR

β

Supplemented media

PC-3(pcDNA3.1)

PC-3(NKX3.1) (S48A)-27

PC-3(NKX3.1) (S48A)-28

-+

-

--

-

-+

-

--

-

-+

-

--

-

++

+

++

+

++

+Serum-free

IGF-I (100pM)

0

0.5

1

1.5

2

2.5

3

3.5 β-actinNKX3.1

pIGF-IR Y1131

IGF-IRβ

0

0.5

1

1.5

2

2.5

*p

hosp

hoI

RS-

1 Y

61

2:

T

otal

IR

S-1

+-

-+

+-

-+

+-

-+

++

PC-3(pcDNA3.1)PC-3(NKX3.1)-1PC-3(NKX3.1)(R52C)-1PC-3(NKX3.1)(S48A)-28

--

Serum-free

IGF-I (100pM)

β-actin

NKX3.1

IRS-1

pIRS-1 Y612

A

B

C

13

Table 6 Effect of NKX3.1 Expression on Cell Proliferation

Cell Type Doubling Time p-valuePC-3 25.34 ± 1.91 0.1716PC-3(Control) 24.26 ± 2.05 *

PC-3(NKX3.1)-1 32.24 ± 5.91 0.0037PC-3(NKX3.1)-2 38.88 ± 7.82 0.0002PC-3(NKX3.1)-8 30.24 ± 2.55 0.002

PC-3(NKX3.1)(S48A)-25 22.19 ± 1.31 0.1368PC-3(NKX3.1)(S48A)-27 22.94 ± 0.98 0.3221PC-3(NKX3.1)(S48A)-28 22.42 ± 2.00 0.2053

PC-3(NKX3.1(R52C)-1 24.34 ± 1.50 0.9555PC-3(NKX3.1)(R52C)-26 25.94 ± 1.48 0.2264PC-3(NKX3.1)(R52C)-27 26.41 ± 1.69 0.1357

The cell doubling time, in hours, of parental PC-3 cells, PC-3(pcDNA3.1) cells, and PC-3(NKX3.1) clones was assayed by cell counting. C ells were counted at 24, 48, 72, a nd 96 hours post-seeding and doubling times were calculated. In the lower section of the table PC-3(pcDNA3.1) and PC-3(NKX3.1)-1 cells were treated w ith tr ansfection r eagent a lone, t he m issense s iRNA ol igonucleotide, a nd t he IGFBP-3 s iRNA oligonucleotide for 24 hours before the first cell count was taken. p-values were calculated in comparison to the PC-3(pcDNA3.1) cell doubling time, using ANOVA. NS = not significant.

Figure 2. The effect of NKX3.1 va riant pr oteins on IGF-IR a ctivation in P C-3 c ells. A . Western bl ot analysis of 90g of total protein extracted from PC-3(pcDNA3.1) and PC-3(NKX3.1)(R52C) stable cell clones that were serum starved for 16 hours and treated with 100pM IGF-I. The values in the graph are the m eans f rom t hree s eparate ex periments. A r epresentative w estern b lot i s s hown i n the i nset. B . Western bl ot a nalysis of 90 g o f to tal protein e xtracted from P C-3(pcDNA3.1) a nd P C-3(NKX3.1)(S48A) stable cell clones that were serum starved for 16 hours and treated with 100pM IGF-I. The values in the graph are the means from three separate experiments. A representative western blot is shown in t he i nset. C . W estern blot analysis of 90g o f to tal p rotein extracted f rom PC-3(pcDNA3.1), PC-3(NKX3.1)-1, PC-3(NKX3.1)(R52C)-1, and PC-3(NKX3.1)(S48A)-28 clones that were serum starved for 16 hour s and treated with 100pM IGF-I. T he values in the graph are the means from three separate experiments. A representative western blot is shown in the inset. * indicates a value different from the PC-3(pcDNA3.1) control with a p<0.001.

14

KEY RESEARCH ACCOMPLISHMENTS: • NKX3.1 activates IGFBP-3 • IGFBP-3 mediates, in part, growth suppression by NKX3.1 • NKX3.1 affects IGF-1 signaling and activation by IGF1-R by activation of IGFBP-3 • NKX3.1 C154T polymorphism does not interact with serum IGF-1 in prostate cancer risk REPORTABLE OUTCOMES: Publication: Muhlbradt, E., Asatiani, E., Ortner, E., Wang, A, and Gelmann, E.P. NKX3.1 activates expression of IGFBP-3 to mediate IGF-I signaling and cell proliferation. Cancer Research, 69:2615-22, 2009. Submitted Manuscript: Erin Muhlbradt, Jing Ma, Gianluca Severi, Elizabeth Ortner, Vanessa Hayes, Hoa N. Hoang, Meir Stampfer, Graham Giles, Michael Pollak, and Edward P. Gelmann. Variant NKX3.1 and serum IGF-1 – investigation of interaction in prostate cancer. Submitted to Cancer Epidemiology, Biomarkers, and Prevention. Employment

Erin Muhlbradt, graduate student who participated in this project Hired as Bioinformatics Research Analyst, Northrup-Grumman. Reston, VA

CONCLUSION: This project is completed an d h as a chieved its g oals. O ur experimental s tudies h ave shown that NKX3.1 activates IGFBP-3 expression and that IGFBP-3 mediates to a large degree the growth suppressive effects of NKX3.1 in vitro. The mechanism of this is via interference with the IGF-1 stimulation of t he IGF-1R. T he va riant N KX3.1 c oded b y the pol ymorphic l ocus NKX3.1 C154T i s a ttenuated i n IGFBP-3 activation and growth suppression in vitro. NKX3.1 C154T is a genetic determinant that is a mild risk factor for prostate cancer. However in our study we did not confirm that NKX3.1 genotype sensitizes men t o pr ocarcinogenesis i n t he pr ostate b y c irculating IGF-1. A s econd pa per i s be ing dr afted now to complete the formal literature report of our data.

15

Reference List

(1) Voeller HJ, Augustus M, Madlike V, Bova GS, Carter KC, Gelmann EP. Coding region of NKX3.1, prostate-specific homeobox gene on 8p21, is not mutated in human prostate cancers. Cancer Res 1997;57:4455-9.

(2) Ornstein DK, Cinquanta M, Weiler S, Duray PH, Emmert-Buck MR, Vocke CD, et al. Expression studies and mutational analysis of the androgen regulated homeobox gene nkx3.1 in benign and malignant prostate epithelium. J Urol 2001;165:1329-34.

(3) Bhatia-Gaur R, Donjacour AA, Sciavolino PJ, Kim M, Desai N, Norton CR, et al. Roles for Nkx3.1 in prostate development and cancer. Genes and Development 1999;13:966-77.

(4) Kim MJ, Cardiff RD, Desai N, Banach-Petrosky WA, Parsons R, Shen MM, et al. Cooperativity of Nkx3.1 and Pten loss of function in a mouse model of prostate carcinogenesis. Proc Natl Acad Sci U S A 2002;99:2884-9.

(5) Magee JA, Abdulkadir SA, Milbrandt J. Haploinsufficiency at the Nkx3.1 locus. A paradigm for stochastic, dosage-sensitive gene regulation during tumor initiation. Cancer Cell 2003;3:273-83.

(6) Steadman DJ, Giuffrida D, Gelmann EP. DNA-binding sequence of the human prostate-specific homeodomain protein NKX3.1. Nucleic Acids Res 2000;28:2389-95.

(7) Carson JA, Fillmore RA, Schwartz RJ, Zimmer WE. The Smooth Muscle gamma -Actin Gene Promoter Is a Molecular Target for the Mouse bagpipe Homologue, mNkx3-1, and Serum Response Factor. J Biol Chem 2000;275:39061-72.

(8) Asatiani E, Huang WX, Wang A, Rodriguez OE, Cavalli LR, Haddad BR, et al. Deletion, methylation, and expression of the NKX3.1 suppressor gene in primary human prostate cancer. Cancer Res 2005;65:1164-73.

(9) Chan JM, Stampfer MJ, Giovannucci E, Gann PH, Ma J, Wilkinson P, et al. Plasma insulin-like growth factor-I and prostate cancer risk: a prospective study. Science 1998;279:563-6.

(10) Gelmann EP, Steadman DJ, Ma J, Ahronovitz N, Voeller HJ, Swope S, et al. Occurrence of NKX3.1 C154T Polymorphism in Men with and without Prostate Cancer and Studies of Its Effect on Protein Function. Cancer Res 2002;62:2654-9.

(11) Paz K, Liu YF, Shorer H, Hemi R, LeRoith D, Quan M, et al. Phosphorylation of insulin receptor substrate-1 (IRS-1) by protein kinase B positively regulates IRS-1 function J Biol Chem 1999;274:28816-22.

(12) Muhlbradt E, Asatiani E, Ortner E, Wang A, Gelmann EP. NKX3.1 activates expression of insulin-

like growth factor binding protein-3 to mediate insulin-like growth factor-I signaling and cell proliferation. Cancer Res 2009;69:2615-22.

16

Appendices Muhlbradt, E., Asatiani, E., Ortner, E., Wang, A, and Gelmann, E.P. NKX3.1 activates expression of IGFBP-3 to mediate IGF-I signaling and cell proliferation. Cancer Research, 69:2615-22, 2009. Erin Muhlbradt, Jing Ma, Gianluca Severi, Elizabeth Ortner, Vanessa Hayes, Hoa N. Hoang, Meir Stampfer, Graham Giles, Michael Pollak, and Edward P. Gelmann. Variant NKX3.1 and serum IGF-1 – investigation of interaction in prostate cancer. Submitted to Cancer Epidemiology, Biomarkers, and Prevention.

NKX3.1 Activates Expression of Insulin-like Growth Factor Binding

Protein-3 to Mediate Insulin-like Growth Factor-I Signaling

and Cell Proliferation

Erin Muhlbradt,1Ekaterina Asatiani,

1Elizabeth Ortner,

1Antai Wang,

1and Edward P. Gelmann

1,2

1Lombardi Comprehensive Cancer Center, Washington, District of Columbia and 2Departments of Medicine and Pathology, Herbert IrvingComprehensive Cancer Center, Columbia University, New York, New York

Abstract

NKX3.1 is a homeobox gene that codes for a haploinsufficientprostate cancer tumor suppressor. NKX3.1 protein levels aredown-regulated in the majority of primary prostate cancertissues. NKX3.1 expression in PC-3 cells increased insulin-likegrowth factor binding protein-3 (IGFBP-3) mRNA expression10-fold as determined by expression microarray analysis. Inboth stably and transiently transfected PC-3 cells and inLNCaP cells, NKX3.1 expression increased IGFBP-3 mRNA andprotein expression. In prostates of Nkx3.1 gene-targeted miceIgfbp-3 mRNA levels correlated with Nkx3.1 copy number.NKX3.1 expression in PC-3 cells attenuated the ability ofinsulin-like growth factor-I (IGF-I) to induce phosphorylationof type I IGF receptor (IGF-IR), insulin receptor substrate 1,phosphatidylinositol 3-kinase, and AKT. The effect of NKX3.1on IGF-I signaling was not seen when cells were exposed tolong-R3-IGF-I, an IGF-I variant peptide that does not bind toIGFBP-3. Additionally, small interfering RNA–induced knock-down of IGFBP-3 expression partially reversed the attenuationof IGF-IR signaling by NKX3.1 and abrogated NKX3.1suppression of PC-3 cell proliferation. Thus, there is a closerelationship in vitro and in vivo between NKX3.1 and IGFBP-3.The growth-suppressive effects of NKX3.1 in prostate cells aremediated, in part, by activation of IGFBP-3 expression. [CancerRes 2009;69(6):2615–22]

Introduction

Adenocarcinoma of the prostate, like many epithelial malignan-cies, initiates in luminal epithelial cells in prostatic ducts thatacquire the precursor or gatekeeper mutations required fordevelopment of the malignant phenotype. Early in prostate cancer,a region of 8p21.2 is lost in the majority of cancers (1). At least onetarget for 8p21.2 loss is the homeobox gene NKX3.1 , which isexpressed specifically in prostate luminal epithelial cells. NKX3.1undergoes progressive loss of protein expression during prostatecancer progression from hormone dependence to hormoneindependence and metastatic disease (2, 3).The Nkx3.1 gene is not subject to somatic mutation in prostate

cancer (4, 5). Gene targeting studies in mice showed that NKX3.1haploinsufficiency alone can predispose to prostate epithelialdysplasia and can cooperate with other oncogenic mutations toaugment prostate carcinogenesis (6, 7). In gene-targeted mice,

decreased Nkx3.1 expression is accompanied by decreasedexpression of genes under the regulation of the Nkx3.l homeo-protein (8). We have recently shown that diminished levels ofNKX3.1 expression in primary human prostate cancer and intra-epithelial neoplasia correlated with the degree of gene inactivationby deletion, methylation, or both. Not only is NKX3.1 down-regulated in preinvasive prostate cancer but NKX3.1 expression isalso reduced in regions of inflammatory atrophy that areprecursors for malignant transformation (9). Inflammatory cyto-kines in these lesions can induce ubiquitination of NKX3.1 andprotein loss (10). Therefore, NKX3.1 may play a role inpremalignant events in the prostate gland by modulating geneexpression to increase the susceptibility of prostate epithelial cellsto malignant transformation. We have sought to characterize thegene expression program activated by NKX3.1 in human cells. Herewe show in vitro and in vivo that NKX3.1 activates expression ofinsulin-like growth factor binding protein-3 (IGFBP-3), a knowngrowth suppressor protein and down-regulator of insulin-likegrowth factor-I (IGF-I) activity.IGFBP-3 is one of six IGFBPs that bind to and modulate the

activity of IGFs. IGFBP-3 is a highly abundant serum protein andtherefore affects the physiologic bioavailability of circulating IGF-I(11). In the pericellular environment, IGFBP-3 is thought to beproapoptotic and to counteract the proliferative effects of IGF-I(12). Pericellular proteases cleave IGFBP-3, thus releasing IGF-I tobind to the type I IGF receptor (IGF-IR). For example, prostate-specific antigen is a metalloproteinase that cleaves IGFBP-3 to yieldat least seven proteolytic fragments, some of which retain theability to bind IGF-I, albeit with lower affinity than the intactprotein (13–16). The interaction of IGFBP-3 with cells is morecomplex than suggested by its interactions with IGF-I. IGFBP-3stimulates cells directly as shown by the biological effects ofIGFBP-3 mutant proteins that lack IGF-I binding (17). Interestingly,although IGFBP-3 expression was not identified in a high-throughput expression analysis of Nkx3.1 gene-targeted mice (8),IGFBP-3 was identified as a major target of down-regulation inprostate cancer compared with nonmalignant prostate tissue (18).We now present data showing a role for IGFBP-3 in growthsuppression by NKX3.1. We propose that IGFBP-3 expressionrepresents an important mechanistic link between the tumor-suppressive effects of NKX3.1 and the prosurvival and proliferativeeffects of IGF-I, a peptide growth factor that has been implicatedin prostate carcinogenesis.

Materials and Methods

Expression array analysis. Total RNA from stable PC-3(NKX3.1)

and PC-3(pcDNA3.1) cells was harvested using the RNeasy Miniprep kit

(Qiagen, Inc.). First-strand cDNA synthesis from total RNA was carried outusing the GeneChip T7-Oligo(dT) primer kit (Affymetrix). Second-strand

Note: Supplementary data for this article are available at Cancer Research Online(http://cancerres.aacrjournals.org/).

Requests for reprints: Edward P. Gelmann, Columbia University, Milstein Hospital6N-435, 177 Fort Washington Avenue, New York, NY 10032. Phone: 212-305-8602;Fax: 212-305-3035; E-mail: gelmanne@columbia.edu.

I2009 American Association for Cancer Research.doi:10.1158/0008-5472.CAN-08-3022

www.aacrjournals.org 2615 Cancer Res 2009; 69: (6). March 15, 2009

Research Article

cDNA synthesis was done using the SuperScript Choice System (Invitrogen).The cDNA was then processed using the GeneChip Sample Cleanup Module

(Affymetrix). Amplification and biotin labeling of antisense cRNA were

carried out using the BioArray High Efficiency RNA Transcript Labeling

system (Affymetrix). Finally, the GeneChip Sample Cleanup Module(Affymetrix) was used to clean up the biotinylated cRNA before it was

sent for analysis on an Affymetrix U-133 array system.

Cell culture and reagents. The prostate cancer cell lines PC-3 andLNCaP and the A172 human glioblastoma cell line were obtained fromAmerican Type Culture Collection. PC-3 and A172 cell lines were grown

in modified IMEM (Invitrogen) containing 10% fetal bovine serum (FBS).

LNCaP cells were grown in modified IMEM with phenol red (Invitrogen)

containing 10% FBS. The PC-3 cells stably expressing the NKX3.1expression vector were continuously grown in modified IMEM (Invi-

trogen) containing 10% FBS and 1.2 mg/mL G418 (Invitrogen). LNCaP

cells were serum starved overnight in IMEM supplemented with 5%charcoal-stripped calf serum and treated with 10 nmol/L R1881 for

48 h before harvesting.

Plasmids and transfection. Full-length NKX3.1 was cloned into the

mammalian expression vector pcDNA3.1 (Invitrogen) as previously

described (19). The phosphatase and tensin homologue (PTEN) expression

vector, cloned into pcDNA3.1, was a kind gift from Charles Sawyers

(Memorial Sloan-Kettering Cancer Center, New York, NY; ref. 20). Transient

and stable transfections were carried out in 75-cm2 cell culture flasks

(Corning, Inc.). Briefly, PC-3 and LNCaP prostate cancer cells were grown to

40% to 60% confluence, and 4 Ag of plasmid DNA were transfected into thecell lines using Lipofectamine Plus reagents (Invitrogen) in Opti-MEM

(Invitrogen). After a 4-h incubation, the medium was replaced with IMEM

containing 10% FBS for an additional 24 h. The PC-3 clones that stably

express NKX3.1 were derived by transfection. After 4-h incubation with

transfection reagent, PC-3 cells were trypsinized and seeded at a 1:30

density in Falcon Integrid 20 mm grid tissue culture dishes (Becton

Dickinson) in modified IMEM containing 10% FBS and 1.2 mg/mL G418

(Invitrogen). The medium was replaced every 4 d until colonies derived

from a single cell could be seen with a light microscope. Single-clone

colonies were isolated with sterile cloning discs (Scienceware) soaked in

0.25% trypsin-EDTA (Invitrogen) and grown to confluence in six-well tissue

culture dishes (Corning) for further study.

Western blot analysis. Cells were grown to 60% to 80% confluence and

medium was aspirated from the tissues culture dish. Immediately following

medium aspiration, lysis buffer was pipetted directly onto the cellmonolayer and cells were scraped from the tissue culture flask. Cells were

lysed with radioimmunoprecipitation assay buffer containing Complete

Mini protease inhibitors (Roche) and/or phosphatase inhibitors (Cell

Signaling) followed by brief sonication to complete lysis. Sixty to ninetymicrograms of total cell lysate were boiled in Novex 2� Tris-glycine SDS

sample buffer (Invitrogen) containing h-mercaptoethanol for 6 min and

resolved on a 10% to 20% Tris-glycine SDS-PAGE gel (Invitrogen). Protein

was then transferred onto a nitrocellulose membrane (Bio-Rad) and probedwith primary antibodies at the following concentrations: h-actin (Sigma),1:10,000; NKX3.1 (ref. 2), 1:2,000; IGFBP-3 (Santa Cruz Biotechnology),

1:8,000; AKT (Cell Signaling), 1:7,500; phospho-AKT Thr308 (Cell Signaling),1:7,500, at 4jC overnight, followed by three washes in PBST. Horseradish

peroxidase–conjugated goat anti-rabbit and goat anti-mouse (ImmunoPure

antibodies, Pierce Biotechnology) secondary antibodies in 1% milk or 1%

bovine serum albumin were applied for 1 h at room temperature. Signaldetection was done with SuperSignal West Pico Chemiluminescent

Substrate (Pierce Biotechnology).

Reverse transcription-PCR analysis. Total RNA was extracted using

the RNeasy Mini Kit (Qiagen) and cells were homogenized using theQiashredder (Qiagen) method. RNA (125–250 ng) was added to the reverse

transcription-PCR (RT-PCR) master mix from OneStep RT-PCR Kit (Qiagen;

includes 5� buffer, deoxynucleotide triphosphates, and Taq polymerase).The following primers were used in the RT-PCR reactions: h-actin ( fwd5¶-GGCCACGGCTGCTTC-3¶ and rev 5¶-GTTGGCGTACAGGTCTTTGC-3¶),NKX3.1 ( fwd 5¶-GCCGCACGAGCAGCCAGAGACA-3¶ and rev 5¶-TTCAGGG-CCGGCAAAGAGGAGTG-3¶), IGFBP-3 ( fwd 5¶-CGCCAGCTCCAGGAAATG-

3¶ and rev 5¶-GCATGCCCTTTCTTGATGATG-3¶), IGFBP-4 ( fwd 5¶-TTAGCC-CAAGAGGTCTGAGC-3¶ and rev 5¶-CTGTGCTTCAAGTCTTCCTTTG-3¶),and lamin A/C ( fwd 5¶-AACTTCAGGATGAGATGCTGCG-3¶ and rev 5¶-GT-CCAGAAGCTCCTGGTACTCGT-3¶). RT-PCR was done in a Techne TechgenePCR machine; 30 min at 50jC, 15 min at 94jC, 22 to 30 cycles of 30 s to1 min at 94jC, 30 s to 1 min at melting temperatures of 55jC to 65jC,and 30 s to 1 min at 72jC, followed by 15 min at 72jC. Samples were storedon ice until and mixed with 10� Blue Juice gel loading buffer (Invitrogen)

and run on a 1.5% agarose gel containing 0.1 Ag/mL ethidium bromide inTris-acetate-EDTA buffer. Gels were imaged on a luminometer and

recorded using a Kodak one-dimensional digital camera.

Real-time RT-PCR analysis of murine prostate RNA. Frozen anteriorprostates from three individual mice of each of genotypes Nkx3.1+/+,

Nkx3.1+/�, and Nkx3.1�/�, from both 4- and 12 mo-old animals, were

generously provided by Cory Abate-Shen (Columbia University, New York,

NY; ref. 6). mRNA was extracted using Qiagen RNeasy mini kit. The real-

time quantitative PCR TaqMan assays were done on the ABI PRISM 7700

Sequence Detection System (SDS) equipment (Applied Biosystems). The

primers and probe were selected for igfbp-3 using Primer Express software

(Applied Biosystems). The primer sequences were forward, 5¶-GCAGG-CAGCCTAAGCACC-3¶, and reverse, 5¶-CCTCCTCGGACTCACTGAT-3¶.The probe sequence (TCCCCTCCCAACCTGCTCCAGG) was labeled at the

5¶ end with the reporter molecule 6-carboxyfluorescein (FAM) and at

the 3¶ with the quencher BHQ-1. Amplification of commercially availableendogenous VIC-labeled control, rodent glyceraldehyde-3-phosphate dehy-

drogenase (GAPDH; Applied Biosystems), was used to standardize the

amount of sample DNA added. Dilutions of DNA from the cell line (LNCaP)

were used to construct standard curves for the target gene and endogenous

control. TaqMan Universal PCR Master Mix was combined with 100 ng of

sample DNA, 900 nmol/L final concentration of primers, and 100 nmol/L

final concentration of the probe. All samples were analyzed as replicates of

four wells. Relative quantitation of the data from 7700 SDS was done using

SDS 2.1 Software (Applied Biosystems).

IGF-IR activation and signaling. Cells were plated in 100-mm culturedishes and washed twice with 1� PBS before being serum starved for 14 to

16 h in modified IMEM containing 1.2 mg/mL G418 (Invitrogen). Cells were

then washed once with PBS and treated for 3 min with 100 pmol/L IGF-I

(a gift from Dr. J. Toretsky, Georgetown University, Washington, DC) or long-R3-IGF-I (GroPep) in IMEM at 37jC. The medium was immediately

aspirated and cells were scraped from the flask and suspended in 2� cell

lysis buffer (Cell Signaling) containing phosphatase inhibitors and proteaseinhibitors by using Complete Mini tablets (Roche). Western blot analysis

was completed as described above with anti–IGF-IRh (Cell Signaling), anti–phospho-IGF-IR (Tyr1131) (Cell Signaling), anti–insulin receptor substrate

1 (IRS-1; Upstate), anti–IRS-1[pY612] (Biosource), anti–phosphatidylinositol3-kinase (PI3K) p85 (Cell Signaling), and anti–phospho-PI3K [pY458] (Cell

Signaling) primary antibodies. Bands were quantified by Scion Imager

software and P values were assessed from triplicate experiments by t test

analysis using Prism GraphPad software (*, P < 0.05; **, P < 0.005;***, P < 0.001).

Cell proliferation assay. PC-3, PC-3(pcDNA3.1), and PC-3(NKX3.1) cellswere seeded in triplicate in 96-well plates at a concentration of 4,000 per

well in IMEM containing 10% FBS (PC-3) or 10% FBS plus 1.2 mg/mL G418[PC-3(pcDNA3.1) and PC-3(NKX3.1)] and incubated for 24 h at 37jC. At 24,48, 72, and 96 h after seeding, wells were trypsinized, suspended in IMEM,

and immediately counted in a Beckman Coulter Z1 cell counter. Doublingtimes were calculated using Microsoft Excel and P values were calculated by

ANOVA.

Tumor xenografts. Animal studies were carried out under the approvedprotocol AAAA-7422 as per Columbia University Institutional Animal Careand Use Committee guidelines and approval. Cell lines were grown to 80%

confluence in IMEM + 10% FBS + 1.2 mg/mL G418 in a Hyperflask (Corning)

and trypsinized with 0.25% trypsin-EDTA (Invitrogen). Cells were resus-

pended in IMEM containing 10% FBS to deactivate trypsin and washedtwice with PBS. Cells were then counted and resuspended in PBS at a

concentration of 3 � 107/mL. Cell suspensions (150 AL) were injected into5-wk-old female NCr-Nude mice (Taconic Farms) on their ventral surface

Cancer Research

Cancer Res 2009; 69: (6). March 15, 2009 2616 www.aacrjournals.org

and tumors were measured in two dimensions once a week. We performed

20 inoculations per cell line. All measurements were done by one observer

(E.M.). Once the tumors reached 500 mm3 or if illness was observed, micewere sacrificed and tumors were dissected and stored in 10% buffered

formalin for paraffin embedding or in RNAlater (Qiagen) at �80jC for

Western blot analysis.

Immunohistochemistry. Cells grown under tissue culture conditionswere embedded in 1% agarose before sectioning and staining. Paraffin

embedding and sectioning of the tumor xenografts and agarose cell plugs

were done by the Molecular Pathology Shared Resource of the HerbertIrving Comprehensive Cancer Center at Columbia University. Slides were

microwaved for 5 min and immersed in two washes of xylene, followed by

successive washes in 100%, 90%, and 70% ethanol and then by a 5-min wash

in PBS. Slides were immersed in 10 mmol/L citrate buffer at pH 6.0 andsteamed in a Black and Decker vegetable steamer for 40 min. Slides were

fully cooled to room temperature and washed once with PBS before the

blocking step, horse serum in PBS (1:66, Pierce) for 30 min at room

temperature. NKX3.1 primary antibody (1:500; Zymed) was applied for 1 h atroom temperature followed by biotin antimouse secondary antibody for

30 min (1:200; Vector Laboratories). This was followed by application of

Vectastain Elite ABC kit (Vector Laboratories) and Vector VIP substrate kit

(Vector Laboratories). Methyl green (Vector Laboratories) was used asa nuclear counterstain.

Small interfering RNA knockdown of IGFBP-3. A series of small

interfering RNA (siRNA) oligonucleotides were purchased from Dharma-con. Another siRNA sequence was derived from sequences published by

Stewart and colleagues (21): a siRNA duplex directed against nucleotides

603 to 623 of IGFBP-3 mRNA (reference sequence NM_000598; 5¶-

AAUCAUCAUCAAGAAAGGGCA-3¶). Control siRNA sequences included a

mismatched oligonucleotide that differed from the IGFBP-3 siRNA

oligonucleotide by 1 bp (5¶-AAUCAUCUACAAGAAAGGGCA-3¶), and thelamin A/C positive control sequence (5¶-GGUGGUGACGAUGUGGGCU-3¶).This single siRNA sequence was the only one of 11 siRNA sequences

tested. The 10 IGFBP-3 siRNA sequences that had no effect are shown in

Supplementary Table S1. Cells (2 � 105) were plated in triplicate in asix-well plate in IMEM + 10% FBS + 1.2 mg/mL G418 the night before the

exposure to the oligonucleotides. Cells were transfected with 20 Amol/L ofsiRNA oligonucleotide using Lipofectamine (Invitrogen) in Opti-MEM(Invitrogen). The medium was changed back to IMEM + 10% FBS +

1.2 mg/mL G418 at 3.5 h posttransfection, and knockdown of IGFBP-3

mRNA was assayed at 24 and 96 h by RT-PCR. In the cell proliferation

assay, knockdown was allowed to proceed for 24 h before the initial cellcount. For the assessment of IGF-IR activation and downstream signaling,

1 � 106 cells were plated in IMEM + 10% FBS + 1.2 mg/mL G418 the night

before exposure to the oligonucleotides. Cells pretreated with oligonucle-

otide for up to 16 h were washed twice with PBS and serum starved for 14to 16 h. Cells were further washed with PBS and treated with 100 pmol/L

IGF-I for 3 min at 37jC.

Results

Effect of NKX3.1 on gene expression in PC-3 prostate cancercells. To identify genes whose expression is affected by NKX3.1, weinitially generated independently transfected clones of PC-3prostate cancer cells chosen because PC-3 cells express essentiallyno NKX3.1 protein and express NKX3.1 mRNA at f1/250 the level

Figure 1. NKX3.1 up-regulates theexpression of IGFBP-3 in prostate cancercell lines. A, Western blot analysis ofcell extracts from stably expressingPC-3(pcDNA3.1) and PC-3(NKX3.1)-1 cellclones that have been analyzed byexpression array. B, left, Western blotanalysis of extracts from additional PC-3clones expressing NKX3.1. Right, RT-PCRanalysis of PC-3(pcDNA3.1) and PC-3(NKX3.1) clones for NKX3.1 andIGFBP-3 expression. A172 cell extract is apositive control for IGFBP-3 expressionand LNCaP cell extract is used as apositive control for NKX3.1 expression.C, left, Western blot analysis of extractsfrom PC-3 cells transiently transfected withan NKX3.1 expression vector. Right,Western blot analysis of extracts fromLNCaP cells transiently transfected with anNKX3.1 expression vector or serumstarved in medium supplemented with 5%charcoal-stripped calf serum overnightand treated with 10 nmol/L R1881.D, RT-PCR analysis of IGFBP-4 mRNAexpression in PC-3(pcDNA3.1) andPC-3(NKX3.1) clones.

NKX3.1 Activates IGFBP-3

www.aacrjournals.org 2617 Cancer Res 2009; 69: (6). March 15, 2009

seen in LNCaP cells.3 Two derivative PC-3 cell lines transfectedwith the pcDNA3.1 empty expression vector and two derivativeNKX3.1 expressing clones were analyzed using the AffymetrixU-133 expression arrays. Approximately 99% of the signals obtainedwere regulated concordantly between the two control clones andthe two NKX3.1-expressing clones. The cDNAs that were discordantbetween the two control clones or between the two NKX3.1-expressing clones were eliminated from the analysis, and theconcordant clone expression levels were averaged across the PC-3control cells and the PC-3(NKX3.1) cells. Then the two meanexpression levels were compared. Using a cutoff of 1.4-fold up-regulation or down-regulation, 984 transcripts were identified(Supplementary Table S2). Two separate IGFBP-3 probes wereactivated 9.22- and 10.23-fold in PC-3 cells expressing NKX3.1compared with PC-3 control transfectants. The IGFBP-3 messagedifferences between control and NKX3.1-expressing cells were thesixth and ninth highest increases of the 508 up-regulatedtranscripts.Effect of NKX3.1 on IGFBP-3 expression in vitro . To validate

the effect of NKX3.1 on IGFBP-3 expression and determine whetherprotein expression was also affected, we performed Westernblotting on a PC-3 clone expressing NKX3.1. NKX3.1 expressionwas clearly seen in transfected cells, and IGFBP-3 expression wasf10-fold activated compared with control transfected cells(Fig. 1A). In a separate transfection experiment, additional PC-3clones expressing NKX3.1 were isolated. A marked increase wasobserved for clone 1 in Fig. 1A ; similar but smaller increases wereobserved in protein and mRNA in two other clones (Fig. 1B).To show that the apparent induction of IGFBP-3 expression by

NKX3.1 was not an adaptation of the cells during clonal selection,we performed Western blotting on PC-3 cells transiently trans-fected with NKX3.1 and again observed increase expression ofIGFBP-3 (Fig. 1C). The relationship between expression of NKX3.1and expression of IGFBP-3 was not exclusive to PC-3 cells becauseincreasing NKX3.1 expression in LNCaP cells by transfection of anNKX3.1 expression vector also increased expression of IGFBP-3

(Fig. 1C). Note that exposure to the synthetic androgen R1881activated NKX3.1 expression but not IGFBP-3. This may be due toproliferative signals of R1881 that interfere with the activation ofIGFBP-3 by NKX3.1. Alternatively, LNCaP cells may have down-regulated expression of IGFBP-3 as an adaptation to growth withcontinuous expression of NKX3.1. However, it should be noted thatdifferences in the medium in which PC-3 and LNCaP cells werecultured may have also contributed to the differences in IGFBP-3expression in these two cell lines. We also noted that a single probefor IGFBP-4 was activated 4-fold by NKX3.1 in the expression arrayanalysis. However, increased expression of IGFBP-4 mRNA was notseen in multiple other PC-3 clones engineered to express NKX3.1(Fig. 1D). LNCaP cells have been shown not to express IGFBP-4 andare used as a negative control in this Western blot, whereas PC-3cells have been shown to express IGFBP-4 (22). No other IGFbinding protein mRNAs were found to be activated in theexpression array.Expression of IGFBP-3 in prostate tissues correlates with

expression of NKX3.1. To determine whether the correlation ofNKX3.1 and IGFBP-3 expression could also be observed in vivo , weanalyzed prostate mRNA in Nkx3.1 gene-targeted mice. We havepublished quantitation of Nkx3.1 protein in intact, Nkx3.1+/� , andNkx3.1�/� mice, showing that levels of Nkx3.1 protein correlatedwith gene copy number in Nkx3.1-targeted mice (3). We performedreal-time RT-PCR of RNA extracted from these mice. Data in Fig. 2show that Igfbp-3 mRNA expression was related to Nkx3.1 genecopy number in murine prostates. In each reaction, Gapdh wasused as a control and was invariant between the different strains.We found that in murine prostates, Igfbp-3 expression levelscorrelated with Nkx3.1 copy number and thus with Nkx3.1expression (Fig. 2).Although we had shown an increase in IGFBP-3 mRNA as a

result of NKX3.1 expression in cultured human cells, we wereunable to show an effect of NKX3.1 on luciferase reporterconstructs that contained regions from the IGFBP-3 gene promoter(data not shown; ref. 23). This is not entirely surprising becauseNKX3.1 by itself does not contribute to the formation of atranscriptional complex and suppresses transcription from reporterconstructs engineered with the NKX3.1 cognate DNA bindingdomain (19).

Figure 2. Nkx3.1 and Igfbp-3 expression in mouse prostate. Real-time RT-PCR analysis of mRNA extracts of prostatic tissue of Nkx3.1 gene-targeted mice at4 mo (A) and 12 mo (B) of age. Anterior prostates were analyzed from three separate animals of each genotype at each time point. Gapdh expression was used as aloading control. Each one of the multiple assay lines in each group represents the results of a single tissue sample. The results correlated with Nkx3.1 genotype.

3 Our unpublished data.

Cancer Research

Cancer Res 2009; 69: (6). March 15, 2009 2618 www.aacrjournals.org

The effect of NKX3.1 on IGF-I signaling. To determine whetherthe induction of IGFBP-3 expression by NKX3.1 affected IGF-I sig-naling, we examined the response of the IGF-IR to IGF-I in derivativePC-3 cells. In the presence of serum-free medium, IGF-I inducedIGF-IR phosphorylation at Tyr1131 within 3 minutes of exposure tothe ligand (24). Phosphorylation of IGF-IR was diminished in cellsexpressing NKX3.1 (Fig. 3A). The effect of NKX3.1 on IGF-IRactivation could also be seen on downstream signaling targets.IGF-I–induced phosphorylation of IRS-1, a target of both the insulinreceptor and IGF-IR, was diminished in cells expressing NKX3.1(Fig. 3B). PC-3 derivative cells were also treated with the long-R3-IGF-I that has minimal binding to IGFBP-3 (25, 26). Long-R3-IGF-Iactivated phosphorylation of IGF-IR equally well in derivativePC-3 cells regardless of NKX3.1 expression (Fig. 3C). This result isconsistent with the notion that NKX3.1 mediates inhibition ofIGF-I signaling via increased expression of IGFBP-3.

Figure 3. NKX3.1 expression inhibits the IGF-1–mediated phosphorylationof the IGF-1R and IRS-1 in PC-3 cells. A, Western blot analysis of extractsfrom PC-3(pcDNA3.1), PC-3(NKX3.1)-1, and PC-3(NKX3.1)-8 stable cellclones serum starved for 16 h and treated with 100 pmol/L IGF-I. Thehistogram of IGF-IR activation is based on three separate experiments.B, Western blot analysis of extracts from PC-3(pcDNA3.1), PC-3(NKX3.1)-1,and PC-3(NKX3.1)-8 clones serum starved for 16 h and treated with100 pmol/L IGF-I. The histogram of IRS-1 activation is based on threeseparate experiments. C, Western blot analysis of extracts fromPC-3(pcDNA3.1), PC-3(NKX3.1)-1, and PC-3(NKX3.1)-8 clones serumstarved for 16 h and treated with 100 pmol/L IGF-1 or long-R3-IGF-I. Thehistogram of IGF-IR activation is based on three separate experiments.Statistical comparisons are indicated by asterisks as explained in Materialsand Methods. Comparisons are versus PC-3(pcDNA3.1) treated with IGF-Iunless otherwise indicated by brackets.

Figure 4. NKX3.1 attenuates IGF-1R downstream signaling. A, Western blotanalysis of extracts from PC-3(pcDNA3.1), PC-3(NKX3.1)-1, and PC-3(NKX3.1)-8 clones serum starved for 16 h and treated with 100 pmol/L IGF-I for 3 min.The histogram of PI-3K activation is based on three separate experiments.Statistical comparisons are indicated by asterisks. Comparisons are versusPC-3(pcDNA3.1) treated with IGF-I. B, Western blot analysis of cell extracts fromPC-3(pcDNA3.1) and PC-3(NKX3.1)-1 cells grown in medium containing 10%FBS. C, Western blot analysis of cell extracts of PC-3 cells transientlytransfected with either a NKX3.1 or a PTEN expression vector.

NKX3.1 Activates IGFBP-3

www.aacrjournals.org 2619 Cancer Res 2009; 69: (6). March 15, 2009

We examined the effect of NKX3.1 expression on the phosphor-ylation of PI3K and its downstream target AKT. PI3K phosphor-ylation was diminished to some degree by expression of NKX3.1 intwo PC-3(NKX3.1) clones (Fig. 4A). AKT phosphorylation was alsodecreased in a PC-3(NKX3.1) clone grown in serum-supplementedmedium that contains IGF-I from FBS (Fig. 4B). We compared theeffects of NKX3.1 expression and PTEN expression in transienttransfection of PC-3 cells and saw comparable degrees of reductionin p-AKT (Fig. 4C).Growth suppression by NKX3.1 is mediated by IGFBP-3.

In vitro growth of the parental and derivative PC-3 cells wasassessed by cell counting over 96 hours. As shown in the top sectionof Table 1, NKX3.1 expression decreased cell proliferation in threeindependent clones. The doubling times for PC-3 cells expressingNKX3.1 ranged from 25% to 60% above the doubling times forcontrol cells. To determine whether this effect of NKX3.1 expressionon cell proliferation was due to IGFBP-3 expression, we performedgrowth experiments in the presence of a siRNA oligonucleotide andcontrol oligonucleotides for IGFBP-3 knockdown (21). IGFBP-3siRNA treatment decreased IGFBP-3 expression at both 24 and96 hours after cells were exposed to the oligonucleotide (Fig. 5A).Growth curves of control and NKX3.1-expressing PC-3 cells weredone in the presence of transfection reagent, missense oligonucle-otide, and IGFBP-3 siRNA. Only the IGFBP-3 siRNA restored PC-3proliferative rate to the level of the controls (Table 1, bottomsection). Thus, IGFBP-3 mediates, at least in part, in vitro growthsuppression by NKX3.1. Consistent with this finding, the IGFBP-3siRNA reversed the suppression of IGF-IR phosphorylation inducedby NKX3.1 (Fig. 5B). IGFBP-3 knockdown was accomplished with asingle IGFBP-3 siRNA oligonucleotide as described in Materials andMethods. Of the 11 sequences tested, only one induced substantialIGFBP-3 knockdown. This one effective siRNA sequence has noidentifiable homology with sequences in other genes, as confirmedby a BLAST search against the entire human genome sequence.

We also performed xenograft experiments wherein PC-3(NKX3.1)clones 1, 2, and 8 and PC-3(cDNA3.1) cells were inoculated intofemaleNCr/nu mice. In every instance, we observed tumor growth ofderivative PC-3 cells (Supplementary Fig. S1). Each tumor type hadlost expression in vivo of the NKX3.1 transgene as shown byimmunohistochemical analysis. Thus, there was a selection in xeno-grafts for loss of NKX3.1 expression, preventing us from observingany growth-suppressive effects of NKX3.1 on PC-3 cells in vivo .

Discussion

NKX3.1 is important for prostate epithelial cell development,growth control, and differentiation (6, 27). Murine Nkx3.1 ishaploinsufficient and loss of a single allele manifests a phenotypesimilar to homozygous deletion, but with longer latency (6). Inearly human prostate cancer, we have found that NKX3.1expression is down-regulated over a broad range, suggesting acomplex effect on the development of human prostate cancer (3).It is important to define the pathways of tumorigenesis that areaffected by NKX3.1. We argue here that expression of IGFBP-3 isdownstream of NKX3.1 and speculate that IGFBP-3 regulates IGF-Iaction in prostate epithelial cells.IGFs are peptide growth factors that bind to the IGF-IR to

regulate cell growth, differentiation, and apoptosis (12). IGFs arepresent in abundance in the circulation and may exert systemicand local effects on cells. Circulating IGF-I is bound mainly toIGFBP-3, one of the most abundant serum proteins (28). AlthoughIGFBP-3 can inhibit the interaction of IGF-I with its receptor at thecellular level, serum IGFBP-3 serves to stabilize circulating IGF-I(29). Serum levels of both proteins vary with age, nutrition, andhormonal status (30). The interaction of serum IGF-I and IGFBP-3and prostate cancer risk has been studied by a number ofinvestigators (29). The majority of studies have found anassociation between higher IGF-I levels and prostate cancer

Table 1. Effect of IGFBP-3 knockdown on cell proliferation

Cell line Treatment Doubling time (h) P

PC-3 None 25.34 F 1.91 NS

PC-3(pcDNA3.1) None 24.26 F 2.05 ReferencePC-3(NKX3.1)-1 None 32.24 F 5.91 0.0037

PC-3(NKX3.1)-2a None 38.88 F 7.82 0.0002

PC-3(NKX3.1)-8 None 30.24 F 2.55 0.002

PC-3(pcDNA3.1) None 23.6 F 2.52 Reference

PC-3(pcDNA3.1) Mock 25.5 F 1.23 NS

PC-3(pcDNA3.1) Missense oligo 24.4 F 1.86 NS

PC-3(pcDNA3.1) IGFBP-3 siRNA oligo 26.4 F 1.40 NSPC-3(NKX3.1)-1 None 32.9 F 1.33 0.0092

PC-3(NKX3.1)-1 Mock 31.7 F 2.49 0.0013

PC-3(NKX3.1)-1 Missense oligo 32.0 F 3.12 0.0022PC-3(NKX3.1)-1 IGFBP-3 siRNA oligo 24.9 F 2.56 NS

NOTE: The cell doubling time, in hours, of parental PC-3 cells, PC-3(pcDNA3.1) cells, and PC-3(NKX3.1) clones was assayed by cell counting. Cells were

counted at 24, 48, 72, and 96 h after seeding and doubling times were calculated. In the bottom section of the table, PC-3(pcDNA3.1) and PC-3(NKX3.1)-1cells were treated with transfection reagent alone, the missense siRNA oligonucleotide, and the IGFBP-3 siRNA oligonucleotide for 24 h before the first

cell count was taken. P values were calculated in comparison with the PC-3(pcDNA3.1) cell doubling time, using ANOVA.

Abbreviation: NS, not significant (P > 0.05).

Cancer Research

Cancer Res 2009; 69: (6). March 15, 2009 2620 www.aacrjournals.org

(31–39). Some investigators have not been able to confirm thesefindings (40–42).NKX3.1 haploinsufficiency affects cell transformation, at least

in part, by downstream effects on transcriptional targets. NKX3.1binds to DNA and suppresses expression of genes downstreamfrom cognate DNA binding sites (19). We have yet to identify apromoter that is transcriptionally activated by direct binding ofNXK3.1 to its cognate DNA -TAAGTA- sequence. In fact, ourexperiments with reporter constructs containing NKX3.1 bindingDNA suggested that NKX3.1 alone cannot initiate assembly of atranscriptional complex (19). NKX3.1 is known to interact withother transcription factors such as serum response factor andserves as a synergistic coactivator of promoters with serumresponse elements such as smooth muscle g-actin (43).Therefore, the effect of NKX3.1 on gene expression is complexand is likely mediated by a number of cofactors. Because otherNK homeodomain protein family members like Nkx2.5 interactwith serum response factor, the physical interaction of NKX3.1and serum response factor has been studied as a model fortranscription factor interactions of NKX3.1. Serum responsefactor is a widely expressed transcription factor involved inorchestrating disparate programs of gene expression linked tomuscle differentiation and cellular growth (44). It is likelythat different targets of transcriptional activation are affected bythe interaction of NKX3.1 with several different transcriptionfactors.We have shown an indirect link between NKX3.1 and

transcription of IGFBP-3 mRNA. In cultured cells with NKX3.1overexpression, we have shown a mechanistic link between NKX3.1,IGFBP-3 expression, IGF-IR activation, and cell proliferation. IGF1-R signaling is complex and affected by many factors that regulateIGF-I availability and intracellular signaling downstream from theIGF-IR. Therefore, the interaction between NKX3.1 and IGFBP-3expression in vivo is likely to be part of a more complex systemregulating the effect of IGF-I on prostate epithelial cells. TheIGFBPs have functions that can compensate for one another,making it difficult to determine specific functions of a single IGF

binding protein by studies of gene-targeted mice (45, 46). Whetherthe same compensatory activation of IGF binding proteins occursin prostate epithelial cells that have reduced NKX3.1 expressionwas not determined.Down-regulation of NKX3.1 protein per se is sufficient to

predispose cells to malignant transformation. In addition, we havedescribed a family in which hereditary prostate cancer cosegre-gated with a T164A missense mutation in the NKX3.1 homeo-domain that reduced DNA binding by 95% (47). Haploinsufficiencyis a reflection of the dominant nature of regulation by NK familymembers. Both missense and truncation mutations in NKX2.5 areautosomal dominant determinants of congenital cardiac abnor-malities (48, 49). Similarly, mutations in NKX2.1/TTF causepulmonary and thyroid developmental abnormalities (50). Para-doxically, NKX2.1 is amplified in a subset of lung cancers andNKX2.1 overexpression contributes to cell transformation andoncogenesis (51). We argue that tumor suppression by NKX3.1 isexerted in a relative manner by modulation of downstream targetsto different degrees. Our finding that IGFBP-3 expression in humanprostate cancer cells correlates quantitatively with NKX3.1expression levels is reminiscent of findings that Nkx3.1 genedosage determines the degree of transcriptional effects in gene-targeted mice (8). Further studies will identify additional NKX3.1targets and elucidate their role in prostate cancer suppression and,perhaps, prevention.

Disclosure of Potential Conflicts of Interest

No potential conflicts of interest were disclosed.

Acknowledgments

Received 8/5/2008; revised 12/30/2008; accepted 12/31/2008; published OnlineFirst3/3/09.

Grant support: National Institute of Environmental Health Sciences grant ES09888(E.P. Gelmann) and Department of Defense grants W81XWH-07-1-0263 (E.P. Gelmann)and PC-05-0590 (E. Muhlbradt).The costs of publication of this article were defrayed in part by the payment of page

charges. This article must therefore be hereby marked advertisement in accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.

Figure 5. IGFBP-3 knockdown in PC-3(NKX3.1) cells. A, RT-PCR analysis of mRNA from PC-3(pcDNA3.1) and PC-3(NKX3.1)-1 cells that were treated withtransfection reagent alone, missense oligo, or the IGFBP-3 siRNA oligo at 24 and 96 h posttransfection. B, Western blot analysis of extracts from PC-3(pcDNA3.1)and PC-3(NKX3.1)-1 cells treated with transfection reagent alone, missense oligo, or the IGFBP-3 siRNA oligo for 96 h, which afterward were serum starved for16 h and treated with 100 pmol/L IGF-I.

NKX3.1 Activates IGFBP-3

www.aacrjournals.org 2621 Cancer Res 2009; 69: (6). March 15, 2009

Cancer Research

Cancer Res 2009; 69: (6). March 15, 2009 2622 www.aacrjournals.org

References

1. Swalwell JI, Vocke CD, Yang Y, et al. Determination ofa minimal deletion interval on chromosome band 8p21in sporadic prostate cancer. Genes ChromosomesCancer 2002;33:201–5.2. Bowen C, Bubendorf L, Voeller HJ, et al. Loss ofNKX3.1 expression in human prostate cancers correlateswith tumor progression. Cancer Res 2000;60:6111–5.3. Asatiani E, Huang WX, Wang A, et al. Deletion,methylation, and expression of the NKX3.1 suppressorgene in primary human prostate cancer. Cancer Res2005;65:1164–73.4. Voeller HJ, Augustus M, Madlike V, et al. Coding regionof NKX3.1, prostate-specific homeobox gene on 8p21, isnot mutated in human prostate cancers. Cancer Res1997;57:4455–9.5. Ornstein DK, Cinquanta M, Weiler S, et al. Expressionstudies and mutational analysis of the androgenregulated homeobox gene nkx3.1 in benign andmalignant prostate epithelium. J Urol 2001;165:1329–34.6. Bhatia-Gaur R, Donjacour AA, Sciavolino PJ, et al.Roles for Nkx3.1 in prostate development and cancer.Genes Dev 1999;13:966–77.7. Kim MJ, Cardiff RD, Desai N, et al. Cooperativity ofNkx3.1 and Pten loss of function in a mouse model ofprostate carcinogenesis. Proc Natl Acad Sci U S A 2002;99:2884–9.8. Magee JA, Abdulkadir SA, Milbrandt J. Haploinsuffi-ciency at the Nkx3.1 locus. A paradigm for stochastic,dosage-sensitive gene regulation during tumor initia-tion. Cancer Cell 2003;3:273–83.9. Bethel CR, Faith D, Li X, et al. Decreased NKX3.1protein expression in focal prostatic atrophy, prostaticintraepithelial neoplasia, and adenocarcinoma: associa-tion with gleason score and chromosome 8p deletion.Cancer Res 2006;66:10683–90.10. Markowski MC, Bowen C, Gelmann EP. Inflammato-ry cytokines induce phosphorylation and ubiquitinationof prostate suppressor protein NKX3.1. Cancer Res 2008;68:6896–901.11. Firth SM, Baxter RC. Cellular actions of the insulin-like growth factor binding proteins. Endocr Rev 2002;23:824–54.12. Khandwala HM, McCutcheon IE, Flyvbjerg A, FriendKE. The effects of insulin-like growth factors ontumorigenesis and neoplastic growth. Endocr Rev2000;21:215–44.13. Cohen P, Graves HC, Peehl DM, et al. Prostate-specific antigen (PSA) is an insulin-like growth factorbinding protein-3 protease found in seminal plasma.J Clin Endocrinol Metab 1992;75:1046–53.14. Koistinen H, Paju A, Koistinen R, et al. Prostate-specific antigen and other prostate-derived proteasescleave IGFBP-3, but prostate cancer is not associatedwith proteolytically cleaved circulating IGFBP-3. Pros-tate 2002;50:112–8.15. Fielder PJ, Rosenfeld RG, Graves HC, et al. Biochem-ical analysis of prostate specific antigen-proteolyzedinsulin-like growth factor binding protein-3. GrowthRegul 1994;4:164–72.16. Cohen P, Peehl DM, Graves HC, Rosenfeld RG.Biological effects of prostate specific antigen as aninsulin-like growth factor binding protein-3 protease.J Endocrinol 1994;142:407–15.17. Hong J, Zhang G, Dong F, Rechler MM. Insulin-likegrowth factor (IGF)-binding protein-3 mutants that donot bind IGF-I or IGF-II stimulate apoptosis in humanprostate cancer cells. J Biol Chem 2002;277:10489–97.18. Rhodes DR, Barrette TR, Rubin MA, Ghosh D,Chinnaiyan AM. Meta-analysis of microarrays: inter-

study validation of gene expression profiles revealspathway dysregulation in prostate cancer. Cancer Res2002;62:4427–33.19. Steadman DJ, Giuffrida D, Gelmann EP. DNA-bindingsequence of the human prostate-specific homeodomainprotein NKX3.1. Nucleic Acids Res 2000;28:2389–95.20. Wu X, Senechal K, Neshat MS, Whang YE, SawyersCL. The PTEN/MMAC1 tumor suppressor phosphatasefunctions as a negative regulator of the phosphoinosi-tide 3-kinase/Akt pathway. Proc Natl Acad Sci U S A1998;95:15587–91.21. Stewart LV, Weigel NL. Role of insulin-like growthfactor binding proteins in 1a,25-dihydroxyvitaminD3-induced growth inhibition of human prostate cancercells. Prostate 2005;64:9–19.22. Kimura G, Kasuya J, Giannini S, et al. Insulin-likegrowth factor (IGF) system components in humanprostatic cancer cell-lines: LNCaP, DU145, and PC-3cells. Int J Urol 1996;3:39–46.23. Walker GE, Wilson EM, Powell D, Oh Y. Butyrate,a histone deacetylase inhibitor, activates the human IGFbinding protein-3 promoter in breast cancer cells:molecular mechanism involves an Sp1/Sp3 multiproteincomplex. Endocrinology 2001;142:3817–27.24. Hernandez-Sanchez C, Blakesley V, Kalebic T,Helman L, LeRoith D. The role of the tyrosine kinasedomain of the insulin-like growth factor-I receptor inintracellular signaling, cellular proliferation, and tumor-igenesis. J Biol Chem 1995;270:29176–81.25. Francis GL, Ross M, Ballard FJ, et al. Novelrecombinant fusion protein analogues of insulin-likegrowth factor (IGF)-I indicate the relative importance ofIGF-binding protein and receptor binding for enhancedbiological potency. J Mol Endocrinol 1992;8:213–23.26. King R, Wells JR, Krieg P, et al. Production andcharacterization of recombinant insulin-like growthfactor-I (IGF-I) and potent analogues of IGF-I, withGly or Arg substituted for Glu3, following theirexpression in Escherichia coli as fusion proteins. J MolEndocrinol 1992;8:29–41.27. Abdulkadir SA, Magee JA, Peters TJ, et al. Conditionalloss of Nkx3.1 in adult mice induces prostatic intra-epithelial neoplasia. Mol Cell Biol 2002;22:1495–503.28. Jones JI, Clemmons DR. Insulin-like growth factorsand their binding proteins: biological actions. EndocrRev 1995;16:3–34.29. Pollak MN, Schernhammer ES, Hankinson SE.Insulin-like growth factors and neoplasia. Nat RevCancer 2004;4:505–18.30. Rajaram S, Baylink DJ, Mohan S. Insulin-like growthfactor-binding proteins in serum and other biologicalfluids: regulation and functions. Endocr Rev 1997;18:801–31.31. Harman SM, Metter EJ, Blackman MR, Landis PK,Carter HB. Serum levels of insulin-like growth factor I(IGF-I), IGF-II, IGF-binding protein-3, and prostate-specific antigen as predictors of clinical prostate cancer.J Clin Endocrinol Metab 2000;85:4258–65.32. Chan JM, Stampfer MJ, Ma J, et al. Insulin-like growthfactor-I (IGF-I) and IGF binding protein-3 as predictorsof advanced-stage prostate cancer. J Natl Cancer Inst2002;94:1099–106.33. Chokkalingam AP, Pollak M, Fillmore CM, et al.Insulin-like growth factors and prostate cancer: apopulation-based case-control study in China. CancerEpidemiol Biomarkers Prev 2001;10:421–7.34. Oliver SE, Gunnell D, Donovan J, et al. Screen-detected prostate cancer and the insulin-like growthfactor axis: results of a population-based case-controlstudy. Int J Cancer 2004;108:887–92.35. Platz EA, Pollak MN, Leitzmann MF, et al. Plasma

insulin-like growth factor-1 and binding protein-3 andsubsequent risk of prostate cancer in the PSA era.Cancer Causes Control 2005;16:255–62.36. Stattin P, Bylund A, Rinaldi S, et al. Plasma insulin-like growth factor-I, insulin-like growth factor-bindingproteins, and prostate cancer risk: a prospective study.J Natl Cancer Inst 2000;92:1910–7.37. Stattin P, Rinaldi S, Biessy C, et al. High levels ofcirculating insulin-like growth factor-I increase prostatecancer risk: a prospective study in a population-basednonscreened cohort. J Clin Oncol 2004;22:3104–12.38. Li L, Yu H, Schumacher F, Casey G, Witte JS. Relationof serum insulin-like growth factor-I (IGF-I) and IGFbinding protein-3 to risk of prostate cancer (UnitedStates). Cancer Causes Control 2003;14:721–6.39. Wolk A, Mantzoros CS, Andersson SO, et al. Insulin-like growth factor 1 and prostate cancer risk: apopulation-based, case-control study. J Natl Cancer Inst1998;90:911–5.40. Janssen JA, Wildhagen MF, Ito K, et al. Circulatingfree insulin-like growth factor (IGF)-I, total IGF-I, andIGF binding protein-3 levels do not predict the futurerisk to develop prostate cancer: results of a case-controlstudy involving 201 patients within a population-basedscreening with a 4-year interval. J Clin Endocrinol Metab2004;89:4391–6.41. Woodson K, Tangrea JA, Pollak M, et al. Seruminsulin-like growth factor I: tumor marker or etiologicfactor? A prospective study of prostate cancer amongFinnish men. Cancer Res 2003;63:3991–4.42. Chen C, Lewis SK, Voigt L, et al. Prostate carcinomaincidence in relation to prediagnostic circulating levelsof insulin-like growth factor I, insulin-like growth factorbinding protein 3, and insulin. Cancer 2005;103:76–84.43. Carson JA, Fillmore RA, Schwartz RJ, Zimmer WE.The smooth muscle g-actin gene promoter is amolecular target for the mouse bagpipe homologue,mNkx3-1, and serum response factor. J Biol Chem 2000;275:39061–72.44. Miano JM. Serum response factor: toggling betweendisparate programs of gene expression. J Mol CellCardiol 2003;35:577–93.45. Ning Y, Schuller AG, Bradshaw S, et al. Diminishedgrowth and enhanced glucose metabolism in tripleknockout mice containing mutations of insulin-likegrowth factor binding protein-3, -4, and -5. MolEndocrinol 2006;20:2173–86.46. Wood TL, Rogler LE, Czick ME, Schuller AGP,Pintar JE. Selective alterations in organ sizes in micewith a targeted disruption of the insulin-like growthfactor binding protein-2 gene. Mol Endocrinol 2000;14:1472–82.47. Zheng SL, Ju JH, Chang BL, et al. Germ-line mutationof NKX3.1 cosegregates with hereditary prostate cancerand alters the homeodomain structure and function.Cancer Res 2006;66:69–77.48. Benson DW, Silberbach GM, Kavanaugh-McHugh A,et al. Mutations in the cardiac transcription factorNKX2.5 affect diverse cardiac developmental pathways.J Clin Invest 1999;104:1567–73.49. Kasahara H, Lee B, Schott JJ, et al. Loss of functionand inhibitory effects of human CSX/NKX2.5 homeo-protein mutations associated with congenital heartdisease. J Clin Invest 2000;106:299–308.50. Iwatani N, Mabe H, Devriendt K, Kodama M, Miike T.Deletion of NKX2.1 gene encoding thyroid transcriptionfactor-1 in two siblings with hypothyroidism andrespiratory failure. J Pediatr 2000;137:272–6.51. Weir BA, Woo MS, Getz G, et al. Characterizing thecancer genome in lung adenocarcinoma. Nature 2007;450:893–8.

Supplementary Table 1 siRNA Oligonucleotide Sequences not Used for IGFBP-3 Knockdown

siRNA Sequence nucleotides SourceGCUACAAAGUUGACUACGA 686-704 ON-TARGET Plus SMART pool sequences GAAAUGCUAGUGAGUCGGA 536-554 ON-TARGET Plus SMART pool sequences GCACAGAUACCCAGAACUU 713-731 ON-TARGET Plus SMART pool sequences GAAUAUGGUCCCUGCCGUA 757-775 ON-TARGET Plus SMART pool sequences UAUCGAGAAUAGGAAAACC 1427-1445 siDESIGN center GCAGCCUCUCCCAGGCUACA 940-958 siDESIGN center GCAUAAGCUCUUUAAAGGCA 1895-1913 siDESIGN center UGCCUGGAUUCCACAGCUU 44-62 siDESIGN center AAGCAGCGTGCCCCGGUUG 106-124 siDESIGN center AAAGGCAAAGCUUUAUUUU 1908-1926 siDESIGN center

Oligonucleotide sequences used for siRNA oligonucleotides tested to induce IGFBP-3

knockdown. Sequences 1-4 were from ON-TARGET Plus SMART pool sequences (Cat.

# L-004777-00-0005, Dharmacon, Lafayette, CO). Sequences 5-10 were generated in our

laboratory using the siDESIGN center from the Dharmacon website

(www.dharmacon.com) by inputting the Genbank accession number NM_000598

(IGFBP-3).

Supplementary Table 2

Transcripts Activated by NKX3.1 in PC-3 Cells

PC-3 cells were stably transfected with the pcDNA3.1 empty vector or NKX3.1 expression vector and mRNA from two clones of each

cell type was isolated for microarray analysis on the Affymetrix U-133 expression array. Analyses of results from each pair of clones

of the same genotype that did not match up were discarded to ensure clonal variation was not a factor. 984 genes were found to be up-

or down-regulated more that 1.4 fold in the NKX3.1 expressing PC-3 cells, in comparison to the PC-3 control cells. The 6th and 9th

most activated probe sets were for human growth hormone-dependent insulin-like growth factor-binding protein, now known as

IGFBP-3.

Supplementary Table 2 NAME Fold Change Description 204081_at

17.93 gb:NM_006176.1 /DEF=Homo sapiens neurogranin (protein kinase C substrate, RC3) (NRGN), mRNA. /FEA=mRNA /GEN=NRGN /PROD=neurogranin /DB_XREF=gi:5453799 /UG=Hs.26944 neurogranin (protein kinase C substrate, RC3) /FL=gb:BC002835.1 gb:U89165.1 gb:NM_006176.1

205067_at 14.79 gb:NM_000576.1 /DEF=Homo sapiens interleukin 1, beta (IL1B), mRNA. /FEA=mRNA /GEN=IL1B /PROD=interleukin 1, beta /DB_XREF=gi:10835144 /UG=Hs.126256 interleukin 1, beta /FL=gb:NM_000576.1 gb:K02770.1 gb:M15330.1 gb:M54933.1

39402_at 11.88 Cluster Incl. M15330:Human interleukin 1-beta (IL1B) mRNA, complete cds /cds=(86,895) /gb=M15330 /gi=186283 /ug=Hs.126256 /len=1497

204953_at 11.53 gb:NM_014841.1 /DEF=Homo sapiens KIAA0656 gene product (KIAA0656), mRNA. /FEA=mRNA /GEN=KIAA0656 /PROD=KIAA0656 gene product /DB_XREF=gi:7662227 /UG=Hs.12477 synaptosomal-associated protein, 91 kDa (mouse) homolog /FL=gb:AB014556.1 gb:NM_014841.1

209372_x_at 10.61 Consensus includes gb:BF971587 /FEA=EST /DB_XREF=gi:12338802 /DB_XREF=est:602239834F1 /CLONE=IMAGE:4328385 /UG=Hs.179661 tubulin, beta polypeptide /FL=gb:BC001352.1

210095_s_at 10.23 gb:M31159.1 /DEF=Human growth hormone-dependent insulin-like growth factor-binding protein mRNA, complete cds. /FEA=mRNA /GEN=IGFBP1 /DB_XREF=gi:183115 /UG=Hs.77326 insulin-like growth factor binding protein 3 /FL=gb:BC000013.1 gb:M31159.1

207714_s_at 9.61 gb:NM_004353.1 /DEF=Homo sapiens serine (or cysteine) proteinase inhibitor, clade H (heat shock protein 47), member 1 (SERPINH1), mRNA. /FEA=mRNA /GEN=SERPINH1 /PROD=serine (or cysteine) proteinase inhibitor, cladeH (heat shock protein 47), member 1 /DB_XREF=gi:4757923 /UG=Hs.241579 serine (or cysteine) proteinase inhibitor, clade H (heat shock protein 47), member 1 /FL=gb:NM_004353.1

208581_x_at 9.26 gb:NM_005952.1 /DEF=Homo sapiens metallothionein 1X (MT1X), mRNA. /FEA=CDS /GEN=MT1X /PROD=metallothionein 1X /DB_XREF=gi:10835231 /UG=Hs.278462 metallothionein 1X /FL=gb:NM_005952.1

212143_s_at 9.22 Consensus includes gb:BF340228 /FEA=EST /DB_XREF=gi:11286690 /DB_XREF=est:602036816F1 /CLONE=IMAGE:4185050 /UG=Hs.77326 insulin-like growth factor binding protein 3 /FL=gb:NM_000598.1

204614_at 9.18 gb:NM_002575.1 /DEF=Homo sapiens serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 2 (SERPINB2), mRNA. /FEA=mRNA /GEN=SERPINB2 /PROD=serine (or cysteine) proteinase inhibitor, cladeB (ovalbumin), member 2 /DB_XREF=gi:4505594 /UG=Hs.75716 serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 2 /FL=gb:J02685.1 gb:J03603.1 gb:M18082.1 gb:NM_002575.1

209118_s_at 8.33 gb:AF141347.1 /DEF=Homo sapiens hum-a-tub2 alpha-tubulin mRNA, complete cds. /FEA=mRNA /PROD=alpha-tubulin /DB_XREF=gi:4929133 /UG=Hs.272897 Tubulin, alpha, brain-specific /FL=gb:AF141347.1 gb:NM_006009.1

216971_s_at 7.97 Consensus includes gb:Z54367 /DEF=H.sapiens gene for plectin /FEA=CDS /DB_XREF=gi:1296661 /UG=Hs.79706 plectin 1, intermediate filament binding protein, 500kD

204247_s_at 7.83 gb:NM_004935.1 /DEF=Homo sapiens cyclin-dependent kinase 5 (CDK5), mRNA. /FEA=mRNA /GEN=CDK5 /PROD=cyclin-dependent kinase 5 /DB_XREF=gi:4826674 /UG=Hs.166071 cyclin-dependent kinase 5 /FL=gb:BC005115.1 gb:NM_004935.1

203921_at 7.48 gb:NM_004267.1 /DEF=Homo sapiens carbohydrate (chondroitin 6keratan) sulfotransferase 2 (CHST2), mRNA. /FEA=mRNA /GEN=CHST2 /PROD=carbohydrate (chondroitin 6keratan)sulfotransferase 2 /DB_XREF=gi:4757983 /UG=Hs.8786 carbohydrate (chondroitin 6keratan) sulfotransferase 2 /FL=gb:AB021124.1 gb:AB014679.1 gb:AB014680.1 gb:AF083066.1 gb:NM_004267.1

204222_s_at 7.24 gb:NM_006851.1 /DEF=Homo sapiens glioma pathogenesis-related protein (RTVP1), mRNA. /FEA=mRNA /GEN=RTVP1 /PROD=glioma pathogenesis-related protein /DB_XREF=gi:5803150 /UG=Hs.64639 glioma pathogenesis-related protein /FL=gb:U16307.1 gb:NM_006851.1

209215_at 7.24 gb:L11669.1 /DEF=Human tetracycline transporter-like protein mRNA, complete cds. /FEA=mRNA /PROD=tetracycline transporter-like protein /DB_XREF=gi:307501 /UG=Hs.157145 tetracycline transporter-like protein /FL=gb:L11669.1 gb:NM_001120.1

219140_s_at 7.18 gb:NM_006744.2 /DEF=Homo sapiens retinol-binding protein 4, interstitial (RBP4), mRNA. /FEA=mRNA /GEN=RBP4 /PROD=retinol-binding protein 4, interstitialprecursor /DB_XREF=gi:8400727 /UG=Hs.76461 retinol-binding protein 4, interstitial /FL=gb:AF119868.1 gb:NM_006744.2

222242_s_at 7.13 Consensus includes gb:AF243527 /DEF=Homo sapiens serine protease gene cluster, complete sequence /FEA=CDS_12 /DB_XREF=gi:11244757 /UG=Hs.50915 kallikrein 5

211456_x_at 6.98 gb:AF333388.1 /DEF=Homo sapiens metallothionein 1H-like protein mRNA, complete cds. /FEA=mRNA /PROD=metallothionein 1H-like protein /DB_XREF=gi:13310411 /UG=Hs.326774 Homo sapiens metallothionein 1H-like protein mRNA, complete cds /FL=gb:AF333388.1

219922_s_at 6.91 gb:NM_021070.1 /DEF=Homo sapiens latent transforming growth factor beta binding protein 3 (LTBP3), mRNA. /FEA=mRNA /GEN=LTBP3 /PROD=latent transforming growth factor beta bindingprotein 3 /DB_XREF=gi:10835104 /UG=Hs.289019 latent transforming growth factor beta binding protein 3 /FL=gb:NM_021070.1 gb:AF135960.2

201739_at 6.84 gb:NM_005627.1 /DEF=Homo sapiens serumglucocorticoid regulated kinase (SGK), mRNA. /FEA=mRNA /GEN=SGK /PROD=serumglucocorticoid regulated kinase /DB_XREF=gi:5032090 /UG=Hs.296323 serumglucocorticoid regulated kinase /FL=gb:BC001263.1 gb:NM_005627.1 gb:AF153609.1

206026_s_at 6.74 gb:NM_007115.1 /DEF=Homo sapiens tumor necrosis factor, alpha-induced protein 6 (TNFAIP6), mRNA. /FEA=mRNA /GEN=TNFAIP6 /PROD=tumor necrosis factor, alpha-induced protein 6 /DB_XREF=gi:6005905 /UG=Hs.29352 tumor necrosis factor, alpha-induced protein 6 /FL=gb:NM_007115.1

221972_s_at 6.72 Consensus includes gb:AL571362 /FEA=EST /DB_XREF=gi:12928582 /DB_XREF=est:AL571362 /CLONE=CS0DI009YD14 (3 prime) /UG=Hs.42806 calcium binding protein Cab45 precursor,

204115_at 6.52 gb:NM_004126.1 /DEF=Homo sapiens guanine nucleotide binding protein 11 (GNG11), mRNA. /FEA=mRNA /GEN=GNG11 /PROD=guanine nucleotide binding protein 11 /DB_XREF=gi:4758447 /UG=Hs.83381 guanine nucleotide binding protein 11 /FL=gb:NM_004126.1 gb:U31384.1

213887_s_at 6.27 Consensus includes gb:AI554759 /FEA=EST /DB_XREF=gi:4487122 /DB_XREF=est:tn30e02.x1 /CLONE=IMAGE:2169146 /UG=Hs.24301 polymerase (RNA) II (DNA directed) polypeptide E (25kD)

215617_at 6.11 Consensus includes gb:AU145711 /FEA=EST /DB_XREF=gi:11007232 /DB_XREF=est:AU145711 /CLONE=HEMBA1005588 /UG=Hs.301006 Homo sapiens cDNA FLJ11754 fis, clone HEMBA1005588

221521_s_at 6.03 gb:BC003186.1 /DEF=Homo sapiens, HSPC037 protein, clone MGC:673, mRNA, complete cds. /FEA=mRNA /PROD=HSPC037 protein /DB_XREF=gi:13112024 /UG=Hs.108196 HSPC037 protein /FL=gb:BC003186.1 gb:AF201939.1

210792_x_at 5.96 gb:AF033111.1 /DEF=Homo sapiens Siva-2 mRNA, complete cds. /FEA=mRNA /PROD=Siva-2 /DB_XREF=gi:5737690 /UG=Hs.112058 CD27-binding (Siva) protein /FL=gb:NM_021709.1 gb:AF033111.1

216080_s_at 5.79 Consensus includes gb:AC004770 /DEF=Homo sapiens chromosome 11, BAC CIT-HSP-311e8 (BC269730) containing the hFEN1 gene /FEA=CDS_3 /DB_XREF=gi:3212836 /UG=Hs.21765 fatty acid desaturase 3

204733_at 5.74 gb:NM_002774.1 /DEF=Homo sapiens kallikrein 6 (neurosin, zyme) (KLK6), mRNA. /FEA=mRNA /GEN=KLK6 /PROD=kallikrein 6 (neurosin, zyme) /DB_XREF=gi:4506154 /UG=Hs.79361 kallikrein 6 (neurosin, zyme) /FL=gb:U62801.1 gb:D78203.1 gb:AF013988.1 gb:NM_002774.1

209278_s_at 5.65 gb:L27624.1 /DEF=Homo sapiens tissue factor pathway inhibitor-2 mRNA, complete cds. /FEA=mRNA /PROD=tissue factor pathway inhibitor-2 /DB_XREF=gi:441149 /UG=Hs.295944 tissue factor pathway inhibitor 2 /FL=gb:BC005330.1 gb:L27624.1 gb:D29992.1 gb:NM_006528.1

204326_x_at 5.64 gb:NM_002450.1 /DEF=Homo sapiens metallothionein 1L (MT1L), mRNA. /FEA=mRNA /GEN=MT1L /PROD=metallothionein 1L /DB_XREF=gi:4505270 /UG=Hs.94360 metallothionein 1L /FL=gb:NM_002450.1

215646_s_at 5.54 Consensus includes gb:R94644 /FEA=EST /DB_XREF=gi:970039 /DB_XREF=est:yq42a12.r1 /CLONE=IMAGE:198430 /UG=Hs.306542 Homo sapiens versican Vint isoform, mRNA, partial cds

217165_x_at 5.5 Consensus includes gb:M10943 /DEF=Human metallothionein-If gene (hMT-If) /FEA=CDS /DB_XREF=gi:187540 /UG=Hs.203936 metallothionein 1F (functional)

204748_at 5.49 gb:NM_000963.1 /DEF=Homo sapiens prostaglandin-endoperoxide synthase 2 (prostaglandin GH synthase and cyclooxygenase) (PTGS2), mRNA. /FEA=mRNA /GEN=PTGS2 /PROD=prostaglandin-endoperoxide synthase 2(prostaglandin GH synthase and cyclooxygenase) /DB_XREF=gi:4506264 /UG=Hs.196384 prostaglandin-endoperoxide synthase 2 (prostaglandin GH synthase and cyclooxygenase) /FL=gb:M90100.1 gb:L15326.1 gb:NM_000963.1

221731_x_at 5.48 Consensus includes gb:BF218922 /FEA=EST /DB_XREF=gi:11112418 /DB_XREF=est:601885091F1 /CLONE=IMAGE:4103447 /UG=Hs.81800 chondroitin sulfate proteoglycan 2 (versican)

204932_at 5.45 Consensus includes gb:BF433902 /FEA=EST /DB_XREF=gi:11446030 /DB_XREF=est:7q56c10.x1 /CLONE=IMAGE:3702163 /UG=Hs.81791 tumor necrosis factor receptor superfamily, member 11b (osteoprotegerin) /FL=gb:U94332.1 gb:AB002146.1 gb:NM_002546.1

212764_at 5.43 Consensus includes gb:AI806174 /FEA=EST /DB_XREF=gi:5392740 /DB_XREF=est:wf06h03.x1 /CLONE=IMAGE:2349845 /UG=Hs.232068 transcription factor 8 (represses interleukin 2 expression)

208960_s_at 5.42 Consensus includes gb:BE675435 /FEA=EST /DB_XREF=gi:10035976 /DB_XREF=est:7f09a11.x1 /CLONE=IMAGE:3294140 /UG=Hs.285313 core promoter element binding protein /FL=gb:BC000311.1 gb:BC004301.1 gb:AF001461.1 gb:AB017493.1 gb:NM_001300.2

212185_x_at 5.26 Consensus includes gb:NM_005953.1 /DEF=Homo sapiens metallothionein 2A (MT2A), mRNA. /FEA=CDS /GEN=MT2A /PROD=metallothionein 2A /DB_XREF=gi:5174763 /UG=Hs.118786 metallothionein 2A /FL=gb:NM_005953.1

204620_s_at 5.26 gb:NM_004385.1 /DEF=Homo sapiens chondroitin sulfate proteoglycan 2 (versican) (CSPG2), mRNA. /FEA=mRNA /GEN=CSPG2 /PROD=chondroitin sulfate proteoglycan 2 (versican) /DB_XREF=gi:4758081 /UG=Hs.81800 chondroitin sulfate proteoglycan 2 (versican) /FL=gb:NM_004385.1

218585_s_at 5.12 gb:NM_016448.1 /DEF=Homo sapiens L2DTL protein (L2DTL), mRNA. /FEA=mRNA /GEN=L2DTL /PROD=L2DTL protein /DB_XREF=gi:7705575 /UG=Hs.126774 L2DTL protein /FL=gb:AF195765.1 gb:NM_016448.1

202855_s_at 5 Consensus includes gb:AL513917 /FEA=EST /DB_XREF=gi:12777411 /DB_XREF=est:AL513917 /CLONE=CL0BA006ZD09 (3 prime) /UG=Hs.85838 solute carrier family 16 (monocarboxylic acid transporters), member 3 /FL=gb:U81800.1 gb:NM_004207.1

204584_at 4.99 Consensus includes gb:AI653981 /FEA=EST /DB_XREF=gi:4737960 /DB_XREF=est:ty04c03.x1 /CLONE=IMAGE:2278084 /UG=Hs.1757 L1 cell adhesion molecule (hydrocephalus, stenosis of aqueduct of Sylvius 1, MASA (mental retardation, aphasia, shuffling gait and adducted thumbs) syndrome, spastic paraplegia 1) /FL=gb:NM_024003.1 gb:NM_000425.2 gb:M77640.1 gb:M74387.1

204775_at 4.98 gb:NM_005441.1 /DEF=Homo sapiens chromatin assembly factor 1, subunit B (p60) (CHAF1B), mRNA. /FEA=mRNA /GEN=CHAF1B /PROD=chromatin assembly factor 1, subunit B (p60) /DB_XREF=gi:4885104 /UG=Hs.75238 chromatin assembly factor 1, subunit B (p60) /FL=gb:NM_005441.1 gb:U20980.1

202779_s_at 4.95 gb:NM_014501.1 /DEF=Homo sapiens ubiquitin carrier protein (E2-EPF), mRNA. /FEA=mRNA /GEN=E2-EPF

/PROD=ubiquitin carrier protein /DB_XREF=gi:7657045 /UG=Hs.174070 ubiquitin carrier protein /FL=gb:M91670.1 gb:NM_014501.1

206461_x_at 4.84 gb:NM_005951.1 /DEF=Homo sapiens metallothionein 1H (MT1H), mRNA. /FEA=mRNA /GEN=MT1H /PROD=metallothionein 1H /DB_XREF=gi:10835084 /UG=Hs.2667 metallothionein 1H /FL=gb:NM_005951.1

204338_s_at 4.8 gb:NM_005613.2 /DEF=Homo sapiens regulator of G-protein signalling 4 (RGS4), mRNA. /FEA=mRNA /GEN=RGS4 /PROD=regulator of G-protein signaling 4 /DB_XREF=gi:11184227 /UG=Hs.227571 regulator of G-protein signalling 4 /FL=gb:NM_005613.2 gb:BC000737.1

222155_s_at 4.77 Consensus includes gb:AK021918.1 /DEF=Homo sapiens cDNA FLJ11856 fis, clone HEMBA1006789. /FEA=mRNA /DB_XREF=gi:10433214 /UG=Hs.6459 hypothetical protein FLJ11856

214974_x_at 4.75 Consensus includes gb:AK026546.1 /DEF=Homo sapiens cDNA: FLJ22893 fis, clone KAT04792. /FEA=mRNA /DB_XREF=gi:10439427 /UG=Hs.287716 Homo sapiens cDNA: FLJ22893 fis, clone KAT04792

219691_at 4.74 gb:NM_017654.1 /DEF=Homo sapiens hypothetical protein FLJ20073 (FLJ20073), mRNA. /FEA=mRNA /GEN=FLJ20073 /PROD=hypothetical protein FLJ20073 /DB_XREF=gi:8923080 /UG=Hs.65641 hypothetical protein FLJ20073 /FL=gb:NM_017654.1

202326_at 4.69 gb:NM_006709.1 /DEF=Homo sapiens ankyrin repeat-containing protein (G9A), mRNA. /FEA=mRNA /GEN=G9A /PROD=ankyrin repeat-containing protein /DB_XREF=gi:5729833 /UG=Hs.75196 ankyrin repeat-containing protein /FL=gb:BC002686.1 gb:NM_006709.1

204306_s_at 4.68 gb:NM_004357.1 /DEF=Homo sapiens CD151 antigen (CD151), mRNA. /FEA=mRNA /GEN=CD151 /PROD=CD151 antigen /DB_XREF=gi:4757941 /UG=Hs.75564 CD151 antigen /FL=gb:BC001374.1 gb:D29963.1 gb:NM_004357.1 gb:U14650.1

219491_at 4.57 gb:NM_024036.1 /DEF=Homo sapiens hypothetical protein MGC3103 (MGC3103), mRNA. /FEA=mRNA /GEN=MGC3103 /PROD=hypothetical protein MGC3103 /DB_XREF=gi:13128987 /UG=Hs.115960 hypothetical protein MGC3103 /FL=gb:BC000207.1 gb:NM_024036.1

208394_x_at 4.56 gb:NM_007036.2 /DEF=Homo sapiens endothelial cell-specific molecule 1 (ESM1), mRNA. /FEA=mRNA /GEN=ESM1 /PROD=endothelial cell-specific molecule 1 precursor /DB_XREF=gi:13259505 /UG=Hs.41716 endothelial cell-specific molecule 1 /FL=gb:NM_007036.2

214240_at 4.52 Consensus includes gb:AL556409 /FEA=EST /DB_XREF=gi:12899058 /DB_XREF=est:AL556409 /CLONE=CS0DK004YA08 (5 prime) /UG=Hs.1907 galanin

212242_at 4.5 Consensus includes gb:AL565074 /FEA=EST /DB_XREF=gi:12916087 /DB_XREF=est:AL565074 /CLONE=CS0DN003YF20 (3 prime) /UG=Hs.75318 tubulin, alpha 1 (testis specific)

204441_s_at 4.5 gb:NM_002689.1 /DEF=Homo sapiens polymerase (DNA-directed), alpha (70kD) (POLA2), mRNA. /FEA=mRNA /GEN=POLA2 /PROD=polymerase (DNA-directed), alpha (70kD) /DB_XREF=gi:4505928 /UG=Hs.81942 polymerase (DNA-directed), alpha (70kD) /FL=gb:BC001347.1 gb:BC002990.1 gb:L24559.1 gb:NM_002689.1

201373_at 4.5 gb:NM_000445.1 /DEF=Homo sapiens plectin 1, intermediate filament binding protein, 500kD (PLEC1), mRNA. /FEA=mRNA /GEN=PLEC1 /PROD=plectin 1, intermediate filament bindingprotein, 500kD /DB_XREF=gi:4505876 /UG=Hs.79706 plectin 1, intermediate filament binding protein, 500kD /FL=gb:U53204.1 gb:NM_000445.1

204597_x_at 4.46 gb:NM_003155.1 /DEF=Homo sapiens stanniocalcin 1 (STC1), mRNA. /FEA=mRNA /GEN=STC1 /PROD=stanniocalcin 1 /DB_XREF=gi:4507264 /UG=Hs.25590 stanniocalcin 1 /FL=gb:U46768.1 gb:U25997.1 gb:NM_003155.1

203680_at 4.42 gb:NM_002736.1 /DEF=Homo sapiens protein kinase, cAMP-dependent, regulatory, type II, beta (PRKAR2B), mRNA. /FEA=mRNA /GEN=PRKAR2B /PROD=protein kinase, cAMP-dependent, regulatory, typeII, beta /DB_XREF=gi:4506064 /UG=Hs.77439 protein kinase, cAMP-dependent, regulatory, type II, beta /FL=gb:M31158.1 gb:NM_002736.1

218332_at 4.41 gb:NM_018476.1 /DEF=Homo sapiens uncharacterized hypothalamus protein HBEX2 (HBEX2), mRNA. /FEA=mRNA /GEN=HBEX2 /PROD=uncharacterized hypothalamus protein HBEX2 /DB_XREF=gi:8923715 /UG=Hs.283719 uncharacterized hypothalamus protein HBEX2 /FL=gb:AF220189.1 gb:NM_018476.1 gb:AF183416.1 gb:AF237783.1

216250_s_at 4.39 Consensus includes gb:X77598.1 /DEF=H.sapiens LAM A3 mRNA for laminin alpha 3 chain. /FEA=mRNA /DB_XREF=gi:9716101 /UG=Hs.83450 laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)

202917_s_at 4.38 gb:NM_002964.2 /DEF=Homo sapiens S100 calcium-binding protein A8 (calgranulin A) (S100A8), mRNA. /FEA=mRNA /GEN=S100A8 /PROD=S100 calcium-binding protein A8 /DB_XREF=gi:9845519 /UG=Hs.100000 S100 calcium-binding protein A8 (calgranulin A) /FL=gb:NM_002964.2

209126_x_at 4.37 gb:L42612.1 /DEF=Homo sapiens keratin 6 isoform K6f (KRT6F) mRNA, complete cds. /FEA=mRNA /GEN=KRT6F /PROD=keratin type II /DB_XREF=gi:908804 /UG=Hs.111758 keratin 6A /FL=gb:NM_005554.1 gb:L42611.1 gb:L42612.1

217716_s_at 4.35 gb:NM_013336.1 /DEF=Homo sapiens sec61 homolog (HSEC61), mRNA. /FEA=mRNA /GEN=HSEC61 /PROD=sec61 homolog /DB_XREF=gi:7019414 /UG=Hs.306079 sec61 homolog /FL=gb:BC002951.1 gb:AF346602.1 gb:AF084458.1 gb:NM_013336.1

217854_s_at 4.23 gb:NM_002695.1 /DEF=Homo sapiens polymerase (RNA) II (DNA directed) polypeptide E (25kD) (POLR2E), mRNA. /FEA=mRNA /GEN=POLR2E /PROD=polymerase (RNA) II (DNA directed) polypeptide E(25kD) /DB_XREF=gi:4505944 /UG=Hs.24301 polymerase (RNA) II (DNA directed) polypeptide E (25kD) /FL=gb:BC004441.1 gb:NM_002695.1 gb:J04965.1 gb:D38251.1

212141_at 4.16 Consensus includes gb:AA604621 /FEA=EST /DB_XREF=gi:2445485 /DB_XREF=est:no84b08.s1 /CLONE=IMAGE:1113495 /UG=Hs.154443 minichromosome maintenance deficient (S. cerevisiae) 4

213746_s_at 4.14 Consensus includes gb:AW051856 /FEA=EST /DB_XREF=gi:5914215 /DB_XREF=est:wz04a05.x1 /CLONE=IMAGE:2557040 /UG=Hs.195464 filamin A, alpha (actin-binding protein-280)

208750_s_at 4.14 Consensus includes gb:AA580004 /FEA=EST /DB_XREF=gi:2355331 /DB_XREF=est:nl79c05.s1 /CLONE=IMAGE:1056872 /UG=Hs.74571 ADP-ribosylation factor 1 /FL=gb:M84326.1 gb:M36340.1 gb:AF055002.1 gb:AF052179.1 gb:NM_001658.2

204745_x_at 4.14 gb:NM_005950.1 /DEF=Homo sapiens metallothionein 1G (MT1G), mRNA. /FEA=mRNA /GEN=MT1G /PROD=metallothionein 1G /DB_XREF=gi:10835229 /UG=Hs.173451 metallothionein 1G /FL=gb:NM_005950.1

201508_at 4.12 gb:NM_001552.1 /DEF=Homo sapiens insulin-like growth factor-binding protein 4 (IGFBP4), mRNA. /FEA=mRNA /GEN=IGFBP4 /PROD=insulin-like growth factor-binding protein 4 /DB_XREF=gi:10835020 /UG=Hs.1516 insulin-like growth factor-binding protein 4 /FL=gb:NM_001552.1 gb:M62403.1

213680_at 4.12 Consensus includes gb:AI831452 /FEA=EST /DB_XREF=gi:5452123 /DB_XREF=est:wj49b03.x1 /CLONE=IMAGE:2406125 /UG=Hs.111758 keratin 6A

209589_s_at 4.1 gb:AF025304.1 /DEF=Homo sapiens protein-tyrosine kinase EPHB2v (EPHB2) mRNA, complete cds. /FEA=mRNA /GEN=EPHB2 /PROD=protein-tyrosine kinase EPHB2v /DB_XREF=gi:2739055 /UG=Hs.125124 EphB2 /FL=gb:AF025304.1

201482_at 4.08 gb:NM_002826.2 /DEF=Homo sapiens quiescin Q6 (QSCN6), mRNA. /FEA=mRNA /GEN=QSCN6 /PROD=quiescin Q6 /DB_XREF=gi:13325074 /UG=Hs.77266 quiescin Q6 /FL=gb:L42379.1 gb:U97276.2 gb:NM_002826.2

202338_at 4.01 gb:NM_003258.1 /DEF=Homo sapiens thymidine kinase 1, soluble (TK1), mRNA. /FEA=mRNA /GEN=TK1 /PROD=thymidine kinase 1, soluble /DB_XREF=gi:4507518 /UG=Hs.105097 thymidine kinase 1, soluble /FL=gb:K02581.1 gb:NM_003258.1

222162_s_at 3.99 Consensus includes gb:AK023795.1 /DEF=Homo sapiens cDNA FLJ13733 fis, clone PLACE3000147, highly

similar to Homo sapiens metalloproteinase with thrombospondin type 1 motifs ADAMTS1 (ADAMTS1) mRNA. /FEA=mRNA /DB_XREF=gi:10435838 /UG=Hs.8230 a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 1

204070_at 3.91 gb:NM_004585.2 /DEF=Homo sapiens retinoic acid receptor responder (tazarotene induced) 3 (RARRES3), mRNA. /FEA=mRNA /GEN=RARRES3 /PROD=retinoic acid receptor responder (tazaroteneinduced) 3 /DB_XREF=gi:8051633 /UG=Hs.17466 retinoic acid receptor responder (tazarotene induced) 3 /FL=gb:AF060228.1 gb:AF092922.1 gb:NM_004585.2 gb:AB030815.1

204595_s_at 3.89 Consensus includes gb:AI300520 /FEA=EST /DB_XREF=gi:3959866 /DB_XREF=est:qn55e06.x1 /CLONE=IMAGE:1902178 /UG=Hs.25590 stanniocalcin 1 /FL=gb:U46768.1 gb:U25997.1 gb:NM_003155.1

32209_at 3.89 Cluster Incl. AF052151:Homo sapiens clone 24574 mRNA sequence /cds=UNKNOWN /gb=AF052151 /gi=3360461 /ug=Hs.18686 /len=1337

202856_s_at 3.88 gb:NM_004207.1 /DEF=Homo sapiens solute carrier family 16 (monocarboxylic acid transporters), member 3 (SLC16A3), mRNA. /FEA=mRNA /GEN=SLC16A3 /PROD=solute carrier family 16 (monocarboxylic acidtransporters), member 3 /DB_XREF=gi:4759111 /UG=Hs.85838 solute carrier family 16 (monocarboxylic acid transporters), member 3 /FL=gb:U81800.1 gb:NM_004207.1

202154_x_at 3.88 gb:NM_006086.1 /DEF=Homo sapiens tubulin, beta, 4 (TUBB4), mRNA. /FEA=mRNA /GEN=TUBB4 /PROD=tubulin, beta, 4 /DB_XREF=gi:5174736 /UG=Hs.159154 tubulin, beta, 4 /FL=gb:BC000748.1 gb:U47634.1 gb:NM_006086.1

208937_s_at 3.86 gb:D13889.1 /DEF=Human mRNA for Id-1H, complete cds. /FEA=mRNA /GEN=Id-1H /PROD=Id-1H /DB_XREF=gi:464181 /UG=Hs.75424 inhibitor of DNA binding 1, dominant negative helix-loop-helix protein /FL=gb:BC000613.1 gb:NM_002165.1 gb:D13889.1

203851_at 3.85 gb:NM_002178.1 /DEF=Homo sapiens insulin-like growth factor binding protein 6 (IGFBP6), mRNA. /FEA=mRNA /GEN=IGFBP6 /PROD=insulin-like growth factor binding protein 6 /DB_XREF=gi:11321592 /UG=Hs.274313 insulin-like growth factor binding protein 6 /FL=gb:NM_002178.1 gb:BC003507.1 gb:BC005007.1 gb:M62402.1

212551_at 3.84 Consensus includes gb:NM_006366.1 /DEF=Homo sapiens adenylyl cyclase-associated protein 2 (CAP2), mRNA. /FEA=CDS /GEN=CAP2 /PROD=adenylyl cyclase-associated protein 2 /DB_XREF=gi:5453592 /UG=Hs.296341 adenylyl cyclase-associated protein 2 /FL=gb:U02390.1 gb:NM_006366.1

201841_s_at 3.82 gb:NM_001540.2 /DEF=Homo sapiens heat shock 27kD protein 1 (HSPB1), mRNA. /FEA=mRNA /GEN=HSPB1 /PROD=heat shock 27kD protein 1 /DB_XREF=gi:4996892 /UG=Hs.76067 heat shock 27kD protein 1 /FL=gb:AB020027.1 gb:BC000510.1 gb:U90906.1 gb:NM_001540.2

203137_at 3.81 gb:NM_004906.1 /DEF=Homo sapiens Wilms tumour 1-associating protein (KIAA0105), mRNA. /FEA=mRNA /GEN=KIAA0105 /PROD=Wilms tumour 1-associating protein /DB_XREF=gi:4758635 /UG=Hs.119 Wilms tumour 1-associating protein /FL=gb:AF277190.1 gb:D14661.1 gb:NM_004906.1

200859_x_at 3.8 gb:NM_001456.1 /DEF=Homo sapiens filamin A, alpha (actin-binding protein-280) (FLNA), mRNA. /FEA=mRNA /GEN=FLNA /PROD=filamin 1 (actin-binding protein-280) /DB_XREF=gi:4503744 /UG=Hs.195464 filamin A, alpha (actin-binding protein-280) /FL=gb:NM_001456.1

203489_at 3.79 gb:NM_006427.2 /DEF=Homo sapiens CD27-binding (Siva) protein (SIVA), transcript variant 1, mRNA. /FEA=mRNA /GEN=SIVA /PROD=CD27-binding (Siva) protein isoform 1 /DB_XREF=gi:11277467 /UG=Hs.112058 CD27-binding (Siva) protein /FL=gb:NM_006427.2 gb:U82938.1

211501_s_at 3.77 gb:BC001173.1 /DEF=Homo sapiens, eukaryotic translation initiation factor 3, subunit 9 (eta, 116kD), clone MGC:2051, mRNA, complete cds. /FEA=mRNA /PROD=eukaryotic translation initiation factor 3,subunit 9 (eta, 116kD) /DB_XREF=gi:12654668 /UG=Hs.57783 eukaryotic translation initiation factor 3, subunit 9 (eta, 116kD) /FL=gb:BC001173.1

215223_s_at 3.76 Consensus includes gb:W46388 /FEA=EST /DB_XREF=gi:1331076 /DB_XREF=est:zc32c08.s1 /CLONE=IMAGE:324014 /UG=Hs.318885 superoxide dismutase 2, mitochondrial

209773_s_at 3.75 gb:BC001886.1 /DEF=Homo sapiens, ribonucleotide reductase M2 polypeptide, clone MGC:1551, mRNA, complete cds. /FEA=mRNA /PROD=ribonucleotide reductase M2 polypeptide /DB_XREF=gi:12804874 /UG=Hs.75319 ribonucleotide reductase M2 polypeptide /FL=gb:BC001886.1

203889_at 3.74 gb:NM_003020.1 /DEF=Homo sapiens secretory granule, neuroendocrine protein 1 (7B2 protein) (SGNE1), mRNA. /FEA=mRNA /GEN=SGNE1 /PROD=secretory granule, neuroendocrine protein 1 (7B2protein) /DB_XREF=gi:4506916 /UG=Hs.2265 secretory granule, neuroendocrine protein 1 (7B2 protein) /FL=gb:BC005349.1 gb:NM_003020.1

213524_s_at 3.74 Consensus includes gb:NM_015714.1 /DEF=Homo sapiens putative lymphocyte G0G1 switch gene (G0S2), mRNA. /FEA=CDS /GEN=G0S2 /PROD=putative lymphocyte G0G1 switch gene /DB_XREF=gi:7657103 /UG=Hs.95910 putative lymphocyte G0G1 switch gene /FL=gb:NM_015714.1

222037_at 3.73 Consensus includes gb:AI859865 /FEA=EST /DB_XREF=gi:5513481 /DB_XREF=est:wm21f03.x1 /CLONE=IMAGE:2436605 /UG=Hs.154443 minichromosome maintenance deficient (S. cerevisiae) 4

200613_at 3.72 gb:NM_004068.1 /DEF=Homo sapiens adaptor-related protein complex 2, mu 1 subunit (AP2M1), mRNA. /FEA=mRNA /GEN=AP2M1 /PROD=adaptor-related protein complex 2, mu 1 subunit /DB_XREF=gi:4757993 /UG=Hs.152936 adaptor-related protein complex 2, mu 1 subunit /FL=gb:U36188.1 gb:BC004996.1 gb:D63475.1 gb:NM_004068.1

221269_s_at 3.71 gb:NM_031286.1 /DEF=Homo sapiens SH3BGRL3-like protein (SH3BGRL3), mRNA. /FEA=mRNA /GEN=SH3BGRL3 /PROD=SH3BGRL3-like protein /DB_XREF=gi:13775197 /FL=gb:NM_031286.1

211730_s_at 3.7 gb:BC005903.1 /DEF=Homo sapiens, polymerase (RNA) II (DNA directed) polypeptide L (7.6kD), clone MGC:14494, mRNA, complete cds. /FEA=mRNA /PROD=polymerase (RNA) II (DNA directed) polypeptide L(7.6kD) /DB_XREF=gi:13543491 /FL=gb:BC005903.1

214321_at 3.67 Consensus includes gb:BF440025 /FEA=EST /DB_XREF=gi:11452542 /DB_XREF=est:nac52c12.x1 /CLONE=IMAGE:3406079 /UG=Hs.235935 nephroblastoma overexpressed gene

217784_at 3.65 Consensus includes gb:BE384482 /FEA=EST /DB_XREF=gi:9329847 /DB_XREF=est:601277836F1 /CLONE=IMAGE:3618848 /UG=Hs.296244 SNARE protein /FL=gb:U95735.1 gb:NM_006555.1

205798_at 3.64 gb:NM_002185.1 /DEF=Homo sapiens interleukin 7 receptor (IL7R), mRNA. /FEA=mRNA /GEN=IL7R /PROD=interleukin 7 receptor /DB_XREF=gi:4504678 /UG=Hs.237868 interleukin 7 receptor /FL=gb:M29696.1 gb:NM_002185.1

212983_at 3.63 Consensus includes gb:NM_005343.1 /DEF=Homo sapiens v-Ha-ras Harvey rat sarcoma viral oncogene homolog (HRAS), mRNA. /FEA=CDS /GEN=HRAS /PROD=v-Ha-ras Harvey rat sarcoma viral oncogenehomolog /DB_XREF=gi:4885424 /UG=Hs.37003 v-Ha-ras Harvey rat sarcoma viral oncogene homolog /FL=gb:NM_005343.1

212691_at 3.63 Consensus includes gb:AW131863 /FEA=EST /DB_XREF=gi:6133470 /DB_XREF=est:xf35f02.x1 /CLONE=IMAGE:2620059 /UG=Hs.30002 SH3-containing protein SH3GLB2

215464_s_at 3.6 Consensus includes gb:AK001327.1 /DEF=Homo sapiens cDNA FLJ10465 fis, clone NT2RP1001616. /FEA=mRNA /DB_XREF=gi:7022515 /UG=Hs.12956 Tax interaction protein 1

202269_x_at 3.6 gb:BC002666.1 /DEF=Homo sapiens, guanylate binding protein 1, interferon-inducible, 67kD, clone MGC:3949, mRNA, complete cds. /FEA=mRNA /PROD=guanylate binding protein 1,interferon-inducible, 67kD /DB_XREF=gi:12803662 /UG=Hs.62661 guanylate binding protein 1, interferon-inducible, 67kD /FL=gb:BC002666.1 gb:M55542.1 gb:NM_002053.1

217875_s_at 3.56 gb:NM_020182.1 /DEF=Homo sapiens transmembrane, prostate androgen induced RNA (TMEPAI), mRNA.

/FEA=mRNA /GEN=TMEPAI /PROD=transmembrane, prostate androgen induced RNA /DB_XREF=gi:9910497 /UG=Hs.83883 transmembrane, prostate androgen induced RNA /FL=gb:AF224278.1 gb:NM_020182.1

204501_at 3.56 gb:NM_002514.1 /DEF=Homo sapiens nephroblastoma overexpressed gene (NOV), mRNA. /FEA=mRNA /GEN=NOV /PROD=nephroblastoma overexpressed gene /DB_XREF=gi:4505422 /UG=Hs.235935 nephroblastoma overexpressed gene /FL=gb:NM_002514.1

AFFX-r2-Hs28SrRNA-3_at

3.53 M11167 Human 28S rRNA sequence, length 5025 bases, middle target bases 1666-3330

209732_at 3.53 gb:BC005254.1 /DEF=Homo sapiens, Similar to C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 2 (activation-induced), clone MGC:12289, mRNA, complete cds. /FEA=mRNA /PROD=Similar to C-type (calcium dependent,carbohydrate-recognition domain) lectin, superfamilymember 2 (activation-induced) /DB_XREF=gi:13528920 /UG=Hs.85201 C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 2 (activation-induced) /FL=gb:BC005254.1 gb:AB015628.1 gb:NM_005127.1

218083_at 3.52 gb:NM_025072.1 /DEF=Homo sapiens hypothetical protein FLJ14038 (FLJ14038), mRNA. /FEA=mRNA /GEN=FLJ14038 /PROD=hypothetical protein FLJ14038 /DB_XREF=gi:13376616 /UG=Hs.288102 hypothetical protein FLJ14038 /FL=gb:NM_025072.1

202589_at 3.51 gb:NM_001071.1 /DEF=Homo sapiens thymidylate synthetase (TYMS), mRNA. /FEA=mRNA /GEN=TYMS /PROD=thymidylate synthetase /DB_XREF=gi:4507750 /UG=Hs.82962 thymidylate synthetase /FL=gb:BC002567.1 gb:NM_001071.1

212680_x_at 3.5 Consensus includes gb:BE305165 /FEA=EST /DB_XREF=gi:9177184 /DB_XREF=est:601186685T1 /CLONE=IMAGE:2959580 /UG=Hs.100623 phospholipase C, beta 3, neighbor pseudogene

212218_s_at 3.44 Consensus includes gb:AI954041 /FEA=EST /DB_XREF=gi:5746351 /DB_XREF=est:wx78h04.x1 /CLONE=IMAGE:2549815 /UG=Hs.11050 F-box only protein 9 /FL=gb:NM_012347.1

203571_s_at 3.43 gb:NM_006829.1 /DEF=Homo sapiens adipose specific 2 (APM2), mRNA. /FEA=mRNA /GEN=APM2 /PROD=adipose specific 2 /DB_XREF=gi:5802975 /UG=Hs.74120 adipose specific 2 /FL=gb:BC004471.1 gb:NM_006829.1 gb:D45370.1

204141_at 3.42 gb:NM_001069.1 /DEF=Homo sapiens tubulin, beta polypeptide (TUBB), mRNA. /FEA=mRNA /GEN=TUBB /PROD=tubulin, beta polypeptide /DB_XREF=gi:4507728 /UG=Hs.179661 tubulin, beta polypeptide /FL=gb:BC001194.1 gb:NM_001069.1

201264_at 3.42 gb:NM_007263.1 /DEF=Homo sapiens coatomer protein complex, subunit epsilon (COPE), mRNA. /FEA=mRNA /GEN=COPE /PROD=coatomer protein complex, subunit epsilon /DB_XREF=gi:6005734 /UG=Hs.10326 coatomer protein complex, subunit epsilon /FL=gb:AL136928.1 gb:BC003155.1 gb:NM_007263.1

205207_at 3.42 gb:NM_000600.1 /DEF=Homo sapiens interleukin 6 (interferon, beta 2) (IL6), mRNA. /FEA=mRNA /GEN=IL6 /PROD=interleukin 6 (interferon, beta 2) /DB_XREF=gi:10834983 /UG=Hs.93913 interleukin 6 (interferon, beta 2) /FL=gb:NM_000600.1 gb:M14584.1 gb:M18403.1 gb:M29150.1 gb:M54894.1

202644_s_at 3.41 gb:NM_006290.1 /DEF=Homo sapiens tumor necrosis factor, alpha-induced protein 3 (TNFAIP3), mRNA. /FEA=mRNA /GEN=TNFAIP3 /PROD=tumor necrosis factor, alpha-induced protein 3 /DB_XREF=gi:5454131 /UG=Hs.211600 tumor necrosis factor, alpha-induced protein 3 /FL=gb:M59465.1 gb:NM_006290.1

209427_at 3.41 gb:AF064238.3 /DEF=Homo sapiens smoothelin large isoform L2 (SMTN) mRNA, complete cds. /FEA=mRNA /GEN=SMTN /PROD=smoothelin large isoform L2 /DB_XREF=gi:8119287 /UG=Hs.149098 smoothelin /FL=gb:AF064238.3

201040_at 3.41 gb:NM_002070.1 /DEF=Homo sapiens guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 (GNAI2), mRNA. /FEA=mRNA /GEN=GNAI2 /PROD=guanine nucleotide binding protein (G protein),alpha inhibiting activity polypeptide 2 /DB_XREF=gi:4504040 /UG=Hs.77269 guanine nucleotide binding

protein (G protein), alpha inhibiting activity polypeptide 2 /FL=gb:J03004.1 gb:NM_002070.1 206421_s_at 3.4 gb:NM_003784.1 /DEF=Homo sapiens serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 7

(SERPINB7), mRNA. /FEA=mRNA /GEN=SERPINB7 /PROD=serine (or cysteine) proteinase inhibitor, cladeB (ovalbumin), member 7 /DB_XREF=gi:4505148 /UG=Hs.138202 serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 7 /FL=gb:AF027866.1 gb:NM_003784.1

214146_s_at 3.4 Consensus includes gb:R64130 /FEA=EST /DB_XREF=gi:836009 /DB_XREF=est:yi18h03.s1 /CLONE=IMAGE:139637 /UG=Hs.2164 pro-platelet basic protein (includes platelet basic protein, beta-thromboglobulin, connective tissue-activating peptide III, neutrophil-activating peptide-2)

217025_s_at 3.4 Consensus includes gb:AL110225.1 /DEF=Homo sapiens mRNA; cDNA DKFZp434D064 (from clone DKFZp434D064); partial cds. /FEA=mRNA /GEN=DKFZp434D064 /PROD=hypothetical protein /DB_XREF=gi:5817161 /UG=Hs.89434 drebrin 1

214752_x_at 3.39 Consensus includes gb:AI625550 /FEA=EST /DB_XREF=gi:4650481 /DB_XREF=est:ty57d06.x1 /CLONE=IMAGE:2283179 /UG=Hs.195464 filamin A, alpha (actin-binding protein-280)

1861_at 3.39 U66879 /FEATURE= /DEFINITION=HSU66879 Human Bcl-2 binding component 6 (bbc6) mRNA, complete cds 211906_s_at 3.37 gb:AB046400.1 /DEF=Homo sapiens mRNA for SCCA2b, complete cds. /FEA=CDS /GEN=SCCA2

/PROD=SCCA2b /DB_XREF=gi:13537193 /FL=gb:AB046400.1 212977_at 3.37 Consensus includes gb:AI817041 /FEA=EST /DB_XREF=gi:5436120 /DB_XREF=est:wj76c06.x1

/CLONE=IMAGE:2408746 /UG=Hs.23016 G protein-coupled receptor 221805_at 3.35 Consensus includes gb:AL537457 /FEA=EST /DB_XREF=gi:12800950 /DB_XREF=est:AL537457

/CLONE=CS0DF025YH07 (3 prime) /UG=Hs.211584 neurofilament, light polypeptide (68kD) /FL=gb:NM_006158.1 212877_at 3.33 Consensus includes gb:AA284075 /FEA=EST /DB_XREF=gi:1928356 /DB_XREF=est:zs49b01.s1

/CLONE=IMAGE:700777 /UG=Hs.117977 kinesin 2 (60-70kD) 210285_x_at 3.32 gb:BC000383.1 /DEF=Homo sapiens, Wilms tumour 1-associating protein, clone MGC:8419, mRNA, complete cds.

/FEA=mRNA /PROD=Wilms tumour 1-associating protein /DB_XREF=gi:12653228 /UG=Hs.119 Wilms tumour 1-associating protein /FL=gb:BC000383.1 gb:BC004432.1

203252_at 3.32 gb:NM_005851.1 /DEF=Homo sapiens tumor suppressor deleted in oral cancer-related 1 (DOC-1R), mRNA. /FEA=mRNA /GEN=DOC-1R /PROD=tumor suppressor deleted in oral cancer-related1 /DB_XREF=gi:5031668 /UG=Hs.25664 tumor suppressor deleted in oral cancer-related 1 /FL=gb:BC002850.1 gb:AF089814.1 gb:NM_005851.1

209720_s_at 3.31 gb:BC005224.1 /DEF=Homo sapiens, serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 3, clone MGC:12244, mRNA, complete cds. /FEA=mRNA /PROD=serine (or cysteine) proteinase inhibitor, cladeB (ovalbumin), member 3 /DB_XREF=gi:13528851 /UG=Hs.227948 serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 3 /FL=gb:U19556.1 gb:BC005224.1 gb:NM_006919.1

212540_at 3.3 Consensus includes gb:BG476661 /FEA=EST /DB_XREF=gi:13408940 /DB_XREF=est:602524946F1 /CLONE=IMAGE:4643458 /UG=Hs.76932 cell division cycle 34

202107_s_at 3.3 gb:NM_004526.1 /DEF=Homo sapiens minichromosome maintenance deficient (S. cerevisiae) 2 (mitotin) (MCM2), mRNA. /FEA=mRNA /GEN=MCM2 /PROD=minichromosome maintenance deficient (S.cerevisiae) 2 (mitotin) /DB_XREF=gi:4758705 /UG=Hs.57101 minichromosome maintenance deficient (S. cerevisiae) 2 (mitotin) /FL=gb:D83987.1 gb:NM_004526.1

216952_s_at 3.29 Consensus includes gb:M94363 /DEF=Human lamin B2 (LAMB2) gene and ppv1 gene sequence /FEA=mRNA /DB_XREF=gi:186920 /UG=Hs.76084 lamin B2

204767_s_at 3.27 gb:BC000323.1 /DEF=Homo sapiens, flap structure-specific endonuclease 1, clone MGC:8478, mRNA, complete cds. /FEA=mRNA /PROD=flap structure-specific endonuclease 1 /DB_XREF=gi:12653112 /UG=Hs.4756 flap

structure-specific endonuclease 1 /FL=gb:BC000323.1 gb:NM_004111.3 201890_at 3.27 Consensus includes gb:BE966236 /FEA=EST /DB_XREF=gi:11771437 /DB_XREF=est:601660172R1

/CLONE=IMAGE:3905920 /UG=Hs.75319 ribonucleotide reductase M2 polypeptide /FL=gb:NM_001034.1 216237_s_at 3.26 Consensus includes gb:AA807529 /FEA=EST /DB_XREF=gi:2875596 /DB_XREF=est:ob92c07.s1

/CLONE=IMAGE:1338828 /UG=Hs.77171 minichromosome maintenance deficient (S. cerevisiae) 5 (cell division cycle 46)

212188_at 3.26 Consensus includes gb:AA551075 /FEA=EST /DB_XREF=gi:2321327 /DB_XREF=est:nk74h06.s1 /CLONE=IMAGE:1019291 /UG=Hs.109438 Homo sapiens clone 24775 mRNA sequence

217782_s_at 3.25 gb:NM_004127.3 /DEF=Homo sapiens G protein pathway suppressor 1 (GPS1), mRNA. /FEA=mRNA /GEN=GPS1 /PROD=G protein pathway suppressor 1 /DB_XREF=gi:13435380 /UG=Hs.268530 G protein pathway suppressor 1 /FL=gb:BC000155.1 gb:NM_004127.3 gb:U20285.2

218952_at 3.23 gb:NM_013271.1 /DEF=Homo sapiens granin-like neuroendocrine peptide precursor (SAAS), mRNA. /FEA=mRNA /GEN=SAAS /PROD=granin-like neuroendocrine peptide precursor /DB_XREF=gi:7019518 /UG=Hs.256311 granin-like neuroendocrine peptide precursor /FL=gb:BC002851.1 gb:AF181562.1 gb:NM_013271.1

205681_at 3.22 gb:NM_004049.1 /DEF=Homo sapiens BCL2-related protein A1 (BCL2A1), mRNA. /FEA=mRNA /GEN=BCL2A1 /PROD=BCL2-related protein A1 /DB_XREF=gi:4757839 /UG=Hs.227817 BCL2-related protein A1 /FL=gb:U27467.1 gb:U29680.1 gb:NM_004049.1

204337_at 3.21 Consensus includes gb:AL514445 /FEA=EST /DB_XREF=gi:12777939 /DB_XREF=est:AL514445 /CLONE=CL0BB010ZF08 (3 prime) /UG=Hs.227571 regulator of G-protein signalling 4 /FL=gb:NM_005613.2 gb:BC000737.1

208782_at 3.21 gb:BC000055.1 /DEF=Homo sapiens, follistatin-like 1, clone MGC:1993, mRNA, complete cds. /FEA=mRNA /PROD=follistatin-like 1 /DB_XREF=gi:12652618 /UG=Hs.296267 follistatin-like 1 /FL=gb:BC000055.1 gb:U06863.1

202912_at 3.2 gb:NM_001124.1 /DEF=Homo sapiens adrenomedullin (ADM), mRNA. /FEA=mRNA /GEN=ADM /PROD=adrenomedullin /DB_XREF=gi:4501944 /UG=Hs.394 adrenomedullin /FL=gb:NM_001124.1 gb:D14874.1

203967_at 3.2 gb:U77949.1 /DEF=Human Cdc6-related protein (HsCDC6) mRNA, complete cds. /FEA=mRNA /GEN=HsCDC6 /PROD=Cdc6-related protein /DB_XREF=gi:1684902 /UG=Hs.69563 CDC6 (cell division cycle 6, S. cerevisiae) homolog /FL=gb:U77949.1 gb:AF022109.1 gb:NM_001254.1

216442_x_at 3.19 Consensus includes gb:AK026737.1 /DEF=Homo sapiens cDNA: FLJ23084 fis, clone LNG06602, highly similar to HSFIB1 Human mRNA for fibronectin (FN precursor). /FEA=mRNA /DB_XREF=gi:10439658 /UG=Hs.287820 fibronectin 1

205082_s_at 3.18 gb:AB046692.1 /DEF=Homo sapiens hAO mRNA for aldeyde oxidase, complete cds. /FEA=mRNA /GEN=hAO /PROD=aldeyde oxidase /DB_XREF=gi:13516378 /UG=Hs.174151 aldehyde oxidase 1 /FL=gb:AB046692.1 gb:L11005.1 gb:NM_001159.2

209277_at 3.18 Consensus includes gb:AL574096 /FEA=EST /DB_XREF=gi:12933969 /DB_XREF=est:AL574096 /CLONE=CS0DI040YI17 (3 prime) /UG=Hs.295944 tissue factor pathway inhibitor 2 /FL=gb:BC005330.1 gb:L27624.1 gb:D29992.1 gb:NM_006528.1

205034_at 3.17 gb:NM_004702.1 /DEF=Homo sapiens cyclin E2 (CCNE2), mRNA. /FEA=mRNA /GEN=CCNE2 /PROD=cyclin E2 /DB_XREF=gi:4757931 /UG=Hs.30464 cyclin E2 /FL=gb:AF091433.1 gb:AF102778.1 gb:AF106690.1 gb:NM_004702.1

209026_x_at 3.17 gb:AF141349.1 /DEF=Homo sapiens beta-tubulin mRNA, complete cds. /FEA=mRNA /PROD=beta-tubulin /DB_XREF=gi:4929137 /UG=Hs.179661 tubulin, beta polypeptide /FL=gb:BC000222.1 gb:BC002347.1 gb:BC001938.1 gb:AF070561.1 gb:AF070593.1 gb:AF070600.1 gb:AF141349.1

206924_at 3.15 gb:NM_000641.1 /DEF=Homo sapiens interleukin 11 (IL11), mRNA. /FEA=mRNA /GEN=IL11 /PROD=interleukin

11 /DB_XREF=gi:10834993 /UG=Hs.1721 interleukin 11 /FL=gb:NM_000641.1 gb:M57765.1 205024_s_at 3.15 gb:NM_002875.1 /DEF=Homo sapiens RAD51 (S. cerevisiae) homolog (E coli RecA homolog) (RAD51), mRNA.

/FEA=mRNA /GEN=RAD51 /PROD=RAD51 (S. cerevisiae) homolog (E coli RecAhomolog) /DB_XREF=gi:4506388 /UG=Hs.23044 RAD51 (S. cerevisiae) homolog (E coli RecA homolog) /FL=gb:D14134.1 gb:D13804.1 gb:NM_002875.1

218695_at 3.14 gb:NM_019037.1 /DEF=Homo sapiens hypothetical protein (FLJ20591), mRNA. /FEA=mRNA /GEN=FLJ20591 /PROD=hypothetical protein /DB_XREF=gi:9506688 /UG=Hs.97574 exosome component Rrp41 /FL=gb:BC002777.1 gb:AF281133.1 gb:NM_019037.1

201392_s_at 3.13 Consensus includes gb:BG031974 /FEA=EST /DB_XREF=gi:12422804 /DB_XREF=est:602300668F1 /CLONE=IMAGE:4402217 /UG=Hs.76473 insulin-like growth factor 2 receptor /FL=gb:J03528.1 gb:NM_000876.1

204619_s_at 3.13 Consensus includes gb:BF590263 /FEA=EST /DB_XREF=gi:11682587 /DB_XREF=est:nab22b12.x1 /CLONE=IMAGE:3266638 /UG=Hs.81800 chondroitin sulfate proteoglycan 2 (versican) /FL=gb:NM_004385.1

91684_g_at 3.11 Cluster Incl. AI571298:tn44e03.x1 Homo sapiens cDNA, 3 end /clone=IMAGE-2170492 /clone_end=3 /gb=AI571298 /gi=4534672 /ug=Hs.97574 /len=537

200075_s_at 3.08 gb:BC006249.1 /DEF=Homo sapiens, guanylate kinase 1, clone MGC:10618, mRNA, complete cds. /FEA=mRNA /PROD=guanylate kinase 1 /DB_XREF=gi:13623296 /FL=gb:BC006249.1

202998_s_at 3.07 gb:NM_002318.1 /DEF=Homo sapiens lysyl oxidase-like 2 (LOXL2), mRNA. /FEA=mRNA /GEN=LOXL2 /PROD=lysyl oxidase-like 2 /DB_XREF=gi:4505010 /UG=Hs.83354 lysyl oxidase-like 2 /FL=gb:BC000594.1 gb:U89942.1 gb:NM_002318.1 gb:AF117949.1

220651_s_at 3.07 gb:NM_018518.1 /DEF=Homo sapiens homolog of yeast MCM10; hypothetical protein PRO2249 (PRO2249), mRNA. /FEA=mRNA /GEN=PRO2249 /PROD=homolog of yeast MCM10; hypothetical proteinPRO2249 /DB_XREF=gi:8924142 /UG=Hs.198363 homolog of yeast MCM10; hypothetical protein PRO2249 /FL=gb:AB042719.1 gb:BC004876.1 gb:AF119869.1 gb:NM_018518.1

203931_s_at 3.07 gb:NM_002949.1 /DEF=Homo sapiens mitochondrial ribosomal protein L12 (MRPL12), mRNA. /FEA=mRNA /GEN=MRPL12 /PROD=mitochondrial ribosomal protein L12 /DB_XREF=gi:4506672 /UG=Hs.109059 mitochondrial ribosomal protein L12 /FL=gb:BC002344.1 gb:U25041.1 gb:AF105278.1 gb:NM_002949.1

217849_s_at 3.05 gb:NM_006035.1 /DEF=Homo sapiens CDC42-binding protein kinase beta (DMPK-like) (CDC42BPB), mRNA. /FEA=mRNA /GEN=CDC42BPB /PROD=CDC42-binding protein kinase beta (DMPK-like) /DB_XREF=gi:5174412 /UG=Hs.12908 CDC42-binding protein kinase beta (DMPK-like) /FL=gb:AF128625.1 gb:NM_006035.1

204647_at 3.05 gb:NM_004838.1 /DEF=Homo sapiens Homer, neuronal immediate early gene, 3 (HOMER-3), mRNA. /FEA=mRNA /GEN=HOMER-3 /PROD=Homer, neuronal immediate early gene, 3 /DB_XREF=gi:4758549 /UG=Hs.166146 Homer, neuronal immediate early gene, 3 /FL=gb:AF093265.1 gb:NM_004838.1

210495_x_at 3.05 gb:AF130095.1 /DEF=Homo sapiens clone FLC0562 PRO2841 mRNA, complete cds. /FEA=mRNA /PROD=PRO2841 /DB_XREF=gi:11493493 /UG=Hs.287820 fibronectin 1 /FL=gb:AF130095.1

213520_at 3.04 Consensus includes gb:NM_004260.1 /DEF=Homo sapiens RecQ protein-like 4 (RECQL4), mRNA. /FEA=CDS /GEN=RECQL4 /PROD=RecQ protein-like 4 /DB_XREF=gi:4759029 /UG=Hs.31442 RecQ protein-like 4 /FL=gb:AB006532.1 gb:NM_004260.1

211571_s_at 3.04 gb:D32039.1 /DEF=Human pgH3 mRNA for proteoglycan PG-M(V3), complete cds. /FEA=mRNA /GEN=pgH3 /PROD=proteoglycan PG-M(V3) /DB_XREF=gi:1008912 /UG=Hs.81800 chondroitin sulfate proteoglycan 2 (versican) /FL=gb:D32039.1

218532_s_at 3.04 gb:NM_019000.1 /DEF=Homo sapiens hypothetical protein (FLJ20152), mRNA. /FEA=mRNA /GEN=FLJ20152 /PROD=hypothetical protein /DB_XREF=gi:9506660 /UG=Hs.82273 hypothetical protein /FL=gb:NM_019000.1

45633_at 3.03 Cluster Incl. AI421812:tf55a07.x1 Homo sapiens cDNA, 3 end /clone=IMAGE-2103156 /clone_end=3

/gb=AI421812 /gi=4267743 /ug=Hs.47125 /len=556 215078_at 3.01 Consensus includes gb:AL050388.1 /DEF=Homo sapiens mRNA; cDNA DKFZp564M2422 (from clone

DKFZp564M2422); partial cds. /FEA=mRNA /GEN=DKFZp564M2422 /PROD=hypothetical protein /DB_XREF=gi:4914612 /UG=Hs.306320 Homo sapiens mRNA; cDNA DKFZp564M2422 (from clone DKFZp564M2422); partial cds

203109_at 3.01 gb:NM_003969.1 /DEF=Homo sapiens ubiquitin-conjugating enzyme E2M (homologous to yeast UBC12) (UBE2M), mRNA. /FEA=mRNA /GEN=UBE2M /PROD=ubiquitin-conjugating enzyme E2M (homologous toyeast UBC12) /DB_XREF=gi:4507790 /UG=Hs.200478 ubiquitin-conjugating enzyme E2M (homologous to yeast UBC12) /FL=gb:AF075599.1 gb:AB012191.1 gb:NM_003969.1

201426_s_at 3 Consensus includes gb:AI922599 /FEA=EST /DB_XREF=gi:5658563 /DB_XREF=est:wm90b11.x1 /CLONE=IMAGE:2443197 /UG=Hs.297753 vimentin /FL=gb:BC000163.2 gb:NM_003380.1

221247_s_at 3 gb:NM_030798.1 /DEF=Homo sapiens hypothetical protein DKFZp434D0421 (DKFZP434D0421), mRNA. /FEA=mRNA /GEN=DKFZP434D0421 /PROD=hypothetical protein DKFZp434D0421 /DB_XREF=gi:13540581 /FL=gb:NM_030798.1

215735_s_at 3 Consensus includes gb:AC005600 /DEF=Homo sapiens chromosome 16, P1 clone 109-9G (LANL), complete sequence /FEA=CDS_1 /DB_XREF=gi:3522919 /UG=Hs.90303 tuberous sclerosis 2

202208_s_at 3 gb:BC001051.1 /DEF=Homo sapiens, ADP-ribosylation factor-like 7, clone MGC:1575, mRNA, complete cds. /FEA=mRNA /PROD=ADP-ribosylation factor-like 7 /DB_XREF=gi:12654450 /UG=Hs.111554 ADP-ribosylation factor-like 7 /FL=gb:BC001051.1 gb:AB016811.1 gb:NM_005737.2

AFFX-HUMRGE/M10098_M_at

3 M10098 Human 18S rRNA gene, complete (_5, _M, _3 represent transcript regions 5 prime, Middle, and 3 prime respectively)

201079_at 2.98 gb:NM_004710.1 /DEF=Homo sapiens synaptogyrin 2 (SYNGR2), mRNA. /FEA=mRNA /GEN=SYNGR2 /PROD=synaptogyrin 2 /DB_XREF=gi:4759201 /UG=Hs.5097 synaptogyrin 2 /FL=gb:BC000407.1 gb:NM_004710.1

200678_x_at 2.98 gb:NM_002087.1 /DEF=Homo sapiens granulin (GRN), mRNA. /FEA=mRNA /GEN=GRN /PROD=granulin /DB_XREF=gi:4504150 /UG=Hs.180577 granulin /FL=gb:M75161.1 gb:AF055008.1 gb:NM_002087.1

211136_s_at 2.98 gb:BC004865.1 /DEF=Homo sapiens, cleft lip and palate associated transmembrane protein 1, clone MGC:10593, mRNA, complete cds. /FEA=mRNA /PROD=cleft lip and palate associated transmembraneprotein 1 /DB_XREF=gi:13436079 /UG=Hs.106671 cleft lip and palate associated transmembrane protein 1 /FL=gb:BC004865.1

221657_s_at 2.97 gb:BC001719.1 /DEF=Homo sapiens, Similar to hypothetical protein FLJ20548, clone MGC:1024, mRNA, complete cds. /FEA=mRNA /PROD=Similar to hypothetical protein FLJ20548 /DB_XREF=gi:12804594 /UG=Hs.125037 hypothetical protein FLJ20548 /FL=gb:BC001719.1

213906_at 2.97 Consensus includes gb:AW592266 /FEA=EST /DB_XREF=gi:7279443 /DB_XREF=est:hf48e04.x1 /CLONE=IMAGE:2935134 /UG=Hs.300592 v-myb avian myeloblastosis viral oncogene homolog-like 1

217871_s_at 2.96 gb:NM_002415.1 /DEF=Homo sapiens macrophage migration inhibitory factor (glycosylation-inhibiting factor) (MIF),mRNA. /FEA=mRNA /GEN=MIF /PROD=macrophage migration inhibitory factor(glycosylation-inhibiting factor) /DB_XREF=gi:4505184 /UG=Hs.73798 macrophage migration inhibitory factor (glycosylation-inhibiting factor) /FL=gb:BC000447.1 gb:M25639.1 gb:L10612.1 gb:NM_002415.1

204236_at 2.96 gb:NM_002017.2 /DEF=Homo sapiens Friend leukemia virus integration 1 (FLI1), mRNA. /FEA=mRNA /GEN=FLI1 /PROD=Friend leukemia virus integration 1 /DB_XREF=gi:7110592 /UG=Hs.108043 Friend leukemia virus integration 1 /FL=gb:BC001670.1 gb:M98833.3 gb:NM_002017.2

214426_x_at 2.94 Consensus includes gb:BF062223 /FEA=EST /DB_XREF=gi:10821121 /DB_XREF=est:7k74c04.x1 /CLONE=IMAGE:3480967 /UG=Hs.79018 chromatin assembly factor 1, subunit A (p150)

211714_x_at 2.94 gb:BC005838.1 /DEF=Homo sapiens, tubulin, beta 5, clone MGC:2440, mRNA, complete cds. /FEA=mRNA /PROD=tubulin, beta 5 /DB_XREF=gi:13543349 /FL=gb:BC005838.1

219588_s_at 2.92 gb:NM_017760.1 /DEF=Homo sapiens hypothetical protein FLJ20311 (FLJ20311), mRNA. /FEA=mRNA /GEN=FLJ20311 /PROD=hypothetical protein FLJ20311 /DB_XREF=gi:8923292 /UG=Hs.18616 hypothetical protein FLJ20311 /FL=gb:NM_017760.1

211716_x_at 2.92 gb:BC005851.1 /DEF=Homo sapiens, Rho GDP dissociation inhibitor (GDI) alpha, clone MGC:2810, mRNA, complete cds. /FEA=mRNA /PROD=Rho GDP dissociation inhibitor (GDI) alpha /DB_XREF=gi:13543380 /FL=gb:BC005851.1

204462_s_at 2.92 gb:NM_006517.1 /DEF=Homo sapiens solute carrier family 16 (monocarboxylic acid transporters), member 2 (putative transporter) (SLC16A2), mRNA. /FEA=mRNA /GEN=SLC16A2 /PROD=solute carrier family 16 (monocarboxylic acidtransporters), member 2 (putative transporter) /DB_XREF=gi:5730044 /UG=Hs.75317 solute carrier family 16 (monocarboxylic acid transporters), member 2 (putative transporter) /FL=gb:NM_006517.1

209706_at 2.92 gb:AF247704.1 /DEF=Homo sapiens homeobox protein NKX3.1 mRNA, complete cds. /FEA=mRNA /PROD=homeobox protein NKX3.1 /DB_XREF=gi:9963969 /UG=Hs.55999 NK homeobox (Drosophila), family 3, A /FL=gb:AF249670.1 gb:AF249672.1 gb:U80669.1 gb:U91540.1 gb:NM_006167.1 gb:AF247704.1

202014_at 2.91 gb:NM_014330.2 /DEF=Homo sapiens growth arrest and DNA-damage-inducible 34 (GADD34), mRNA. /FEA=mRNA /GEN=GADD34 /PROD=growth arrest and DNA-damage-inducible 34 /DB_XREF=gi:9790902 /UG=Hs.76556 growth arrest and DNA-damage-inducible 34 /FL=gb:BC003067.1 gb:U83981.1 gb:NM_014330.2

207891_s_at 2.91 gb:NM_017518.2 /DEF=Homo sapiens Xq28, 2000bp sequence contg. ORF (HSXQ28ORF), mRNA. /FEA=mRNA /GEN=HSXQ28ORF /PROD=Xq28, 2000bp sequence contg. ORF /DB_XREF=gi:11120679 /UG=Hs.6487 Xq28, 2000bp sequence contg. ORF /FL=gb:NM_017518.2 gb:AF267739.1

221916_at 2.9 Consensus includes gb:BF055311 /FEA=EST /DB_XREF=gi:10809207 /DB_XREF=est:7j78a07.x1 /CLONE=IMAGE:3392532 /UG=Hs.302689 hypothetical protein

218875_s_at 2.9 gb:NM_012177.1 /DEF=Homo sapiens F-box only protein 5 (FBXO5), mRNA. /FEA=mRNA /GEN=FBXO5 /PROD=F-box only protein 5 /DB_XREF=gi:6912365 /UG=Hs.272027 F-box only protein 5 /FL=gb:AF129535.1 gb:NM_012177.1

205035_at 2.9 gb:NM_004715.1 /DEF=Homo sapiens CTD (carboxy-terminal domina, RNA polymerase II, polypeptide A) phosphatase, subunit 1 (CTDP1), mRNA. /FEA=mRNA /GEN=CTDP1 /PROD=CTD (carboxy-terminal domina, RNA polymerase II,polypeptide A) phosphatase, subunit 1 /DB_XREF=gi:4758093 /UG=Hs.4076 CTD (carboxy-terminal domina, RNA polymerase II, polypeptide A) phosphatase, subunit 1 /FL=gb:AF081287.1 gb:NM_004715.1 gb:AF154115.1

201331_s_at 2.9 gb:BC004973.1 /DEF=Homo sapiens, signal transducer and activator of transcription 6, interleukin-4 induced, cloneMGC:3649, mRNA, complete cds. /FEA=mRNA /PROD=signal transducer and activator of transcription6, interleukin-4 induced /DB_XREF=gi:13436385 /UG=Hs.181015 signal transducer and activator of transcription 6, interleukin-4 induced /FL=gb:BC004973.1 gb:NM_003153.1 gb:U16031.1

205436_s_at 2.89 gb:NM_002105.1 /DEF=Homo sapiens H2A histone family, member X (H2AFX), mRNA. /FEA=mRNA /GEN=H2AFX /PROD=H2A histone family, member X /DB_XREF=gi:4504252 /UG=Hs.147097 H2A histone family, member X /FL=gb:BC004915.1 gb:NM_002105.1

213187_x_at 2.87 Consensus includes gb:BG538564 /FEA=EST /DB_XREF=gi:13530797 /DB_XREF=est:602567289F1 /CLONE=IMAGE:4691639 /UG=Hs.324746 alpha-2-HS-glycoprotein

204603_at 2.86 gb:NM_003686.1 /DEF=Homo sapiens exonuclease 1 (EXO1), mRNA. /FEA=mRNA /GEN=EXO1 /PROD=Rad2

nuclease family member, homolog of S.cerevisiae exonuclease 1 /DB_XREF=gi:4504368 /UG=Hs.47504 exonuclease 1 /FL=gb:NM_006027.1 gb:AF042282.1 gb:AF060479.1 gb:AF091740.1 gb:AF084974.1 gb:NM_003686.1

204768_s_at 2.84 gb:NM_004111.3 /DEF=Homo sapiens flap structure-specific endonuclease 1 (FEN1), mRNA. /FEA=mRNA /GEN=FEN1 /PROD=flap structure-specific endonuclease 1 /DB_XREF=gi:6325465 /UG=Hs.4756 flap structure-specific endonuclease 1 /FL=gb:BC000323.1 gb:NM_004111.3

220615_s_at 2.84 gb:NM_018099.1 /DEF=Homo sapiens hypothetical protein FLJ10462 (FLJ10462), mRNA. /FEA=mRNA /GEN=FLJ10462 /PROD=hypothetical protein FLJ10462 /DB_XREF=gi:8922433 /UG=Hs.100895 hypothetical protein FLJ10462 /FL=gb:AL136843.1 gb:NM_018099.1

211168_s_at 2.82 gb:D86988.1 /DEF=Human mRNA for KIAA0221 gene, complete cds. /FEA=mRNA /GEN=KIAA0221 /PROD=KIAA0221 /DB_XREF=gi:1944406 /UG=Hs.12719 regulator of nonsense transcripts 1 /FL=gb:D86988.1

31874_at 2.81 Cluster Incl. Y07846:H.sapiens mRNA for GAR22 protein /cds=(132,1145) /gb=Y07846 /gi=1666070 /ug=Hs.15346 /len=2238

211006_s_at 2.81 gb:L02840.1 /DEF=Homo sapiens potassium channel Kv2.1 mRNA, complete cds. /FEA=mRNA /PROD=voltage-gated potassium channel /DB_XREF=gi:186797 /UG=Hs.84244 potassium voltage-gated channel, Shab-related subfamily, member 1 /FL=gb:L02840.1 gb:AF026005.1 gb:NM_004975.1

203718_at 2.8 gb:NM_006702.1 /DEF=Homo sapiens neuropathy target esterase (NTE), mRNA. /FEA=mRNA /GEN=NTE /PROD=neuropathy target esterase /DB_XREF=gi:5729950 /UG=Hs.5038 neuropathy target esterase /FL=gb:NM_006702.1

200852_x_at 2.8 gb:NM_005273.1 /DEF=Homo sapiens guanine nucleotide binding protein (G protein), beta polypeptide 2 (GNB2), mRNA. /FEA=mRNA /GEN=GNB2 /PROD=guanine nucleotide binding protein (G protein),beta polypeptide 2 /DB_XREF=gi:4885282 /UG=Hs.91299 guanine nucleotide binding protein (G protein), beta polypeptide 2 /FL=gb:M16538.1 gb:M36429.1 gb:NM_005273.1

209665_at 2.8 gb:AF040704.1 /DEF=Homo sapiens putative tumor suppressor protein (101F6) mRNA, complete cds. /FEA=mRNA /GEN=101F6 /PROD=putative tumor suppressor protein /DB_XREF=gi:2935319 /UG=Hs.149443 putative tumor suppressor /FL=gb:AF040704.1 gb:NM_007022.1

202270_at 2.8 gb:NM_002053.1 /DEF=Homo sapiens guanylate binding protein 1, interferon-inducible, 67kD (GBP1), mRNA. /FEA=mRNA /GEN=GBP1 /PROD=guanylate binding protein 1,interferon-inducible, 67kD /DB_XREF=gi:4503938 /UG=Hs.62661 guanylate binding protein 1, interferon-inducible, 67kD /FL=gb:BC002666.1 gb:M55542.1 gb:NM_002053.1

202071_at 2.79 gb:NM_002999.1 /DEF=Homo sapiens syndecan 4 (amphiglycan, ryudocan) (SDC4), mRNA. /FEA=mRNA /GEN=SDC4 /PROD=syndecan 4 (amphiglycan, ryudocan) /DB_XREF=gi:4506860 /UG=Hs.252189 syndecan 4 (amphiglycan, ryudocan) /FL=gb:NM_002999.1

212636_at 2.79 Consensus includes gb:AL031781 /DEF=Human DNA sequence from clone 51J12 on chromosome 6q26-27. Contains the 3 part of the alternatively spliced gene for the human orthologs of mouse QKI-7 and QKI-7B (KH Domain RNA Binding proteins) and zebrafish ZKQ-1 (Quaking protein homolog). Con... /FEA=mRNA_2 /DB_XREF=gi:4038570 /UG=Hs.15020 homolog of mouse quaking QKI (KH domain RNA binding protein) /FL=gb:AF142417.1

213977_s_at 2.79 Consensus includes gb:AA054734 /FEA=EST /DB_XREF=gi:1545679 /DB_XREF=est:zk68f07.s1 /CLONE=IMAGE:488005 /UG=Hs.23476 Cip1-interacting zinc finger protein

201700_at 2.78 gb:NM_001760.1 /DEF=Homo sapiens cyclin D3 (CCND3), mRNA. /FEA=mRNA /GEN=CCND3 /PROD=cyclin D3 /DB_XREF=gi:4502618 /UG=Hs.83173 cyclin D3 /FL=gb:M90814.1 gb:M92287.1 gb:NM_001760.1

200766_at 2.78 gb:NM_001909.1 /DEF=Homo sapiens cathepsin D (lysosomal aspartyl protease) (CTSD), mRNA. /FEA=mRNA

/GEN=CTSD /PROD=cathepsin D (lysosomal aspartyl protease) /DB_XREF=gi:4503142 /UG=Hs.79572 cathepsin D (lysosomal aspartyl protease) /FL=gb:M11233.1 gb:NM_001909.1

212646_at 2.78 Consensus includes gb:D42043.1 /DEF=Human mRNA for KIAA0084 gene, partial cds. /FEA=mRNA /GEN=KIAA0084 /DB_XREF=gi:577298 /UG=Hs.79123 KIAA0084 protein

213040_s_at 2.78 Consensus includes gb:AL008583 /DEF=Human DNA sequence from clone RP3-327J16 on chromosome 22q12.3-13.2 Contains the DNAL4 gene for axonemal dynein light polypeptide 4, the NPTXR gene for neuronal pentraxin receptor and the CBX6 gene for chromobox homolog 6. Contains ESTs, STSs, a G... /FEA=mRNA_2 /DB_XREF=gi:4160195 /UG=Hs.91622 neuronal pentraxin receptor /FL=gb:NM_014293.1

52741_at 2.77 Cluster Incl. AI962879:wt24c06.x1 Homo sapiens cDNA, 3 end /clone=IMAGE-2508394 /clone_end=3 /gb=AI962879 /gi=5755592 /ug=Hs.81920 /len=490

208791_at 2.77 gb:M25915.1 /DEF=Human complement cytolysis inhibitor (CLI) mRNA, complete cds. /FEA=mRNA /DB_XREF=gi:180619 /UG=Hs.75106 clusterin (complement lysis inhibitor, SP-40,40, sulfated glycoprotein 2, testosterone-repressed prostate message 2, apolipoprotein J) /FL=gb:J02908.1 gb:M25915.1 gb:M64722.1 gb:NM_001831.1

214383_x_at 2.77 Consensus includes gb:BF063121 /FEA=EST /DB_XREF=gi:10822031 /DB_XREF=est:7h83f11.x1 /CLONE=IMAGE:3322605 /UG=Hs.281706 sortilin 1

206953_s_at 2.76 gb:NM_012302.1 /DEF=Homo sapiens latrophilin (KIAA0786), mRNA. /FEA=mRNA /GEN=KIAA0786 /PROD=latrophilin /DB_XREF=gi:6912463 /UG=Hs.24212 latrophilin /FL=gb:AF104939.1 gb:NM_012302.1

208711_s_at 2.76 gb:BC000076.1 /DEF=Homo sapiens, cyclin D1 (PRAD1: parathyroid adenomatosis 1), clone MGC:2316, mRNA, complete cds. /FEA=mRNA /PROD=cyclin D1 (PRAD1: parathyroid adenomatosis 1) /DB_XREF=gi:12652656 /UG=Hs.82932 cyclin D1 (PRAD1: parathyroid adenomatosis 1) /FL=gb:BC000076.1 gb:M73554.1

204727_at 2.76 Consensus includes gb:AW772140 /FEA=EST /DB_XREF=gi:7704203 /DB_XREF=est:hn68b03.x1 /CLONE=IMAGE:3033005 /UG=Hs.72160 AND-1 protein /FL=gb:NM_007086.1

209729_at 2.75 gb:BC001782.1 /DEF=Homo sapiens, GAS2-related on chromosome 22, clone MGC:2104, mRNA, complete cds. /FEA=mRNA /PROD=GAS2-related on chromosome 22 /DB_XREF=gi:12804706 /UG=Hs.322852 Homo sapiens, GAS2-related on chromosome 22, clone MGC:2104, mRNA, complete cds /FL=gb:BC001782.1

213726_x_at 2.75 Consensus includes gb:AA515698 /FEA=EST /DB_XREF=gi:2255298 /DB_XREF=est:nf66f09.s1 /CLONE=IMAGE:924905 /UG=Hs.251653 tubulin, beta, 2

212907_at 2.75 Consensus includes gb:AI972416 /FEA=EST /DB_XREF=gi:5769332 /DB_XREF=est:wr39d10.x1 /CLONE=IMAGE:2490067 /UG=Hs.24385 Human hbc647 mRNA sequence

209719_x_at 2.75 gb:U19556.1 /DEF=Human squamous cell carcinoma antigen 1 (SCCA1) mRNA, complete cds. /FEA=mRNA /GEN=SCCA1 /PROD=squamous cell carcinoma antigen 1 /DB_XREF=gi:1276435 /UG=Hs.227948 serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 3 /FL=gb:U19556.1 gb:BC005224.1 gb:NM_006919.1

209953_s_at 2.74 gb:U63131.1 /DEF=Human CDC37 homolog mRNA, complete cds. /FEA=mRNA /PROD=CDC37 homolog /DB_XREF=gi:1421820 /UG=Hs.160958 CDC37 (cell division cycle 37, S. cerevisiae, homolog) /FL=gb:BC000083.1 gb:U43077.1 gb:U63131.1 gb:NM_007065.1

203270_at 2.74 gb:NM_012145.1 /DEF=Homo sapiens deoxythymidylate kinase (thymidylate kinase) (DTYMK), mRNA. /FEA=mRNA /GEN=DTYMK /PROD=deoxythymidylate kinase (thymidylate kinase) /DB_XREF=gi:6912339 /UG=Hs.79006 deoxythymidylate kinase (thymidylate kinase) /FL=gb:BC001827.1 gb:L16991.1 gb:NM_012145.1

219869_s_at 2.74 gb:NM_022154.1 /DEF=Homo sapiens up-regulated by BCG-CWS (LOC64116), mRNA. /FEA=mRNA /GEN=LOC64116 /PROD=up-regulated by BCG-CWS /DB_XREF=gi:11545899 /UG=Hs.284205 up-regulated by BCG-CWS /FL=gb:NM_022154.1

214290_s_at 2.74 Consensus includes gb:AI313324 /FEA=EST /DB_XREF=gi:4018929 /DB_XREF=est:ta77f02.x2

/CLONE=IMAGE:2050107 /UG=Hs.795 H2A histone family, member O 217785_s_at 2.74 gb:NM_006555.1 /DEF=Homo sapiens SNARE protein (YKT6), mRNA. /FEA=mRNA /GEN=YKT6 /PROD=SNARE

protein /DB_XREF=gi:5730119 /UG=Hs.296244 SNARE protein /FL=gb:U95735.1 gb:NM_006555.1 212873_at 2.73 Consensus includes gb:BE349017 /FEA=EST /DB_XREF=gi:9260870 /DB_XREF=est:ht48a03.x1

/CLONE=IMAGE:3149932 /UG=Hs.196914 minor histocompatibility antigen HA-1 202929_s_at 2.72 gb:NM_001355.2 /DEF=Homo sapiens D-dopachrome tautomerase (DDT), mRNA. /FEA=mRNA /GEN=DDT

/PROD=D-dopachrome tautomerase /DB_XREF=gi:5453630 /UG=Hs.180015 D-dopachrome tautomerase /FL=gb:U84143.1 gb:U49785.1 gb:NM_001355.2

55093_at 2.72 Cluster Incl. AA534198:nj21a11.s1 Homo sapiens cDNA, 3 end /clone=IMAGE-993116 /clone_end=3 /gb=AA534198 /gi=2278214 /ug=Hs.86392 /len=603

202736_s_at 2.71 Consensus includes gb:AA112507 /FEA=EST /DB_XREF=gi:1665056 /DB_XREF=est:zm28c01.r1 /CLONE=IMAGE:526944 /UG=Hs.76719 U6 snRNA-associated Sm-like protein /FL=gb:BC000387.1 gb:BC003652.1 gb:AF182290.1 gb:AF117235.1 gb:NM_012321.1 gb:AF251218.1

208977_x_at 2.71 gb:BC004188.1 /DEF=Homo sapiens, tubulin, beta, 2, clone MGC:2826, mRNA, complete cds. /FEA=mRNA /PROD=tubulin, beta, 2 /DB_XREF=gi:13278848 /UG=Hs.251653 tubulin, beta, 2 /FL=gb:BC002783.1 gb:BC002885.1 gb:BC001911.1 gb:BC004188.1 gb:NM_006088.1

210413_x_at 2.71 gb:U19557.1 /DEF=Human squamous cell carcinoma antigen 2 (SCCA2) mRNA, complete cds. /FEA=mRNA /GEN=SCCA2 /PROD=squamous cell carcinoma antigen 2 /DB_XREF=gi:1052870 /UG=Hs.123035 serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 4 /FL=gb:U19557.1

211003_x_at 2.71 gb:BC003551.1 /DEF=Homo sapiens, Similar to transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase), clone MGC:1193, mRNA, complete cds. /FEA=mRNA /PROD=Similar to transglutaminase 2 (C polypeptide,protein-glutamine-gamma-glutamyltransferase) /DB_XREF=gi:13097680 /UG=Hs.8265 transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase) /FL=gb:BC003551.1

203729_at 2.7 gb:NM_001425.1 /DEF=Homo sapiens epithelial membrane protein 3 (EMP3), mRNA. /FEA=mRNA /GEN=EMP3 /PROD=epithelial membrane protein 3 /DB_XREF=gi:4503562 /UG=Hs.9999 epithelial membrane protein 3 /FL=gb:U52101.1 gb:U87947.1 gb:NM_001425.1

207390_s_at 2.7 gb:NM_006932.1 /DEF=Homo sapiens smoothelin (SMTN), mRNA. /FEA=mRNA /GEN=SMTN /PROD=smoothelin /DB_XREF=gi:5902099 /UG=Hs.149098 smoothelin /FL=gb:NM_006932.1

208961_s_at 2.7 gb:AB017493.1 /DEF=Homo sapiens mRNA for DNA-binding zinc finger(GBF), complete cds. /FEA=mRNA /PROD=DNA-binding zinc finger(GBF) /DB_XREF=gi:3582142 /UG=Hs.285313 core promoter element binding protein /FL=gb:BC000311.1 gb:BC004301.1 gb:AF001461.1 gb:AB017493.1 gb:NM_001300.2

204928_s_at 2.67 gb:NM_019848.2 /DEF=Homo sapiens Protein P3 (P3), mRNA. /FEA=mRNA /GEN=P3 /PROD=Protein P3 /DB_XREF=gi:10938005 /UG=Hs.72980 Protein P3 /FL=gb:NM_019848.2

212233_at 2.67 Consensus includes gb:AL523076 /FEA=EST /DB_XREF=gi:12786569 /DB_XREF=est:AL523076 /CLONE=CS0DC001YI12 (3 prime) /UG=Hs.82503 H.sapiens mRNA for 3UTR of unknown protein

205483_s_at 2.67 gb:NM_005101.1 /DEF=Homo sapiens interferon-stimulated protein, 15 kDa (ISG15), mRNA. /FEA=mRNA /GEN=ISG15 /PROD=interferon-stimulated protein, 15 kDa /DB_XREF=gi:4826773 /UG=Hs.833 interferon-stimulated protein, 15 kDa /FL=gb:M13755.1 gb:NM_005101.1

204451_at 2.67 gb:NM_003505.1 /DEF=Homo sapiens frizzled (Drosophila) homolog 1 (FZD1), mRNA. /FEA=mRNA /GEN=FZD1 /PROD=frizzled 1 /DB_XREF=gi:4503824 /UG=Hs.94234 frizzled (Drosophila) homolog 1 /FL=gb:AB017363.1 gb:NM_003505.1 gb:AF072872.1

209357_at 2.66 gb:AF109161.1 /DEF=Homo sapiens p35srj (MRG1) mRNA, complete cds. /FEA=mRNA /GEN=MRG1 /PROD=p35srj /DB_XREF=gi:4193945 /UG=Hs.82071 Cbpp300-interacting transactivator, with GluAsp-rich

carboxy-terminal domain, 2 /FL=gb:BC004377.1 gb:AF109161.1 208712_at 2.66 gb:M73554.1 /DEF=Human bcl-1 mRNA, complete CDS. /FEA=mRNA /GEN=bcl-1 /PROD=bcl-1

/DB_XREF=gi:179364 /UG=Hs.82932 cyclin D1 (PRAD1: parathyroid adenomatosis 1) /FL=gb:BC000076.1 gb:M73554.1

213432_at 2.66 Consensus includes gb:AI697108 /FEA=EST /DB_XREF=gi:4985008 /DB_XREF=est:tq14g03.x1/CLONE=IMAGE:2208820 /UG=Hs.102482 mucin 5, subtype B, tracheobronchial

212782_x_at 2.65 Consensus includes gb:BG335629 /FEA=EST /DB_XREF=gi:13142067 /DB_XREF=est:602404254F1 /CLONE=IMAGE:4542084 /UG=Hs.80475 polymerase (RNA) II (DNA directed) polypeptide J (13.3kD)

204221_x_at 2.65 gb:U16307.1 /DEF=Human glioma pathogenesis-related protein (GliPR) mRNA, complete cds. /FEA=mRNA /GEN=GliPR /PROD=glioma pathogenesis-related protein /DB_XREF=gi:1100927 /UG=Hs.64639 glioma pathogenesis-related protein /FL=gb:U16307.1 gb:NM_006851.1

212878_s_at 2.65 Consensus includes gb:AA284075 /FEA=EST /DB_XREF=gi:1928356 /DB_XREF=est:zs49b01.s1 /CLONE=IMAGE:700777 /UG=Hs.117977 kinesin 2 (60-70kD)

208677_s_at 2.64 Consensus includes gb:AL550657 /FEA=EST /DB_XREF=gi:12887837 /DB_XREF=est:AL550657 /CLONE=CS0DI058YI15 (5 prime) /UG=Hs.74631 basigin (OK blood group) /FL=gb:M87879.1 gb:L20471.1 gb:D45131.1 gb:L10240.1 gb:NM_001728.1

202870_s_at 2.63 gb:NM_001255.1 /DEF=Homo sapiens CDC20 (cell division cycle 20, S. cerevisiae, homolog) (CDC20), mRNA. /FEA=mRNA /GEN=CDC20 /PROD=cell division cycle 20 /DB_XREF=gi:4557436 /UG=Hs.82906 CDC20 (cell division cycle 20, S. cerevisiae, homolog) /FL=gb:BC001088.1 gb:AF099644.1 gb:NM_001255.1 gb:U05340.1

209267_s_at 2.63 gb:AB040120.1 /DEF=Homo sapiens mRNA for BCG induced integral membrane protein BIGMo-103, complete cds. /FEA=mRNA /GEN=BIGMo-103 /PROD=BCG induced integral membrane protein BIGMo-103 /DB_XREF=gi:12657580 /UG=Hs.284205 up-regulated by BCG-CWS /FL=gb:AB040120.1

200783_s_at 2.63 gb:NM_005563.2 /DEF=Homo sapiens leukemia-associated phosphoprotein p18 (stathmin) (LAP18), mRNA. /FEA=mRNA /GEN=LAP18 /PROD=leukemia-associated phosphoprotein p18 /DB_XREF=gi:13518023 /UG=Hs.81915 leukemia-associated phosphoprotein p18 (stathmin) /FL=gb:NM_005563.2 gb:J04991.1

214687_x_at 2.62 Consensus includes gb:AK026577.1 /DEF=Homo sapiens cDNA: FLJ22924 fis, clone KAT06977, highly similar to HSALDAR Human fibroblast mRNA for aldolase A. /FEA=mRNA /DB_XREF=gi:10439461 /UG=Hs.273415 aldolase A, fructose-bisphosphate

201173_x_at 2.62 gb:NM_006600.1 /DEF=Homo sapiens nuclear distribution gene C (A.nidulans) homolog (NUDC), mRNA. /FEA=mRNA /GEN=NUDC /PROD=nuclear distribution gene C (A.nidulans)homolog /DB_XREF=gi:5729952 /UG=Hs.263812 nuclear distribution gene C (A.nidulans) homolog /FL=gb:BC002399.1 gb:BC003132.1 gb:AB019408.1 gb:AF130736.1 gb:AF125465.1 gb:AF100760.1 gb:NM_006600.1

211719_x_at 2.61 gb:BC005858.1 /DEF=Homo sapiens, clone MGC:3255, mRNA, complete cds. /FEA=mRNA /PROD=Unknown (protein for MGC:3255) /DB_XREF=gi:13543399 /FL=gb:BC005858.1

221512_at 2.6 gb:AL136683.1 /DEF=Homo sapiens mRNA; cDNA DKFZp564D0478 (from clone DKFZp564D0478); complete cds. /FEA=mRNA /GEN=DKFZp564D0478 /PROD=hypothetical protein /DB_XREF=gi:12052889 /UG=Hs.321214 Homo sapiens mRNA; cDNA DKFZp564D0478 (from clone DKFZp564D0478); complete cds /FL=gb:AL136683.1

205083_at 2.6 gb:NM_001159.2 /DEF=Homo sapiens aldehyde oxidase 1 (AOX1), mRNA. /FEA=mRNA /GEN=AOX1 /PROD=aldehyde oxidase 1 /DB_XREF=gi:6598319 /UG=Hs.174151 aldehyde oxidase 1 /FL=gb:AB046692.1 gb:L11005.1 gb:NM_001159.2

213338_at 2.6 Consensus includes gb:BF062629 /FEA=EST /DB_XREF=gi:10821539 /DB_XREF=est:7h62h07.x1 /CLONE=IMAGE:3320605 /UG=Hs.35861 DKFZP586E1621 protein

218115_at 2.59 gb:NM_018154.1 /DEF=Homo sapiens hypothetical protein FLJ10604 (FLJ10604), mRNA. /FEA=mRNA

/GEN=FLJ10604 /PROD=hypothetical protein FLJ10604 /DB_XREF=gi:8922548 /UG=Hs.26516 hypothetical protein FLJ10604 /FL=gb:NM_018154.1

216041_x_at 2.59 Consensus includes gb:AK023348.1 /DEF=Homo sapiens cDNA FLJ13286 fis, clone OVARC1001154, highly similar to Homo sapiens clone 24720 epithelin 1 and 2 mRNA. /FEA=mRNA /DB_XREF=gi:10435243 /UG=Hs.180577 granulin

201818_at 2.59 gb:NM_024830.1 /DEF=Homo sapiens hypothetical protein FLJ12443 (FLJ12443), mRNA. /FEA=mRNA /GEN=FLJ12443 /PROD=hypothetical protein FLJ12443 /DB_XREF=gi:13376233 /UG=Hs.179882 hypothetical protein FLJ12443 /FL=gb:NM_024830.1

214085_x_at 2.59 Consensus includes gb:AI912583 /FEA=EST /DB_XREF=gi:5632438 /DB_XREF=est:we11d05.x1 /CLONE=IMAGE:2340777 /UG=Hs.154762 HIV-1 rev binding protein 2

202017_at 2.58 gb:NM_000120.2 /DEF=Homo sapiens epoxide hydrolase 1, microsomal (xenobiotic) (EPHX1), mRNA. /FEA=mRNA /GEN=EPHX1 /PROD=epoxide hydrolase 1, microsomal (xenobiotic) /DB_XREF=gi:4557560 /UG=Hs.89649 epoxide hydrolase 1, microsomal (xenobiotic) /FL=gb:BC003567.1 gb:J03518.1 gb:L25878.1 gb:L25879.1 gb:NM_000120.2

202219_at 2.58 gb:NM_005629.1 /DEF=Homo sapiens solute carrier family 6 (neurotransmitter transporter, creatine), member 8 (SLC6A8), mRNA. /FEA=mRNA /GEN=SLC6A8 /PROD=solute carrier family 6 (neurotransmittertransporter, creatine), member 8 /DB_XREF=gi:5032096 /UG=Hs.187958 solute carrier family 6 (neurotransmitter transporter, creatine), member 8 /FL=gb:L31409.1 gb:NM_005629.1

208792_s_at 2.58 gb:M25915.1 /DEF=Human complement cytolysis inhibitor (CLI) mRNA, complete cds. /FEA=mRNA /DB_XREF=gi:180619 /UG=Hs.75106 clusterin (complement lysis inhibitor, SP-40,40, sulfated glycoprotein 2, testosterone-repressed prostate message 2, apolipoprotein J) /FL=gb:J02908.1 gb:M25915.1 gb:M64722.1 gb:NM_001831.1

204916_at 2.57 gb:NM_005855.1 /DEF=Homo sapiens receptor (calcitonin) activity modifying protein 1 (RAMP1), mRNA. /FEA=mRNA /GEN=RAMP1 /PROD=receptor (calcitonin) activity modifying protein1 precursor /DB_XREF=gi:5032018 /UG=Hs.32989 receptor (calcitonin) activity modifying protein 1 /FL=gb:BC000548.1 gb:NM_005855.1

210869_s_at 2.57 gb:M29277.1 /DEF=Human isolate JuSo MUC18 glycoprotein mRNA (3 variant), complete cds. /FEA=mRNA /PROD=MUC18 glycoprotein /DB_XREF=gi:530047 /UG=Hs.211579 melanoma adhesion molecule /FL=gb:M29277.1

204158_s_at 2.56 gb:NM_006019.1 /DEF=Homo sapiens T-cell, immune regulator 1 (TCIRG1), mRNA. /FEA=mRNA /GEN=TCIRG1 /PROD=ATPase, H+ transporting, 116kD /DB_XREF=gi:5174620 /UG=Hs.46465 T-cell, immune regulator 1 /FL=gb:U45285.1 gb:NM_006019.1

203879_at 2.56 gb:U86453.1 /DEF=Human phosphatidylinositol 3-kinase catalytic subunit p110delta mRNA, complete cds. /FEA=mRNA /PROD=phosphatidylinositol 3-kinase catalytic subunitp110delta /DB_XREF=gi:2317893 /UG=Hs.162808 phosphoinositide-3-kinase, catalytic, delta polypeptide /FL=gb:U86453.1 gb:NM_005026.1

209772_s_at 2.55 gb:X69397.1 /DEF=H.sapiens CD24 gene, complete CDS. /FEA=mRNA /GEN=CD24 /PROD=cell surface antigen /DB_XREF=gi:396167 /UG=Hs.286124 CD24 antigen (small cell lung carcinoma cluster 4 antigen) /FL=gb:X69397.1

52078_at 2.55 Cluster Incl. AI828080:wk31e09.x1 Homo sapiens cDNA, 3 end /clone=IMAGE-2413960 /clone_end=3 /gb=AI828080 /gi=5448751 /ug=Hs.4293 /len=544

202391_at 2.55 gb:NM_006317.1 /DEF=Homo sapiens brain acid-soluble protein 1 (BASP1), mRNA. /FEA=mRNA /GEN=BASP1 /PROD=brain acid-soluble protein 1 /DB_XREF=gi:5453749 /UG=Hs.79516 brain abundant, membrane attached signal protein 1 /FL=gb:BC000518.1 gb:AF039656.1 gb:NM_006317.1

203832_at 2.54 gb:NM_003095.1 /DEF=Homo sapiens small nuclear ribonucleoprotein polypeptide F (SNRPF), mRNA. /FEA=mRNA /GEN=SNRPF /PROD=small nuclear ribonucleoprotein polypeptide F /DB_XREF=gi:4507130 /UG=Hs.105465 small nuclear ribonucleoprotein polypeptide F /FL=gb:BC002505.1 gb:NM_003095.1

218494_s_at 2.54 gb:NM_020062.1 /DEF=Homo sapiens GLUT4 enhancer factor (GEF), mRNA. /FEA=mRNA /GEN=GEF /PROD=GLUT4 enhancer factor /DB_XREF=gi:13236503 /UG=Hs.170088 GLUT4 enhancer factor /FL=gb:AF249267.3 gb:NM_020062.1

218741_at 2.54 gb:NM_024053.1 /DEF=Homo sapiens hypothetical protein MGC861 (MGC861), mRNA. /FEA=mRNA /GEN=MGC861 /PROD=hypothetical protein MGC861 /DB_XREF=gi:13129021 /UG=Hs.208912 hypothetical protein MGC861 /FL=gb:BC000705.1 gb:NM_024053.1

203968_s_at 2.53 gb:NM_001254.1 /DEF=Homo sapiens CDC6 (cell division cycle 6, S. cerevisiae) homolog (CDC6), mRNA. /FEA=mRNA /GEN=CDC6 /PROD=CDC6 (cell division cycle 6, S. cerevisiae)homolog /DB_XREF=gi:4502702 /UG=Hs.69563 CDC6 (cell division cycle 6, S. cerevisiae) homolog /FL=gb:U77949.1 gb:AF022109.1 gb:NM_001254.1

204331_s_at 2.52 gb:NM_021107.1 /DEF=Homo sapiens mitochondrial ribosomal protein S12 (MRPS12), mRNA. /FEA=mRNA /GEN=MRPS12 /PROD=mitochondrial ribosomal protein S12 /DB_XREF=gi:11056055 /UG=Hs.9964 mitochondrial ribosomal protein S12 /FL=gb:NM_021107.1

203462_x_at 2.51 gb:NM_003751.1 /DEF=Homo sapiens eukaryotic translation initiation factor 3, subunit 9 (eta, 116kD) (EIF3S9), mRNA. /FEA=mRNA /GEN=EIF3S9 /PROD=eukaryotic translation initiation factor 3,subunit 9 (eta, 116kD) /DB_XREF=gi:4503526 /UG=Hs.57783 eukaryotic translation initiation factor 3, subunit 9 (eta, 116kD) /FL=gb:U62583.1 gb:NM_003751.1

219990_at 2.5 gb:NM_024680.1 /DEF=Homo sapiens hypothetical protein FLJ23311 (FLJ23311), mRNA. /FEA=mRNA /GEN=FLJ23311 /PROD=hypothetical protein FLJ23311 /DB_XREF=gi:13375949 /UG=Hs.94292 hypothetical protein FLJ23311 /FL=gb:NM_024680.1

200916_at 2.5 gb:NM_003564.1 /DEF=Homo sapiens transgelin 2 (TAGLN2), mRNA. /FEA=mRNA /GEN=TAGLN2 /PROD=transgelin 2 /DB_XREF=gi:4507356 /UG=Hs.75725 transgelin 2 /FL=gb:D21261.1 gb:NM_003564.1

32502_at 2.49 Cluster Incl. AL041124:DKFZp434D0316_s1 Homo sapiens cDNA, 3 end /clone=DKFZp434D0316 /clone_end=3 /gb=AL041124 /gi=5410060 /ug=Hs.6748 /len=719

212192_at 2.48 Consensus includes gb:AI718937 /FEA=EST /DB_XREF=gi:5036193 /DB_XREF=est:as50b04.x1 /CLONE=IMAGE:2320591 /UG=Hs.109438 Homo sapiens clone 24775 mRNA sequence

202284_s_at 2.48 gb:NM_000389.1 /DEF=Homo sapiens cyclin-dependent kinase inhibitor 1A (p21, Cip1) (CDKN1A), mRNA. /FEA=mRNA /GEN=CDKN1A /PROD=cyclin-dependent kinase inhibitor 1A (p21,Cip1) /DB_XREF=gi:11386202 /UG=Hs.179665 cyclin-dependent kinase inhibitor 1A (p21, Cip1) /FL=gb:NM_000389.1 gb:BC000275.1 gb:BC001935.1 gb:U03106.1 gb:L26165.1 gb:L25610.1 gb:U09579.1

206277_at 2.45 gb:NM_002564.1 /DEF=Homo sapiens purinergic receptor P2Y, G-protein coupled, 2 (P2RY2), mRNA. /FEA=mRNA /GEN=P2RY2 /PROD=purinergic receptor P2Y, G-protein coupled, 2 /DB_XREF=gi:4505558 /UG=Hs.339 purinergic receptor P2Y, G-protein coupled, 2 /FL=gb:NM_002564.1 gb:U07225.1

208024_s_at 2.44 gb:NM_005675.1 /DEF=Homo sapiens DiGeorge syndrome critical region gene 6 (DGCR6), mRNA. /FEA=mRNA /GEN=DGCR6 /PROD=DiGeorge syndrome critical region protein 6 /DB_XREF=gi:5031662 /UG=Hs.153910 DiGeorge syndrome critical region gene 6 /FL=gb:AF228707.1 gb:NM_005675.1

208973_at 2.44 gb:BC001072.1 /DEF=Homo sapiens, clone MGC:2683, mRNA, complete cds. /FEA=mRNA /PROD=Unknown (protein for MGC:2683) /DB_XREF=gi:12654484 /UG=Hs.151032 hypothetical protein MGC2683 /FL=gb:BC001072.1 gb:BC004456.1

202638_s_at 2.44 gb:NM_000201.1 /DEF=Homo sapiens intercellular adhesion molecule 1 (CD54), human rhinovirus receptor

(ICAM1), mRNA. /FEA=mRNA /GEN=ICAM1 /PROD=intercellular adhesion molecule 1 precursor /DB_XREF=gi:4557877 /UG=Hs.168383 intercellular adhesion molecule 1 (CD54), human rhinovirus receptor /FL=gb:M24283.1 gb:J03132.1 gb:NM_000201.1

48808_at 2.44 Cluster Incl. AI144299:qb59h06.x1 Homo sapiens cDNA, 3 end /clone=IMAGE-1704443 /clone_end=3 /gb=AI144299 /gi=3666108 /ug=Hs.106843 /len=765

AFFX-r2-Hs18SrRNA-M_x_at

2.44 M10098 Human 18S rRNA sequence, length 1969 bases, middle target bases 647-1292

201950_x_at 2.43 gb:NM_004930.1 /DEF=Homo sapiens capping protein (actin filament) muscle Z-line, beta (CAPZB), mRNA. /FEA=mRNA /GEN=CAPZB /PROD=F-actin capping protein beta subunit /DB_XREF=gi:4826658 /UG=Hs.76368 capping protein (actin filament) muscle Z-line, beta /FL=gb:NM_004930.1 gb:U03271.1

202619_s_at 2.43 Consensus includes gb:AI754404 /FEA=EST /DB_XREF=gi:5132668 /DB_XREF=est:cr24g06.x1 /CLONE=HBMSC_cr24g06 /UG=Hs.41270 procollagen-lysine, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase) 2 /FL=gb:U84573.1 gb:NM_000935.1

201466_s_at 2.42 gb:NM_002228.2 /DEF=Homo sapiens v-jun avian sarcoma virus 17 oncogene homolog (JUN), mRNA. /FEA=mRNA /GEN=JUN /PROD=v-jun avian sarcoma virus 17 oncogene homolog /DB_XREF=gi:7710122 /UG=Hs.78465 v-jun avian sarcoma virus 17 oncogene homolog /FL=gb:BC002646.1 gb:NM_002228.2

213476_x_at 2.42 Consensus includes gb:AL565749 /FEA=EST /DB_XREF=gi:12917434 /DB_XREF=est:AL565749 /CLONE=CS0DF007YJ03 (3 prime) /UG=Hs.159154 tubulin, beta, 4

204728_s_at 2.42 gb:NM_007086.1 /DEF=Homo sapiens AND-1 protein (AND-1), mRNA. /FEA=mRNA /GEN=AND-1 /PROD=AND-1 protein /DB_XREF=gi:5901891 /UG=Hs.72160 AND-1 protein /FL=gb:NM_007086.1

209482_at 2.4 gb:BC001430.1 /DEF=Homo sapiens, POP7 (processing of precursor, S. cerevisiae) homolog, clone MGC:1986, mRNA, complete cds. /FEA=mRNA /PROD=POP7 (processing of precursor, S. cerevisiae)homolog /DB_XREF=gi:12655150 /UG=Hs.18747 POP7 (processing of precursor, S. cerevisiae) homolog /FL=gb:BC001430.1 gb:U94316.1 gb:NM_005837.1

200736_s_at 2.4 gb:NM_000581.1 /DEF=Homo sapiens glutathione peroxidase 1 (GPX1), mRNA. /FEA=mRNA /GEN=GPX1 /PROD=glutathione peroxidase 1 /DB_XREF=gi:10834975 /UG=Hs.76686 glutathione peroxidase 1 /FL=gb:NM_000581.1 gb:BC000742.1 gb:M21304.1

200966_x_at 2.4 gb:NM_000034.1 /DEF=Homo sapiens aldolase A, fructose-bisphosphate (ALDOA), mRNA. /FEA=mRNA /GEN=ALDOA /PROD=aldolase A /DB_XREF=gi:4557304 /UG=Hs.273415 aldolase A, fructose-bisphosphate /FL=gb:BC004333.1 gb:M11560.1 gb:NM_000034.1

AFFX-M27830_M_at

2.4 M27830 Human 28S ribosomal RNA gene, complete cds (_5, _M, _3 represent transcript regions 5 prime, Middle, and 3 prime respectively)

212567_s_at 2.4 Consensus includes gb:AL523310 /FEA=EST /DB_XREF=gi:12786803 /DB_XREF=est:AL523310 /CLONE=CS0DC001YN06 (3 prime) /UG=Hs.150580 putative translation initiation factor

212212_s_at 2.39 Consensus includes gb:BF055496 /FEA=EST /DB_XREF=gi:10809392 /DB_XREF=est:7j80h12.x1 /CLONE=IMAGE:3392807 /UG=Hs.112184 DKFZP586J0619 protein

217294_s_at 2.39 Consensus includes gb:U88968.1 /DEF=Human alpha enolase like 1 (ENO1L1) mRNA, partial cds. /FEA=mRNA /GEN=ENO1L1 /PROD=alpha enolase like 1 /DB_XREF=gi:3282242 /UG=Hs.254105 enolase 1, (alpha)

218034_at 2.39 gb:NM_016068.1 /DEF=Homo sapiens CGI-135 protein (LOC51024), mRNA. /FEA=mRNA /GEN=LOC51024 /PROD=CGI-135 protein /DB_XREF=gi:7705631 /UG=Hs.84344 CGI-135 protein /FL=gb:BC003540.1 gb:AF151893.1 gb:NM_016068.1

211924_s_at 2.39 gb:AY029180.1 /DEF=Homo sapiens soluble urokinase plasminogen activator receptor precursor (SUPAR) mRNA,

complete cds. /FEA=CDS /GEN=SUPAR /PROD=soluble urokinase plasminogen activator receptorprecursor /DB_XREF=gi:13641308 /FL=gb:AY029180.1

201555_at 2.38 gb:NM_002388.2 /DEF=Homo sapiens minichromosome maintenance deficient (S. cerevisiae) 3 (MCM3), mRNA. /FEA=mRNA /GEN=MCM3 /PROD=minichromosome maintenance deficient (S.cerevisiae) 3 /DB_XREF=gi:6631094 /UG=Hs.179565 minichromosome maintenance deficient (S. cerevisiae) 3 /FL=gb:BC001626.1 gb:NM_002388.2 gb:D38073.1

205516_x_at 2.38 gb:NM_012127.1 /DEF=Homo sapiens Cip1-interacting zinc finger protein (CIZ1), mRNA. /FEA=mRNA /GEN=CIZ1 /PROD=Cip1-interacting zinc finger protein /DB_XREF=gi:6912307 /UG=Hs.23476 Cip1-interacting zinc finger protein /FL=gb:AB030835.1 gb:AF159025.1 gb:NM_012127.1

203411_s_at 2.38 gb:NM_005572.1 /DEF=Homo sapiens lamin AC (LMNA), mRNA. /FEA=mRNA /GEN=LMNA /PROD=lamin AC /DB_XREF=gi:5031874 /UG=Hs.77886 lamin AC /FL=gb:BC000511.1 gb:BC003162.1 gb:M13451.1 gb:NM_005572.1

202580_x_at 2.37 gb:NM_021953.1 /DEF=Homo sapiens forkhead box M1 (FOXM1), mRNA. /FEA=mRNA /GEN=FOXM1 /PROD=forkhead box M1 /DB_XREF=gi:11386144 /UG=Hs.239 forkhead box M1 /FL=gb:NM_021953.1 gb:U83113.1 gb:L16783.1

218493_at 2.37 gb:NM_024571.1 /DEF=Homo sapiens hypothetical protein FLJ22940 (FLJ22940), mRNA. /FEA=mRNA /GEN=FLJ22940 /PROD=hypothetical protein FLJ22940 /DB_XREF=gi:13443017 /UG=Hs.15277 hypothetical protein FLJ22940 /FL=gb:BC001381.1 gb:NM_024571.1

AFFX-M27830_5_at

2.37 M27830 Human 28S ribosomal RNA gene, complete cds (_5, _M, _3 represent transcript regions 5 prime, Middle, and 3 prime respectively)

210845_s_at 2.37 gb:U08839.1 /DEF=Human urokinase-type plasminogen activator receptor mRNA, complete cds. /FEA=mRNA /PROD=urokinase-type plasminogen activator receptor /DB_XREF=gi:517197 /UG=Hs.179657 plasminogen activator, urokinase receptor /FL=gb:U08839.1

205462_s_at 2.37 gb:NM_002149.1 /DEF=Homo sapiens hippocalcin-like 1 (HPCAL1), mRNA. /FEA=mRNA /GEN=HPCAL1 /PROD=hippocalcin-like 1 /DB_XREF=gi:4504474 /UG=Hs.3618 hippocalcin-like 1 /FL=gb:NM_002149.1 gb:D16227.1

213629_x_at 2.37 Consensus includes gb:BF246115 /FEA=EST /DB_XREF=gi:11160133 /DB_XREF=est:601854068F1 /CLONE=IMAGE:4073921 /UG=Hs.8765 RNA helicase-related protein

201082_s_at 2.36 gb:NM_004082.2 /DEF=Homo sapiens dynactin 1 (p150, Glued (Drosophila) homolog) (DCTN1), transcript variant 1, mRNA. /FEA=mRNA /GEN=DCTN1 /PROD=dynactin 1, isoform 1 /DB_XREF=gi:13259509 /UG=Hs.74617 dynactin 1 (p150, Glued (Drosophila) homolog) /FL=gb:NM_023019.1 gb:NM_004082.2

218060_s_at 2.36 gb:NM_024598.1 /DEF=Homo sapiens hypothetical protein FLJ13154 (FLJ13154), mRNA. /FEA=mRNA /GEN=FLJ13154 /PROD=hypothetical protein FLJ13154 /DB_XREF=gi:13375796 /UG=Hs.25303 hypothetical protein FLJ13154 /FL=gb:BC004415.1 gb:NM_024598.1

50314_i_at 2.36 Cluster Incl. AI761506:wi61b11.x1 Homo sapiens cDNA, 3 end /clone=IMAGE-2394717 /clone_end=3 /gb=AI761506 /gi=5177173 /ug=Hs.239692 /len=544

202718_at 2.36 gb:NM_000597.1 /DEF=Homo sapiens insulin-like growth factor binding protein 2 (36kD) (IGFBP2), mRNA. /FEA=mRNA /GEN=IGFBP2 /PROD=insulin-like growth factor binding protein 2(36kD) /DB_XREF=gi:10835156 /UG=Hs.162 insulin-like growth factor binding protein 2 (36kD) /FL=gb:NM_000597.1 gb:BC004312.1 gb:M35410.1

201954_at 2.36 gb:NM_005720.1 /DEF=Homo sapiens actin related protein 23 complex, subunit 1A (41 kD) (ARPC1B), mRNA. /FEA=mRNA /GEN=ARPC1B /PROD=actin related protein 23 complex, subunit 1A(41 kD) /DB_XREF=gi:5031600 /UG=Hs.11538 actin related protein 23 complex, subunit 1A (41 kD) /FL=gb:BC002562.1 gb:AF006084.1 gb:NM_005720.1

217992_s_at 2.36 gb:NM_024329.1 /DEF=Homo sapiens hypothetical protein MGC4342 (MGC4342), mRNA. /FEA=mRNA /GEN=MGC4342 /PROD=hypothetical protein MGC4342 /DB_XREF=gi:13443015 /UG=Hs.301342 hypothetical protein MGC4342 /FL=gb:BC003033.1 gb:NM_024329.1

202510_s_at 2.36 gb:NM_006291.1 /DEF=Homo sapiens tumor necrosis factor, alpha-induced protein 2 (TNFAIP2), mRNA. /FEA=mRNA /GEN=TNFAIP2 /PROD=tumor necrosis factor, alpha-induced protein 2 /DB_XREF=gi:5454133 /UG=Hs.101382 tumor necrosis factor, alpha-induced protein 2 /FL=gb:M92357.1 gb:NM_006291.1

209440_at 2.35 gb:BC001605.1 /DEF=Homo sapiens, phosphoribosyl pyrophosphate synthetase 1, clone MGC:2256, mRNA, complete cds. /FEA=mRNA /PROD=phosphoribosyl pyrophosphate synthetase 1 /DB_XREF=gi:12804406 /UG=Hs.56 phosphoribosyl pyrophosphate synthetase 1 /FL=gb:BC001605.1 gb:D00860.1

210524_x_at 2.35 gb:AF078844.1 /DEF=Homo sapiens hqp0376 protein mRNA, complete cds. /FEA=mRNA /PROD=hqp0376 protein /DB_XREF=gi:6683748 /UG=Hs.8765 RNA helicase-related protein /FL=gb:AF078844.1

203434_s_at 2.34 Consensus includes gb:AI433463 /FEA=EST /DB_XREF=gi:4289355 /DB_XREF=est:ti65g11.x1 /CLONE=IMAGE:2136932 /UG=Hs.1298 membrane metallo-endopeptidase (neutral endopeptidase, enkephalinase, CALLA, CD10) /FL=gb:J03779.1 gb:NM_007287.1 gb:NM_007288.1

206569_at 2.34 gb:NM_006850.1 /DEF=Homo sapiens suppression of tumorigenicity 16 (melanoma differentiation) (ST16), mRNA. /FEA=mRNA /GEN=ST16 /PROD=suppression of tumorigenicity 16 (melanomadifferentiation) /DB_XREF=gi:5803085 /UG=Hs.315463 suppression of tumorigenicity 16 (melanoma differentiation) /FL=gb:U16261.1 gb:NM_006850.1

209156_s_at 2.34 gb:AY029208.1 /DEF=Homo sapiens type VI collagen alpha 2 chain precursor (COL6A2) mRNA, complete cds, alternatively spliced. /FEA=mRNA /GEN=COL6A2 /PROD=type VI collagen alpha 2 chain precursor /DB_XREF=gi:13603393 /UG=Hs.159263 collagen, type VI, alpha 2 /FL=gb:AY029208.1

216606_x_at 2.33 Consensus includes gb:AL050332 /DEF=Human DNA sequence from clone RP4-570F3 on chromosome 6 Contains a gene similar to Rattus norvegicus synaptic ras GTPase-activating protein p135, the CICK0721Q.5 (polypeptide from patented cDNA Em:E06811) gene, the PHF1 (PHD finger protein 1) gen... /FEA=mRNA_1 /DB_XREF=gi:6010176 /UG=Hs.306238 acyl-protein

207850_at 2.33 gb:NM_002090.1 /DEF=Homo sapiens GRO3 oncogene (GRO3), mRNA. /FEA=mRNA /GEN=GRO3 /PROD=GRO3 oncogene /DB_XREF=gi:4504156 /UG=Hs.89690 GRO3 oncogene /FL=gb:M36821.1 gb:NM_002090.1

218154_at 2.33 gb:NM_024736.1 /DEF=Homo sapiens hypothetical protein FLJ12150 (FLJ12150), mRNA. /FEA=mRNA /GEN=FLJ12150 /PROD=hypothetical protein FLJ12150 /DB_XREF=gi:13376057 /UG=Hs.118983 hypothetical protein FLJ12150 /FL=gb:NM_024736.1

202757_at 2.33 gb:NM_015456.1 /DEF=Homo sapiens DKFZP586B0519 protein (DKFZP586B0519), mRNA. /FEA=mRNA /GEN=DKFZP586B0519 /PROD=DKFZP586B0519 protein /DB_XREF=gi:7661663 /UG=Hs.27633 DKFZP586B0519 protein /FL=gb:AL050280.1 gb:NM_015456.1

201618_x_at 2.33 gb:NM_003801.2 /DEF=Homo sapiens anchor attachment protein 1 (Gaa1p, yeast) homolog (GPAA1), mRNA./FEA=mRNA /GEN=GPAA1 /PROD=anchor attachment protein 1 /DB_XREF=gi:6031166 /UG=Hs.4742 anchor attachment protein 1 (Gaa1p, yeast) homolog /FL=gb:BC003171.1 gb:BC004129.1 gb:AB006969.1 gb:AB002135.1 gb:NM_003801.2

209318_x_at 2.33 Consensus includes gb:BG547855 /FEA=EST /DB_XREF=gi:13546520 /DB_XREF=est:602576153F1 /CLONE=IMAGE:4704108 /UG=Hs.75825 pleiomorphic adenoma gene-like 1 /FL=gb:U72621.3

209715_at 2.32 gb:L07515.1 /DEF=Human heterochromatin protein homologue (HP1) mRNA, complete cds. /FEA=mRNA /DB_XREF=gi:184310 /UG=Hs.89232 chromobox homolog 5 (Drosophila HP1 alpha) /FL=gb:L07515.1 gb:NM_012117.1

212464_s_at 2.32 Consensus includes gb:X02761.1 /DEF=Human mRNA for fibronectin (FN precursor). /FEA=mRNA /PROD=fibronectin precursor /DB_XREF=gi:31396 /UG=Hs.287820 fibronectin 1

201369_s_at 2.32 gb:NM_006887.1 /DEF=Homo sapiens butyrate response factor 2 (EGF-response factor 2) (BRF2), mRNA. /FEA=mRNA /GEN=BRF2 /PROD=butyrate response factor 2 (EGF-response factor2) /DB_XREF=gi:5901899 /UG=Hs.78909 butyrate response factor 2 (EGF-response factor 2) /FL=gb:BC005010.1 gb:NM_006887.1

209708_at 2.31 gb:AY007239.1 /DEF=Homo sapiens monooxygenase X mRNA, complete cds. /FEA=mRNA /PROD=monooxygenase X /DB_XREF=gi:9988949 /UG=Hs.6909 DKFZP564G202 protein /FL=gb:AY007239.1

218280_x_at 2.31 gb:NM_003516.1 /DEF=Homo sapiens H2A histone family, member O (H2AFO), mRNA. /FEA=mRNA /GEN=H2AFO /PROD=H2A histone family, member O /DB_XREF=gi:4504250 /UG=Hs.795 H2A histone family, member O /FL=gb:BC001629.1 gb:L19779.1 gb:NM_003516.1

205364_at 2.31 gb:NM_003500.1 /DEF=Homo sapiens acyl-Coenzyme A oxidase 2, branched chain (ACOX2), mRNA. /FEA=mRNA /GEN=ACOX2 /PROD=acyl-Coenzyme A oxidase 2, branched chain /DB_XREF=gi:4501868 /UG=Hs.9795 acyl-Coenzyme A oxidase 2, branched chain /FL=gb:NM_003500.1

212082_s_at 2.31 Consensus includes gb:BE734356 /FEA=EST /DB_XREF=gi:10148348 /DB_XREF=est:601565603F1 /CLONE=IMAGE:3840385 /UG=Hs.77385 myosin, light polypeptide 6, alkali, smooth muscle and non-muscle

208625_s_at 2.31 gb:AF104913.1 /DEF=Homo sapiens eukaryotic protein synthesis initiation factor mRNA, complete cds. /FEA=mRNA /PROD=eukaryotic protein synthesis initiation factor /DB_XREF=gi:3941723 /UG=Hs.211568 eukaryotic translation initiation factor 4 gamma, 1 /FL=gb:AF104913.1

211573_x_at 2.31 gb:M98478.1 /DEF=Human transglutaminase mRNA, complete cds. /FEA=mRNA /PROD=transglutaminase /DB_XREF=gi:339577 /UG=Hs.8265 transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase) /FL=gb:M98478.1

218681_s_at 2.31 gb:NM_022044.1 /DEF=Homo sapiens stromal cell-derived factor 2-like 1 (SDF2L1), mRNA. /FEA=mRNA /GEN=SDF2L1 /PROD=stromal cell-derived factor 2-like 1 /DB_XREF=gi:11545742 /UG=Hs.303116 stromal cell-derived factor 2-like 1 /FL=gb:AB043007.1 gb:NM_022044.1

204559_s_at 2.3 gb:NM_016199.1 /DEF=Homo sapiens U6 snRNA-associated Sm-like protein LSm7 (LOC51690), mRNA. /FEA=mRNA /GEN=LOC51690 /PROD=U6 snRNA-associated Sm-like protein LSm7 /DB_XREF=gi:7706422 /UG=Hs.70830 U6 snRNA-associated Sm-like protein LSm7 /FL=gb:AF182293.1 gb:NM_016199.1

37012_at 2.3 Cluster Incl. U03271:Human F-actin capping protein beta subunit mRNA, complete cds /cds=(0,818) /gb=U03271 /gi=595256 /ug=Hs.76368 /len=1077

220189_s_at 2.3 gb:NM_014275.1 /DEF=Homo sapiens mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isoenzyme B (MGAT4B), mRNA. /FEA=mRNA /GEN=MGAT4B /PROD=mannosyl (alpha-1,3-)-glycoproteinbeta-1,4-N-acetylglucosaminyltransferase, isoenzyme B /DB_XREF=gi:7710151 /UG=Hs.4867 mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isoenzyme B /FL=gb:AB000624.1 gb:NM_014275.1

209263_x_at 2.29 gb:BC000389.1 /DEF=Homo sapiens, transmembrane 4 superfamily member 7, clone MGC:8437, mRNA, complete cds. /FEA=mRNA /PROD=transmembrane 4 superfamily member 7 /DB_XREF=gi:12653240 /UG=Hs.26518 transmembrane 4 superfamily member 7 /FL=gb:BC000389.1 gb:AF022813.1 gb:AF054841.1 gb:NM_003271.1

200078_s_at 2.29 gb:BC005876.1 /DEF=Homo sapiens, ATPase, H+ transporting, lysosomal (vacuolar proton pump) 21kD, clone MGC:4498, mRNA, complete cds. /FEA=mRNA /PROD=ATPase, H+ transporting, lysosomal (vacuolarproton pump) 21kD /DB_XREF=gi:13543437 /FL=gb:BC005876.1

203300_x_at 2.29 gb:NM_003916.1 /DEF=Homo sapiens adaptor-related protein complex 1, sigma 2 subunit (AP1S2), mRNA. /FEA=mRNA /GEN=AP1S2 /PROD=adaptor-related protein complex 1, sigma 2subunit /DB_XREF=gi:4506956

/UG=Hs.40368 adaptor-related protein complex 1, sigma 2 subunit /FL=gb:AF251295.1 gb:BC001117.1 gb:AB015320.1 gb:NM_003916.1

220734_s_at 2.28 gb:NM_030575.1 /DEF=Homo sapiens hypothetical protein MGC10334 (MGC10334), mRNA. /FEA=mRNA /GEN=MGC10334 /PROD=hypothetical protein MGC10334 /DB_XREF=gi:13386487 /UG=Hs.302446 hypothetical protein MGC10334 /FL=gb:BC004366.1 gb:NM_030575.1

201185_at 2.28 gb:NM_002775.1 /DEF=Homo sapiens protease, serine, 11 (IGF binding) (PRSS11), mRNA. /FEA=mRNA /GEN=PRSS11 /PROD=protease, serine, 11 (IGF binding) /DB_XREF=gi:4506140 /UG=Hs.75111 protease, serine, 11 (IGF binding) /FL=gb:D87258.1 gb:NM_002775.1

201393_s_at 2.28 gb:NM_000876.1 /DEF=Homo sapiens insulin-like growth factor 2 receptor (IGF2R), mRNA. /FEA=mRNA /GEN=IGF2R /PROD=insulin-like growth factor 2 receptor /DB_XREF=gi:4504610 /UG=Hs.76473 insulin-like growth factor 2 receptor /FL=gb:J03528.1 gb:NM_000876.1

202669_s_at 2.27 gb:U16797.1 /DEF=Human LERK-5 (EPLG5) mRNA, complete cds. /FEA=mRNA /GEN=EPLG5 /PROD=LERK-5 /DB_XREF=gi:902370 /UG=Hs.30942 ephrin-B2 /FL=gb:U81262.1 gb:NM_004093.1 gb:L38734.1 gb:U16797.1

AFFX-HSAC07/X00351_5_at

2.27 X00351 Human mRNA for beta-actin (_5, _M, _3 represent transcript regions 5 prime, Middle, and 3 prime respectively)

202206_at 2.27 Consensus includes gb:AW450363 /FEA=EST /DB_XREF=gi:6991139 /DB_XREF=est:UI-H-BI3-akn-d-02-0-UI.s1 /CLONE=IMAGE:2734875 /UG=Hs.111554 ADP-ribosylation factor-like 7 /FL=gb:BC001051.1 gb:AB016811.1 gb:NM_005737.2

200632_s_at 2.26 gb:NM_006096.1 /DEF=Homo sapiens N-myc downstream regulated (NDRG1), mRNA. /FEA=mRNA /GEN=NDRG1 /PROD=N-myc downstream regulated /DB_XREF=gi:5174656 /UG=Hs.75789 N-myc downstream regulated /FL=gb:BC003175.1 gb:D87953.1 gb:AF004162.1 gb:NM_006096.1

217766_s_at 2.26 gb:NM_014313.1 /DEF=Homo sapiens small membrane protein 1 (SMP1), mRNA. /FEA=mRNA /GEN=SMP1 /PROD=small membrane protein 1 /DB_XREF=gi:7657594 /UG=Hs.107979 small membrane protein 1 /FL=gb:AL136627.1 gb:AF081282.1 gb:NM_014313.1

204175_at 2.25 gb:NM_015871.1 /DEF=Homo sapiens zinc finger protein (LOC51042), mRNA. /FEA=mRNA /GEN=LOC51042 /PROD=zinc finger protein /DB_XREF=gi:7705661 /UG=Hs.102419 zinc finger protein /FL=gb:BC002580.1 gb:D45213.1 gb:NM_015871.1

207172_s_at 2.25 gb:NM_001797.1 /DEF=Homo sapiens cadherin 11, type 2, OB-cadherin (osteoblast) (CDH11), mRNA. /FEA=mRNA /GEN=CDH11 /PROD=cadherin 11, type 2, OB-cadherin (osteoblast) /DB_XREF=gi:4502716 /UG=Hs.75929 cadherin 11, type 2, OB-cadherin (osteoblast) /FL=gb:NM_001797.1 gb:L34056.1 gb:D21254.1

212647_at 2.24 Consensus includes gb:NM_006270.1 /DEF=Homo sapiens related RAS viral (r-ras) oncogene homolog (RRAS), mRNA. /FEA=CDS /GEN=RRAS /PROD=related RAS viral (r-ras) oncogene homolog /DB_XREF=gi:5454027 /UG=Hs.9651 related RAS viral (r-ras) oncogene homolog /FL=gb:NM_006270.1

215101_s_at 2.24 Consensus includes gb:BG166705 /FEA=EST /DB_XREF=gi:12673408 /DB_XREF=est:602339217F1 /CLONE=IMAGE:4447013 /UG=Hs.89714 small inducible cytokine subfamily B (Cys-X-Cys), member 5 (epithelial-derived neutrophil-activating peptide 78)

200787_s_at 2.24 gb:BC002426.1 /DEF=Homo sapiens, phosphoprotein enriched in astrocytes 15, clone MGC:1685, mRNA, complete cds. /FEA=mRNA /PROD=phosphoprotein enriched in astrocytes 15 /DB_XREF=gi:12803230 /UG=Hs.194673 phosphoprotein enriched in astrocytes 15 /FL=gb:BC002426.1 gb:NM_003768.1

201109_s_at 2.23 Consensus includes gb:AV726673 /FEA=EST /DB_XREF=gi:10836094 /DB_XREF=est:AV726673 /CLONE=HTCBGC12 /UG=Hs.87409 thrombospondin 1 /FL=gb:NM_003246.1

201245_s_at 2.23 Consensus includes gb:AL523776 /FEA=EST /DB_XREF=gi:12787269 /DB_XREF=est:AL523776

/CLONE=CS0DC003YC23 (5 prime) /UG=Hs.108504 hypothetical protein FLJ20113 /FL=gb:NM_017670.1 205743_at 2.23 gb:NM_003149.1 /DEF=Homo sapiens src homology three (SH3) and cysteine rich domain (STAC), mRNA.

/FEA=mRNA /GEN=STAC /PROD=src homology three (SH3) and cysteine richdomain /DB_XREF=gi:4507246 /UG=Hs.56045 src homology three (SH3) and cysteine rich domain /FL=gb:D86640.1 gb:NM_003149.1

208688_x_at 2.23 gb:U78525.1 /DEF=Homo sapiens eukaryotic translation initiation factor (eIF3) mRNA, complete cds. /FEA=mRNA /GEN=eIF3 /PROD=eukaryotic translation initiation factor /DB_XREF=gi:2558667 /UG=Hs.57783 eukaryotic translation initiation factor 3, subunit 9 (eta, 116kD) /FL=gb:U78525.1

221263_s_at 2.23 gb:NM_031287.1 /DEF=Homo sapiens hypothetical protein MGC3133 (MGC3133), mRNA. /FEA=mRNA /GEN=MGC3133 /PROD=hypothetical protein MGC3133 /DB_XREF=gi:13775199 /FL=gb:NM_031287.1

200885_at 2.22 gb:NM_005167.1 /DEF=Homo sapiens ras homolog gene family, member C (ARHC), mRNA. /FEA=mRNA /GEN=ARHC /PROD=ras homolog gene family, member C /DB_XREF=gi:4885066 /UG=Hs.179735 ras homolog gene family, member C /FL=gb:L25081.1 gb:NM_005167.1

36936_at 2.22 Cluster Incl. U58766:Human FX protein mRNA, complete cds /cds=(74,1039) /gb=U58766 /gi=1381178 /ug=Hs.75801 /len=1330

218636_s_at 2.22 gb:NM_016219.1 /DEF=Homo sapiens alpha 1,2-mannosidase (LOC51697), mRNA. /FEA=mRNA /GEN=LOC51697 /PROD=alpha 1,2-mannosidase /DB_XREF=gi:7706436 /UG=Hs.279881 alpha 1,2-mannosidase /FL=gb:BC002953.1 gb:AF148509.1 gb:NM_016219.1

202123_s_at 2.22 gb:NM_005157.2 /DEF=Homo sapiens v-abl Abelson murine leukemia viral oncogene homolog 1 (ABL1), transcript variant a, mRNA. /FEA=mRNA /GEN=ABL1 /PROD=v-abl Abelson murine leukemia viral oncogenehomolog 1 isoform a /DB_XREF=gi:6382056 /UG=Hs.146355 v-abl Abelson murine leukemia viral oncogene homolog 1 /FL=gb:M14752.1 gb:NM_005157.2

202587_s_at 2.22 gb:BC001116.1 /DEF=Homo sapiens, adenylate kinase 1, clone MGC:1808, mRNA, complete cds. /FEA=mRNA /PROD=adenylate kinase 1 /DB_XREF=gi:12654562 /UG=Hs.76240 adenylate kinase 1 /FL=gb:BC001116.1 gb:NM_000476.1 gb:AB021871.1

212430_at 2.22 Consensus includes gb:AL109955 /DEF=Human DNA sequence from clone RP4-800J21 on chromosome 20 Contains ESTs, STSs, GSSs and CpG islands. Contains the 3 part of the RAE1 gene for a homolog to RNA export protein 1 from S.pombe and the gene for the ssDNA binding protein SEB4D.n /FEA=mRNA_1 /DB_XREF=gi:11558768 /UG=Hs.236361 seb4D

212016_s_at 2.21 Consensus includes gb:AA679988 /FEA=EST /DB_XREF=gi:2656455 /DB_XREF=est:ag51f11.s1 /CLONE=IMAGE:1126509 /UG=Hs.172550 polypyrimidine tract binding protein (heterogeneous nuclear ribonucleoprotein I)

218188_s_at 2.21 gb:NM_012458.1 /DEF=Homo sapiens translocase of inner mitochondrial membrane 13 (yeast) homolog B (TIMM13B), mRNA. /FEA=mRNA /GEN=TIMM13B /PROD=translocase of inner mitochondrial membrane 13(yeast) homolog B /DB_XREF=gi:11024699 /UG=Hs.23410 translocase of inner mitochondrial membrane 13 (yeast) homolog B /FL=gb:NM_012458.1 gb:AF144700.1 gb:AF152352.1

203054_s_at 2.21 gb:NM_022171.1 /DEF=Homo sapiens T-cell leukemia translocation altered gene (TCTA), mRNA. /FEA=mRNA /GEN=TCTA /PROD=T-cell leukemia translocation altered gene /DB_XREF=gi:11560140 /UG=Hs.250894 T-cell leukemia translocation altered gene /FL=gb:NM_022171.1 gb:BC005157.1

216841_s_at 2.21 Consensus includes gb:X15132.1 /DEF=Human mRNA for manganese containing superoxide dismutase (EC 1.15.1.1). /FEA=mRNA /DB_XREF=gi:34794 /UG=Hs.318885 superoxide dismutase 2, mitochondrial

205498_at 2.2 gb:NM_000163.1 /DEF=Homo sapiens growth hormone receptor (GHR), mRNA. /FEA=mRNA /GEN=GHR /PROD=growth hormone receptor /DB_XREF=gi:4503992 /UG=Hs.125180 growth hormone receptor /FL=gb:NM_000163.1

201578_at 2.2 gb:NM_005397.1 /DEF=Homo sapiens podocalyxin-like (PODXL), mRNA. /FEA=mRNA /GEN=PODXL /PROD=podocalyxin-like /DB_XREF=gi:4885556 /UG=Hs.16426 podocalyxin-like /FL=gb:U97519.1 gb:NM_005397.1

203767_s_at 2.2 Consensus includes gb:AI122754 /FEA=EST /DB_XREF=gi:3538520 /DB_XREF=est:qa48e01.x1 /CLONE=IMAGE:1690008 /UG=Hs.79876 steroid sulfatase (microsomal), arylsulfatase C, isozyme S /FL=gb:NM_000351.2 gb:M16505.1 gb:J04964.1

211060_x_at 2.19 gb:BC006383.1 /DEF=Homo sapiens, clone MGC:12663, mRNA, complete cds. /FEA=mRNA /PROD=Unknown (protein for MGC:12663) /DB_XREF=gi:13623546 /FL=gb:BC006383.1

201541_s_at 2.19 gb:NM_006349.1 /DEF=Homo sapiens putative cyclin G1 interacting protein (CG1I), mRNA. /FEA=mRNA /GEN=CG1I /PROD=putative cyclin G1 interacting protein /DB_XREF=gi:5453616 /UG=Hs.10028 putative cyclin G1 interacting protein /FL=gb:U61837.1 gb:NM_006349.1

201168_x_at 2.19 gb:NM_004309.1 /DEF=Homo sapiens Rho GDP dissociation inhibitor (GDI) alpha (ARHGDIA), mRNA. /FEA=mRNA /GEN=ARHGDIA /PROD=Rho GDP dissociation inhibitor (GDI) alpha /DB_XREF=gi:4757767 /UG=Hs.159161 Rho GDP dissociation inhibitor (GDI) alpha /FL=gb:D13989.1 gb:M97579.1 gb:NM_004309.1

219500_at 2.19 gb:NM_013246.1 /DEF=Homo sapiens cardiotrophin-like cytokine; neurotrophin-1B-cell stimulating factor-3 (CLC), mRNA. /FEA=mRNA /GEN=CLC /PROD=cardiotrophin-like cytokine;neurotrophin-1B-cell stimulating factor-3 /DB_XREF=gi:7019350 /UG=Hs.132004 cardiotrophin-like cytokine; neurotrophin-1B-cell stimulating factor-3 /FL=gb:AF172854.1 gb:AF176911.1 gb:NM_013246.1

211358_s_at 2.18 gb:AF234161.1 /DEF=Homo sapiens nuclear protein NP94b (NP94) mRNA, complete cds, alternatively spliced. /FEA=mRNA /GEN=NP94 /PROD=nuclear protein NP94b /DB_XREF=gi:7188807 /UG=Hs.23476 Cip1-interacting zinc finger protein /FL=gb:AF234161.1

202424_at 2.17 gb:NM_030662.1 /DEF=Homo sapiens mitogen-activated protein kinase kinase 2 (MAP2K2), mRNA. /FEA=mRNA /GEN=MAP2K2 /PROD=mitogen-activated protein kinase kinase 2 /DB_XREF=gi:13489053 /UG=Hs.72241 mitogen-activated protein kinase kinase 2 /FL=gb:BC000471.1 gb:NM_030662.1

218770_s_at 2.17 gb:NM_018056.1 /DEF=Homo sapiens hypothetical protein FLJ10315 (FLJ10315), mRNA. /FEA=mRNA /GEN=FLJ10315 /PROD=hypothetical protein FLJ10315 /DB_XREF=gi:8922347 /UG=Hs.25544 hypothetical protein FLJ10315 /FL=gb:AL136695.1 gb:NM_018056.1

211284_s_at 2.17 gb:BC000324.1 /DEF=Homo sapiens, Similar to granulin, clone MGC:8480, mRNA, complete cds. /FEA=mRNA /PROD=Similar to granulin /DB_XREF=gi:12653114 /UG=Hs.180577 granulin /FL=gb:BC000324.1

202096_s_at 2.16 gb:NM_000714.2 /DEF=Homo sapiens benzodiazapine receptor (peripheral) (BZRP), nuclear gene encoding mitochondrial protein, transcript variant PBR, mRNA. /FEA=mRNA /GEN=BZRP /PROD=peripheral benzodiazapine receptor /DB_XREF=gi:6382068 /UG=Hs.202 benzodiazapine receptor (peripheral) /FL=gb:BC001110.1 gb:M36035.1 gb:NM_000714.2

217949_s_at 2.16 gb:NM_024006.1 /DEF=Homo sapiens hypothetical protein IMAGE3455200 (IMAGE3455200), mRNA. /FEA=mRNA /GEN=IMAGE3455200 /PROD=hypothetical protein IMAGE3455200 /DB_XREF=gi:13124769 /UG=Hs.324844 hypothetical protein IMAGE3455200 /FL=gb:BC002911.1 gb:NM_024006.1

201115_at 2.16 gb:NM_006230.1 /DEF=Homo sapiens polymerase (DNA directed), delta 2, regulatory subunit (50kD) (POLD2), mRNA. /FEA=mRNA /GEN=POLD2 /PROD=polymerase (DNA directed), delta 2, regulatorysubunit (50kD) /DB_XREF=gi:5453923 /UG=Hs.74598 polymerase (DNA directed), delta 2, regulatory subunit (50kD) /FL=gb:U21090.1 gb:BC000459.1 gb:NM_006230.1

210428_s_at 2.16 gb:AF260566.1 /DEF=Homo sapiens hepatocyte growth factor-regulated tyrosine kinase substrate HRS isoform 2 (HRS) mRNA, complete cds. /FEA=mRNA /GEN=HRS /PROD=hepatocyte growth factor-regulated tyrosinekinase substrate HRS isoform 2 /DB_XREF=gi:9022388 /UG=Hs.24756 hepatocyte growth factor-regulated tyrosine

kinase substrate /FL=gb:AF260566.1 202888_s_at 2.16 gb:NM_001150.1 /DEF=Homo sapiens alanyl (membrane) aminopeptidase (aminopeptidase N, aminopeptidase M,

microsomal aminopeptidase, CD13, p150) (ANPEP), mRNA. /FEA=mRNA /GEN=ANPEP /PROD=membrane alanine aminopeptidase precursor /DB_XREF=gi:4502094 /UG=Hs.1239 alanyl (membrane) aminopeptidase (aminopeptidase N, aminopeptidase M, microsomal aminopeptidase, CD13, p150) /FL=gb:M22324.1 gb:NM_001150.1

209821_at 2.15 gb:AB024518.1 /DEF=Homo sapiens mRNA for DVS27-related protein, complete cds. /FEA=mRNA /GEN=DVS27 /PROD=DVS27-related protein /DB_XREF=gi:4520327 /UG=Hs.58589 glycogenin 2 /FL=gb:AB024518.1

210042_s_at 2.15 gb:AF073890.1 /DEF=Homo sapiens cathepsin X precursor, mRNA, complete cds. /FEA=mRNA /PROD=cathepsin X precursor /DB_XREF=gi:3650497 /UG=Hs.252549 cathepsin Z /FL=gb:AF032906.1 gb:AF073890.1 gb:NM_001336.1 gb:AF136273.1

201801_s_at 2.15 gb:AF079117.1 /DEF=Homo sapiens equilibrative NBMPR-sensitive nucleoside transporter (ENT1) mRNA, complete cds. /FEA=mRNA /GEN=ENT1 /PROD=equilibrative NBMPR-sensitive nucleosidetransporter /DB_XREF=gi:3694939 /UG=Hs.25450 solute carrier family 29 (nucleoside transporters), member 1 /FL=gb:BC001382.1 gb:U81375.1 gb:AF079117.1 gb:NM_004955.1

204257_at 2.14 gb:NM_021727.1 /DEF=Homo sapiens fatty acid desaturase 3 (FADS3), mRNA. /FEA=mRNA /GEN=FADS3 /PROD=fatty acid desaturase 3 /DB_XREF=gi:13375615 /UG=Hs.21765 fatty acid desaturase 3 /FL=gb:AF084560.1 gb:NM_021727.1 gb:BC004901.1 gb:AF134404.1

204604_at 2.14 gb:NM_012395.1 /DEF=Homo sapiens PFTAIRE protein kinase 1 (PFTK1), mRNA. /FEA=mRNA /GEN=PFTK1 /PROD=PFTAIRE protein kinase 1 /DB_XREF=gi:6912583 /UG=Hs.57856 PFTAIRE protein kinase 1 /FL=gb:AB020641.1 gb:NM_012395.1

65884_at 2.14 Cluster Incl. AA631254:nq81c12.s1 Homo sapiens cDNA, 3 end /clone=IMAGE-1158742 /clone_end=3 /gb=AA631254 /gi=2553865 /ug=Hs.4814 /len=876

212554_at 2.13 Consensus includes gb:N90755 /FEA=EST /DB_XREF=gi:1444082 /DB_XREF=est:zb22c08.s1 /CLONE=IMAGE:302798 /UG=Hs.296341 adenylyl cyclase-associated protein 2 /FL=gb:U02390.1 gb:NM_006366.1

212386_at 2.13 Consensus includes gb:BF592782 /FEA=EST /DB_XREF=gi:11685106 /DB_XREF=est:7j94d06.x1 /CLONE=IMAGE:3442594 /UG=Hs.289068 Homo sapiens cDNA FLJ11918 fis, clone HEMBB1000272

209373_at 2.13 gb:BC003179.1 /DEF=Homo sapiens, clone MGC:4419, mRNA, complete cds. /FEA=mRNA /PROD=Unknown (protein for MGC:4419) /DB_XREF=gi:13112010 /UG=Hs.185055 BENE protein /FL=gb:BC003179.1 gb:NM_005434.1

209260_at 2.12 gb:BC000329.1 /DEF=Homo sapiens, stratifin, clone MGC:8516, mRNA, complete cds. /FEA=mRNA /PROD=stratifin /DB_XREF=gi:12653124 /UG=Hs.184510 stratifin /FL=gb:BC000329.1 gb:BC000995.2 gb:BC002995.1 gb:M93010.1 gb:AF029082.1 gb:NM_006142.1

219763_at 2.12 gb:NM_024820.1 /DEF=Homo sapiens KIAA1608 protein (KIAA1608), mRNA. /FEA=mRNA /GEN=KIAA1608 /PROD=hypothetical protein FLJ21129 /DB_XREF=gi:13449264 /UG=Hs.300842 KIAA1608 protein /FL=gb:NM_024820.1

208795_s_at 2.12 gb:D55716.1 /DEF=Human mRNA for P1cdc47, complete cds. /FEA=mRNA /GEN=P1cdc47 /PROD=P1cdc47 /DB_XREF=gi:1255616 /UG=Hs.77152 minichromosome maintenance deficient (S. cerevisiae) 7 /FL=gb:D55716.1

201231_s_at 2.12 gb:NM_001428.1 /DEF=Homo sapiens enolase 1, (alpha) (ENO1), mRNA. /FEA=mRNA /GEN=ENO1 /PROD=enolase 1, (alpha) /DB_XREF=gi:4503570 /UG=Hs.254105 enolase 1, (alpha) /FL=gb:BC001810.1 gb:BC004458.1 gb:M14328.1 gb:NM_001428.1

206595_at 2.11 gb:NM_001323.1 /DEF=Homo sapiens cystatin EM (CST6), mRNA. /FEA=mRNA /GEN=CST6 /PROD=cystatin M

/DB_XREF=gi:4503112 /UG=Hs.83393 cystatin EM /FL=gb:U62800.1 gb:U81233.1 gb:NM_001323.1 220607_x_at 2.11 gb:NM_016397.1 /DEF=Homo sapiens TH1 drosophila homolog (HSPC130), mRNA. /FEA=mRNA

/GEN=HSPC130 /PROD=TH1 drosophila homolog /DB_XREF=gi:7705462 /UG=Hs.5184 TH1 drosophila homolog /FL=gb:AF161479.1 gb:NM_016397.1

211066_x_at 2.1 gb:BC006439.1 /DEF=Homo sapiens, Similar to protocadherin gamma subfamily A, 5, clone MGC:13163, mRNA, complete cds. /FEA=mRNA /PROD=Similar to protocadherin gamma subfamily A, 5 /DB_XREF=gi:13623638 /FL=gb:BC006439.1

1053_at 2.1 M87338 /FEATURE= /DEFINITION=HUMA1SBU Human replication factor C, 40-kDa subunit (A1) mRNA, complete cds

213008_at 2.09 Consensus includes gb:BG403615 /FEA=EST /DB_XREF=gi:13297063 /DB_XREF=est:602419331F1 /CLONE=IMAGE:4526406 /UG=Hs.80961 polymerase (DNA directed), gamma

210517_s_at 2.09 gb:AB003476.1 /DEF=Homo sapiens mRNA for gravin, complete cds. /FEA=mRNA /PROD=gravin /DB_XREF=gi:2081606 /UG=Hs.788 A kinase (PRKA) anchor protein (gravin) 12 /FL=gb:AB003476.1

209204_at 2.08 Consensus includes gb:AI824831 /FEA=EST /DB_XREF=gi:5445502 /DB_XREF=est:wb02d08.x1 /CLONE=IMAGE:2304495 /UG=Hs.3844 LIM domain only 4 /FL=gb:BC003600.1 gb:U24576.1 gb:NM_006769.2

222036_s_at 2.08 Consensus includes gb:AI859865 /FEA=EST /DB_XREF=gi:5513481 /DB_XREF=est:wm21f03.x1 /CLONE=IMAGE:2436605 /UG=Hs.154443 minichromosome maintenance deficient (S. cerevisiae) 4

213007_at 2.08 Consensus includes gb:W74442 /FEA=EST /DB_XREF=gi:1384777 /DB_XREF=est:zd75e09.s1 /CLONE=IMAGE:346504 /UG=Hs.80961 polymerase (DNA directed), gamma

215280_s_at 2.08 Consensus includes gb:AK023850.1 /DEF=Homo sapiens cDNA FLJ13788 fis, clone SKNMC1000046, highly similar to Homo sapiens liprin-alpha3 mRNA. /FEA=mRNA /DB_XREF=gi:10435912 /UG=Hs.109299 protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3

210978_s_at 2.07 gb:BC002616.1 /DEF=Homo sapiens, transgelin 2, clone MGC:2989, mRNA, complete cds. /FEA=mRNA /PROD=transgelin 2 /DB_XREF=gi:12803566 /UG=Hs.75725 transgelin 2 /FL=gb:BC002616.1

216242_x_at 2.07 Consensus includes gb:AW402635 /FEA=EST /DB_XREF=gi:6921341 /DB_XREF=est:UI-HF-BK0-aav-a-09-0-UI.r1 /CLONE=IMAGE:3055001 /UG=Hs.80475 polymerase (RNA) II (DNA directed) polypeptide J (13.3kD)

210830_s_at 2.07 gb:AF001602.1 /DEF=Homo sapiens paraoxonase (PON2) mRNA, with alternatively spliced exon 3, complete cds. /FEA=mRNA /GEN=PON2 /PROD=paraoxonase /DB_XREF=gi:2228776 /UG=Hs.169857 paraoxonase 2 /FL=gb:AF001602.1

212624_s_at 2.06 Consensus includes gb:BF339445 /FEA=EST /DB_XREF=gi:11285900 /DB_XREF=est:602038795F1 /CLONE=IMAGE:4186582 /UG=Hs.169965 chimerin (chimaerin) 1

221830_at 2.06 Consensus includes gb:AI302106 /FEA=EST /DB_XREF=gi:3961452 /DB_XREF=est:qn57h10.x1 /CLONE=IMAGE:1902403 /UG=Hs.301746 RAP2A, member of RAS oncogene family /FL=gb:NM_021033.1

217388_s_at 2.06 Consensus includes gb:D55639.1 /DEF=Human monocyte PABL (pseudoautosomal boundary-like sequence) mRNA, clone Mo1. /FEA=mRNA /DB_XREF=gi:1255614 /UG=Hs.169139 kynureninase (L-kynurenine hydrolase)

207943_x_at 2.06 gb:NM_006718.1 /DEF=Homo sapiens pleiomorphic adenoma gene-like 1 (PLAGL1), transcript variant 2, mRNA. /FEA=mRNA /GEN=PLAGL1 /PROD=pleiomorphic adenoma gene-like 1 isoform 2 /DB_XREF=gi:6031193 /UG=Hs.75825 pleiomorphic adenoma gene-like 1 /FL=gb:NM_006718.1

208336_s_at 2.06 gb:NM_004868.1 /DEF=Homo sapiens glycoprotein, synaptic 2 (GPSN2), mRNA. /FEA=mRNA /GEN=GPSN2 /PROD=glycoprotein, synaptic 2 /DB_XREF=gi:4759061 /UG=Hs.306122 glycoprotein, synaptic 2 /FL=gb:AF038959.1 gb:NM_004868.1

AFFX-r2-Hs18SrRNA-

2.05 M10098 Human 18S rRNA sequence, length 1969 bases, 3 prime target bases 1293-1938

3_s_at212625_at 2.05 Consensus includes gb:NM_003765.1 /DEF=Homo sapiens syntaxin 10 (STX10), mRNA. /FEA=CDS /GEN=STX10

/PROD=syntaxin 10 /DB_XREF=gi:4507284 /UG=Hs.43812 syntaxin 10 /FL=gb:AF035531.1 gb:NM_003765.1 205588_s_at 2.05 gb:NM_007045.1 /DEF=Homo sapiens FGFR1 oncogene partner (FOP), mRNA. /FEA=mRNA /GEN=FOP

/PROD=FGFR1 oncogene partner /DB_XREF=gi:5901953 /UG=Hs.180296 FGFR1 oncogene partner /FL=gb:NM_007045.1

219493_at 2.04 gb:NM_024745.1 /DEF=Homo sapiens hypothetical protein FLJ22009 (FLJ22009), mRNA. /FEA=mRNA /GEN=FLJ22009 /PROD=hypothetical protein FLJ22009 /DB_XREF=gi:13376069 /UG=Hs.123253 hypothetical protein FLJ22009 /FL=gb:NM_024745.1

218111_s_at 2.04 gb:NM_018686.1 /DEF=Homo sapiens CMP-N-acetylneuraminic acid synthase (LOC55907), mRNA. /FEA=mRNA /GEN=LOC55907 /PROD=CMP-N-acetylneuraminic acid synthase /DB_XREF=gi:8923899 /UG=Hs.12492 CMP-N-acetylneuraminic acid synthase /FL=gb:AF271388.1 gb:NM_018686.1

202954_at 2.04 gb:NM_007019.1 /DEF=Homo sapiens ubiquitin carrier protein E2-C (UBCH10), mRNA. /FEA=mRNA /GEN=UBCH10 /PROD=ubiquitin carrier protein E2-C /DB_XREF=gi:5902145 /UG=Hs.93002 ubiquitin carrier protein E2-C /FL=gb:U73379.1 gb:NM_007019.1

214679_x_at 2.04 Consensus includes gb:AL110227.1 /DEF=Homo sapiens mRNA; cDNA DKFZp434J194 (from clone DKFZp434J194). /FEA=mRNA /DB_XREF=gi:5817165 /UG=Hs.323067 Homo sapiens mRNA; cDNA DKFZp434J194 (from clone DKFZp434J194)

207163_s_at 2.04 gb:NM_005163.1 /DEF=Homo sapiens v-akt murine thymoma viral oncogene homolog 1 (AKT1), mRNA. /FEA=mRNA /GEN=AKT1 /PROD=serinethreonine protein kinase /DB_XREF=gi:4885060 /UG=Hs.71816 v-akt murine thymoma viral oncogene homolog 1 /FL=gb:M63167.1 gb:NM_005163.1

58696_at 2.03 Cluster Incl. AL039469:DKFZp434P0110_s1 Homo sapiens cDNA, 3 end /clone=DKFZp434P0110 /clone_end=3 /gb=AL039469 /gi=5408517 /ug=Hs.97574 /len=888

210983_s_at 2.03 gb:AF279900.1 /DEF=Homo sapiens PNAS-146 mRNA, complete cds. /FEA=mRNA /PROD=PNAS-146 /DB_XREF=gi:12751125 /UG=Hs.77152 minichromosome maintenance deficient (S. cerevisiae) 7 /FL=gb:AF279900.1

201490_s_at 2.03 gb:NM_005729.1 /DEF=Homo sapiens peptidylprolyl isomerase F (cyclophilin F) (PPIF), mRNA. /FEA=mRNA /GEN=PPIF /PROD=peptidylprolyl isomerase F (cyclophilin F) /DB_XREF=gi:5031986 /UG=Hs.173125 peptidylprolyl isomerase F (cyclophilin F) /FL=gb:BC005020.1 gb:M80254.1 gb:NM_005729.1

218069_at 2.03 gb:NM_024096.1 /DEF=Homo sapiens hypothetical protein MGC5627 (MGC5627), mRNA. /FEA=mRNA /GEN=MGC5627 /PROD=hypothetical protein MGC5627 /DB_XREF=gi:13129099 /UG=Hs.237971 hypothetical protein MGC5627 /FL=gb:BC001344.1 gb:NM_024096.1 gb:AF212242.1

211065_x_at 2.02 gb:BC006422.1 /DEF=Homo sapiens, clone MGC:12724, mRNA, complete cds. /FEA=mRNA /PROD=Unknown (protein for MGC:12724) /DB_XREF=gi:13623608 /FL=gb:BC006422.1

204949_at 2.02 gb:NM_002162.2 /DEF=Homo sapiens intercellular adhesion molecule 3 (ICAM3), mRNA. /FEA=mRNA /GEN=ICAM3 /PROD=intercellular adhesion molecule 3 precursor /DB_XREF=gi:12545399 /UG=Hs.99995 intercellular adhesion molecule 3 /FL=gb:NM_002162.2

202094_at 2.02 Consensus includes gb:AA648913 /FEA=EST /DB_XREF=gi:2575342 /DB_XREF=est:ns41a09.s1 /CLONE=IMAGE:1186168 /UG=Hs.1578 baculoviral IAP repeat-containing 5 (survivin) /FL=gb:NM_001168.1 gb:AF077350.1

221676_s_at 2.01 gb:BC002342.1 /DEF=Homo sapiens, coronin, actin-binding protein, 1C, clone MGC:8518, mRNA, complete cds. /FEA=mRNA /PROD=coronin, actin-binding protein, 1C /DB_XREF=gi:12803080 /UG=Hs.17377 coronin, actin-binding protein, 1C /FL=gb:BC002342.1

209191_at 2.01 gb:BC002654.1 /DEF=Homo sapiens, Similar to tubulin, beta, 4, clone MGC:4083, mRNA, complete cds. /FEA=mRNA /PROD=Similar to tubulin, beta, 4 /DB_XREF=gi:12803638 /UG=Hs.274398 Homo sapiens, Similar to tubulin, beta, 4, clone MGC:4083, mRNA, complete cds /FL=gb:BC002654.1

200661_at 2 gb:NM_000308.1 /DEF=Homo sapiens protective protein for beta-galactosidase (galactosialidosis) (PPGB), mRNA. /FEA=mRNA /GEN=PPGB /PROD=protective protein for beta-galactosidase /DB_XREF=gi:4505988 /UG=Hs.118126 protective protein for beta-galactosidase (galactosialidosis) /FL=gb:BC000597.1 gb:M22960.1 gb:NM_000308.1

211676_s_at 2 gb:AF056979.1 /DEF=Homo sapiens clone YAN1 interferon-gamma receptor mRNA, complete cds. /FEA=mRNA /PROD=interferon-gamma receptor /DB_XREF=gi:13562048 /FL=gb:AF056979.1

205199_at 2 gb:NM_001216.1 /DEF=Homo sapiens carbonic anhydrase IX (CA9), mRNA. /FEA=mRNA /GEN=CA9 /PROD=carbonic anhydrase IX precursor /DB_XREF=gi:9955947 /UG=Hs.63287 carbonic anhydrase IX /FL=gb:NM_001216.1

218153_at 2 gb:NM_024537.1 /DEF=Homo sapiens hypothetical protein FLJ12118 (FLJ12118), mRNA. /FEA=mRNA /GEN=FLJ12118 /PROD=hypothetical protein FLJ12118 /DB_XREF=gi:13375694 /UG=Hs.7779 hypothetical protein FLJ12118 /FL=gb:NM_024537.1

220272_at 2 gb:NM_017637.1 /DEF=Homo sapiens hypothetical protein FLJ20043 (FLJ20043), mRNA. /FEA=mRNA /GEN=FLJ20043 /PROD=hypothetical protein FLJ20043 /DB_XREF=gi:8923050 /UG=Hs.103853 hypothetical protein FLJ20043 /FL=gb:NM_017637.1

200788_s_at 2 gb:NM_003768.1 /DEF=Homo sapiens phosphoprotein enriched in astrocytes 15 (PEA15), mRNA. /FEA=mRNA /GEN=PEA15 /PROD=phosphoprotein enriched in astrocytes 15 /DB_XREF=gi:4505704 /UG=Hs.194673 phosphoprotein enriched in astrocytes 15 /FL=gb:BC002426.1 gb:NM_003768.1

208611_s_at 1.99 gb:U83867.1 /DEF=Human alpha II spectrin mRNA, complete cds. /FEA=mRNA /PROD=alpha II spectrin /DB_XREF=gi:1805279 /UG=Hs.77196 spectrin, alpha, non-erythrocytic 1 (alpha-fodrin) /FL=gb:J05243.1 gb:U83867.1 gb:NM_003127.1

201819_at 1.99 gb:NM_005505.1 /DEF=Homo sapiens CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 1 (CD36L1), mRNA. /FEA=mRNA /GEN=CD36L1 /PROD=CD36 antigen (collagen type I receptor,thrombospondin receptor)-like 1 /DB_XREF=gi:5031628 /UG=Hs.180616 CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 1 /FL=gb:NM_005505.1

213951_s_at 1.98 Consensus includes gb:BE964655 /FEA=EST /DB_XREF=gi:11768198 /DB_XREF=est:601658585R1 /CLONE=IMAGE:3885812 /UG=Hs.78185 MAX-like bHLHZIP protein

222047_s_at 1.97 Consensus includes gb:AI523895 /FEA=EST /DB_XREF=gi:4438030 /DB_XREF=est:tg97g03.x1 /CLONE=IMAGE:2116756 /UG=Hs.111801 arsenate resistance protein ARS2

203454_s_at 1.97 gb:NM_004045.1 /DEF=Homo sapiens ATX1 (antioxidant protein 1, yeast) homolog 1 (ATOX1), mRNA. /FEA=mRNA /GEN=ATOX1 /PROD=ATX1 (antioxidant protein 1, yeast) homolog 1 /DB_XREF=gi:4757803 /UG=Hs.279910 ATX1 (antioxidant protein 1, yeast) homolog 1 /FL=gb:NM_004045.1

207002_s_at 1.96 gb:NM_002656.1 /DEF=Homo sapiens pleiomorphic adenoma gene-like 1 (PLAGL1), transcript variant 1, mRNA. /FEA=mRNA /GEN=PLAGL1 /PROD=pleiomorphic adenoma gene-like 1 isoform 1 /DB_XREF=gi:4505856 /UG=Hs.75825 pleiomorphic adenoma gene-like 1 /FL=gb:U81992.1 gb:NM_002656.1

200997_at 1.96 gb:NM_002896.1 /DEF=Homo sapiens RNA binding motif protein 4 (RBM4), mRNA. /FEA=mRNA /GEN=RBM4 /PROD=RNA binding motif protein 4 /DB_XREF=gi:4506444 /UG=Hs.6106 RNA binding motif protein 4 /FL=gb:BC000307.1 gb:U89505.1 gb:NM_002896.1

217934_x_at 1.96 gb:NM_005861.1 /DEF=Homo sapiens STIP1 homology and U-Box containing protein 1 (STUB1), mRNA. /FEA=mRNA /GEN=STUB1 /PROD=serologically defined colon cancer antigen 7 /DB_XREF=gi:5031962

/UG=Hs.25197 STIP1 homology and U-Box containing protein 1 /FL=gb:AF039689.1 gb:AF129085.1 gb:NM_005861.1

219068_x_at 1.96 gb:NM_018188.1 /DEF=Homo sapiens hypothetical protein FLJ10709 (FLJ10709), mRNA. /FEA=mRNA /GEN=FLJ10709 /PROD=hypothetical protein FLJ10709 /DB_XREF=gi:8922608 /UG=Hs.273357 hypothetical protein FLJ10709 /FL=gb:NM_018188.1

206022_at 1.96 gb:NM_000266.1 /DEF=Homo sapiens Norrie disease (pseudoglioma) (NDP), mRNA. /FEA=mRNA /GEN=NDP /PROD=Norrie disease protein /DB_XREF=gi:4557788 /UG=Hs.2839 Norrie disease (pseudoglioma) /FL=gb:NM_000266.1

200621_at 1.96 gb:NM_004078.1 /DEF=Homo sapiens cysteine and glycine-rich protein 1 (CSRP1), mRNA. /FEA=mRNA /GEN=CSRP1 /PROD=cysteine and glycine-rich protein 1 /DB_XREF=gi:4758085 /UG=Hs.108080 cysteine and glycine-rich protein 1 /FL=gb:M33146.1 gb:NM_004078.1

209172_s_at 1.95 gb:U30872.1 /DEF=Human mitosin mRNA, complete cds. /FEA=mRNA /PROD=mitosin /DB_XREF=gi:1000093 /UG=Hs.77204 centromere protein F (350400kD, mitosin) /FL=gb:U30872.1

221704_s_at 1.95 gb:BC005882.1 /DEF=Homo sapiens, hypothetical protein FLJ12750, clone MGC:4691, mRNA, complete cds. /FEA=mRNA /PROD=hypothetical protein FLJ12750 /DB_XREF=gi:13543447 /FL=gb:BC005882.1

208622_s_at 1.94 Consensus includes gb:AA670344 /FEA=EST /DB_XREF=gi:2631843 /DB_XREF=est:ad16b08.s1 /CLONE=IMAGE:878391 /UG=Hs.155191 villin 2 (ezrin) /FL=gb:J05021.1 gb:AL162086.1 gb:NM_003379.2

201895_at 1.94 gb:NM_001654.1 /DEF=Homo sapiens v-raf murine sarcoma 3611 viral oncogene homolog 1 (ARAF1), mRNA. /FEA=mRNA /GEN=ARAF1 /PROD=v-raf murine sarcoma 3611 viral oncogene homolog1 /DB_XREF=gi:4502192 /UG=Hs.77183 v-raf murine sarcoma 3611 viral oncogene homolog 1 /FL=gb:BC002466.1 gb:NM_001654.1

207980_s_at 1.94 gb:NM_006079.1 /DEF=Homo sapiens Cbpp300-interacting transactivator, with GluAsp-rich carboxy-terminal domain, 2 (CITED2), mRNA. /FEA=mRNA /GEN=CITED2 /PROD=Cbpp300-interacting transactivator, withGluAsp-rich carboxy-terminal domain, 2 /DB_XREF=gi:5174416 /UG=Hs.82071 Cbpp300-interacting transactivator, with GluAsp-rich carboxy-terminal domain, 2 /FL=gb:U65093.1 gb:NM_006079.1

203572_s_at 1.94 gb:NM_005641.1 /DEF=Homo sapiens TATA box binding protein (TBP)-associated factor, RNA polymerase II, E, 7085kD (TAF2E), mRNA. /FEA=mRNA /GEN=TAF2E /PROD=TATA box binding protein (TBP)-associatedfactor, RNA polymerase II, E, 7085kD /DB_XREF=gi:5032146 /UG=Hs.78865 TATA box binding protein (TBP)-associated factor, RNA polymerase II, E, 7085kD /FL=gb:NM_005641.1 gb:L25444.1

202725_at 1.94 gb:NM_000937.1 /DEF=Homo sapiens polymerase (RNA) II (DNA directed) polypeptide A (220kD) (POLR2A), mRNA. /FEA=mRNA /GEN=POLR2A /PROD=polymerase (RNA) II (DNA directed) polypeptide A(220kD) /DB_XREF=gi:4505938 /UG=Hs.171880 polymerase (RNA) II (DNA directed) polypeptide A (220kD) /FL=gb:NM_000937.1

212722_s_at 1.94 Consensus includes gb:AK021780.1 /DEF=Homo sapiens cDNA FLJ11718 fis, clone HEMBA1005252, highly similar to Homo sapiens mRNA for KIAA0585 protein. /FEA=mRNA /DB_XREF=gi:10433034 /UG=Hs.72660 phosphatidylserine receptor

201999_s_at 1.93 gb:NM_006519.1 /DEF=Homo sapiens t-complex-associated-testis-expressed 1-like 1 (TCTEL1), mRNA. /FEA=mRNA /GEN=TCTEL1 /PROD=t-complex-associated-testis-expressed 1-like 1 /DB_XREF=gi:5730084 /UG=Hs.266940 t-complex-associated-testis-expressed 1-like 1 /FL=gb:U56255.1 gb:D50663.1 gb:NM_006519.1

200884_at 1.93 gb:NM_001823.1 /DEF=Homo sapiens creatine kinase, brain (CKB), mRNA. /FEA=mRNA /GEN=CKB /PROD=creatine kinase, brain /DB_XREF=gi:4502850 /UG=Hs.173724 creatine kinase, brain /FL=gb:L47647.1 gb:BC001190.1 gb:BC004914.1 gb:M16364.1 gb:M16451.1 gb:NM_001823.1

202292_x_at 1.93 gb:NM_007260.1 /DEF=Homo sapiens lysophospholipase II (LYPLA2), mRNA. /FEA=mRNA /GEN=LYPLA2 /PROD=lysophospholipase II /DB_XREF=gi:9966763 /UG=Hs.283655 lysophospholipase II /FL=gb:AF098668.1

gb:NM_007260.1 209774_x_at 1.93 gb:M57731.1 /DEF=Human gro-beta mRNA, complete cds. /FEA=mRNA /GEN=gro-beta /PROD=cytokine gro-beta

/DB_XREF=gi:183626 /UG=Hs.75765 GRO2 oncogene /FL=gb:M57731.1 gb:M36820.1 gb:NM_002089.1 202819_s_at 1.92 gb:NM_003198.1 /DEF=Homo sapiens transcription elongation factor B (SIII), polypeptide 3 (110kD, elongin A)

(TCEB3), mRNA. /FEA=mRNA /GEN=TCEB3 /PROD=elongin A /DB_XREF=gi:4507388 /UG=Hs.155202 transcription elongation factor B (SIII), polypeptide 3 (110kD, elongin A) /FL=gb:BC002883.1 gb:NM_003198.1gb:L47345.1

205345_at 1.91 gb:NM_000465.1 /DEF=Homo sapiens BRCA1 associated RING domain 1 (BARD1), mRNA. /FEA=mRNA /GEN=BARD1 /PROD=BRCA1 associated RING domain 1 /DB_XREF=gi:4557348 /UG=Hs.54089 BRCA1 associated RING domain 1 /FL=gb:U76638.1 gb:NM_000465.1

207876_s_at 1.91 gb:NM_001458.1 /DEF=Homo sapiens filamin C, gamma (actin-binding protein-280) (FLNC), mRNA. /FEA=mRNA /GEN=FLNC /PROD=gamma filamin /DB_XREF=gi:4557596 /UG=Hs.58414 filamin C, gamma (actin-binding protein-280) /FL=gb:AF089841.1 gb:NM_001458.1

202945_at 1.9 gb:NM_004957.1 /DEF=Homo sapiens folylpolyglutamate synthase (FPGS), mRNA. /FEA=mRNA /GEN=FPGS /PROD=folylpolyglutamate synthase /DB_XREF=gi:4826727 /UG=Hs.754 folylpolyglutamate synthase /FL=gb:M98045.1 gb:NM_004957.1

205352_at 1.9 gb:NM_005025.1 /DEF=Homo sapiens protease inhibitor 12 (neuroserpin) (SERPINI1), mRNA. /FEA=mRNA /GEN=SERPINI1 /PROD=protease inhibitor 12 (neuroserpin) /DB_XREF=gi:4826903 /UG=Hs.78589 serine (or cysteine) proteinase inhibitor, clade I (neuroserpin), member 1 /FL=gb:NM_005025.1

221591_s_at 1.9 gb:BC005004.1 /DEF=Homo sapiens, hypothetical protein FLJ10491, clone MGC:961, mRNA, complete cds. /FEA=mRNA /PROD=hypothetical protein FLJ10491 /DB_XREF=gi:13436475 /UG=Hs.86211 hypothetical protein /FL=gb:BC005004.1

212788_x_at 1.9 Consensus includes gb:BG537190 /FEA=EST /DB_XREF=gi:13528922 /DB_XREF=est:602565589F1 /CLONE=IMAGE:4690079 /UG=Hs.111334 ferritin, light polypeptide

210933_s_at 1.89 gb:BC004908.1 /DEF=Homo sapiens, clone MGC:4655, mRNA, complete cds. /FEA=mRNA /PROD=Unknown (protein for MGC:4655) /DB_XREF=gi:13436196 /UG=Hs.326737 Homo sapiens, clone MGC:4655, mRNA, complete cds /FL=gb:BC004908.1

217907_at 1.88 gb:NM_014161.1 /DEF=Homo sapiens HSPC071 protein (HSPC071), mRNA. /FEA=mRNA /GEN=HSPC071 /PROD=HSPC071 protein /DB_XREF=gi:7661777 /UG=Hs.23038 HSPC071 protein /FL=gb:AL136633.1 gb:BC001623.1 gb:AF161556.1 gb:NM_014161.1

211126_s_at 1.88 gb:U46006.1 /DEF=Homo sapiens smooth muscle LIM protein (h-SmLIM) mRNA, complete cds. /FEA=mRNA /GEN=h-SmLIM /PROD=smooth muscle LIM protein /DB_XREF=gi:1314358 /UG=Hs.10526 cysteine and glycine-rich protein 2 /FL=gb:U46006.1

220757_s_at 1.88 gb:NM_025241.1 /DEF=Homo sapiens UBX domain-containing gene 1 (UBXD1), mRNA. /FEA=mRNA /GEN=UBXD1 /PROD=UBX domain-containing gene 1 /DB_XREF=gi:13376853 /UG=Hs.11081 UBX domain-containing 2 /FL=gb:AF272893.1 gb:NM_025241.1

209478_at 1.88 gb:U95006.1 /DEF=Human D9 splice variant A mRNA, complete cds. /FEA=mRNA /PROD=D9 splice variant A /DB_XREF=gi:2071992 /UG=Hs.37616 Human D9 splice variant B mRNA, complete cds /FL=gb:U95006.1 gb:U95007.1

202275_at 1.87 gb:NM_000402.1 /DEF=Homo sapiens glucose-6-phosphate dehydrogenase (G6PD), nuclear gene encoding mitochondrial protein, mRNA. /FEA=mRNA /GEN=G6PD /PROD=glucose-6-phosphate dehydrogenase /DB_XREF=gi:4503844 /UG=Hs.80206 glucose-6-phosphate dehydrogenase /FL=gb:BC000337.1 gb:M21248.1 gb:NM_000402.1

203085_s_at 1.85 gb:BC000125.1 /DEF=Homo sapiens, Similar to transforming growth factor, beta 1, clone MGC:3119, mRNA, complete cds. /FEA=mRNA /PROD=Similar to transforming growth factor, beta 1 /DB_XREF=gi:12652748 /UG=Hs.1103 transforming growth factor, beta 1 /FL=gb:NM_000660.1 gb:BC000125.1 gb:BC001180.1 gb:M38449.1

215566_x_at 1.85 Consensus includes gb:AK024724.1 /DEF=Homo sapiens cDNA: FLJ21071 fis, clone CAS01789, highly similar to AF098668 Homo sapiens acyl-protein thioesterase mRNA. /FEA=mRNA /DB_XREF=gi:10437080 /UG=Hs.283655 lysophospholipase II

202207_at 1.85 Consensus includes gb:BG435404 /FEA=EST /DB_XREF=gi:13341910 /DB_XREF=est:602507678F1 /CLONE=IMAGE:4605066 /UG=Hs.111554 ADP-ribosylation factor-like 7 /FL=gb:BC001051.1 gb:AB016811.1 gb:NM_005737.2

201976_s_at 1.84 gb:NM_012334.1 /DEF=Homo sapiens myosin X (MYO10), mRNA. /FEA=mRNA /GEN=MYO10 /PROD=myosin X /DB_XREF=gi:11037056 /UG=Hs.61638 myosin X /FL=gb:NM_012334.1 gb:AF234532.1 gb:AF247457.2

211814_s_at 1.82 gb:AF112857.1 /DEF=Homo sapiens cyclin E2 splice variant 1 mRNA, complete cds. /FEA=CDS /PROD=cyclin E2 splice variant 1 /DB_XREF=gi:4092787 /UG=Hs.30464 cyclin E2 /FL=gb:AF112857.1

206593_s_at 1.79 gb:NM_006752.1 /DEF=Homo sapiens surfeit 5 (SURF5), mRNA. /FEA=mRNA /GEN=SURF5 /PROD=surfeit 5 /DB_XREF=gi:5803182 /UG=Hs.78354 surfeit 5 /FL=gb:NM_006752.1

221436_s_at 1.78 gb:NM_031299.1 /DEF=Homo sapiens hypothetical protein MGC2577 (MGC2577), mRNA. /FEA=CDS /GEN=MGC2577 /PROD=hypothetical protein MGC2577 /DB_XREF=gi:13876383 /FL=gb:NM_031299.1

201645_at 1.78 gb:NM_002160.1 /DEF=Homo sapiens hexabrachion (tenascin C, cytotactin) (HXB), mRNA. /FEA=mRNA /GEN=HXB /PROD=hexabrachion (tenascin C, cytotactin) /DB_XREF=gi:4504548 /UG=Hs.289114 hexabrachion (tenascin C, cytotactin) /FL=gb:M55618.1 gb:NM_002160.1

209053_s_at 1.78 Consensus includes gb:BE793789 /FEA=EST /DB_XREF=gi:10214987 /DB_XREF=est:601589946F1 /CLONE=IMAGE:3944195 /UG=Hs.110457 Wolf-Hirschhorn syndrome candidate 1 /FL=gb:AF083389.1

204214_s_at 1.78 gb:NM_006834.1 /DEF=Homo sapiens RAB32, member RAS oncogene family (RAB32), mRNA. /FEA=mRNA /GEN=RAB32 /PROD=RAB32, member RAS oncogene family /DB_XREF=gi:5803132 /UG=Hs.32217 RAB32, member RAS oncogene family /FL=gb:U71127.1 gb:NM_006834.1

215047_at 1.77 Consensus includes gb:AL080170.1 /DEF=Homo sapiens mRNA; cDNA DKFZp434C091 (from clone DKFZp434C091); partial cds. /FEA=mRNA /GEN=DKFZp434C091 /PROD=hypothetical protein /DB_XREF=gi:5262639 /UG=Hs.51692 DKFZP434C091 protein

211535_s_at 1.77 gb:M60485.1 /DEF=Human fibroblast growth factor receptor mRNA, complete cds. /FEA=mRNA /PROD=fibroblast growth factor receptor /DB_XREF=gi:182560 /UG=Hs.748 fibroblast growth factor receptor 1 (fms-related tyrosine kinase 2, Pfeiffer syndrome) /FL=gb:M60485.1

213668_s_at 1.77 Consensus includes gb:AI989477 /FEA=EST /DB_XREF=gi:5836358 /DB_XREF=est:ws25b11.x1 /CLONE=IMAGE:2498205 /UG=Hs.83484 SRY (sex determining region Y)-box 4

202407_s_at 1.77 Consensus includes gb:BF342707 /FEA=EST /DB_XREF=gi:11289729 /DB_XREF=est:602013660F1 /CLONE=IMAGE:4149542 /UG=Hs.183438 DKFZP566J153 protein /FL=gb:AL050369.1 gb:NM_015629.1

213646_x_at 1.77 Consensus includes gb:BE300252 /FEA=EST /DB_XREF=gi:9184000 /DB_XREF=est:600944004T1 /CLONE=IMAGE:2960280 /UG=Hs.240615 hypothetical protein FLJ13556 similar to N-myc downstream regulated 3

213147_at 1.77 Consensus includes gb:AI375919 /FEA=EST /DB_XREF=gi:4175909 /DB_XREF=est:tc14d04.x1/CLONE=IMAGE:2063815 /UG=Hs.110637 homeo box A10 /FL=gb:NM_018951.1

222043_at 1.75 Consensus includes gb:AI982754 /FEA=EST /DB_XREF=gi:5809973 /DB_XREF=est:wz28g10.x1 /CLONE=IMAGE:2559426 /UG=Hs.75106 clusterin (complement lysis inhibitor, SP-40,40, sulfated glycoprotein 2,

testosterone-repressed prostate message 2, apolipoprotein J) 215537_x_at 1.74 Consensus includes gb:AJ012008 /DEF=Homo sapiens genes encoding RNCC protein, DDAH protein, Ly6-C

protein, Ly6-D protein and immunoglobulin receptor /FEA=mRNA_4 /DB_XREF=gi:5304874 /UG=Hs.247362 dimethylarginine dimethylaminohydrolase 2

203175_at 1.74 gb:NM_001665.1 /DEF=Homo sapiens ras homolog gene family, member G (rho G) (ARHG), mRNA. /FEA=mRNA /GEN=ARHG /PROD=ras homolog gene family, member G (rho G) /DB_XREF=gi:4502218 /UG=Hs.75082 ras homolog gene family, member G (rho G) /FL=gb:NM_001665.1

200959_at 1.74 gb:NM_004960.1 /DEF=Homo sapiens fusion, derived from t(12;16) malignant liposarcoma (FUS), mRNA. /FEA=mRNA /GEN=FUS /PROD=fusion, derived from t(12;16) malignantliposarcoma /DB_XREF=gi:4826733 /UG=Hs.99969 fusion, derived from t(12;16) malignant liposarcoma /FL=gb:BC000402.1 gb:BC002459.1 gb:NM_004960.1

216228_s_at 1.72 Consensus includes gb:AK001538.1 /DEF=Homo sapiens cDNA FLJ10676 fis, clone NT2RP2006464, highly similar to Homo sapiens mRNA for AND-1 protein. /FEA=mRNA /DB_XREF=gi:7022855 /UG=Hs.72160 AND-1 protein

204998_s_at 1.72 gb:NM_012068.2 /DEF=Homo sapiens activating transcription factor 5 (ATF5), mRNA. /FEA=mRNA /GEN=ATF5 /PROD=activating transcription factor 5 /DB_XREF=gi:12597624 /UG=Hs.9754 activating transcription factor 5 /FL=gb:AF305687.1 gb:AB021663.2 gb:NM_012068.2 gb:BC005174.1

201949_x_at 1.71 Consensus includes gb:AL572341 /FEA=EST /DB_XREF=gi:12930514 /DB_XREF=est:AL572341 /CLONE=CS0DI007YC13 (3 prime) /UG=Hs.76368 capping protein (actin filament) muscle Z-line, beta /FL=gb:NM_004930.1 gb:U03271.1

218105_s_at 1.65 gb:NM_015956.1 /DEF=Homo sapiens CGI-28 protein (LOC51073), mRNA. /FEA=mRNA /GEN=LOC51073 /PROD=CGI-28 protein /DB_XREF=gi:7705721 /UG=Hs.279652 CGI-28 protein /FL=gb:AF132962.1 gb:NM_015956.1

212203_x_at 1.59 Consensus includes gb:BF338947 /FEA=EST /DB_XREF=gi:11285367 /DB_XREF=est:602036012F1 /CLONE=IMAGE:4184090 /UG=Hs.182241 interferon induced transmembrane protein 3 (1-8U)

201427_s_at 1.56 gb:NM_005410.1 /DEF=Homo sapiens selenoprotein P, plasma, 1 (SEPP1), mRNA. /FEA=mRNA /GEN=SEPP1 /PROD=selenoprotein P precursor /DB_XREF=gi:4885590 /UG=Hs.3314 selenoprotein P, plasma, 1 /FL=gb:NM_005410.1

217729_s_at 1.49 gb:NM_001130.3 /DEF=Homo sapiens amino-terminal enhancer of split (AES), mRNA. /FEA=mRNA /GEN=AES /PROD=amino-terminal enhancer of split /DB_XREF=gi:6382065 /UG=Hs.244 amino-terminal enhancer of split /FL=gb:AF072902.1 gb:U04241.1 gb:NM_001130.3

212518_at 1.4 Consensus includes gb:AB011161.1 /DEF=Homo sapiens mRNA for KIAA0589 protein, partial cds. /FEA=mRNA /GEN=KIAA0589 /PROD=KIAA0589 protein /DB_XREF=gi:3043701 /UG=Hs.275182 phosphatidylinositol-4-phosphate 5-kinase, type I, gamma

206482_at -1.4 gb:NM_005975.1 /DEF=Homo sapiens PTK6 protein tyrosine kinase 6 (PTK6), mRNA. /FEA=mRNA /GEN=PTK6 /PROD=PTK6 protein tyrosine kinase 6 /DB_XREF=gi:5174646 /UG=Hs.51133 PTK6 protein tyrosine kinase 6 /FL=gb:NM_005975.1

211959_at -1.44 Consensus includes gb:AW007532 /FEA=EST /DB_XREF=gi:5856310 /DB_XREF=est:ws52h07.x1 /CLONE=IMAGE:2500861 /UG=Hs.103391 Human insulin-like growth factor binding protein 5 (IGFBP5) mRNA

204276_at -1.47 Consensus includes gb:BE895437 /FEA=EST /DB_XREF=gi:10358829 /DB_XREF=est:601437912F1 /CLONE=IMAGE:3922971 /UG=Hs.274701 thymidine kinase 2, mitochondrial /FL=gb:NM_004614.1 gb:U77088.1

209538_at -1.5 gb:U69645.1 /DEF=Human zinc finger protein mRNA, complete cds. /FEA=mRNA /PROD=zinc finger protein /DB_XREF=gi:1575614 /UG=Hs.78765 zinc finger protein 32 (KOX 30) /FL=gb:U69645.1

201831_s_at -1.55 Consensus includes gb:BE875592 /FEA=EST /DB_XREF=gi:10324368 /DB_XREF=est:601487031F1 /CLONE=IMAGE:3889710 /UG=Hs.325948 vesicle docking protein p115 /FL=gb:D86326.1 gb:NM_003715.1

218769_s_at -1.57 gb:NM_023039.1 /DEF=Homo sapiens ankyrin repeat, family A (RFXANK-like), 2 (ANKRA2), mRNA. /FEA=mRNA /GEN=ANKRA2 /PROD=ankyrin repeat, family A (RFXANK-like), 2 /DB_XREF=gi:12746411 /UG=Hs.239154 ankyrin repeat, family A (RFXANK-like), 2 /FL=gb:AF314032.1 gb:NM_023039.1

206668_s_at -1.61 gb:NM_004866.1 /DEF=Homo sapiens secretory carrier membrane protein 1 (SCAMP1), mRNA. /FEA=mRNA /GEN=SCAMP1 /PROD=secretory carrier membrane protein 1 /DB_XREF=gi:4759063 /UG=Hs.31218 secretory carrier membrane protein 1 /FL=gb:AF005037.1 gb:AF038966.1 gb:NM_004866.1

218383_at -1.62 gb:NM_017815.1 /DEF=Homo sapiens hypothetical protein FLJ20424 (FLJ20424), mRNA. /FEA=mRNA /GEN=FLJ20424 /PROD=hypothetical protein FLJ20424 /DB_XREF=gi:8923395 /UG=Hs.8886 hypothetical protein FLJ20424 /FL=gb:BC002554.1 gb:BC001916.1 gb:NM_017815.1

203711_s_at -1.66 gb:NM_014362.1 /DEF=Homo sapiens 3-hydroxyisobutyryl-Coenzyme A hydrolase (HIBCH), mRNA. /FEA=mRNA /GEN=HIBCH /PROD=3-hydroxyisobutyryl-Coenzyme A hydrolase /DB_XREF=gi:7657159 /UG=Hs.236642 3-hydroxyisobutyryl-Coenzyme A hydrolase /FL=gb:BC005190.1 gb:U66669.1 gb:NM_014362.1

218764_at -1.68 gb:NM_024064.1 /DEF=Homo sapiens hypothetical protein MGC5363 (MGC5363), mRNA. /FEA=mRNA /GEN=MGC5363 /PROD=hypothetical protein MGC5363 /DB_XREF=gi:13129041 /UG=Hs.1880 hypothetical protein MGC5363 /FL=gb:BC001000.2 gb:NM_024064.1

213605_s_at -1.7 Consensus includes gb:AL049987.1 /DEF=Homo sapiens mRNA; cDNA DKFZp564F112 (from clone DKFZp564F112). /FEA=mRNA /DB_XREF=gi:4884238 /UG=Hs.166361 Homo sapiens mRNA; cDNA DKFZp564F112 (from clone DKFZp564F112)

211812_s_at -1.73 gb:AB050856.1 /DEF=Homo sapiens beta3GalNAcT-1 mRNA for globoside synthase, complete cds, clone:type 2. /FEA=CDS /GEN=beta3GalNAcT-1 /PROD=globoside synthase /DB_XREF=gi:11136456 /UG=Hs.267695 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 3 /FL=gb:AB050856.1

215221_at -1.74 Consensus includes gb:AK025064.1 /DEF=Homo sapiens cDNA: FLJ21411 fis, clone COL03986. /FEA=mRNA /DB_XREF=gi:10437503 /UG=Hs.306758 Homo sapiens cDNA: FLJ21411 fis, clone COL03986

205709_s_at -1.77 gb:NM_001263.1 /DEF=Homo sapiens CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1 (CDS1), mRNA. /FEA=mRNA /GEN=CDS1 /PROD=CDP-diacylglycerol synthase (phosphatidatecytidylyltransferase) 1 /DB_XREF=gi:4502756 /UG=Hs.152981 CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1 /FL=gb:U65887.1 gb:NM_001263.1

203166_at -1.81 gb:NM_006324.1 /DEF=Homo sapiens craniofacial development protein 1 (CFDP1), mRNA. /FEA=mRNA /GEN=CFDP1 /PROD=craniofacial development protein 1 /DB_XREF=gi:5453566 /UG=Hs.296460 craniofacial development protein 1 /FL=gb:BC000991.2 gb:AB009285.1 gb:NM_006324.1

213073_at -1.82 Consensus includes gb:AB002319.1 /DEF=Human mRNA for KIAA0321 gene, partial cds. /FEA=mRNA /GEN=KIAA0321 /DB_XREF=gi:2224582 /UG=Hs.8663 KIAA0321 protein

35148_at -1.82 Cluster Incl. AC005954:Homo sapiens chromosome 19, cosmid R28784 /cds=(0,2858) /gb=AC005954 /gi=3851201 /ug=Hs.25527 /len=2859

212274_at -1.82 Consensus includes gb:AV705559 /FEA=EST /DB_XREF=gi:10722858 /DB_XREF=est:AV705559 /CLONE=ADBAPE04 /UG=Hs.81412 lipin 1

213049_at -1.83 Consensus includes gb:BG436400 /FEA=EST /DB_XREF=gi:13342906 /DB_XREF=est:602509062F1 /CLONE=IMAGE:4619679 /UG=Hs.167031 DKFZP566D133 protein

204203_at -1.83 gb:NM_001806.1 /DEF=Homo sapiens CCAATenhancer binding protein (CEBP), gamma (CEBPG), mRNA./FEA=mRNA /GEN=CEBPG /PROD=CCAATenhancer binding protein gamma /DB_XREF=gi:4502768 /UG=Hs.2227 CCAATenhancer binding protein (CEBP), gamma /FL=gb:NM_001806.1 gb:U20240.1

39549_at -1.84 Cluster Incl. AI743090:wg87a11.x1 Homo sapiens cDNA, 3 end /clone=IMAGE-2372060 /clone_end=3 /gb=AI743090 /gi=5111378 /ug=Hs.106705 /len=547

212686_at -1.84 Consensus includes gb:AB032983.1 /DEF=Homo sapiens mRNA for KIAA1157 protein, partial cds. /FEA=mRNA /GEN=KIAA1157 /PROD=KIAA1157 protein /DB_XREF=gi:6330128 /UG=Hs.21894 KIAA1157 protein

214077_x_at -1.84 Consensus includes gb:H15129 /FEA=EST /DB_XREF=gi:879949 /DB_XREF=est:ym30b02.s1 /CLONE=IMAGE:49680 /UG=Hs.117313 Meis (mouse) homolog 3

200854_at -1.85 Consensus includes gb:AB028970.1 /DEF=Homo sapiens mRNA for KIAA1047 protein, partial cds. /FEA=mRNA /GEN=KIAA1047 /PROD=KIAA1047 protein /DB_XREF=gi:5689430 /UG=Hs.144904 nuclear receptor co-repressor 1 /FL=gb:AF044209.1 gb:NM_006311.1

206075_s_at -1.85 gb:NM_001895.1 /DEF=Homo sapiens casein kinase 2, alpha 1 polypeptide (CSNK2A1), mRNA. /FEA=mRNA /GEN=CSNK2A1 /PROD=casein kinase 2, alpha 1 polypeptide /DB_XREF=gi:4503094 /UG=Hs.155140 casein kinase 2, alpha 1 polypeptide /FL=gb:M55265.1 gb:NM_001895.1 gb:J02853.1

215296_at -1.85 Consensus includes gb:AK027000.1 /DEF=Homo sapiens cDNA: FLJ23347 fis, clone HEP13727. /FEA=mRNA /DB_XREF=gi:10440000 /UG=Hs.18586 KIAA0451 gene product

201860_s_at -1.86 gb:NM_000930.1 /DEF=Homo sapiens plasminogen activator, tissue (PLAT), mRNA. /FEA=mRNA /GEN=PLAT /PROD=plasminogen activator, tissue /DB_XREF=gi:4505860 /UG=Hs.274404 plasminogen activator, tissue /FL=gb:NM_000931.1 gb:M15518.1 gb:M18182.1 gb:NM_000930.1

213056_at -1.86 Consensus includes gb:AU145019 /FEA=EST /DB_XREF=gi:11006540 /DB_XREF=est:AU145019 /CLONE=HEMBA1003646 /UG=Hs.96427 KIAA1013 protein

219166_at -1.87 gb:NM_018139.1 /DEF=Homo sapiens hypothetical protein FLJ10563 (FLJ10563), mRNA. /FEA=mRNA /GEN=FLJ10563 /PROD=hypothetical protein FLJ10563 /DB_XREF=gi:8922518 /UG=Hs.265960 hypothetical protein FLJ10563 /FL=gb:NM_018139.1

220559_at -1.87 gb:NM_001426.2 /DEF=Homo sapiens engrailed homolog 1 (EN1), mRNA. /FEA=mRNA /GEN=EN1 /PROD=engrailed homolog 1 /DB_XREF=gi:7710118 /UG=Hs.271977 engrailed homolog 1 /FL=gb:NM_001426.2

208070_s_at -1.87 gb:NM_002912.1 /DEF=Homo sapiens REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta (REV3L), mRNA. /FEA=mRNA /GEN=REV3L /PROD=REV3 (yeast homolog)-like, catalytic subunit ofDNA polymerase zeta /DB_XREF=gi:4506482 /UG=Hs.115521 REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta /FL=gb:AF078695.1 gb:NM_002912.1 gb:AF179428.1

213992_at -1.87 Consensus includes gb:AI889941 /FEA=EST /DB_XREF=gi:5595105 /DB_XREF=est:wm65d06.x1 /CLONE=IMAGE:2440811 /UG=Hs.408 collagen, type IV, alpha 6

214734_at -1.88 Consensus includes gb:AB014524.1 /DEF=Homo sapiens mRNA for KIAA0624 protein, partial cds. /FEA=mRNA /GEN=KIAA0624 /PROD=KIAA0624 protein /DB_XREF=gi:3327061 /UG=Hs.138380 KIAA0624 protein

218649_x_at -1.88 gb:NM_004713.1 /DEF=Homo sapiens serologically defined colon cancer antigen 1 (SDCCAG1), mRNA. /FEA=mRNA /GEN=SDCCAG1 /PROD=serologically defined colon cancer antigen 1 /DB_XREF=gi:4759077 /UG=Hs.54900 serologically defined colon cancer antigen 1 /FL=gb:AF039687.1 gb:NM_004713.1

211574_s_at -1.88 gb:D84105.1 /DEF=Human CD46 mRNA, complete cds. /FEA=mRNA /PROD=CD46 /DB_XREF=gi:1256700 /UG=Hs.83532 membrane cofactor protein (CD46, trophoblast-lymphocyte cross-reactive antigen) /FL=gb:D84105.1

218142_s_at -1.88 gb:NM_016302.1 /DEF=Homo sapiens protein x 0001 (LOC51185), mRNA. /FEA=mRNA /GEN=LOC51185 /PROD=protein x 0001 /DB_XREF=gi:10047097 /UG=Hs.18925 protein x 0001 /FL=gb:NM_016302.1 gb:AF117230.1

219822_at -1.88 gb:NM_004294.1 /DEF=Homo sapiens mitochondrial translational release factor 1 (MTRF1), mRNA. /FEA=mRNA /GEN=MTRF1 /PROD=mitochondrial translational release factor 1 /DB_XREF=gi:4758743 /UG=Hs.80683

mitochondrial translational release factor 1 /FL=gb:AF072934.1 gb:NM_004294.1 206654_s_at -1.88 gb:NM_006467.1 /DEF=Homo sapiens polymerase (RNA) III (DNA directed) (32kD) (RPC32), mRNA.

/FEA=mRNA /GEN=RPC32 /PROD=polymerase (RNA) III (DNA directed) (32kD) /DB_XREF=gi:5454017 /UG=Hs.282387 polymerase (RNA) III (DNA directed) (32kD) /FL=gb:U93868.1 gb:NM_006467.1

218940_at -1.89 gb:NM_024558.1 /DEF=Homo sapiens hypothetical protein FLJ13920 (FLJ13920), mRNA. /FEA=mRNA /GEN=FLJ13920 /PROD=hypothetical protein FLJ13920 /DB_XREF=gi:13375724 /UG=Hs.13056 hypothetical protein FLJ13920 /FL=gb:NM_024558.1

202731_at -1.9 gb:NM_014456.1 /DEF=Homo sapiens programmed cell death 4 (PDCD4), mRNA. /FEA=mRNA /GEN=PDCD4 /PROD=programmed cell death 4 /DB_XREF=gi:7657448 /UG=Hs.296251 programmed cell death 4 /FL=gb:U96628.1 gb:NM_014456.1

203786_s_at -1.9 gb:NM_003287.1 /DEF=Homo sapiens tumor protein D52-like 1 (TPD52L1), mRNA. /FEA=mRNA /GEN=TPD52L1 /PROD=tumor protein D52-like 1 /DB_XREF=gi:4507640 /UG=Hs.16611 tumor protein D52-like 1 /FL=gb:U44427.1 gb:NM_003287.1

205540_s_at -1.93 gb:NM_016656.1 /DEF=Homo sapiens GTP-binding protein ragB (RAGB), transcript variant RAGBl, mRNA. /FEA=mRNA /GEN=RAGB /PROD=GTP-binding protein ragB long isoform /DB_XREF=gi:8051626 /UG=Hs.50282 GTP-binding protein ragB /FL=gb:NM_016656.1

208693_s_at -1.94 gb:D30658.1 /DEF=Human T-cell mRNA for glycyl tRNA synthetase, complete cds. /FEA=mRNA /PROD=glycyl tRNA synthetase /DB_XREF=gi:577711 /UG=Hs.75280 glycyl-tRNA synthetase /FL=gb:D30658.1 gb:U09587.1 gb:NM_002047.1

219100_at -1.94 gb:NM_024928.1 /DEF=Homo sapiens hypothetical protein FLJ22559 (FLJ22559), mRNA. /FEA=mRNA /GEN=FLJ22559 /PROD=hypothetical protein FLJ22559 /DB_XREF=gi:13487922 /UG=Hs.273387 hypothetical protein FLJ22559 /FL=gb:NM_024928.1

218138_at -1.95 gb:NM_018848.1 /DEF=Homo sapiens McKusick-Kaufman syndrome (MKKS), mRNA. /FEA=mRNA /GEN=MKKS /PROD=McKusick-Kaufman syndrome protein /DB_XREF=gi:9055271 /UG=Hs.46743 McKusick-Kaufman syndrome /FL=gb:AF275813.1 gb:AF221992.1 gb:AF221993.1 gb:NM_018848.1

202402_s_at -1.95 gb:NM_001751.1 /DEF=Homo sapiens cysteinyl-tRNA synthetase (CARS), mRNA. /FEA=mRNA /GEN=CARS /PROD=cysteinyl-tRNA synthetase /DB_XREF=gi:10835050 /UG=Hs.159604 cysteinyl-tRNA synthetase /FL=gb:NM_001751.1 gb:BC002880.1 gb:AF288206.1 gb:AF288207.1

200769_s_at -1.96 gb:NM_005911.1 /DEF=Homo sapiens methionine adenosyltransferase II, alpha (MAT2A), mRNA. /FEA=mRNA /GEN=MAT2A /PROD=methionine adenosyltransferase II, alpha /DB_XREF=gi:5174528 /UG=Hs.77502 methionine adenosyltransferase II, alpha /FL=gb:BC001686.1 gb:BC001854.1 gb:NM_005911.1

212325_at -1.97 Consensus includes gb:AK027231.1 /DEF=Homo sapiens cDNA: FLJ23578 fis, clone LNG12709. /FEA=mRNA /DB_XREF=gi:10440313 /UG=Hs.202949 KIAA1102 protein

222282_at -1.97 Consensus includes gb:AV761453 /FEA=EST /DB_XREF=gi:10919301 /DB_XREF=est:AV761453 /CLONE=MDSBZA03 /UG=Hs.294014 ESTs

203223_at -1.97 gb:NM_004703.1 /DEF=Homo sapiens rabaptin-5 (RAB5EP), mRNA. /FEA=mRNA /GEN=RAB5EP /PROD=rabaptin-5 /DB_XREF=gi:4759005 /UG=Hs.326056 rabaptin-5 /FL=gb:NM_004703.1

208933_s_at -1.98 Consensus includes gb:AI659005 /FEA=EST /DB_XREF=gi:4762575 /DB_XREF=est:tu23e02.x1/CLONE=IMAGE:2251898 /UG=Hs.4082 lectin, galactoside-binding, soluble, 8 (galectin 8) /FL=gb:AF342815.1 gb:L78132.1 gb:AF074000.1 gb:NM_006499.1

218276_s_at -1.98 gb:NM_021818.1 /DEF=Homo sapiens WW Domain-Containing Gene (WW45), mRNA. /FEA=mRNA /GEN=WW45 /PROD=WW Domain-Containing Gene /DB_XREF=gi:11141888 /UG=Hs.288906 WW Domain-Containing Gene /FL=gb:NM_021818.1

215012_at -1.98 Consensus includes gb:AU144775 /FEA=EST /DB_XREF=gi:11006296 /DB_XREF=est:AU144775 /CLONE=HEMBA1002935 /UG=Hs.172329 KIAA0576 protein

203459_s_at -1.98 gb:NM_022575.1 /DEF=Homo sapiens vacuolar protein sorting 16 (yeast homolog) (VPS16), mRNA. /FEA=mRNA /GEN=VPS16 /PROD=vacuolar protein sorting 16 (yeast homolog) /DB_XREF=gi:12007657 /UG=Hs.302441 vacuolar protein sorting 16 (yeast homolog) /FL=gb:AF308801.1 gb:NM_022575.1

221771_s_at -1.98 Consensus includes gb:BC003542.1 /DEF=Homo sapiens, clone IMAGE:3611719, mRNA, partial cds. /FEA=mRNA /PROD=Unknown (protein for IMAGE:3611719) /DB_XREF=gi:13097656 /UG=Hs.244482 Homo sapiens, clone IMAGE:3611719, mRNA, partial cds

207564_x_at -1.98 gb:NM_003605.2 /DEF=Homo sapiens O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase) (OGT), mRNA. /FEA=mRNA /GEN=OGT /PROD=O-linked GlcNAc transferase /DB_XREF=gi:6006036 /UG=Hs.100293 O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase) /FL=gb:U77413.1 gb:NM_003605.2

205063_at -1.98 gb:NM_003616.1 /DEF=Homo sapiens survival of motor neuron protein interacting protein 1 (SIP1), mRNA. /FEA=mRNA /GEN=SIP1 /PROD=survival of motor neuron protein interactingprotein 1 /DB_XREF=gi:4506960 /UG=Hs.102456 survival of motor neuron protein interacting protein 1 /FL=gb:AF027150.1 gb:NM_003616.1

217776_at -1.99 gb:AF167438.1 /DEF=Homo sapiens androgen-regulated short-chain dehydrogenasereductase 1 (ARSDR1) mRNA, complete cds. /FEA=mRNA /GEN=ARSDR1 /PROD=androgen-regulated short-chaindehydrogenasereductase 1 /DB_XREF=gi:9622123 /UG=Hs.179817 CGI-82 protein /FL=gb:BC000112.1 gb:AF151840.1 gb:NM_016026.1 gb:AF167438.1

202458_at -1.99 gb:NM_007173.1 /DEF=Homo sapiens protease, serine, 23 (SPUVE), mRNA. /FEA=mRNA /GEN=SPUVE /PROD=protease, serine, 23 /DB_XREF=gi:6005881 /UG=Hs.325820 protease, serine, 23 /FL=gb:AL136914.1 gb:BC001278.1 gb:AF015287.1 gb:NM_007173.1 gb:AF193611.1

220173_at -1.99 gb:NM_025057.1 /DEF=Homo sapiens hypothetical protein FLJ23189 (FLJ23189), mRNA. /FEA=mRNA /GEN=FLJ23189 /PROD=hypothetical protein FLJ23189 /DB_XREF=gi:13376590 /UG=Hs.287733 hypothetical protein FLJ23189 /FL=gb:NM_025057.1

212328_at -2 Consensus includes gb:AB029025.1 /DEF=Homo sapiens mRNA for KIAA1102 protein, partial cds. /FEA=mRNA /GEN=KIAA1102 /PROD=KIAA1102 protein /DB_XREF=gi:5689540 /UG=Hs.202949 KIAA1102 protein

218251_at -2 gb:NM_021242.1 /DEF=Homo sapiens hypothetical protein STRAIT11499 (STRAIT11499), mRNA. /FEA=mRNA /GEN=STRAIT11499 /PROD=hypothetical protein STRAIT11499 /DB_XREF=gi:10864050 /UG=Hs.236556 hypothetical protein STRAIT11499 /FL=gb:NM_021242.1

203787_at -2.01 gb:NM_012446.1 /DEF=Homo sapiens single-stranded-DNA-binding protein (SSBP2), mRNA. /FEA=mRNA /GEN=SSBP2 /PROD=single-stranded-DNA-binding protein /DB_XREF=gi:7106422 /UG=Hs.169833 single-stranded-DNA-binding protein /FL=gb:AL080076.1 gb:AF161465.1 gb:NM_012446.1

211657_at -2.01 gb:M18728.1 /DEF=Human nonspecific crossreacting antigen mRNA, complete cds. /FEA=mRNA /GEN=NCA; NCA; NCA /PROD=non-specific cross reacting antigen /DB_XREF=gi:189084 /FL=gb:M18728.1

204681_s_at -2.01 gb:NM_012294.1 /DEF=Homo sapiens guanine nucleotide exchange factor for Rap1; M-Ras-regulated GEF (KIAA0277), mRNA. /FEA=mRNA /GEN=KIAA0277 /PROD=guanine nucleotide exchange factor for Rap1;M-Ras-regulated GEF /DB_XREF=gi:6912455 /UG=Hs.80620 guanine nucleotide exchange factor for Rap1; M-Ras-regulated GEF /FL=gb:D87467.1 gb:NM_012294.1

202430_s_at -2.01 gb:NM_021105.1 /DEF=Homo sapiens phospholipid scramblase 1 (PLSCR1), mRNA. /FEA=mRNA /GEN=PLSCR1 /PROD=phospholipid scramblase 1 /DB_XREF=gi:10863876 /UG=Hs.198282 phospholipid scramblase 1 /FL=gb:NM_021105.1 gb:AB006746.1 gb:AF098642.1

217653_x_at -2.02 Consensus includes gb:AW150065 /FEA=EST /DB_XREF=gi:6197971 /DB_XREF=est:xg48a10.x1 /CLONE=IMAGE:2630778 /UG=Hs.271957 ESTs

217738_at -2.02 Consensus includes gb:BF575514 /FEA=EST /DB_XREF=gi:11649318 /DB_XREF=est:602133090F1 /CLONE=IMAGE:4288079 /UG=Hs.239138 pre-B-cell colony-enhancing factor /FL=gb:U02020.1 gb:NM_005746.1

218006_s_at -2.02 gb:NM_006963.1 /DEF=Homo sapiens zinc finger protein 22 (KOX 15) (ZNF22), mRNA. /FEA=mRNA /GEN=ZNF22 /PROD=zinc finger protein 22 (KOX 15) /DB_XREF=gi:5902159 /UG=Hs.108642 zinc finger protein 22 (KOX 15) /FL=gb:NM_006963.1

217906_at -2.02 gb:NM_014315.1 /DEF=Homo sapiens host cell factor homolog (LCP), mRNA. /FEA=mRNA /GEN=LCP /PROD=host cell factor homolog /DB_XREF=gi:7657300 /UG=Hs.20597 host cell factor homolog /FL=gb:BC002335.1 gb:AF113131.1 gb:NM_014315.1 gb:AF244137.1

217807_s_at -2.02 gb:NM_015710.1 /DEF=Homo sapiens glioma tumor suppressor candidate region gene 2 (GLTSCR2), mRNA. /FEA=mRNA /GEN=GLTSCR2 /PROD=glioma tumor suppressor candidate region gene 2 /DB_XREF=gi:7657129 /UG=Hs.2237 glioma tumor suppressor candidate region gene 2 /FL=gb:AF182076.1 gb:NM_015710.1

214012_at -2.02 Consensus includes gb:BE551138 /FEA=EST /DB_XREF=gi:9792830 /DB_XREF=est:7b55a07.x1 /CLONE=IMAGE:3232116 /UG=Hs.247043 type 1 tumor necrosis factor receptor shedding aminopeptidase regulator

201816_s_at -2.03 gb:NM_001483.1 /DEF=Homo sapiens glioblastoma amplified sequence (GBAS), mRNA. /FEA=mRNA /GEN=GBAS /PROD=glioblastoma amplified sequence /DB_XREF=gi:4503936 /UG=Hs.152707 glioblastoma amplified sequence /FL=gb:BC000732.1 gb:BC001837.1 gb:AF029786.1 gb:NM_001483.1

213703_at -2.04 Consensus includes gb:W95043 /FEA=EST /DB_XREF=gi:1424182 /DB_XREF=est:zh46c11.s1 /CLONE=IMAGE:415124 /UG=Hs.79732 fibulin 1

219754_at -2.04 gb:NM_018301.1 /DEF=Homo sapiens hypothetical protein FLJ11016 (FLJ11016), mRNA. /FEA=mRNA /GEN=FLJ11016 /PROD=hypothetical protein FLJ11016 /DB_XREF=gi:8922825 /UG=Hs.210859 hypothetical protein FLJ11016 /FL=gb:NM_018301.1

220773_s_at -2.05 gb:NM_020806.1 /DEF=Homo sapiens gephyrin (GPH), mRNA. /FEA=mRNA /GEN=GPH /PROD=gephryin /DB_XREF=gi:10880982 /UG=Hs.13405 gephyrin /FL=gb:NM_020806.1

213122_at -2.05 Consensus includes gb:AI096375 /FEA=EST /DB_XREF=gi:3446286 /DB_XREF=est:qb91e08.x1 /CLONE=IMAGE:1707494 /UG=Hs.173094 Homo sapiens mRNA for KIAA1750 protein, partial cds

201415_at -2.05 gb:NM_000178.1 /DEF=Homo sapiens glutathione synthetase (GSS), mRNA. /FEA=mRNA /GEN=GSS /PROD=glutathione synthetase /DB_XREF=gi:4504168 /UG=Hs.82327 glutathione synthetase /FL=gb:U34683.1 gb:NM_000178.1

210372_s_at -2.05 gb:AF208012.1 /DEF=Homo sapiens tumor protein D52-like 2 (TPD52L2) mRNA, complete cds. /FEA=mRNA /GEN=TPD52L2 /PROD=tumor protein D52-like 2 /DB_XREF=gi:12246900 /UG=Hs.16611 tumor protein D52-like 1 /FL=gb:AF208012.1

204278_s_at -2.05 gb:NM_004215.1 /DEF=Homo sapiens estrogen receptor binding site associated, antigen, 9 (EBAG9), mRNA. /FEA=mRNA /GEN=EBAG9 /PROD=estrogen receptor binding site associated,antigen, 9 /DB_XREF=gi:4758229 /UG=Hs.9222 estrogen receptor binding site associated, antigen, 9 /FL=gb:BC005249.1 gb:AF006265.1 gb:AB007619.1 gb:NM_004215.1

213737_x_at -2.05 Consensus includes gb:AI620911 /FEA=EST /DB_XREF=gi:4630037 /DB_XREF=est:tu05d12.x1 /CLONE=IMAGE:2250167 /UG=Hs.205125 ESTs

210425_x_at -2.05 gb:AF164622.1 /DEF=Homo sapiens golgin-67 (GOLGA5) mRNA, complete cds. /FEA=mRNA /GEN=GOLGA5 /PROD=golgin-67 /DB_XREF=gi:7211437 /UG=Hs.182982 golgin-67 /FL=gb:AF163441.1 gb:AF164622.1

205531_s_at -2.06 gb:NM_013267.1 /DEF=Homo sapiens breast cell glutaminase (GA), mRNA. /FEA=mRNA /GEN=GA

/PROD=breast cell glutaminase /DB_XREF=gi:7019388 /UG=Hs.325443 breast cell glutaminase /FL=gb:AF110330.1 gb:AF110331.1 gb:AF223944.1 gb:NM_013267.1

217941_s_at -2.06 gb:NM_018695.1 /DEF=Homo sapiens erbb2-interacting protein ERBIN (LOC55914), mRNA. /FEA=mRNA /GEN=LOC55914 /PROD=erbb2-interacting protein ERBIN /DB_XREF=gi:8923908 /UG=Hs.8117 erbb2-interacting protein ERBIN /FL=gb:AF263744.1 gb:NM_018695.1

213283_s_at -2.06 Consensus includes gb:BG285616 /FEA=EST /DB_XREF=gi:13037752 /DB_XREF=est:602380622F1 /CLONE=IMAGE:4498325 /UG=Hs.79971 sal (Drosophila)-like 2

205173_x_at -2.06 gb:NM_001779.1 /DEF=Homo sapiens CD58 antigen, (lymphocyte function-associated antigen 3) (CD58), mRNA. /FEA=mRNA /GEN=CD58 /PROD=CD58 antigen, (lymphocyte function-associatedantigen 3) /DB_XREF=gi:4502676 /UG=Hs.75626 CD58 antigen, (lymphocyte function-associated antigen 3) /FL=gb:NM_001779.1

214212_x_at -2.06 Consensus includes gb:AI928241 /FEA=EST /DB_XREF=gi:5664205 /DB_XREF=est:wo95g11.x1 /CLONE=IMAGE:2463140 /UG=Hs.75260 mitogen inducible 2

221081_s_at -2.06 gb:NM_024901.1 /DEF=Homo sapiens hypothetical protein FLJ22457 (FLJ22457), mRNA. /FEA=mRNA /GEN=FLJ22457 /PROD=hypothetical protein FLJ22457 /DB_XREF=gi:13376358 /UG=Hs.238707 hypothetical protein FLJ22457 /FL=gb:NM_024901.1

219767_s_at -2.07 gb:NM_005111.1 /DEF=Homo sapiens crystallin, zeta (quinone reductase)-like 1 (CRYZL1), mRNA. /FEA=mRNA /GEN=CRYZL1 /PROD=crystallin, zeta (quinone reductase)-like 1 /DB_XREF=gi:4826679 /UG=Hs.330208 crystallin, zeta (quinone reductase)-like 1 /FL=gb:AF029689.1 gb:NM_005111.1

219513_s_at -2.07 gb:NM_005490.1 /DEF=Homo sapiens novel SH2-containing protein 1 (NSP1), mRNA. /FEA=mRNA /GEN=NSP1 /PROD=novel SH2-containing protein 1 /DB_XREF=gi:4885524 /UG=Hs.268541 novel SH2-containing protein 1 /FL=gb:AF124249.1 gb:NM_005490.1

218637_at -2.07 gb:NM_018439.1 /DEF=Homo sapiens hypothetical protein IMPACT (IMPACT), mRNA. /FEA=mRNA /GEN=IMPACT /PROD=hypothetical protein IMPACT /DB_XREF=gi:8923818 /UG=Hs.284245 hypothetical protein IMPACT /FL=gb:AF208694.1 gb:AB026264.1 gb:NM_018439.1

215208_x_at -2.08 Consensus includes gb:AK021571.1 /DEF=Homo sapiens cDNA FLJ11509 fis, clone HEMBA1002166. /FEA=mRNA /DB_XREF=gi:10432777 /UG=Hs.289093 Homo sapiens cDNA FLJ11509 fis, clone HEMBA1002166

212177_at -2.08 Consensus includes gb:AW081113 /FEA=EST /DB_XREF=gi:6036265 /DB_XREF=est:xc29c08.x1 /CLONE=IMAGE:2585678 /UG=Hs.18368 DKFZP564B0769 protein

201685_s_at -2.08 gb:NM_014828.1 /DEF=Homo sapiens KIAA0737 gene product (KIAA0737), mRNA. /FEA=mRNA /GEN=KIAA0737 /PROD=KIAA0737 gene product /DB_XREF=gi:7662273 /UG=Hs.194035 KIAA0737 gene product /FL=gb:AB018280.1 gb:NM_014828.1

212971_at -2.09 Consensus includes gb:AI769685 /FEA=EST /DB_XREF=gi:5236194 /DB_XREF=est:wj25f08.x1 /CLONE=IMAGE:2403879 /UG=Hs.159604 cysteinyl-tRNA synthetase

218204_s_at -2.09 gb:NM_024513.1 /DEF=Homo sapiens FYVE and coiled-coil domain containing 1 (FYCO1), mRNA. /FEA=mRNA /GEN=FYCO1 /PROD=FYVE and coiled-coil domain containing 1 /DB_XREF=gi:13470091 /UG=Hs.257267 FYVE and coiled-coil domain containing 1 /FL=gb:NM_024513.1

202990_at -2.09 gb:NM_002863.1 /DEF=Homo sapiens phosphorylase, glycogen; liver (Hers disease, glycogen storage disease type VI) (PYGL), mRNA. /FEA=mRNA /GEN=PYGL /PROD=phosphorylase, glycogen; liver (Hers disease,glycogen storage disease type VI) /DB_XREF=gi:4506352 /UG=Hs.771 phosphorylase, glycogen; liver (Hers disease, glycogen storage disease type VI) /FL=gb:M14636.1 gb:AF066858.1 gb:AF046785.1 gb:NM_002863.1

202536_at -2.09 Consensus includes gb:AK002165.1 /DEF=Homo sapiens cDNA FLJ11303 fis, clone PLACE1009995, highly

similar to Homo sapiens mRNA; cDNA DKFZp564O123. /FEA=mRNA /DB_XREF=gi:7023876 /UG=Hs.11449 DKFZP564O123 protein /FL=gb:AF151842.1 gb:AL080122.1 gb:NM_014043.1

209481_at -2.09 gb:AF226044.1 /DEF=Homo sapiens HSNFRK (HSNFRK) mRNA, complete cds. /FEA=mRNA /GEN=HSNFRK /PROD=HSNFRK /DB_XREF=gi:9295326 /UG=Hs.79025 KIAA0096 protein /FL=gb:AF226044.1

206059_at -2.1 gb:NM_003430.1 /DEF=Homo sapiens zinc finger protein 91 (HPF7, HTF10) (ZNF91), mRNA. /FEA=mRNA /GEN=ZNF91 /PROD=zinc finger protein 91 (HPF7, HTF10) /DB_XREF=gi:4508040 /UG=Hs.8597 zinc finger protein 91 (HPF7, HTF10) /FL=gb:L11672.1 gb:NM_003430.1

209610_s_at -2.1 Consensus includes gb:BF340083 /FEA=EST /DB_XREF=gi:11286545 /DB_XREF=est:602037236F1 /CLONE=IMAGE:4185248 /UG=Hs.323878 solute carrier family 1 (glutamateneutral amino acid transporter), member 4 /FL=gb:L14595.1 gb:NM_003038.1 gb:L19444.1 gb:AB026689.1

218323_at -2.1 gb:NM_018307.1 /DEF=Homo sapiens hypothetical protein FLJ11040 (FLJ11040), mRNA. /FEA=mRNA /GEN=FLJ11040 /PROD=hypothetical protein FLJ11040 /DB_XREF=gi:8922837 /UG=Hs.14202 hypothetical protein FLJ11040 /FL=gb:NM_018307.1

207231_at -2.1 gb:NM_014648.1 /DEF=Homo sapiens KIAA0675 gene product (KIAA0675), mRNA. /FEA=mRNA /GEN=KIAA0675 /PROD=KIAA0675 gene product /DB_XREF=gi:7662243 /UG=Hs.165662 KIAA0675 gene product /FL=gb:AB014575.1 gb:NM_014648.1

203140_at -2.11 gb:NM_001706.1 /DEF=Homo sapiens B-cell CLLlymphoma 6 (zinc finger protein 51) (BCL6), mRNA. /FEA=mRNA /GEN=BCL6 /PROD=B-cell CLLlymphoma 6 (zinc finger protein 51) /DB_XREF=gi:4502382 /UG=Hs.155024 B-cell CLLlymphoma 6 (zinc finger protein 51) /FL=gb:U00115.1 gb:NM_001706.1

209098_s_at -2.11 gb:U61276.1 /DEF=Human transmembrane protein Jagged 1 (HJ1) mRNA, complete cds. /FEA=mRNA /GEN=HJ1 /PROD=transmembrane protein Jagged 1 /DB_XREF=gi:1438936 /UG=Hs.91143 jagged 1 (Alagille syndrome) /FL=gb:U61276.1 gb:U73936.1 gb:AF003837.1 gb:AF028593.1 gb:NM_000214.1

218924_s_at -2.11 gb:NM_004388.1 /DEF=Homo sapiens chitobiase, di-N-acetyl- (CTBS), mRNA. /FEA=mRNA /GEN=CTBS /PROD=chitobiase, di-N-acetyl- /DB_XREF=gi:4758091 /UG=Hs.135578 chitobiase, di-N-acetyl- /FL=gb:M95767.1 gb:NM_004388.1

203762_s_at -2.12 gb:NM_016008.1 /DEF=Homo sapiens CGI-60 protein (LOC51626), mRNA. /FEA=mRNA /GEN=LOC51626 /PROD=CGI-60 protein /DB_XREF=gi:7706299 /UG=Hs.7627 CGI-60 protein /FL=gb:AF151818.1 gb:NM_016008.1

212675_s_at -2.12 Consensus includes gb:AB011154.1 /DEF=Homo sapiens mRNA for KIAA0582 protein, partial cds. /FEA=mRNA /GEN=KIAA0582 /PROD=KIAA0582 protein /DB_XREF=gi:3043687 /UG=Hs.79507 KIAA0582 protein

203552_at -2.12 Consensus includes gb:AW298170 /FEA=EST /DB_XREF=gi:6704806 /DB_XREF=est:UI-H-BW0-ajt-a-06-0-UI.s1 /CLONE=IMAGE:2732819 /UG=Hs.246970 mitogen-activated protein kinase kinase kinase kinase 5 /FL=gb:U77129.1 gb:NM_006575.1

212072_s_at -2.12 Consensus includes gb:AL049761 /DEF=Human DNA sequence from clone RP5-863C7 on chromosome 20p12.3-13. Contains the CSNK2A1 gene for casein kinase 2 alpha 1 polypeptide (EC 2.7.1.37), ESTs, STSs and GSSs /FEA=mRNA_2 /DB_XREF=gi:5738437 /UG=Hs.155140 casein kinase 2, alpha 1 polypeptide

211776_s_at -2.13 gb:BC006141.1 /DEF=Homo sapiens, Similar to erythrocyte protein band 4.1-like 3, clone MGC:13087, mRNA, complete cds. /FEA=mRNA /PROD=Similar to erythrocyte protein band 4.1-like 3 /DB_XREF=gi:13544008 /FL=gb:BC006141.1

211744_s_at -2.13 gb:BC005930.1 /DEF=Homo sapiens, Similar to CD58 antigen, (lymphocyte function-associated antigen 3), clone MGC:14538, mRNA, complete cds. /FEA=mRNA /PROD=Similar to CD58 antigen, (lymphocytefunction-associated antigen 3) /DB_XREF=gi:13543544 /FL=gb:BC005930.1

214544_s_at -2.13 Consensus includes gb:NM_003825.1 /DEF=Homo sapiens synaptosomal-associated protein, 23kD (SNAP23),

mRNA. /FEA=CDS /GEN=SNAP23 /PROD=synaptosomal-associated protein, 23kD /DB_XREF=gi:4507096 /UG=Hs.184376 synaptosomal-associated protein, 23kD /FL=gb:Y09568.1 gb:NM_003825.1

219276_x_at -2.13 gb:NM_024828.1 /DEF=Homo sapiens hypothetical protein FLJ13657 (FLJ13657), mRNA. /FEA=mRNA /GEN=FLJ13657 /PROD=hypothetical protein FLJ13657 /DB_XREF=gi:13376229 /UG=Hs.178357 hypothetical protein FLJ13657 /FL=gb:NM_024828.1

201810_s_at -2.13 Consensus includes gb:AL562152 /FEA=EST /DB_XREF=gi:12910291 /DB_XREF=est:AL562152 /CLONE=CS0DC001YK23 (3 prime) /UG=Hs.109150 SH3-domain binding protein 5 (BTK-associated) /FL=gb:AB005047.1 gb:NM_004844.1

209311_at -2.13 gb:D87461.1 /DEF=Human mRNA for KIAA0271 gene, complete cds. /FEA=mRNA /GEN=KIAA0271 /DB_XREF=gi:1944417 /UG=Hs.75244 BCL2-like 2 /FL=gb:U59747.1 gb:D87461.1 gb:NM_004050.1

60794_f_at -2.13 Cluster Incl. AI400621:tg49g02.x1 Homo sapiens cDNA, 3 end /clone=IMAGE-2112146 /clone_end=3 /gb=AI400621 /gi=4243708 /ug=Hs.213640 /len=529

203757_s_at -2.13 gb:BC005008.1 /DEF=Homo sapiens, carcinoembryonic antigen-related cell adhesion molecule 6 (non-specific cross reacting antigen), clone MGC:10467, mRNA, complete cds. /FEA=mRNA /PROD=carcinoembryonic antigen-related cell adhesionmolecule 6 (non-specific cross reacting antigen) /DB_XREF=gi:13477106 /UG=Hs.73848 carcinoembryonic antigen-related cell adhesion molecule 6 (non-specific cross reacting antigen) /FL=gb:BC005008.1 gb:M18216.1 gb:M29541.1 gb:NM_002483.1

215304_at -2.14 Consensus includes gb:U79293.1 /DEF=Human clone 23948 mRNA sequence. /FEA=mRNA /DB_XREF=gi:1710274 /UG=Hs.159264 Human clone 23948 mRNA sequence

201941_at -2.14 Consensus includes gb:BE349147 /FEA=EST /DB_XREF=gi:9261086 /DB_XREF=est:ht51f05.x1 /CLONE=IMAGE:3150273 /UG=Hs.5057 carboxypeptidase D /FL=gb:U65090.1 gb:D85390.1 gb:NM_001304.2

215079_at -2.15 Consensus includes gb:AK026723.1 /DEF=Homo sapiens cDNA: FLJ23070 fis, clone LNG05629. /FEA=mRNA /DB_XREF=gi:10439641 /UG=Hs.30579 Homo sapiens cDNA: FLJ23070 fis, clone LNG05629

205891_at -2.15 gb:NM_000676.1 /DEF=Homo sapiens adenosine A2b receptor (ADORA2B), mRNA. /FEA=mRNA /GEN=ADORA2B /PROD=adenosine A2b receptor /DB_XREF=gi:4501950 /UG=Hs.45743 adenosine A2b receptor /FL=gb:M97759.1 gb:NM_000676.1

207267_s_at -2.16 gb:NM_018962.1 /DEF=Homo sapiens Down syndrome critical region gene 6 (DSCR6), mRNA. /FEA=mRNA /GEN=DSCR6 /PROD=Down syndrome critical region protein 6 /DB_XREF=gi:9506556 /UG=Hs.254560 Down syndrome critical region gene 6 /FL=gb:AB037158.1 gb:NM_018962.1

203355_s_at -2.16 gb:NM_015310.1 /DEF=Homo sapiens KIAA0942 protein (KIAA0942), mRNA. /FEA=mRNA /GEN=KIAA0942 /PROD=KIAA0942 protein /DB_XREF=gi:7662395 /UG=Hs.6763 KIAA0942 protein /FL=gb:AF243495.2 gb:NM_015310.1

203553_s_at -2.16 gb:NM_006575.1 /DEF=Homo sapiens mitogen-activated protein kinase kinase kinase kinase 5 (MAP4K5), mRNA. /FEA=mRNA /GEN=MAP4K5 /PROD=mitogen-activated protein kinase kinase kinasekinase /DB_XREF=gi:5729890 /UG=Hs.246970 mitogen-activated protein kinase kinase kinase kinase 5 /FL=gb:U77129.1 gb:NM_006575.1

216858_x_at -2.16 Consensus includes gb:AL080112.1 /DEF=Homo sapiens mRNA; cDNA DKFZp586H0722 (from clone DKFZp586H0722). /FEA=mRNA /DB_XREF=gi:5262539 /UG=Hs.332731 Homo sapiens mRNA; cDNA DKFZp586H0722 (from clone DKFZp586H0722)

218307_at -2.16 gb:NM_018346.1 /DEF=Homo sapiens hypothetical protein FLJ11164 (FLJ11164), mRNA. /FEA=mRNA /GEN=FLJ11164 /PROD=hypothetical protein FLJ11164 /DB_XREF=gi:8922910 /UG=Hs.8033 hypothetical protein FLJ11164 /FL=gb:NM_018346.1

204350_s_at -2.17 gb:NM_004270.1 /DEF=Homo sapiens cofactor required for Sp1 transcriptional activation, subunit 9 (33kD)

(CRSP9), mRNA. /FEA=mRNA /GEN=CRSP9 /PROD=cofactor required for Sp1 transcriptionalactivation, subunit 9 (33kD) /DB_XREF=gi:4758063 /UG=Hs.279902 cofactor required for Sp1 transcriptional activation, subunit 9 (33kD) /FL=gb:BC005250.1 gb:AF031383.1 gb:AF104251.1 gb:NM_004270.1

213273_at -2.17 Consensus includes gb:BF112171 /FEA=EST /DB_XREF=gi:10941861 /DB_XREF=est:7l48d06.x1 /CLONE=IMAGE:3524770 /UG=Hs.5028 DKFZP564O0423 protein

212634_at -2.17 Consensus includes gb:AW298092 /FEA=EST /DB_XREF=gi:6704728 /DB_XREF=est:UI-H-BW0-ajs-b-03-0-UI.s1 /CLONE=IMAGE:2732860 /UG=Hs.5460 KIAA0776 protein

219973_at -2.17 gb:NM_024590.1 /DEF=Homo sapiens hypothetical protein FLJ23548 (FLJ23548), mRNA. /FEA=mRNA /GEN=FLJ23548 /PROD=hypothetical protein FLJ23548 /DB_XREF=gi:13375780 /UG=Hs.22895 hypothetical protein FLJ23548 /FL=gb:NM_024590.1

212183_at -2.18 Consensus includes gb:AW511135 /FEA=EST /DB_XREF=gi:7149213 /DB_XREF=est:hd43g08.x1 /CLONE=IMAGE:2912318 /UG=Hs.92381 nudix (nucleoside diphosphate linked moiety X)-type motif 4

203765_at -2.18 gb:NM_012198.1 /DEF=Homo sapiens grancalcin (GCL), mRNA. /FEA=mRNA /GEN=GCL /PROD=grancalcin /DB_XREF=gi:6912387 /UG=Hs.79381 grancalcin /FL=gb:BC005214.1 gb:M81637.1 gb:NM_012198.1

217988_at -2.18 gb:NM_021178.1 /DEF=Homo sapiens enhancer of invasion 10 (HEI10), mRNA. /FEA=mRNA /GEN=HEI10 /PROD=enhancer of invasion 10 /DB_XREF=gi:10863978 /UG=Hs.107003 enhancer of invasion 10 /FL=gb:NM_021178.1 gb:BC000369.1 gb:BC001218.1 gb:BC004435.1 gb:AF216381.1

204682_at -2.18 gb:NM_000428.1 /DEF=Homo sapiens latent transforming growth factor beta binding protein 2 (LTBP2), mRNA. /FEA=mRNA /GEN=LTBP2 /PROD=latent transforming growth factor beta bindingprotein 2 /DB_XREF=gi:4557732 /UG=Hs.83337 latent transforming growth factor beta binding protein 2 /FL=gb:NM_000428.1

209442_x_at -2.19 gb:AL136710.1 /DEF=Homo sapiens mRNA; cDNA DKFZp566P0524 (from clone DKFZp566P0524); complete cds. /FEA=mRNA /GEN=DKFZp566P0524 /PROD=hypothetical protein /DB_XREF=gi:12052939 /UG=Hs.75893 ankyrin 3, node of Ranvier (ankyrin G) /FL=gb:AL136710.1

221729_at -2.19 Consensus includes gb:AL575735 /FEA=EST /DB_XREF=gi:12937190 /DB_XREF=est:AL575735 /CLONE=CS0DI070YK23 (3 prime) /UG=Hs.82985 collagen, type V, alpha 2 /FL=gb:NM_000393.1

203538_at -2.19 gb:NM_001745.1 /DEF=Homo sapiens calcium modulating ligand (CAMLG), mRNA. /FEA=mRNA /GEN=CAMLG /PROD=calcium modulating ligand /DB_XREF=gi:4502558 /UG=Hs.13572 calcium modulating ligand /FL=gb:NM_001745.1 gb:U18242.1

220266_s_at -2.19 gb:NM_004235.1 /DEF=Homo sapiens Kruppel-like factor 4 (gut) (KLF4), mRNA. /FEA=mRNA /GEN=KLF4 /PROD=Kruppel-like factor 4 (gut) /DB_XREF=gi:4758321 /UG=Hs.7934 Kruppel-like factor 4 (gut) /FL=gb:U70663.1 gb:AF022184.1 gb:NM_004235.1 gb:AF105036.1

212976_at -2.19 Consensus includes gb:R41498 /FEA=EST /DB_XREF=gi:816800 /DB_XREF=est:yf86h08.s1 /CLONE=IMAGE:29486 /UG=Hs.199243 KIAA0231 protein

213929_at -2.19 Consensus includes gb:AL050204.1 /DEF=Homo sapiens mRNA; cDNA DKFZp586F1223 (from clone DKFZp586F1223). /FEA=mRNA /DB_XREF=gi:4884443 /UG=Hs.28540 Homo sapiens mRNA; cDNA DKFZp586F1223 (from clone DKFZp586F1223)

218446_s_at -2.2 gb:NM_016078.1 /DEF=Homo sapiens CGI-148 protein (LOC51030), mRNA. /FEA=mRNA /GEN=LOC51030 /PROD=CGI-148 protein /DB_XREF=gi:7705643 /UG=Hs.6776 CGI-148 protein /FL=gb:AF151906.1 gb:AF223467.1 gb:NM_016078.1

209004_s_at -2.2 gb:AF142481.1 /DEF=Homo sapiens F-box protein FLR1 (FLR1) mRNA, complete cds. /FEA=mRNA /GEN=FLR1 /PROD=F-box protein FLR1 /DB_XREF=gi:7672733 /UG=Hs.5548 f-box and leucine-rich repeat protein 5 /FL=gb:AF199420.1 gb:AF142481.1 gb:AF157323.1

206652_at -2.2 gb:NM_016384.1 /DEF=Homo sapiens hypothetical protein (HSPC050), mRNA. /FEA=mRNA /GEN=HSPC050

/PROD=hypothetical protein /DB_XREF=gi:7705438 /UG=Hs.278985 hypothetical protein /FL=gb:AF161535.1 gb:NM_016384.1

217106_x_at -2.21 Consensus includes gb:AF091078.1 /DEF=Homo sapiens clone 559 unknown mRNA, complete sequence. /FEA=mRNA /PROD=unknown /DB_XREF=gi:3859993 /UG=Hs.125819 putative dimethyladenosine transferase

213995_at -2.21 Consensus includes gb:AW195882 /FEA=EST /DB_XREF=gi:6475112 /DB_XREF=est:xn86c10.x1 /CLONE=IMAGE:2701362 /UG=Hs.56155 hypothetical protein

201761_at -2.21 gb:NM_006636.2 /DEF=Homo sapiens methylene tetrahydrofolate dehydrogenase (NAD+ dependent), methenyltetrahydrofolate cyclohydrolase (MTHFD2), nuclear gene encoding mitochondrial protein, mRNA. /FEA=mRNA /GEN=MTHFD2 /PROD=methylene tetrahydrofolate dehydrogenase (NAD+dependent), methenyltetrahydrofolate cyclohydrolase,precursor /DB_XREF=gi:13699869 /UG=Hs.154672 methylene tetrahydrofolate dehydrogenase (NAD+ dependent), methenyltetrahydrofolate cyclohydrolase /FL=gb:NM_006636.2

204388_s_at -2.21 gb:NM_000240.1 /DEF=Homo sapiens monoamine oxidase A (MAOA), nuclear gene encoding mitochondrial protein, mRNA. /FEA=mRNA /GEN=MAOA /PROD=monoamine oxidase A /DB_XREF=gi:4557734 /UG=Hs.183109 monoamine oxidase A /FL=gb:M68840.1 gb:M69226.1 gb:NM_000240.1

216028_at -2.21 Consensus includes gb:AL049980.1 /DEF=Homo sapiens mRNA; cDNA DKFZp564C152 (from clone DKFZp564C152). /FEA=mRNA /GEN=DKFZp564C152 /PROD=hypothetical protein /DB_XREF=gi:4884230 /UG=Hs.184216 DKFZP564C152 protein

217999_s_at -2.21 Consensus includes gb:NM_007350.1 /DEF=Homo sapiens pleckstrin homology-like domain, family A, member 1 (PHLDA1), mRNA. /FEA=mRNA /GEN=PHLDA1 /PROD=pleckstrin homology-like domain, family A,member 1 /DB_XREF=gi:6679302 /UG=Hs.82101 pleckstrin homology-like domain, family A, member 1 /FL=gb:NM_007350.1

219572_at -2.22 gb:NM_017954.1 /DEF=Homo sapiens hypothetical protein FLJ20761 (FLJ20761), mRNA. /FEA=mRNA /GEN=FLJ20761 /PROD=hypothetical protein FLJ20761 /DB_XREF=gi:8923671 /UG=Hs.107872 hypothetical protein FLJ20761 /FL=gb:NM_017954.1

203565_s_at -2.22 gb:NM_002431.1 /DEF=Homo sapiens menage a trois 1 (CAK assembly factor) (MNAT1), mRNA. /FEA=mRNA /GEN=MNAT1 /PROD=menage a trois 1 (CAK assembly factor) /DB_XREF=gi:4505224 /UG=Hs.82380 menage a trois 1 (CAK assembly factor) /FL=gb:BC000820.1 gb:NM_002431.1

218789_s_at -2.22 gb:NM_019021.1 /DEF=Homo sapiens hypothetical protein (FLJ20010), mRNA. /FEA=mRNA /GEN=FLJ20010 /PROD=hypothetical protein /DB_XREF=gi:9506646 /UG=Hs.91816 hypothetical protein /FL=gb:NM_019021.1

204791_at -2.22 gb:NM_003297.1 /DEF=Homo sapiens nuclear receptor subfamily 2, group C, member 1 (NR2C1), mRNA. /FEA=mRNA /GEN=NR2C1 /PROD=nuclear receptor subfamily 2, group C, member 1 /DB_XREF=gi:4507672 /UG=Hs.108301 nuclear receptor subfamily 2, group C, member 1 /FL=gb:M29960.1 gb:NM_003297.1

218859_s_at -2.22 gb:NM_016649.1 /DEF=Homo sapiens HDCMC28P protein (HDCMC28P), mRNA. /FEA=mRNA /GEN=HDCMC28P /PROD=HDCMC28P protein /DB_XREF=gi:7705402 /UG=Hs.88820 HDCMC28P protein /FL=gb:AF068285.1 gb:NM_016649.1

218352_at -2.22 gb:NM_018191.1 /DEF=Homo sapiens hypothetical protein FLJ10716 (FLJ10716), mRNA. /FEA=mRNA /GEN=FLJ10716 /PROD=hypothetical protein FLJ10716 /DB_XREF=gi:8922616 /UG=Hs.24129 hypothetical protein FLJ10716 /FL=gb:NM_018191.1

213320_at -2.22 Consensus includes gb:AL551971 /FEA=EST /DB_XREF=gi:12890422 /DB_XREF=est:AL551971 /CLONE=CS0DI060YG02 (3 prime) /UG=Hs.152337 protein arginine N-methyltransferase 3(hnRNP methyltransferase S. cerevisiae)-like 3

210621_s_at -2.22 gb:M23612.1 /DEF=Human GTPase-activating protein (GAP) mRNA, complete cds. /FEA=mRNA /GEN=GAP /PROD=GTPase-activating protein /DB_XREF=gi:182973 /UG=Hs.758 RAS p21 protein activator (GTPase

activating protein) 1 /FL=gb:NM_022650.1 gb:M23612.1 219976_at -2.23 gb:NM_015888.1 /DEF=Homo sapiens hook1 protein (HOOK1), mRNA. /FEA=mRNA /GEN=HOOK1

/PROD=hook1 protein /DB_XREF=gi:7705414 /UG=Hs.250752 hook1 protein /FL=gb:AF044923.1 gb:NM_015888.1

218706_s_at -2.23 Consensus includes gb:AW575493 /FEA=EST /DB_XREF=gi:7247032 /DB_XREF=est:UI-HF-BM0-adp-a-04-0-UI.s1 /CLONE=IMAGE:3062287 /UG=Hs.235445 hypothetical protein FLJ21313 /FL=gb:NM_023927.1

220936_s_at -2.23 gb:NM_018267.1 /DEF=Homo sapiens hypothetical protein FLJ10903 (FLJ10903), mRNA. /FEA=mRNA /GEN=FLJ10903 /PROD=hypothetical protein FLJ10903 /DB_XREF=gi:8922757 /UG=Hs.36727 hypothetical protein FLJ10903 /FL=gb:NM_018267.1

213425_at -2.23 Consensus includes gb:AI968085 /FEA=EST /DB_XREF=gi:5764903 /DB_XREF=est:wu12h08.x1 /CLONE=IMAGE:2516799 /UG=Hs.152213 wingless-type MMTV integration site family, member 5A

205768_s_at -2.24 gb:NM_003645.1 /DEF=Homo sapiens fatty-acid-Coenzyme A ligase, very long-chain 1 (FACVL1), mRNA. /FEA=mRNA /GEN=FACVL1 /PROD=very long-chain fatty-acid-Coenzyme A ligase 1 /DB_XREF=gi:4503652 /UG=Hs.11729 fatty-acid-Coenzyme A ligase, very long-chain 1 /FL=gb:D88308.1 gb:AF096290.1 gb:NM_003645.1

207326_at -2.24 gb:NM_001729.1 /DEF=Homo sapiens betacellulin (BTC), mRNA. /FEA=mRNA /GEN=BTC /PROD=betacellulin /DB_XREF=gi:4502460 /UG=Hs.73105 betacellulin /FL=gb:NM_001729.1

219957_at -2.24 gb:NM_017987.1 /DEF=Homo sapiens hypothetical protein FLJ10063 (FLJ10063), mRNA. /FEA=mRNA /GEN=FLJ10063 /PROD=hypothetical protein FLJ10063 /DB_XREF=gi:8922215 /UG=Hs.154091 hypothetical protein FLJ10063 /FL=gb:NM_017987.1

218371_s_at -2.25 gb:NM_018282.1 /DEF=Homo sapiens hypothetical protein FLJ10955 (FLJ10955), mRNA. /FEA=mRNA /GEN=FLJ10955 /PROD=hypothetical protein FLJ10955 /DB_XREF=gi:8922788 /UG=Hs.16364 hypothetical protein FLJ10955 /FL=gb:NM_018282.1

205194_at -2.25 gb:NM_004577.1 /DEF=Homo sapiens phosphoserine phosphatase (PSPH), mRNA. /FEA=mRNA /GEN=PSPH /PROD=phosphoserine phosphatase /DB_XREF=gi:4758971 /UG=Hs.56407 phosphoserine phosphatase /FL=gb:NM_004577.1

212327_at -2.25 Consensus includes gb:AK026815.1 /DEF=Homo sapiens cDNA: FLJ23162 fis, clone LNG09734. /FEA=mRNA /DB_XREF=gi:10439759 /UG=Hs.202949 KIAA1102 protein

213540_at -2.26 Consensus includes gb:AL031228 /DEF=Human DNA sequence from clone 1033B10 on chromosome 6p21.2-21.31. Contains the BING5 gene, exons 11 to 15 of the BING4 gene, the gene for GalT3 (beta3-Galactosyltransferase), the RPS18 (40S ribosomal protein S18) gene, the SACM2L (suppressor of ac... /FEA=mRNA_1 /DB_XREF=gi:3646023 /UG=Hs.288354 FabG (beta-ketoacyl-acyl-carrier-protein reductase, E coli) like

203169_at -2.26 gb:NM_014785.1 /DEF=Homo sapiens KIAA0258 gene product (KIAA0258), mRNA. /FEA=mRNA /GEN=KIAA0258 /PROD=KIAA0258 gene product /DB_XREF=gi:7662029 /UG=Hs.47313 KIAA0258 gene product /FL=gb:BC001725.1 gb:D87447.1 gb:NM_014785.1

214440_at -2.26 Consensus includes gb:NM_000662.1 /DEF=Homo sapiens N-acetyltransferase 1 (arylamine N-acetyltransferase) (NAT1), mRNA. /FEA=CDS /GEN=NAT1 /PROD=N-acetyltransferase 1 /DB_XREF=gi:4505334 /UG=Hs.155956 N-acetyltransferase 1 (arylamine N-acetyltransferase) /FL=gb:NM_000662.1

218804_at -2.26 gb:NM_018043.1 /DEF=Homo sapiens hypothetical protein FLJ10261 (FLJ10261), mRNA. /FEA=mRNA /GEN=FLJ10261 /PROD=hypothetical protein FLJ10261 /DB_XREF=gi:8922319 /UG=Hs.26176 hypothetical protein FLJ10261 /FL=gb:NM_018043.1

203232_s_at -2.26 gb:NM_000332.1 /DEF=Homo sapiens spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal

dominant, ataxin 1) (SCA1), mRNA. /FEA=mRNA /GEN=SCA1 /PROD=ataxin 1 /DB_XREF=gi:4506792 /UG=Hs.74520 spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1) /FL=gb:NM_000332.1

213110_s_at -2.26 Consensus includes gb:AW052179 /FEA=EST /DB_XREF=gi:5914538 /DB_XREF=est:wx26h09.x1 /CLONE=IMAGE:2544833 /UG=Hs.169825 collagen, type IV, alpha 5 (Alport syndrome) /FL=gb:NM_000495.2

204838_s_at -2.26 gb:NM_014381.1 /DEF=Homo sapiens mutL (E. coli) homolog 3 (MLH3), mRNA. /FEA=mRNA /GEN=MLH3 /PROD=mutL (E. coli) homolog 3 /DB_XREF=gi:7657336 /UG=Hs.279843 mutL (E. coli) homolog 3 /FL=gb:AF195657.1 gb:NM_014381.1

216805_at -2.26 Consensus includes gb:AK027254.1 /DEF=Homo sapiens cDNA: FLJ23601 fis, clone LNG15501. /FEA=mRNA /DB_XREF=gi:10440343 /UG=Hs.306918 Homo sapiens cDNA: FLJ23601 fis, clone LNG15501

208181_at -2.27 gb:NM_003543.2 /DEF=Homo sapiens H4 histone family, member H (H4FH), mRNA. /FEA=mRNA /GEN=H4FH /PROD=H4 histone family, member H /DB_XREF=gi:5579466 /UG=Hs.93758 H4 histone family, member H /FL=gb:NM_003543.2

200704_at -2.27 gb:AB034747.1 /DEF=Homo sapiens SIMPLE mRNA for small integral membrane protein of lysosomelate endosome, complete cds. /FEA=mRNA /GEN=SIMPLE /PROD=small integral membrane protein of lysosomelateendosome /DB_XREF=gi:12862475 /UG=Hs.76507 LPS-induced TNF-alpha factor /FL=gb:AB034747.1 gb:U77396.1 gb:AF010312.1 gb:NM_004862.1

209112_at -2.27 gb:BC001971.1 /DEF=Homo sapiens, Similar to cyclin-dependent kinase inhibitor 1B (p27, Kip1), clone MGC:5304, mRNA, complete cds. /FEA=mRNA /PROD=Similar to cyclin-dependent kinase inhibitor 1B(p27, Kip1) /DB_XREF=gi:12805034 /UG=Hs.238990 cyclin-dependent kinase inhibitor 1B (p27, Kip1) /FL=gb:BC001971.1 gb:NM_004064.1 gb:U10906.1 gb:AF247551.1 gb:AY004255.1

203439_s_at -2.27 gb:BC000658.1 /DEF=Homo sapiens, stanniocalcin 2, clone MGC:1881, mRNA, complete cds. /FEA=mRNA /PROD=stanniocalcin 2 /DB_XREF=gi:12653744 /UG=Hs.155223 stanniocalcin 2 /FL=gb:BC000658.1 gb:AF055460.1 gb:AB012664.1 gb:AF098462.1 gb:AF031036.1 gb:NM_003714.1

214007_s_at -2.27 Consensus includes gb:AW665024 /FEA=EST /DB_XREF=gi:7457569 /DB_XREF=est:hi86c09.x1 /CLONE=IMAGE:2979184 /UG=Hs.82643 protein tyrosine kinase 9

206113_s_at -2.27 gb:NM_004162.1 /DEF=Homo sapiens RAB5A, member RAS oncogene family (RAB5A), mRNA. /FEA=mRNA /GEN=RAB5A /PROD=RAB5A, member RAS oncogene family /DB_XREF=gi:4759003 /UG=Hs.73957 RAB5A, member RAS oncogene family /FL=gb:NM_004162.1 gb:M28215.1

209099_x_at -2.28 gb:U73936.1 /DEF=Homo sapiens Jagged 1 (HJ1) mRNA, complete cds. /FEA=mRNA /GEN=HJ1 /PROD=Jagged 1 /DB_XREF=gi:1695273 /UG=Hs.91143 jagged 1 (Alagille syndrome) /FL=gb:U61276.1 gb:U73936.1 gb:AF003837.1 gb:AF028593.1 gb:NM_000214.1

215175_at -2.29 Consensus includes gb:AB023212.1 /DEF=Homo sapiens mRNA for KIAA0995 protein, partial cds. /FEA=mRNA /GEN=KIAA0995 /PROD=KIAA0995 protein /DB_XREF=gi:4589633 /UG=Hs.225967 KIAA0995 protein

219608_s_at -2.3 gb:NM_024862.1 /DEF=Homo sapiens hypothetical protein FLJ13962 (FLJ13962), mRNA. /FEA=mRNA /GEN=FLJ13962 /PROD=hypothetical protein FLJ13962 /DB_XREF=gi:13376291 /UG=Hs.330407 hypothetical protein FLJ13962 /FL=gb:NM_024862.1

214096_s_at -2.31 Consensus includes gb:AW190316 /FEA=EST /DB_XREF=gi:6464796 /DB_XREF=est:xl13g08.x1 /CLONE=IMAGE:2676158 /UG=Hs.2186 eukaryotic translation elongation factor 1 gamma

202956_at -2.31 gb:NM_006421.2 /DEF=Homo sapiens brefeldin A-inhibited guanine nucleotide-exchange protein 1 (BIG1), mRNA. /FEA=mRNA /GEN=BIG1 /PROD=brefeldin A-inhibited guaninenucleotide-exchange protein 1 /DB_XREF=gi:6715588 /UG=Hs.94631 brefeldin A-inhibited guanine nucleotide-exchange protein 1 /FL=gb:AF084520.1 gb:AF111162.1 gb:NM_006421.2

203227_s_at -2.31 gb:NM_005981.1 /DEF=Homo sapiens sarcoma amplified sequence (SAS), mRNA. /FEA=mRNA /GEN=SAS /PROD=sarcoma amplified sequence /DB_XREF=gi:5174666 /UG=Hs.50984 sarcoma amplified sequence /FL=gb:U01160.1 gb:NM_005981.1

203895_at -2.31 Consensus includes gb:AL535113 /FEA=EST /DB_XREF=gi:12798606 /DB_XREF=est:AL535113 /CLONE=CS0DF008YC23 (3 prime) /UG=Hs.283006 phospholipase C, beta 4 /FL=gb:NM_000933.1 gb:L41349.1

214831_at -2.31 Consensus includes gb:AK024944.1 /DEF=Homo sapiens cDNA: FLJ21291 fis, clone COL01963. /FEA=mRNA /DB_XREF=gi:10437366 /UG=Hs.287657 Homo sapiens cDNA: FLJ21291 fis, clone COL01963

209210_s_at -2.32 gb:Z24725.1 /DEF=H.sapiens mitogen inducible gene mig-2, complete CDS. /FEA=mRNA /PROD=mitogen inducible gene mig-2 /DB_XREF=gi:505032 /UG=Hs.75260 mitogen inducible 2 /FL=gb:Z24725.1

219581_at -2.32 gb:NM_025265.1 /DEF=Homo sapiens hypothetical protein MGC2776 (MGC2776), mRNA. /FEA=mRNA /GEN=MGC2776 /PROD=hypothetical protein MGC2776 /DB_XREF=gi:13376881 /UG=Hs.15713 hypothetical protein MGC2776 /FL=gb:BC004178.1 gb:BC004211.1 gb:NM_025265.1

205219_s_at -2.33 gb:NM_002044.1 /DEF=Homo sapiens galactokinase 2 (GALK2), mRNA. /FEA=mRNA /GEN=GALK2 /PROD=galactokinase 2 /DB_XREF=gi:4503896 /UG=Hs.129228 galactokinase 2 /FL=gb:BC005141.1 gb:M84443.1 gb:NM_002044.1

204672_s_at -2.33 gb:NM_014942.1 /DEF=Homo sapiens KIAA0957 protein (KIAA0957), mRNA. /FEA=mRNA /GEN=KIAA0957 /PROD=KIAA0957 protein /DB_XREF=gi:7662405 /UG=Hs.30991 KIAA0957 protein /FL=gb:AB023174.1 gb:NM_014942.1

202342_s_at -2.33 gb:NM_015271.1 /DEF=Homo sapiens tripartite motif protein TRIM2 (KIAA0517), mRNA. /FEA=mRNA /GEN=KIAA0517 /PROD=tripartite motif protein TRIM2 /DB_XREF=gi:13446226 /UG=Hs.12372 tripartite motif protein TRIM2 /FL=gb:AF220018.1 gb:NM_015271.1

216942_s_at -2.33 Consensus includes gb:D28586.1 /DEF=Human mRNA for LFA-3(delta D2), partial cds. /FEA=mRNA /PROD=LFA-3(delta D2) /DB_XREF=gi:466540 /UG=Hs.75626 CD58 antigen, (lymphocyte function-associated antigen 3)

215723_s_at -2.34 Consensus includes gb:AJ276230.1 /DEF=Homo sapiens mRNA for partial phospholipase D1, splice variant PLD1ab2. /FEA=mRNA /GEN=PLD1 /PROD=phospholipase D1 /DB_XREF=gi:7161182 /UG=Hs.82587 phospholipase D1, phophatidylcholine-specific

213501_at -2.34 Consensus includes gb:T62985 /FEA=EST /DB_XREF=gi:666642 /DB_XREF=est:yc15d05.s1 /CLONE=IMAGE:80745 /UG=Hs.167835 acyl-Coenzyme A oxidase 1, palmitoyl

207416_s_at -2.34 gb:NM_004555.1 /DEF=Homo sapiens nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3 (NFATC3), mRNA. /FEA=mRNA /GEN=NFATC3 /PROD=nuclear factor of activated T-cells,cytoplasmic, calcineurin-dependent 3 /DB_XREF=gi:4758803 /UG=Hs.172674 nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3 /FL=gb:U85428.1 gb:NM_004555.1 gb:L41067.1

203570_at -2.34 gb:NM_005576.1 /DEF=Homo sapiens lysyl oxidase-like 1 (LOXL1), mRNA. /FEA=mRNA /GEN=LOXL1 /PROD=lysyl oxidase-like 1 /DB_XREF=gi:5031882 /UG=Hs.65436 lysyl oxidase-like 1 /FL=gb:L21186.1 gb:NM_005576.1

218877_s_at -2.35 gb:NM_021820.1 /DEF=Homo sapiens MDS024 protein (MDS024), mRNA. /FEA=mRNA /GEN=MDS024 /PROD=MDS024 protein /DB_XREF=gi:11141892 /UG=Hs.286122 MDS024 protein /FL=gb:AF182423.1 gb:NM_021820.1

220122_at -2.35 gb:NM_024717.1 /DEF=Homo sapiens hypothetical protein FLJ22344 (FLJ22344), mRNA. /FEA=mRNA /GEN=FLJ22344 /PROD=hypothetical protein FLJ22344 /DB_XREF=gi:13376020 /UG=Hs.107716 hypothetical protein FLJ22344 /FL=gb:NM_024717.1

220089_at -2.35 gb:NM_024884.1 /DEF=Homo sapiens hypothetical protein FLJ12618 (FLJ12618), mRNA. /FEA=mRNA /GEN=FLJ12618 /PROD=hypothetical protein FLJ12618 /DB_XREF=gi:13376330 /UG=Hs.222021 hypothetical

protein FLJ12618 /FL=gb:NM_024884.1 218701_at -2.36 gb:NM_016027.1 /DEF=Homo sapiens CGI-83 protein (LOC51110), mRNA. /FEA=mRNA /GEN=LOC51110

/PROD=CGI-83 protein /DB_XREF=gi:7705792 /UG=Hs.118554 CGI-83 protein /FL=gb:BC000878.1 gb:AF151841.1 gb:NM_016027.1

218545_at -2.37 gb:NM_018318.1 /DEF=Homo sapiens hypothetical protein FLJ11088 (FLJ11088), mRNA. /FEA=mRNA /GEN=FLJ11088 /PROD=hypothetical protein FLJ11088 /DB_XREF=gi:8922858 /UG=Hs.49282 hypothetical protein FLJ11088 /FL=gb:NM_018318.1

207713_s_at -2.37 gb:NM_006462.1 /DEF=Homo sapiens HBV associated factor (XAP4), mRNA. /FEA=mRNA /GEN=XAP4 /PROD=HBV associated factor /DB_XREF=gi:5454167 /UG=Hs.247280 HBV associated factor /FL=gb:NM_006462.1

202149_at -2.37 Consensus includes gb:AL136139 /DEF=Human DNA sequence from clone RP4-761I2 on chromosome 6 Contains 3 part of the gene for enhancer of filamentation (HEF1), ESTs, STSs and CpG islands /FEA=mRNA /DB_XREF=gi:8217463 /UG=Hs.80261 enhancer of filamentation 1 (cas-like docking; Crk-associated substrate related) /FL=gb:L43821.1 gb:U64317.1 gb:NM_006403.1

206101_at -2.37 gb:NM_001393.1 /DEF=Homo sapiens extracellular matrix protein 2, female organ and adipocyte specific (ECM2), mRNA. /FEA=mRNA /GEN=ECM2 /PROD=extracellular matrix protein 2 /DB_XREF=gi:4557542 /UG=Hs.35094 extracellular matrix protein 2, female organ and adipocyte specific /FL=gb:AB011792.1 gb:NM_001393.1

205087_at -2.38 gb:NM_015485.1 /DEF=Homo sapiens DKFZP566K023 protein (DKFZP566K023), mRNA. /FEA=mRNA /GEN=DKFZP566K023 /PROD=DKFZP566K023 protein /DB_XREF=gi:7661655 /UG=Hs.19999 DKFZP566K023 protein /FL=gb:NM_015485.1

204040_at -2.39 gb:NM_014746.1 /DEF=Homo sapiens KIAA0161 gene product (KIAA0161), mRNA. /FEA=mRNA /GEN=KIAA0161 /PROD=KIAA0161 gene product /DB_XREF=gi:7661955 /UG=Hs.78894 KIAA0161 gene product /FL=gb:D79983.1 gb:NM_014746.1

210510_s_at -2.39 gb:AF145712.1 /DEF=Homo sapiens soluble neuropilin-1 mRNA, complete cds. /FEA=mRNA /PROD=soluble neuropilin-1 /DB_XREF=gi:7271464 /UG=Hs.69285 neuropilin 1 /FL=gb:AF145712.1

220072_at -2.39 gb:NM_024790.1 /DEF=Homo sapiens hypothetical protein FLJ22490 (FLJ22490), mRNA. /FEA=mRNA /GEN=FLJ22490 /PROD=hypothetical protein FLJ22490 /DB_XREF=gi:13376157 /UG=Hs.153746 hypothetical protein FLJ22490 /FL=gb:NM_024790.1

218197_s_at -2.39 gb:NM_018002.1 /DEF=Homo sapiens oxidation resistance 1 (OXR1), mRNA. /FEA=mRNA /GEN=OXR1 /PROD=oxidation resistance 1 /DB_XREF=gi:8922240 /UG=Hs.169111 oxidation resistance 1 /FL=gb:NM_018002.1

219109_at -2.4 gb:NM_024532.1 /DEF=Homo sapiens hypothetical protein FLJ22724 (FLJ22724), mRNA. /FEA=mRNA /GEN=FLJ22724 /PROD=hypothetical protein FLJ22724 /DB_XREF=gi:13375683 /UG=Hs.6783 hypothetical protein FLJ22724 /FL=gb:NM_024532.1

216411_s_at -2.4 Consensus includes gb:AK023699.1 /DEF=Homo sapiens cDNA FLJ13637 fis, clone PLACE1011165. /FEA=mRNA /DB_XREF=gi:10435704 /UG=Hs.287584 Homo sapiens cDNA FLJ13637 fis, clone PLACE1011165

213419_at -2.41 Consensus includes gb:U62325.1 /DEF=Human FE65-like protein (hFE65L) mRNA, partial cds. /FEA=mRNA /GEN=hFE65L /PROD=FE65-like protein /DB_XREF=gi:1657751 /UG=Hs.324125 amyloid beta (A4) precursor protein-binding, family B, member 2 (Fe65-like)

212338_at -2.41 Consensus includes gb:AA621962 /FEA=EST /DB_XREF=gi:2525838 /DB_XREF=est:nq24b02.s1 /CLONE=IMAGE:1144779 /UG=Hs.39871 KIAA0727 protein

212870_at -2.41 Consensus includes gb:AI628605 /FEA=EST /DB_XREF=gi:4665405 /DB_XREF=est:ty77a08.x1 /CLONE=IMAGE:2285078 /UG=Hs.326392 son of sevenless (Drosophila) homolog 1 /FL=gb:L13858.1

gb:NM_005633.1 213839_at -2.41 Consensus includes gb:AW028110 /FEA=EST /DB_XREF=gi:5886866 /DB_XREF=est:wv26a10.x1

/CLONE=IMAGE:2530650 /UG=Hs.301478 KIAA0500 protein 219280_at -2.41 gb:NM_018963.1 /DEF=Homo sapiens WD repeat domain 9 (WDR9), mRNA. /FEA=mRNA /GEN=WDR9

/PROD=WD repeat domain 9 /DB_XREF=gi:11321643 /UG=Hs.225674 WD repeat domain 9 /FL=gb:NM_018963.1 221730_at -2.41 Consensus includes gb:NM_000393.1 /DEF=Homo sapiens collagen, type V, alpha 2 (COL5A2), mRNA.

/FEA=CDS /GEN=COL5A2 /PROD=collagen, type V, alpha 2 /DB_XREF=gi:4502958 /UG=Hs.82985 collagen, type V, alpha 2 /FL=gb:NM_000393.1

209189_at -2.43 gb:BC004490.1 /DEF=Homo sapiens, v-fos FBJ murine osteosarcoma viral oncogene homolog, clone MGC:11074, mRNA, complete cds. /FEA=mRNA /PROD=v-fos FBJ murine osteosarcoma viral oncogenehomolog /DB_XREF=gi:13325363 /UG=Hs.25647 v-fos FBJ murine osteosarcoma viral oncogene homolog /FL=gb:BC004490.1 gb:NM_005252.2

203513_at -2.43 gb:NM_025137.1 /DEF=Homo sapiens hypothetical protein FLJ21439 (FLJ21439), mRNA. /FEA=mRNA /GEN=FLJ21439 /PROD=hypothetical protein FLJ21439 /DB_XREF=gi:13376718 /UG=Hs.288872 hypothetical protein FLJ21439 /FL=gb:NM_025137.1

221824_s_at -2.43 Consensus includes gb:AA770170 /FEA=EST /DB_XREF=gi:2821408 /DB_XREF=est:ah84d09.s1 /CLONE=1322321 /UG=Hs.288156 Homo sapiens cDNA: FLJ21819 fis, clone HEP01185

203780_at -2.44 gb:AF275945.1 /DEF=Homo sapiens epithelial V-like antigen 1 (EVA1) mRNA, complete cds. /FEA=mRNA /GEN=EVA1 /PROD=epithelial V-like antigen 1 /DB_XREF=gi:9392652 /UG=Hs.116651 epithelial V-like antigen 1 /FL=gb:AF304447.1 gb:AF030455.1 gb:NM_005797.1 gb:AF275945.1

220945_x_at -2.44 gb:NM_018050.1 /DEF=Homo sapiens hypothetical protein FLJ10298 (FLJ10298), mRNA. /FEA=mRNA /GEN=FLJ10298 /PROD=hypothetical protein FLJ10298 /DB_XREF=gi:8922334 /UG=Hs.5999 hypothetical protein FLJ10298 /FL=gb:NM_018050.1

207219_at -2.44 gb:NM_023070.1 /DEF=Homo sapiens hypothetical protein (LOC65243), mRNA. /FEA=mRNA /GEN=LOC65243 /PROD=hypothetical protein /DB_XREF=gi:12751478 /UG=Hs.133034 hypothetical protein /FL=gb:NM_023070.1

217627_at -2.45 Consensus includes gb:BE515346 /FEA=EST /DB_XREF=gi:9722561 /DB_XREF=est:601235986F1 /CLONE=IMAGE:3608205 /UG=Hs.278871 ESTs, Weakly similar to S47072 finger protein HZF10, Krueppel-related H.sapiens

61732_r_at -2.46 Cluster Incl. AI610355:tp18g08.x1 Homo sapiens cDNA, 3 end /clone=IMAGE-2188190 /clone_end=3 /gb=AI610355 /gi=4619522 /ug=Hs.39328 /len=463

209457_at -2.46 gb:U16996.1 /DEF=Human protein tyrosine phosphatase mRNA, complete cds. /FEA=mRNA /PROD=protein tyrosine phosphatase /DB_XREF=gi:642012 /UG=Hs.2128 dual specificity phosphatase 5 /FL=gb:NM_004419.2 gb:U16996.1 gb:U15932.2

213308_at -2.46 Consensus includes gb:BF435773 /FEA=EST /DB_XREF=gi:11448088 /DB_XREF=est:nab41f03.x1 /CLONE=IMAGE:3268373 /UG=Hs.12696 cortactin SH3 domain-binding protein

220176_at -2.46 gb:NM_025152.1 /DEF=Homo sapiens hypothetical protein FLJ12660 (FLJ12660), mRNA. /FEA=mRNA /GEN=FLJ12660 /PROD=hypothetical protein FLJ12660 /DB_XREF=gi:13376746 /UG=Hs.288981 hypothetical protein FLJ12660 /FL=gb:NM_025152.1

205594_at -2.46 gb:NM_014897.1 /DEF=Homo sapiens KIAA0924 protein (KIAA0924), mRNA. /FEA=mRNA /GEN=KIAA0924 /PROD=KIAA0924 protein /DB_XREF=gi:7662383 /UG=Hs.190386 KIAA0924 protein /FL=gb:AB023141.1 gb:NM_014897.1

215022_x_at -2.47 Consensus includes gb:BG429214 /FEA=EST /DB_XREF=gi:13335720 /DB_XREF=est:602498083F1 /CLONE=IMAGE:4611836 /UG=Hs.258144 zinc finger protein 33b (KOX 31)

215610_at -2.48 Consensus includes gb:AK022038.1 /DEF=Homo sapiens cDNA FLJ11976 fis, clone HEMBB1001253. /FEA=mRNA /DB_XREF=gi:10433356 /UG=Hs.296679 Homo sapiens cDNA FLJ11976 fis, clone HEMBB1001253

218043_s_at -2.48 gb:NM_022461.1 /DEF=Homo sapiens hypothetical protein FLJ21939 similar to 5-azacytidine induced gene 2 (FLJ21939), mRNA. /FEA=mRNA /GEN=FLJ21939 /PROD=hypothetical protein FLJ21939 similar to5-azacytidine induced gene 2 /DB_XREF=gi:11968002 /UG=Hs.164478 hypothetical protein FLJ21939 similar to 5-azacytidine induced gene 2 /FL=gb:NM_022461.1

209551_at -2.48 gb:BC004875.1 /DEF=Homo sapiens, Similar to RIKEN cDNA 2310034L04 gene, clone MGC:11061, mRNA, complete cds. /FEA=mRNA /PROD=Similar to RIKEN cDNA 2310034L04 gene /DB_XREF=gi:13436109 /UG=Hs.66309 Homo sapiens, Similar to RIKEN cDNA 2310034L04 gene, clone MGC:11061, mRNA, complete cds /FL=gb:BC004875.1

213212_x_at -2.48 Consensus includes gb:AI632181 /FEA=EST /DB_XREF=gi:4683511 /DB_XREF=est:ts85h05.x1/CLONE=IMAGE:2238105 /UG=Hs.182982 golgin-67

206506_s_at -2.48 gb:NM_003599.1 /DEF=Homo sapiens suppressor of Ty (S.cerevisiae) 3 homolog (SUPT3H), mRNA. /FEA=mRNA /GEN=SUPT3H /PROD=suppressor of Ty (S.cerevisiae) 3 homolog /DB_XREF=gi:4507308 /UG=Hs.96757 suppressor of Ty (S.cerevisiae) 3 homolog /FL=gb:AF073930.1 gb:AF069734.1 gb:NM_003599.1

204671_s_at -2.48 Consensus includes gb:BE677131 /FEA=EST /DB_XREF=gi:10037672 /DB_XREF=est:7d80g06.x1 /CLONE=IMAGE:3279322 /UG=Hs.30991 KIAA0957 protein /FL=gb:AB023174.1 gb:NM_014942.1

205042_at -2.48 gb:NM_005476.2 /DEF=Homo sapiens UDP-N-acetylglucosamine-2-epimeraseN-acetylmannosamine kinase (GNE), mRNA. /FEA=mRNA /GEN=GNE /PROD=UDP-N-acetylglucosamine-2-epimeraseN-acetylmannosamine kinase /DB_XREF=gi:6382074 /UG=Hs.5920 UDP-N-acetylglucosamine-2-epimeraseN-acetylmannosamine kinase /FL=gb:AF051852.1 gb:AF155663.1 gb:NM_005476.2

217915_s_at -2.49 gb:NM_016304.1 /DEF=Homo sapiens 60S ribosomal protein L30 isolog (LOC51187), mRNA. /FEA=mRNA /GEN=LOC51187 /PROD=60S ribosomal protein L30 isolog /DB_XREF=gi:10047101 /UG=Hs.284162 60S ribosomal protein L30 isolog /FL=gb:NM_016304.1 gb:AF060926.1 gb:AF212226.1 gb:BC005344.1 gb:AF201949.1 gb:AF165521.1

204554_at -2.49 Consensus includes gb:AL109928 /DEF=Human DNA sequence from clone RP4-551D2 on chromosome 20q13.2-13.33. Contains the gene for a novel Cadherin domain protein, a novel gene, the PPP1R6 gene for protein phosphatase 1 regulatory subunit 6, the 5 end of the SYCP2 gene for synaptonemal... /FEA=mRNA_6 /DB_XREF=gi:7981303 /UG=Hs.42215 protein phosphatase 1, regulatory subunit 6 /FL=gb:NM_006242.2

204205_at -2.49 gb:NM_021822.1 /DEF=Homo sapiens phorbolin-like protein MDS019 (MDS019), mRNA. /FEA=mRNA /GEN=MDS019 /PROD=phorbolin-like protein MDS019 /DB_XREF=gi:13399303 /UG=Hs.250619 phorbolin-like protein MDS019 /FL=gb:AF182420.1 gb:NM_021822.1

215163_at -2.5 Consensus includes gb:AK022211.1 /DEF=Homo sapiens cDNA FLJ12149 fis, clone MAMMA1000421. /FEA=mRNA /DB_XREF=gi:10433557 /UG=Hs.203349 Homo sapiens cDNA FLJ12149 fis, clone MAMMA1000421

206667_s_at -2.5 gb:AF005037.1 /DEF=Homo sapiens secretory carrier membrane protein (SCAMP1) mRNA, complete cds. /FEA=mRNA /GEN=SCAMP1 /PROD=secretory carrier membrane protein /DB_XREF=gi:2232238 /UG=Hs.31218 secretory carrier membrane protein 1 /FL=gb:AF005037.1 gb:AF038966.1 gb:NM_004866.1

203186_s_at -2.5 gb:NM_002961.2 /DEF=Homo sapiens S100 calcium-binding protein A4 (calcium protein, calvasculin, metastasin, murine placental homolog) (S100A4), transcript variant 1, mRNA. /FEA=mRNA /GEN=S100A4 /PROD=S100 calcium-binding protein A4 /DB_XREF=gi:9845514 /UG=Hs.81256 S100 calcium-binding protein A4 (calcium protein, calvasculin, metastasin, murine placental homolog) /FL=gb:NM_002961.2 gb:NM_019554.1

216470_x_at -2.5 Consensus includes gb:AF009664 /DEF=Homo sapiens T cell receptor beta locus, 3 trypsinogen repeats /FEA=CDS_1 /DB_XREF=gi:2275594 /UG=Hs.303157 T cell receptor beta locus

205280_at -2.51 gb:NM_000824.1 /DEF=Homo sapiens glycine receptor, beta (GLRB), mRNA. /FEA=mRNA /GEN=GLRB /PROD=glycine receptor, beta /DB_XREF=gi:4504022 /UG=Hs.32973 glycine receptor, beta /FL=gb:AF094754.1 gb:NM_000824.1 gb:U33267.1

202538_s_at -2.51 gb:NM_014043.1 /DEF=Homo sapiens DKFZP564O123 protein (DKFZP564O123), mRNA. /FEA=mRNA /GEN=DKFZP564O123 /PROD=DKFZP564O123 protein /DB_XREF=gi:7661633 /UG=Hs.11449 DKFZP564O123 protein /FL=gb:AF151842.1 gb:AL080122.1 gb:NM_014043.1

207836_s_at -2.53 gb:NM_006867.1 /DEF=Homo sapiens RNA-binding protein gene with multiple splicing (RBPMS), mRNA. /FEA=mRNA /GEN=RBPMS /PROD=RNA-binding protein gene with multiple splicing /DB_XREF=gi:5803140 /UG=Hs.80248 RNA-binding protein gene with multiple splicing /FL=gb:D84110.1 gb:NM_006867.1

203917_at -2.53 gb:NM_001338.1 /DEF=Homo sapiens coxsackie virus and adenovirus receptor (CXADR), mRNA. /FEA=mRNA /GEN=CXADR /PROD=coxsackie virus and adenovirus receptor /DB_XREF=gi:4503172 /UG=Hs.79187 coxsackie virus and adenovirus receptor /FL=gb:BC003684.1 gb:U90716.1 gb:NM_001338.1

221986_s_at -2.53 Consensus includes gb:AW006750 /FEA=EST /DB_XREF=gi:5855528 /DB_XREF=est:wr28h09.x1 /CLONE=IMAGE:2489057 /UG=Hs.246875 hypothetical protein FLJ20059

218176_at -2.53 gb:NM_022149.1 /DEF=Homo sapiens MAGEF1 protein (MAGEF1), mRNA. /FEA=mRNA /GEN=MAGEF1 /PROD=MAGEF1 protein /DB_XREF=gi:11545891 /UG=Hs.306123 MAGEF1 protein /FL=gb:AF295378.1 gb:NM_022149.1

218919_at -2.54 gb:NM_024699.1 /DEF=Homo sapiens hypothetical protein FLJ14007 (FLJ14007), mRNA. /FEA=mRNA /GEN=FLJ14007 /PROD=hypothetical protein FLJ14007 /DB_XREF=gi:13375984 /UG=Hs.99519 hypothetical protein FLJ14007 /FL=gb:NM_024699.1

211555_s_at -2.54 gb:AF020340.1 /DEF=Homo sapiens soluble guanylate cyclase beta-1 subunit (GC-S-beta-1) mRNA, alternatively spliced, complete cds. /FEA=mRNA /GEN=GC-S-beta-1 /PROD=soluble guanylate cyclase beta-1 subunit /DB_XREF=gi:2746082 /UG=Hs.77890 guanylate cyclase 1, soluble, beta 3 /FL=gb:AF020340.1

222148_s_at -2.54 Consensus includes gb:BF688108 /FEA=EST /DB_XREF=gi:11973516 /DB_XREF=est:602067332F1 /CLONE=IMAGE:4066422 /UG=Hs.14202 hypothetical protein FLJ11040

213376_at -2.54 Consensus includes gb:AI656706 /FEA=EST /DB_XREF=gi:4740685 /DB_XREF=est:tt53e01.x1 /CLONE=IMAGE:2244504 /UG=Hs.24083 KIAA0997 protein

201811_x_at -2.54 gb:NM_004844.1 /DEF=Homo sapiens SH3-domain binding protein 5 (BTK-associated) (SH3BP5), mRNA. /FEA=mRNA /GEN=SH3BP5 /PROD=SH3-domain binding protein 5 (BTK-associated) /DB_XREF=gi:4759057 /UG=Hs.109150 SH3-domain binding protein 5 (BTK-associated) /FL=gb:AB005047.1 gb:NM_004844.1

218035_s_at -2.55 gb:NM_019027.1 /DEF=Homo sapiens hypothetical protein (FLJ20273), mRNA. /FEA=mRNA /GEN=FLJ20273 /PROD=hypothetical protein /DB_XREF=gi:9506670 /UG=Hs.95549 hypothetical protein /FL=gb:NM_019027.1

210480_s_at -2.55 gb:U90236.2 /DEF=Homo sapiens myosin VI (MYO6) mRNA, complete cds. /FEA=mRNA /GEN=MYO6 /PROD=myosin VI /DB_XREF=gi:9280815 /UG=Hs.22564 myosin VI /FL=gb:U90236.2

203408_s_at -2.55 gb:NM_002971.1 /DEF=Homo sapiens special AT-rich sequence binding protein 1 (binds to nuclear matrixscaffold-associating DNAs) (SATB1), mRNA. /FEA=mRNA /GEN=SATB1 /PROD=special AT-rich sequence binding protein 1(binds to nuclear matrixscaffold-associating DNAs) /DB_XREF=gi:4506790 /UG=Hs.74592 special AT-rich sequence binding protein 1 (binds to nuclear matrixscaffold-associating DNAs) /FL=gb:M97287.1 gb:NM_002971.1

215707_s_at -2.55 Consensus includes gb:AV725328 /FEA=EST /DB_XREF=gi:10830606 /DB_XREF=est:AV725328 /CLONE=HTCAVD03 /UG=Hs.74621 prion protein (p27-30) (Creutzfeld-Jakob disease, Gerstmann-Strausler-Scheinker syndrome, fatal familial insomnia)

204068_at -2.55 gb:NM_006281.1 /DEF=Homo sapiens serinethreonine kinase 3 (Ste20, yeast homolog) (STK3), mRNA. /FEA=mRNA /GEN=STK3 /PROD=serinethreonine kinase 3 (Ste20, yeasthomolog) /DB_XREF=gi:5454093

/UG=Hs.166684 serinethreonine kinase 3 (Ste20, yeast homolog) /FL=gb:U26424.1 gb:U60206.1 gb:NM_006281.1 203988_s_at -2.55 gb:NM_004480.1 /DEF=Homo sapiens fucosyltransferase 8 (alpha (1,6) fucosyltransferase) (FUT8), mRNA.

/FEA=mRNA /GEN=FUT8 /PROD=fucosyltransferase 8 (alpha (1,6)fucosyltransferase) /DB_XREF=gi:4758407 /UG=Hs.118722 fucosyltransferase 8 (alpha (1,6) fucosyltransferase) /FL=gb:D89289.1 gb:NM_004480.1

222266_at -2.55 Consensus includes gb:BF796940 /FEA=EST /DB_XREF=gi:12101994 /DB_XREF=est:602258153F1 /CLONE=IMAGE:4341588 /UG=Hs.294100 ESTs

203608_at -2.56 Consensus includes gb:AL031230 /DEF=Human DNA sequence from clone 73M23 on chromosome 6p22.2-22.3. Contains the 5 part of the possibly alternatively spliced gene for Phosphatidylinositol-glycan-specific Phospholipase D 1 precursor (EC 3.1.4.50, PIGPLD1, Glycoprotein Phospholipase D... /FEA=mRNA_5 /DB_XREF=gi:3947845 /UG=Hs.5299 aldehyde dehydrogenase 5 family, member A1 (succinate-semialdehyde dehydrogenase) /FL=gb:NM_001080.1

211937_at -2.56 Consensus includes gb:NM_001417.1 /DEF=Homo sapiens eukaryotic translation initiation factor 4B (EIF4B), mRNA. /FEA=CDS /GEN=EIF4B /PROD=eukaryotic translation initiation factor 4B /DB_XREF=gi:4503532 /UG=Hs.93379 eukaryotic translation initiation factor 4B /FL=gb:NM_001417.1

212633_at -2.56 Consensus includes gb:AL132776 /DEF=Human DNA sequence from clone RP3-393D12 on chromosome 6q16.1-16.3. Contains the 3 end of the gene KIAA0776, the gene for a novel LIM domain protein, ESTs, STSs and GSSs /FEA=mRNA_2 /DB_XREF=gi:6706246 /UG=Hs.5460 KIAA0776 protein

220169_at -2.56 gb:NM_024943.1 /DEF=Homo sapiens hypothetical protein FLJ23235 (FLJ23235), mRNA. /FEA=mRNA /GEN=FLJ23235 /PROD=hypothetical protein FLJ23235 /DB_XREF=gi:13376422 /UG=Hs.283578 hypothetical protein FLJ23235 /FL=gb:NM_024943.1

221085_at -2.56 gb:NM_005118.1 /DEF=Homo sapiens tumor necrosis factor (ligand) superfamily, member 15 (TNFSF15), mRNA. /FEA=mRNA /GEN=TNFSF15 /PROD=tumor necrosis factor (ligand) superfamily,member 15 /DB_XREF=gi:4827031 /UG=Hs.241382 tumor necrosis factor (ligand) superfamily, member 15 /FL=gb:NM_005118.1

203989_x_at -2.57 gb:NM_001992.2 /DEF=Homo sapiens coagulation factor II (thrombin) receptor (F2R), mRNA. /FEA=mRNA /GEN=F2R /PROD=coagulation factor II receptor precursor /DB_XREF=gi:6031164 /UG=Hs.128087 coagulation factor II (thrombin) receptor /FL=gb:BC002464.1 gb:M62424.1 gb:NM_001992.2

211277_x_at -2.57 gb:BC004369.1 /DEF=Homo sapiens, Similar to amyloid beta (A4) precursor protein (protease nexin-II, Alzheimerdisease), clone MGC:10403, mRNA, complete cds. /FEA=mRNA /PROD=Similar to amyloid beta (A4) precursor protein(protease nexin-II, Alzheimer disease) /DB_XREF=gi:13325111 /UG=Hs.177486 amyloid beta (A4) precursor protein (protease nexin-II, Alzheimer disease) /FL=gb:BC004369.1

218645_at -2.58 gb:NM_021994.1 /DEF=Homo sapiens zinc finger protein 277 (ZNF277), mRNA. /FEA=mRNA /GEN=ZNF277 /PROD=zinc finger protein 277 /DB_XREF=gi:11496268 /UG=Hs.42636 zinc finger protein 277 /FL=gb:NM_021994.1 gb:AF209198.1

215785_s_at -2.58 Consensus includes gb:AL161999.1 /DEF=Homo sapiens mRNA; cDNA DKFZp761H087 (from clone DKFZp761H087); partial cds. /FEA=mRNA /GEN=DKFZp761H087 /PROD=hypothetical protein /DB_XREF=gi:7328000 /UG=Hs.258503 p53 inducible protein

214182_at -2.58 Consensus includes gb:AA243143 /FEA=EST /DB_XREF=gi:1874138 /DB_XREF=est:zs13h04.s1 /CLONE=IMAGE:685111 /UG=Hs.89474 ADP-ribosylation factor 6

209212_s_at -2.58 gb:AB030824.1 /DEF=Homo sapiens mRNA for transcription factor BTEB2, complete cds. /FEA=mRNA /GEN=bteb2 /PROD=transcription factor BTEB2 /DB_XREF=gi:8272417 /UG=Hs.84728 Kruppel-like factor 5 (intestinal) /FL=gb:D14520.1 gb:NM_001730.1 gb:AF132818.1 gb:AB030824.1 gb:AF287272.1

215294_s_at -2.58 Consensus includes gb:AK026426.1 /DEF=Homo sapiens cDNA: FLJ22773 fis, clone KAIA1473, highly similar to

HUMSNF2L Human global transcription activator homologous sequence mRNA. /FEA=mRNA /DB_XREF=gi:10439287 /UG=Hs.152292 SWISNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1

218311_at -2.58 gb:NM_003618.1 /DEF=Homo sapiens mitogen-activated protein kinase kinase kinase kinase 3 (MAP4K3), mRNA. /FEA=mRNA /GEN=MAP4K3 /PROD=mitogen-activated protein kinase kinase kinasekinase 3 /DB_XREF=gi:4506376 /UG=Hs.227400 mitogen-activated protein kinase kinase kinase kinase 3 /FL=gb:AF000145.1 gb:NM_003618.1

209625_at -2.59 gb:BC004100.1 /DEF=Homo sapiens, phosphatidylinositol glycan, class H, clone MGC:10360, mRNA, complete cds. /FEA=mRNA /PROD=phosphatidylinositol glycan, class H /DB_XREF=gi:13278629 /UG=Hs.177 phosphatidylinositol glycan, class H /FL=gb:BC004100.1 gb:L19783.1 gb:NM_004569.1

212299_at -2.59 Consensus includes gb:AL117502.1 /DEF=Homo sapiens mRNA; cDNA DKFZp434D0935 (from clone DKFZp434D0935). /FEA=mRNA /DB_XREF=gi:5912009 /UG=Hs.7200 Homo sapiens mRNA; cDNA DKFZp434D0935 (from clone DKFZp434D0935)

212593_s_at -2.61 Consensus includes gb:N92498 /FEA=EST /DB_XREF=gi:1264807 /DB_XREF=est:zb28a04.s1 /CLONE=IMAGE:304878 /UG=Hs.326248 Homo sapiens cDNA: FLJ22071 fis, clone HEP11691

215395_x_at -2.61 Consensus includes gb:U66061 /DEF=Human germline T-cell receptor beta chain TCRBV17S1A1T, TCRBV2S1, TCRBV10S1P, TCRBV29S1P, TCRBV19S1P, TCRBV15S1, TCRBV11S1A1T, HVB relic, TCRBV28S1P, TCRBV34S1, TCRBV14S1, TCRBV3S1, TCRBV4S1A1T, TRY4, TRY5, TRY6, TRY7, TRY8, TCRBD1, TCRBJ1S1, TCRB... /FEA=CDS_1 /DB_XREF=gi:1552511 /UG=Hs.302180 Human germline T-cell receptor beta chain TCRBV17S1A1T, TCRBV2S1, TCRBV10S1P, TCRBV29S1P, TCRBV19S1P, TCRBV15S1, TCRBV11S1A1T, HVB relic, TCRBV28S1P, TCRBV34S1, TCRBV14S1, TCRBV3S1, TCRBV4S1A1T, TRY4, TRY5, TRY6, TRY7, TRY8, TCRBD1, TCRBJ1S1, TCRBJ1S2, TC

221268_s_at -2.61 gb:NM_030791.1 /DEF=Homo sapiens sphingosine-1-phosphatase (LOC81537), mRNA. /FEA=mRNA /GEN=LOC81537 /PROD=sphingosine-1-phosphatase /DB_XREF=gi:13540568 /FL=gb:NM_030791.1

211760_s_at -2.62 gb:BC005974.1 /DEF=Homo sapiens, vesicle-associated membrane protein 4, clone MGC:14658, mRNA, complete cds. /FEA=mRNA /PROD=vesicle-associated membrane protein 4 /DB_XREF=gi:13543647 /FL=gb:BC005974.1

203265_s_at -2.62 Consensus includes gb:AA810268 /FEA=EST /DB_XREF=gi:2879627 /DB_XREF=est:od14f07.s1 /CLONE=IMAGE:1367941 /UG=Hs.75217 mitogen-activated protein kinase kinase 4 /FL=gb:NM_003010.1 gb:L36870.1 gb:U17743.1

218665_at -2.62 gb:NM_012193.1 /DEF=Homo sapiens frizzled (Drosophila) homolog 4 (FZD4), mRNA. /FEA=mRNA /GEN=FZD4 /PROD=frizzled (Drosophila) homolog 4 /DB_XREF=gi:6912383 /UG=Hs.19545 frizzled (Drosophila) homolog 4 /FL=gb:AB032417.1 gb:NM_012193.1

206417_at -2.65 gb:NM_000087.1 /DEF=Homo sapiens cyclic nucleotide gated channel alpha 1 (CNGA1), mRNA. /FEA=mRNA /GEN=CNGA1 /PROD=cyclic nucleotide gated channel alpha 1 /DB_XREF=gi:4502914 /UG=Hs.1323 cyclic nucleotide gated channel alpha 1 /FL=gb:M84741.1 gb:NM_000087.1

213704_at -2.66 Consensus includes gb:AA129753 /FEA=EST /DB_XREF=gi:1690163 /DB_XREF=est:zl16a12.s1 /CLONE=IMAGE:502078 /UG=Hs.78948 Rab geranylgeranyltransferase, beta subunit

204351_at -2.67 gb:NM_005980.1 /DEF=Homo sapiens S100 calcium-binding protein P (S100P), mRNA. /FEA=mRNA /GEN=S100P /PROD=S100 calcium-binding protein P /DB_XREF=gi:5174662 /UG=Hs.2962 S100 calcium-binding protein P /FL=gb:NM_005980.1

205402_x_at -2.68 gb:NM_002770.1 /DEF=Homo sapiens protease, serine, 2 (trypsin 2) (PRSS2), mRNA. /FEA=mRNA /GEN=PRSS2 /PROD=protease, serine, 2 (trypsin 2) /DB_XREF=gi:4506146 /UG=Hs.241561 protease, serine, 2 (trypsin 2) /FL=gb:NM_002770.1 gb:M27602.1

65517_at -2.68 Cluster Incl. AA910946:ok85g06.s1 Homo sapiens cDNA, 3 end /clone=IMAGE-1520794 /clone_end=3 /gb=AA910946 /gi=3050236 /ug=Hs.18894 /len=982

213672_at -2.7 Consensus includes gb:AA621558 /FEA=EST /DB_XREF=gi:2525497 /DB_XREF=est:af53a09.s1 /CLONE=IMAGE:1035352 /UG=Hs.279946 methionine-tRNA synthetase

210802_s_at -2.7 gb:BC002841.1 /DEF=Homo sapiens, Similar to putative dimethyladenosine transferase, clone MGC:3382, mRNA, complete cds. /FEA=mRNA /PROD=Similar to putative dimethyladenosinetransferase /DB_XREF=gi:12803982 /UG=Hs.125819 putative dimethyladenosine transferase /FL=gb:BC002841.1

219270_at -2.71 gb:NM_024111.1 /DEF=Homo sapiens hypothetical protein MGC4504 (MGC4504), mRNA. /FEA=mRNA /GEN=MGC4504 /PROD=hypothetical protein MGC4504 /DB_XREF=gi:13129125 /UG=Hs.155569 hypothetical protein MGC4504 /FL=gb:BC001847.1 gb:NM_024111.1

206354_at -2.71 gb:NM_019844.1 /DEF=Homo sapiens solute carrier family 21 (organic anion transporter), member 8 (SLC21A8), mRNA. /FEA=mRNA /GEN=SLC21A8 /PROD=solute carrier family 21 (organic aniontransporter), member 8 /DB_XREF=gi:9790232 /UG=Hs.274981 solute carrier family 21 (organic anion transporter), member 8 /FL=gb:AF187815.1 gb:NM_019844.1

213421_x_at -2.71 Consensus includes gb:AW007273 /FEA=EST /DB_XREF=gi:5856051 /DB_XREF=est:wt54d10.x1 /CLONE=IMAGE:2511283 /UG=Hs.58247 protease, serine, 4 (trypsin 4, brain)

219429_at -2.72 gb:NM_024306.1 /DEF=Homo sapiens fatty acid hydroxylase (FAAH), mRNA. /FEA=mRNA /GEN=FAAH /PROD=fatty acid hydroxylase /DB_XREF=gi:13236537 /UG=Hs.249163 fatty acid hydroxylase /FL=gb:BC002679.1 gb:NM_024306.1 gb:BC004263.1

217564_s_at -2.72 Consensus includes gb:W80357 /FEA=EST /DB_XREF=gi:1391394 /DB_XREF=est:zh49a06.s1 /CLONE=IMAGE:415378 /UG=Hs.326685 Homo sapiens carbamoyl-phosphate synthetase 1, mitochondrial (CPS1), mRNA

220728_at -2.72 gb:NM_025120.1 /DEF=Homo sapiens hypothetical protein FLJ13480 (FLJ13480), mRNA. /FEA=mRNA /GEN=FLJ13480 /PROD=hypothetical protein FLJ13480 /DB_XREF=gi:13376698 /UG=Hs.288734 hypothetical protein FLJ13480 /FL=gb:NM_025120.1

218779_x_at -2.73 gb:NM_017729.1 /DEF=Homo sapiens hypothetical protein FLJ20258 (FLJ20258), mRNA. /FEA=mRNA /GEN=FLJ20258 /PROD=hypothetical protein FLJ20258 /DB_XREF=gi:8923231 /UG=Hs.28907 hypothetical protein FLJ20258 /FL=gb:NM_017729.1

206385_s_at -2.73 gb:NM_020987.1 /DEF=Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (ANK3), transcript variant 1, mRNA. /FEA=mRNA /GEN=ANK3 /PROD=ankyrin 3, isoform 1 /DB_XREF=gi:10947055 /UG=Hs.75893 ankyrin 3, node of Ranvier (ankyrin G) /FL=gb:NM_020987.1 gb:U13616.1

222209_s_at -2.75 Consensus includes gb:AK000684.1 /DEF=Homo sapiens cDNA FLJ20677 fis, clone KAIA4183. /FEA=mRNA /DB_XREF=gi:7020930 /UG=Hs.183887 hypothetical protein FLJ22104

206633_at -2.75 gb:NM_000079.1 /DEF=Homo sapiens cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle) (CHRNA1), mRNA. /FEA=mRNA /GEN=CHRNA1 /PROD=cholinergic receptor, nicotinic, alphapolypeptide 1 (muscle) precursor /DB_XREF=gi:4557456 /UG=Hs.2266 cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle) /FL=gb:NM_000079.1

212307_s_at -2.75 Consensus includes gb:BF001665 /FEA=EST /DB_XREF=gi:10701940 /DB_XREF=est:7g91d11.x1 /CLONE=IMAGE:3313845 /UG=Hs.100293 O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase)

215504_x_at -2.77 Consensus includes gb:AF131777.1 /DEF=Homo sapiens clone 25061 mRNA sequence. /FEA=mRNA /DB_XREF=gi:4406602 /UG=Hs.183475 Homo sapiens clone 25061 mRNA sequence

205355_at -2.77 gb:NM_001609.1 /DEF=Homo sapiens acyl-Coenzyme A dehydrogenase, shortbranched chain (ACADSB), nuclear

gene encoding mitochondrial protein, mRNA. /FEA=mRNA /GEN=ACADSB /PROD=acyl-Coenzyme A dehydrogenase, shortbranchedchain precursor /DB_XREF=gi:4501858 /UG=Hs.81934 acyl-Coenzyme A dehydrogenase, shortbranched chain /FL=gb:NM_001609.1 gb:U12778.1

64900_at -2.78 Cluster Incl. AA401703:zt60f09.r1 Homo sapiens cDNA, 5 end /clone=IMAGE-726761 /clone_end=5 /gb=AA401703 /gi=2057294 /ug=Hs.6853 /len=580

219317_at -2.79 gb:NM_007195.1 /DEF=Homo sapiens polymerase (DNA directed) iota (POLI), mRNA. /FEA=mRNA /GEN=POLI /PROD=polymerase (DNA directed) iota /DB_XREF=gi:6005847 /UG=Hs.271699 polymerase (DNA directed) iota /FL=gb:AL136670.1 gb:AF140501.1 gb:NM_007195.1 gb:AF245438.1

219080_s_at -2.8 gb:NM_019857.1 /DEF=Homo sapiens CTP synthase II (CTPS2), mRNA. /FEA=mRNA /GEN=CTPS2 /PROD=CTP synthase II /DB_XREF=gi:9789918 /UG=Hs.58553 CTP synthase II /FL=gb:AF226667.1 gb:NM_019857.1

201940_at -2.8 Consensus includes gb:AA897514 /FEA=EST /DB_XREF=gi:3034134 /DB_XREF=est:aj62b12.s1 /CLONE=IMAGE:1394879 /UG=Hs.5057 carboxypeptidase D /FL=gb:U65090.1 gb:D85390.1 gb:NM_001304.2

218736_s_at -2.8 gb:NM_017734.1 /DEF=Homo sapiens hypothetical protein FLJ20271 (FLJ20271), mRNA. /FEA=mRNA /GEN=FLJ20271 /PROD=hypothetical protein FLJ20271 /DB_XREF=gi:8923242 /UG=Hs.14606 hypothetical protein FLJ20271 /FL=gb:NM_017734.1

215577_at -2.81 Consensus includes gb:AU146791 /FEA=EST /DB_XREF=gi:11008312 /DB_XREF=est:AU146791 /CLONE=HEMBB1001531 /UG=Hs.287474 Homo sapiens cDNA FLJ12000 fis, clone HEMBB1001531

205569_at -2.82 gb:NM_014398.1 /DEF=Homo sapiens similar to lysosome-associated membrane glycoprotein (TSC403), mRNA. /FEA=mRNA /GEN=TSC403 /PROD=similar to lysosome-associated membraneglycoprotein /DB_XREF=gi:7657660 /UG=Hs.10887 similar to lysosome-associated membrane glycoprotein /FL=gb:AB013924.1 gb:NM_014398.1

217028_at -2.82 Consensus includes gb:AJ224869 /DEF=Homo sapiens CXCR4 gene encoding receptor CXCR4 /FEA=mRNA /DB_XREF=gi:3059119 /UG=Hs.89414 chemokine (C-X-C motif), receptor 4 (fusin)

201943_s_at -2.83 gb:NM_001304.2 /DEF=Homo sapiens carboxypeptidase D (CPD), mRNA. /FEA=mRNA /GEN=CPD /PROD=carboxypeptidase D precursor /DB_XREF=gi:8051580 /UG=Hs.5057 carboxypeptidase D /FL=gb:U65090.1 gb:D85390.1 gb:NM_001304.2

213186_at -2.83 Consensus includes gb:BG502305 /FEA=EST /DB_XREF=gi:13463822 /DB_XREF=est:602550583F1 /CLONE=IMAGE:4657940 /UG=Hs.165662 KIAA0675 gene product

203845_at -2.83 Consensus includes gb:AV727449 /FEA=EST /DB_XREF=gi:10836870 /DB_XREF=est:AV727449 /CLONE=HTCAYG01 /UG=Hs.199061 p300CBP-associated factor /FL=gb:U57317.2 gb:NM_003884.2

219343_at -2.84 gb:NM_017913.1 /DEF=Homo sapiens hypothetical protein FLJ20639 (FLJ20639), mRNA. /FEA=mRNA /GEN=FLJ20639 /PROD=hypothetical protein FLJ20639 /DB_XREF=gi:8923591 /UG=Hs.128646 hypothetical protein FLJ20639 /FL=gb:NM_017913.1

218923_at -2.84 Consensus includes gb:AW304174 /FEA=EST /DB_XREF=gi:6713863 /DB_XREF=est:xv61d01.x1 /CLONE=IMAGE:2817601 /UG=Hs.135578 chitobiase, di-N-acetyl- /FL=gb:M95767.1 gb:NM_004388.1

207463_x_at -2.86 gb:NM_002771.1 /DEF=Homo sapiens protease, serine, 3 (trypsin 3) (PRSS3), mRNA. /FEA=mRNA /GEN=PRSS3 /PROD=protease, serine, 3 (trypsin 3) /DB_XREF=gi:4506148 /UG=Hs.278310 protease, serine, 3 (trypsin 3) /FL=gb:NM_002771.1

205571_at -2.86 gb:NM_015929.1 /DEF=Homo sapiens lipoyltransferase (LOC51601), mRNA. /FEA=mRNA /GEN=LOC51601 /PROD=lipoyltransferase /DB_XREF=gi:7706251 /UG=Hs.112356 lipoyltransferase /FL=gb:AB017566.1 gb:NM_015929.1

221841_s_at -2.89 Consensus includes gb:BF514079 /FEA=EST /DB_XREF=gi:11599258 /DB_XREF=est:UI-H-BW1-amw-b-08-0-UI.s1 /CLONE=IMAGE:3071198 /UG=Hs.7934 Kruppel-like factor 4 (gut)

214373_at -2.89 Consensus includes gb:AI582773 /FEA=EST /DB_XREF=gi:4568670 /DB_XREF=est:tn17d08.x1 /CLONE=IMAGE:2167887 /UG=Hs.125682 protein phosphatase 4 regulatory subunit 2

205479_s_at -2.89 gb:NM_002658.1 /DEF=Homo sapiens plasminogen activator, urokinase (PLAU), mRNA. /FEA=mRNA /GEN=PLAU /PROD=plasminogen activator, urokinase /DB_XREF=gi:4505862 /UG=Hs.77274 plasminogen activator, urokinase /FL=gb:M15476.1 gb:NM_002658.1

213359_at -2.9 Consensus includes gb:W74620 /FEA=EST /DB_XREF=gi:1384833 /DB_XREF=est:zd77e04.s1 /CLONE=IMAGE:346686 /UG=Hs.303627 heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA-binding protein 1, 37kD)

208608_s_at -2.9 gb:NM_021021.1 /DEF=Homo sapiens syntrophin, beta 1 (dystrophin-associated protein A1, 59kD, basic component 1) (SNTB1), mRNA. /FEA=CDS /GEN=SNTB1 /PROD=syntrophin, beta 1 (dystrophin-associatedprotein A1, 59kD, basic component 1) /DB_XREF=gi:11321639 /UG=Hs.95011 syntrophin, beta 1 (dystrophin-associated protein A1, 59kD, basic component 1) /FL=gb:NM_021021.1

218087_s_at -2.9 gb:NM_015385.1 /DEF=Homo sapiens SH3-domain protein 5 (ponsin) (SH3D5), mRNA. /FEA=mRNA /GEN=SH3D5 /PROD=ponsin /DB_XREF=gi:7661699 /UG=Hs.108924 SH3-domain protein 5 (ponsin) /FL=gb:AL117472.1 gb:NM_015385.1

221586_s_at -2.91 gb:U15642.1 /DEF=Human transcription factor E2F-5 mRNA, complete cds. /FEA=mRNA /PROD=E2F-5 /DB_XREF=gi:758415 /UG=Hs.2331 E2F transcription factor 5, p130-binding /FL=gb:NM_001951.2 gb:U15642.1 gb:U31556.1

215578_at -2.91 Consensus includes gb:AU145365 /FEA=EST /DB_XREF=gi:11006886 /DB_XREF=est:AU145365 /CLONE=HEMBA1004629 /UG=Hs.287437 Homo sapiens cDNA FLJ11662 fis, clone HEMBA1004629

205633_s_at -2.92 gb:NM_000688.1 /DEF=Homo sapiens aminolevulinate, delta-, synthase 1 (ALAS1), nuclear gene encoding mitochondrial protein, mRNA. /FEA=mRNA /GEN=ALAS1 /PROD=aminolevulinate, delta-, synthase 1 /DB_XREF=gi:4502024 /UG=Hs.78712 aminolevulinate, delta-, synthase 1 /FL=gb:NM_000688.1

212942_s_at -2.92 Consensus includes gb:AB033025.1 /DEF=Homo sapiens mRNA for KIAA1199 protein, partial cds. /FEA=mRNA /GEN=KIAA1199 /PROD=KIAA1199 protein /DB_XREF=gi:6330400 /UG=Hs.50081 KIAA1199 protein

209114_at -2.93 gb:AF133425.1 /DEF=Homo sapiens tetraspanin TM4-C mRNA, complete cds. /FEA=mRNA /PROD=tetraspanin TM4-C /DB_XREF=gi:6434903 /UG=Hs.38972 tetraspan 1 /FL=gb:AF054838.1 gb:AF065388.1 gb:NM_005727.1 gb:AF133425.1

202259_s_at -2.93 gb:NM_014887.1 /DEF=Homo sapiens hypothetical protein from BCRA2 region (CG005), mRNA. /FEA=mRNA /GEN=CG005 /PROD=hypothetical protein from BCRA2 region /DB_XREF=gi:7656970 /UG=Hs.23518 hypothetical protein from BCRA2 region /FL=gb:NM_014887.1

213017_at -2.94 Consensus includes gb:AL534702 /FEA=EST /DB_XREF=gi:12798195 /DB_XREF=est:AL534702 /CLONE=CS0DF006YN17 (3 prime) /UG=Hs.13377 Homo sapiens clone 23649 and 23755 unknown mRNA, partial cds

202202_s_at -2.95 gb:NM_002290.2 /DEF=Homo sapiens laminin, alpha 4 (LAMA4), mRNA. /FEA=mRNA /GEN=LAMA4 /PROD=laminin, alpha 4 precursor /DB_XREF=gi:9845494 /UG=Hs.78672 laminin, alpha 4 /FL=gb:NM_002290.2

219880_at -2.95 gb:NM_022907.1 /DEF=Homo sapiens hypothetical protein FLJ23053 (FLJ23053), mRNA. /FEA=mRNA /GEN=FLJ23053 /PROD=hypothetical protein FLJ23053 /DB_XREF=gi:12597650 /UG=Hs.94037 hypothetical protein FLJ23053 /FL=gb:NM_022907.1

203407_at -2.95 gb:NM_002705.1 /DEF=Homo sapiens periplakin (PPL), mRNA. /FEA=mRNA /GEN=PPL /PROD=periplakin /DB_XREF=gi:4505992 /UG=Hs.74304 periplakin /FL=gb:AF001691.1 gb:NM_002705.1

200841_s_at -2.96 Consensus includes gb:AI142677 /FEA=EST /DB_XREF=gi:3659036 /DB_XREF=est:ok33h03.s1 /CLONE=IMAGE:1509653 /UG=Hs.55921 glutamyl-prolyl-tRNA synthetase /FL=gb:NM_004446.1

212459_x_at -2.96 Consensus includes gb:BF593940 /FEA=EST /DB_XREF=gi:11686264 /DB_XREF=est:nab48f10.x1 /CLONE=IMAGE:3269154 /UG=Hs.247309 succinate-CoA ligase, GDP-forming, beta subunit

216268_s_at -2.97 Consensus includes gb:U77914.1 /DEF=Human soluble protein Jagged mRNA, partial cds. /FEA=mRNA /PROD=soluble protein Jagged /DB_XREF=gi:1684889 /UG=Hs.91143 jagged 1 (Alagille syndrome)

202454_s_at -2.97 gb:NM_001982.1 /DEF=Homo sapiens v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3 (ERBB3), mRNA. /FEA=mRNA /GEN=ERBB3 /PROD=v-erb-b2 avian erythroblastic leukemia viraloncogene homolog 3 /DB_XREF=gi:4503596 /UG=Hs.199067 v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3 /FL=gb:M29366.1 gb:M34309.1 gb:NM_001982.1

203830_at -2.99 gb:NM_022344.1 /DEF=Homo sapiens protein kinase Njmu-R1 (NJMU-R1), mRNA. /FEA=mRNA /GEN=NJMU-R1 /PROD=protein kinase Njmu-R1 /DB_XREF=gi:11641248 /UG=Hs.9800 protein kinase Njmu-R1 /FL=gb:AF305686.1 gb:NM_022344.1

202769_at -3 Consensus includes gb:AW134535 /FEA=EST /DB_XREF=gi:6138088 /DB_XREF=est:UI-H-BI1-abv-g-06-0-UI.s1 /CLONE=IMAGE:2713163 /UG=Hs.79069 cyclin G2 /FL=gb:U47414.1 gb:NM_004354.1

205239_at -3 gb:NM_001657.1 /DEF=Homo sapiens amphiregulin (schwannoma-derived growth factor) (AREG), mRNA. /FEA=mRNA /GEN=AREG /PROD=amphiregulin (schwannoma-derived growth factor) /DB_XREF=gi:4502198 /UG=Hs.270833 amphiregulin (schwannoma-derived growth factor) /FL=gb:M30704.1 gb:NM_001657.1

207563_s_at -3 gb:U77413.1 /DEF=Human O-linked GlcNAc transferase mRNA, complete cds. /FEA=mRNA /PROD=O-linked GlcNAc transferase /DB_XREF=gi:2266993 /UG=Hs.100293 O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase) /FL=gb:U77413.1 gb:NM_003605.2

210078_s_at -3.02 gb:L39833.1 /DEF=Homo sapiens (clone hKvBeta3) K+ channel beta subunit mRNA, complete cds. /FEA=mRNA /PROD=K+ channel beta-subunit /DB_XREF=gi:666896 /UG=Hs.172471 potassium voltage-gated channel, shaker-related subfamily, beta member 1 /FL=gb:L39833.1 gb:U16953.1

202800_at -3.02 gb:NM_004172.1 /DEF=Homo sapiens solute carrier family 1 (glial high affinity glutamate transporter), member 3 (SLC1A3), nuclear gene encoding mitochondrial protein, mRNA. /FEA=mRNA /GEN=SLC1A3 /PROD=solute carrier family 1 (glial high affinityglutamate transporter), member 3 /DB_XREF=gi:4759125 /UG=Hs.75379 solute carrier family 1 (glial high affinity glutamate transporter), member 3 /FL=gb:D26443.1 gb:NM_004172.1 gb:U03504.1

203763_at -3.03 gb:NM_016008.1 /DEF=Homo sapiens CGI-60 protein (LOC51626), mRNA. /FEA=mRNA /GEN=LOC51626 /PROD=CGI-60 protein /DB_XREF=gi:7706299 /UG=Hs.7627 CGI-60 protein /FL=gb:AF151818.1 gb:NM_016008.1

207761_s_at -3.04 gb:NM_014033.1 /DEF=Homo sapiens DKFZP586A0522 protein (DKFZP586A0522), mRNA. /FEA=mRNA /GEN=DKFZP586A0522 /PROD=DKFZP586A0522 protein /DB_XREF=gi:13378140 /UG=Hs.288771 DKFZP586A0522 protein /FL=gb:NM_014033.1

214835_s_at -3.04 Consensus includes gb:AF131748.1 /DEF=Homo sapiens clone 25191 GTP-specific succinyl-CoA synthetase beta subunit (SCS) mRNA sequence, partial cds. /FEA=mRNA /PROD=GTP-specific succinyl-CoA synthetase betasubunit /DB_XREF=gi:4406563 /UG=Hs.247309 succinate-CoA ligase, GDP-forming, beta subunit

207604_s_at -3.04 gb:NM_003615.1 /DEF=Homo sapiens solute carrier family 4, sodium bicarbonate cotransporter, member 7 (SLC4A7), mRNA. /FEA=mRNA /GEN=SLC4A7 /PROD=solute carrier family 4, sodium bicarbonatecotransporter, member 7 /DB_XREF=gi:4507028 /UG=Hs.132904 solute carrier family 4, sodium bicarbonate cotransporter, member 7 /FL=gb:AB012130.1 gb:NM_003615.1

206043_s_at -3.05 gb:NM_014861.1 /DEF=Homo sapiens KIAA0703 gene product (KIAA0703), mRNA. /FEA=mRNA /GEN=KIAA0703 /PROD=KIAA0703 gene product /DB_XREF=gi:7662255 /UG=Hs.6168 KIAA0703 gene product /FL=gb:AB014603.1 gb:NM_014861.1

204485_s_at -3.06 gb:NM_005486.1 /DEF=Homo sapiens target of myb1 (chicken) homolog-like 1 (TOM1L1), mRNA. /FEA=mRNA /GEN=TOM1L1 /PROD=target of myb1 (chicken) homolog-like 1 /DB_XREF=gi:4885638 /UG=Hs.153504 target of myb1 (chicken) homolog-like 1 /FL=gb:NM_005486.1

203779_s_at -3.06 gb:NM_005797.1 /DEF=Homo sapiens epithelial V-like antigen 1 (EVA1), mRNA. /FEA=mRNA /GEN=EVA1 /PROD=epithelial V-like antigen 1 precursor /DB_XREF=gi:5032246 /UG=Hs.116651 epithelial V-like antigen 1 /FL=gb:AF304447.1 gb:AF030455.1 gb:NM_005797.1 gb:AF275945.1

219388_at -3.08 gb:NM_024915.1 /DEF=Homo sapiens hypothetical protein FLJ13782 (FLJ13782), mRNA. /FEA=mRNA /GEN=FLJ13782 /PROD=hypothetical protein FLJ13782 /DB_XREF=gi:13376381 /UG=Hs.257924 hypothetical protein FLJ13782 /FL=gb:NM_024915.1

210306_at -3.08 gb:U89358.1 /DEF=Human l(3)mbt protein homolog mRNA, complete cds. /FEA=mRNA /PROD=l(3)mbt protein homolog /DB_XREF=gi:3811110 /UG=Hs.300863 lethal (3) malignant brain tumor l(3)mbt protein (Drosophila) homolog /FL=gb:U89358.1

209209_s_at -3.08 Consensus includes gb:AW469573 /FEA=EST /DB_XREF=gi:7039679 /DB_XREF=est:hd29e09.x1 /CLONE=IMAGE:2910952 /UG=Hs.75260 mitogen inducible 2 /FL=gb:Z24725.1

205842_s_at -3.1 gb:AF001362.1 /DEF=Homo sapiens Jak2 kinase (JAK2) mRNA, complete cds. /FEA=mRNA /GEN=JAK2 /PROD=Jak2 kinase /DB_XREF=gi:3236321 /UG=Hs.115541 Janus kinase 2 (a protein tyrosine kinase) /FL=gb:NM_004972.2 gb:AF005216.1 gb:AF058925.1 gb:AF001362.1

205229_s_at -3.11 Consensus includes gb:AA669336 /FEA=EST /DB_XREF=gi:2630835 /DB_XREF=est:ad47a02.s1 /CLONE=IMAGE:884810 /UG=Hs.21016 coagulation factor C (Limulus polyphemus) homology (cochlin) /FL=gb:AF006740.1 gb:NM_004086.1

214437_s_at -3.13 Consensus includes gb:NM_005412.1 /DEF=Homo sapiens serine hydroxymethyltransferase 2 (mitochondrial) (SHMT2), mRNA. /FEA=CDS /GEN=SHMT2 /PROD=serine hydroxymethyltransferase 2(mitochondrial) /DB_XREF=gi:4885594 /UG=Hs.75069 serine hydroxymethyltransferase 2 (mitochondrial) /FL=gb:NM_005412.1

205808_at -3.14 gb:NM_004318.1 /DEF=Homo sapiens aspartate beta-hydroxylase (ASPH), mRNA. /FEA=mRNA /GEN=ASPH /PROD=aspartate beta-hydroxylase /DB_XREF=gi:4757799 /UG=Hs.283664 aspartate beta-hydroxylase /FL=gb:U03109.1 gb:NM_004318.1

209122_at -3.19 gb:BC005127.1 /DEF=Homo sapiens, adipose differentiation-related protein, clone MGC:10598, mRNA, complete cds. /FEA=mRNA /PROD=adipose differentiation-related protein /DB_XREF=gi:13477306 /UG=Hs.3416 adipose differentiation-related protein /FL=gb:BC005127.1 gb:NM_001122.1

218858_at -3.21 gb:NM_022783.1 /DEF=Homo sapiens hypothetical protein FLJ12428 (FLJ12428), mRNA. /FEA=mRNA /GEN=FLJ12428 /PROD=hypothetical protein FLJ12428 /DB_XREF=gi:12232472 /UG=Hs.87729 hypothetical protein FLJ12428 /FL=gb:AL136678.1 gb:NM_022783.1

209884_s_at -3.21 gb:AF047033.1 /DEF=Homo sapiens sodium bicarbonate cotransporter 3 (SLC4A7) mRNA, complete cds. /FEA=mRNA /GEN=SLC4A7 /PROD=sodium bicarbonate cotransporter 3 /DB_XREF=gi:5051627 /UG=Hs.132904 solute carrier family 4, sodium bicarbonate cotransporter, member 7 /FL=gb:AF047033.1

221899_at -3.24 Consensus includes gb:AI809961 /FEA=EST /DB_XREF=gi:5396527 /DB_XREF=est:wf64b09.x1 /CLONE=IMAGE:2360345 /UG=Hs.23518 hypothetical protein from BCRA2 region

215772_x_at -3.25 Consensus includes gb:AL050226.1 /DEF=Homo sapiens mRNA; cDNA DKFZp586M2023 (from clone DKFZp586M2023); partial cds. /FEA=mRNA /GEN=DKFZp586M2023 /PROD=hypothetical protein /DB_XREF=gi:4884469 /UG=Hs.247309 succinate-CoA ligase, GDP-forming, beta subunit

221218_s_at -3.25 gb:NM_022445.1 /DEF=Homo sapiens mouse thiamin pyrophosphokinase homolog (TPK1), mRNA. /FEA=mRNA /GEN=TPK1 /PROD=mouse thiamin pyrophosphokinase homolog /DB_XREF=gi:11990617 /UG=Hs.58715 thiamine pyrophosphokinase /FL=gb:NM_022445.1

219443_at -3.25 gb:NM_017714.1 /DEF=Homo sapiens hypothetical protein FLJ20212 (FLJ20212), mRNA. /FEA=mRNA /GEN=FLJ20212 /PROD=hypothetical protein FLJ20212 /DB_XREF=gi:8923201 /UG=Hs.88367 hypothetical protein FLJ20212 /FL=gb:NM_017714.1

209131_s_at -3.3 gb:U55936.1 /DEF=Human SNAP-23 mRNA, complete cds. /FEA=mRNA /PROD=SNAP-23 /DB_XREF=gi:1374812 /UG=Hs.184376 synaptosomal-associated protein, 23kD /FL=gb:BC000148.2 gb:BC003686.1 gb:U55936.1 gb:Y09567.1

202887_s_at -3.31 gb:NM_019058.1 /DEF=Homo sapiens hypothetical protein (FLJ20500), mRNA. /FEA=mRNA /GEN=FLJ20500 /PROD=hypothetical protein /DB_XREF=gi:9506686 /UG=Hs.111244 hypothetical protein /FL=gb:AL136668.1 gb:NM_019058.1

203817_at -3.31 Consensus includes gb:W93728 /FEA=EST /DB_XREF=gi:1422918 /DB_XREF=est:zd96a11.s1 /CLONE=IMAGE:357308 /UG=Hs.77890 guanylate cyclase 1, soluble, beta 3 /FL=gb:NM_000857.1

91826_at -3.35 Cluster Incl. AI219073:qg16e08.x1 Homo sapiens cDNA, 3 end /clone=IMAGE-1759718 /clone_end=3 /gb=AI219073 /gi=3801276 /ug=Hs.126062 /len=555

201942_s_at -3.35 gb:D85390.1 /DEF=Homo sapiens mRNA for gp180-carboxypeptidase D-like enzyme, complete cds. /FEA=mRNA /PROD=gp180-carboxypeptidase D-like enzyme /DB_XREF=gi:3641620 /UG=Hs.5057 carboxypeptidase D /FL=gb:U65090.1 gb:D85390.1 gb:NM_001304.2

219014_at -3.37 gb:NM_016619.1 /DEF=Homo sapiens hypothetical protein (LOC51316), mRNA. /FEA=mRNA /GEN=LOC51316 /PROD=hypothetical protein /DB_XREF=gi:7706157 /UG=Hs.107139 hypothetical protein /FL=gb:AF208846.1 gb:NM_016619.1

204199_at -3.39 gb:NM_014636.1 /DEF=Homo sapiens Ral guanine nucleotide exchange factor RalGPS1A (RalGPS1A), mRNA. /FEA=mRNA /GEN=RalGPS1A /PROD=Ral guanine nucleotide exchange factor RalGPS1A /DB_XREF=gi:7662069 /UG=Hs.170307 Ral guanine nucleotide exchange factor RalGPS1A /FL=gb:AB002349.1 gb:NM_014636.1

210377_at -3.42 gb:D16350.1 /DEF=Human SA mRNA for SA gene product, complete cds. /FEA=mRNA /GEN=SA /DB_XREF=gi:471131 /UG=Hs.181345 SA (rat hypertension-associated) homolog /FL=gb:D16350.1

215203_at -3.43 Consensus includes gb:AW438464 /FEA=EST /DB_XREF=gi:6973770 /DB_XREF=est:xu43g07.x1 /CLONE=IMAGE:2804508 /UG=Hs.288760 Homo sapiens cDNA FLJ12327 fis, clone MAMMA1002140

201131_s_at -3.44 gb:NM_004360.1 /DEF=Homo sapiens cadherin 1, type 1, E-cadherin (epithelial) (CDH1), mRNA. /FEA=mRNA /GEN=CDH1 /PROD=cadherin 1, type 1, E-cadherin (epithelial) /DB_XREF=gi:4757959 /UG=Hs.194657 cadherin 1, type 1, E-cadherin (epithelial) /FL=gb:L08599.1 gb:NM_004360.1

222358_x_at -3.44 Consensus includes gb:AI523613 /FEA=EST /DB_XREF=gi:4437748 /DB_XREF=est:tg95a07.x1 /CLONE=IMAGE:2116500 /UG=Hs.293495 ESTs, Weakly similar to ALU1_HUMAN ALU SUBFAMILY J SEQUENCE CONTAMINATION WARNING ENTRY H.sapiens

214705_at -3.44 Consensus includes gb:AJ001306.1 /DEF=Homo sapiens mRNA for PDZ domain protein. /FEA=mRNA /PROD=PDZ domain protein /DB_XREF=gi:2370148 /UG=Hs.321197 PDZ domain protein (Drosophila inaD-like)

206548_at -3.44 gb:NM_024880.1 /DEF=Homo sapiens hypothetical protein FLJ23556 (FLJ23556), mRNA. /FEA=mRNA /GEN=FLJ23556 /PROD=hypothetical protein FLJ23556 /DB_XREF=gi:13376321 /UG=Hs.214039 hypothetical protein FLJ23556 /FL=gb:NM_024880.1

205841_at -3.47 gb:NM_004972.2 /DEF=Homo sapiens Janus kinase 2 (a protein tyrosine kinase) (JAK2), mRNA. /FEA=mRNA /GEN=JAK2 /PROD=Janus kinase 2 /DB_XREF=gi:13325062 /UG=Hs.115541 Janus kinase 2 (a protein tyrosine kinase) /FL=gb:NM_004972.2 gb:AF005216.1 gb:AF058925.1 gb:AF001362.1

219115_s_at -3.48 gb:NM_014432.1 /DEF=Homo sapiens interleukin 20 receptor, alpha (IL20RA), mRNA. /FEA=mRNA /GEN=IL20RA /PROD=interleukin 20 receptor, alpha /DB_XREF=gi:7657690 /UG=Hs.21814 interleukin 20 receptor, alpha

/FL=gb:AF184971.1 gb:NM_014432.1 203896_s_at -3.49 gb:NM_000933.1 /DEF=Homo sapiens phospholipase C, beta 4 (PLCB4), mRNA. /FEA=mRNA /GEN=PLCB4

/PROD=phospholipase C, beta 4 /DB_XREF=gi:4505866 /UG=Hs.283006 phospholipase C, beta 4 /FL=gb:NM_000933.1 gb:L41349.1

209498_at -3.5 Consensus includes gb:X16354.1 /DEF=Human mRNA for transmembrane carcinoembryonic antigen BGPa (formerly TM1-CEA). /FEA=mRNA /PROD=TM1-CEA preprotein /DB_XREF=gi:37197 /UG=Hs.50964 carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) /FL=gb:J03858.1

212406_s_at -3.52 Consensus includes gb:AB028973.1 /DEF=Homo sapiens mRNA for KIAA1050 protein, partial cds. /FEA=mRNA /GEN=KIAA1050 /PROD=KIAA1050 protein /DB_XREF=gi:5689436 /UG=Hs.184628 hypothetical protein FLJ10883

218677_at -3.53 gb:NM_020672.1 /DEF=Homo sapiens S100-type calcium binding protein A14 (LOC57402), mRNA. /FEA=mRNA /GEN=LOC57402 /PROD=S100-type calcium binding protein A14 /DB_XREF=gi:10190711 /UG=Hs.288998 S100-type calcium binding protein A14 /FL=gb:NM_020672.1 gb:BC005019.1 gb:AY007220.1

215314_at -3.54 Consensus includes gb:AU146646 /FEA=EST /DB_XREF=gi:11008167 /DB_XREF=est:AU146646 /CLONE=HEMBB1001096 /UG=Hs.179752 Homo sapiens cDNA FLJ10270 fis, clone HEMBB1001096

214823_at -3.58 Consensus includes gb:AF033199.1 /DEF=Homo sapiens C2H2 zinc finger protein pseudogene, mRNA sequence. /FEA=mRNA /DB_XREF=gi:3252864 /UG=Hs.8198 zinc finger protein 204

220622_at -3.6 gb:NM_024727.1 /DEF=Homo sapiens hypothetical protein FLJ23259 (FLJ23259), mRNA. /FEA=mRNA /GEN=FLJ23259 /PROD=hypothetical protein FLJ23259 /DB_XREF=gi:13376039 /UG=Hs.114005 hypothetical protein FLJ23259 /FL=gb:NM_024727.1

217513_at -3.62 Consensus includes gb:BG334495 /FEA=EST /DB_XREF=gi:13140933 /DB_XREF=est:602461128F1 /CLONE=IMAGE:4577718 /UG=Hs.228201 ESTs, Moderately similar to AF118094 25 PRO1992 H.sapiens

203509_at -3.64 gb:NM_003105.2 /DEF=Homo sapiens sortilin-related receptor, L(DLR class) A repeats-containing (SORL1), mRNA. /FEA=mRNA /GEN=SORL1 /PROD=sortilin-related receptor, L(DLR class) Arepeats-containing /DB_XREF=gi:6325473 /UG=Hs.278571 sortilin-related receptor, L(DLR class) A repeats-containing /FL=gb:U60975.2 gb:NM_003105.2

218839_at -3.7 gb:NM_012258.1 /DEF=Homo sapiens hairyenhancer-of-split related with YRPW motif 1 (HEY1), mRNA. /FEA=mRNA /GEN=HEY1 /PROD=hairyenhancer-of-split related with YRPW motif1 /DB_XREF=gi:6912411 /UG=Hs.234434 hairyenhancer-of-split related with YRPW motif 1 /FL=gb:AF311883.1 gb:BC001873.1 gb:AF151522.1 gb:AF176422.1 gb:NM_012258.1 gb:AF232239.1

205500_at -3.72 gb:NM_001735.1 /DEF=Homo sapiens complement component 5 (C5), mRNA. /FEA=mRNA /GEN=C5 /PROD=complement component 5 /DB_XREF=gi:4502506 /UG=Hs.1281 complement component 5 /FL=gb:M57729.1 gb:NM_001735.1

221827_at -3.73 Consensus includes gb:BE788439 /FEA=EST /DB_XREF=gi:10209637 /DB_XREF=est:601475616F1 /CLONE=IMAGE:3878643 /UG=Hs.247280 HBV associated factor

218976_at -3.73 gb:NM_021800.1 /DEF=Homo sapiens J domain containing protein 1 (JDP1), mRNA. /FEA=mRNA /GEN=JDP1 /PROD=J domain containing protein 1 /DB_XREF=gi:11141870 /UG=Hs.260720 J domain containing protein 1 /FL=gb:NM_021800.1 gb:AF176012.1

207781_s_at -3.75 gb:NM_021998.1 /DEF=Homo sapiens zinc finger protein 6 (CMPX1) (ZNF6), mRNA. /FEA=mRNA /GEN=ZNF6 /PROD=zinc finger protein 6 (CMPX1) /DB_XREF=gi:11527399 /UG=Hs.323950 zinc finger protein 6 (CMPX1) /FL=gb:NM_021998.1

211559_s_at -3.81 gb:L49506.1 /DEF=Homo sapiens cyclin G2 mRNA, complete cds. /FEA=mRNA /PROD=cyclin G2 /DB_XREF=gi:1236234 /UG=Hs.79069 cyclin G2 /FL=gb:L49506.1

44783_s_at -3.81 Cluster Incl. R61374:yh15e02.s1 Homo sapiens cDNA, 3 end /clone=IMAGE-37665 /clone_end=3 /gb=R61374 /gi=832069 /ug=Hs.234434 /len=434

208161_s_at -3.82 gb:NM_020037.1 /DEF=Homo sapiens ATP-binding cassette, sub-family C (CFTRMRP), member 3 (ABCC3), transcript variant MRP3A, mRNA. /FEA=mRNA /GEN=ABCC3 /PROD=ATP-binding cassette, sub-family C, member 3,isoform MRP3A /DB_XREF=gi:9955971 /UG=Hs.90786 ATP-binding cassette, sub-family C (CFTRMRP), member 3 /FL=gb:AF085691.1 gb:NM_020037.1

205968_at -3.84 gb:NM_002252.1 /DEF=Homo sapiens potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3 (KCNS3), mRNA. /FEA=mRNA /GEN=KCNS3 /PROD=potassium voltage-gated channel,delayed-rectifier, subfamily S, member 3 /DB_XREF=gi:4504862 /UG=Hs.47584 potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3 /FL=gb:BC004148.1 gb:BC004987.1 gb:AF043472.1 gb:NM_002252.1

218145_at -3.85 gb:NM_021158.1 /DEF=Homo sapiens protein kinase domains containing protein similar to phosphoprotein C8FW (LOC57761), mRNA. /FEA=mRNA /GEN=LOC57761 /PROD=protein kinase domains containing proteinsimilar to phosphoprotein C8FW /DB_XREF=gi:11056039 /UG=Hs.26802 protein kinase domains containing protein similar to phosphoprotein C8FW /FL=gb:NM_021158.1

221698_s_at -3.85 gb:AF313468.1 /DEF=Homo sapiens dendritic cell-associated C-type lectin-1 mRNA, complete cds. /FEA=mRNA /PROD=dendritic cell-associated C-type lectin-1 /DB_XREF=gi:13649707 /FL=gb:AF313468.1

215250_at -3.86 Consensus includes gb:AU147317 /FEA=EST /DB_XREF=gi:11008838 /DB_XREF=est:AU147317 /CLONE=MAMMA1000340 /UG=Hs.287491 Homo sapiens cDNA FLJ12140 fis, clone MAMMA1000340

211668_s_at -3.87 gb:K03226.1 /DEF=Human preprourokinase mRNA, complete cds. /FEA=mRNA /GEN=PLAU /DB_XREF=gi:340155 /FL=gb:K03226.1

220484_at -3.88 gb:NM_018298.1 /DEF=Homo sapiens hypothetical protein FLJ11006 (FLJ11006), mRNA. /FEA=mRNA /GEN=FLJ11006 /PROD=hypothetical protein FLJ11006 /DB_XREF=gi:8922819 /UG=Hs.49344 hypothetical protein FLJ11006 /FL=gb:NM_018298.1

206546_at -3.9 gb:NM_014258.1 /DEF=Homo sapiens synaptonemal complex protein 2 (SYCP2), mRNA. /FEA=mRNA /GEN=SYCP2 /PROD=synaptonemal complex protein 2 /DB_XREF=gi:7657634 /UG=Hs.202676 synaptonemal complex protein 2 /FL=gb:NM_014258.1

205583_s_at -3.9 gb:NM_024810.1 /DEF=Homo sapiens hypothetical protein FLJ23018 (FLJ23018), mRNA. /FEA=mRNA /GEN=FLJ23018 /PROD=hypothetical protein FLJ23018 /DB_XREF=gi:13376194 /UG=Hs.169078 hypothetical protein FLJ23018 /FL=gb:NM_024810.1

204466_s_at -3.9 Consensus includes gb:BG260394 /FEA=EST /DB_XREF=gi:12770210 /DB_XREF=est:602371523F1 /CLONE=IMAGE:4479556 /UG=Hs.76930 synuclein, alpha (non A4 component of amyloid precursor) /FL=gb:L08850.1 gb:NM_000345.2

204389_at -3.91 gb:NM_000240.1 /DEF=Homo sapiens monoamine oxidase A (MAOA), nuclear gene encoding mitochondrial protein, mRNA. /FEA=mRNA /GEN=MAOA /PROD=monoamine oxidase A /DB_XREF=gi:4557734 /UG=Hs.183109 monoamine oxidase A /FL=gb:M68840.1 gb:M69226.1 gb:NM_000240.1

215392_at -3.95 Consensus includes gb:AU148154 /FEA=EST /DB_XREF=gi:11009675 /DB_XREF=est:AU148154 /CLONE=MAMMA1002744 /UG=Hs.298014 Homo sapiens cDNA FLJ14136 fis, clone MAMMA1002744

205376_at -4 gb:NM_003866.1 /DEF=Homo sapiens inositol polyphosphate-4-phosphatase, type II, 105kD (INPP4B), mRNA./FEA=mRNA /GEN=INPP4B /PROD=inositol polyphosphate-4-phosphatase, type II,105kD /DB_XREF=gi:4504706 /UG=Hs.153687 inositol polyphosphate-4-phosphatase, type II, 105kD /FL=gb:U96922.1 gb:NM_003866.1

204268_at -4.04 gb:NM_005978.2 /DEF=Homo sapiens S100 calcium-binding protein A2 (S100A2), mRNA. /FEA=mRNA /GEN=S100A2 /PROD=S100 calcium-binding protein A2 /DB_XREF=gi:9845513 /UG=Hs.38991 S100 calcium-binding protein A2 /FL=gb:BC002829.1 gb:NM_005978.2

211429_s_at -4.05 gb:AF119873.1 /DEF=Homo sapiens PRO2275 mRNA, complete cds. /FEA=mRNA /PROD=PRO2275 /DB_XREF=gi:7770182 /UG=Hs.297681 serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1 /FL=gb:AF119873.1

214790_at -4.05 Consensus includes gb:AK001406.1 /DEF=Homo sapiens cDNA FLJ10544 fis, clone NT2RP2001601, highly similar to Homo sapiens mRNA for KIAA0797 protein. /FEA=mRNA /DB_XREF=gi:7022642 /UG=Hs.27197 SUMO-1-specific protease

205769_at -4.07 gb:NM_003645.1 /DEF=Homo sapiens fatty-acid-Coenzyme A ligase, very long-chain 1 (FACVL1), mRNA. /FEA=mRNA /GEN=FACVL1 /PROD=very long-chain fatty-acid-Coenzyme A ligase 1 /DB_XREF=gi:4503652 /UG=Hs.11729 fatty-acid-Coenzyme A ligase, very long-chain 1 /FL=gb:D88308.1 gb:AF096290.1 gb:NM_003645.1

216129_at -4.11 Consensus includes gb:AL117659.1 /DEF=Homo sapiens mRNA; cDNA DKFZp586I0624 (from clone DKFZp586I0624). /FEA=mRNA /DB_XREF=gi:5912252 /UG=Hs.306353 Homo sapiens mRNA; cDNA DKFZp586I0624 (from clone DKFZp586I0624)

202770_s_at -4.19 gb:NM_004354.1 /DEF=Homo sapiens cyclin G2 (CCNG2), mRNA. /FEA=mRNA /GEN=CCNG2 /PROD=cyclin G2 /DB_XREF=gi:4757935 /UG=Hs.79069 cyclin G2 /FL=gb:U47414.1 gb:NM_004354.1

210652_s_at -4.24 gb:BC004399.1 /DEF=Homo sapiens, clone MGC:10985, mRNA, complete cds. /FEA=mRNA /PROD=Unknown (protein for MGC:10985) /DB_XREF=gi:13325163 /UG=Hs.125783 DEME-6 protein /FL=gb:BC004399.1

208966_x_at -4.24 gb:AF208043.1 /DEF=Homo sapiens IFI16b (IFI16b) mRNA, complete cds. /FEA=mRNA /GEN=IFI16b /PROD=IFI16b /DB_XREF=gi:6644296 /UG=Hs.155530 interferon, gamma-inducible protein 16 /FL=gb:AF208043.1

207078_at -4.3 gb:NM_005466.1 /DEF=Homo sapiens RNA polymerase II transcriptional regulation mediator (Med6, S. cerevisiae, homolog of) (MED6), mRNA. /FEA=mRNA /GEN=MED6 /PROD=RNA polymerase II transcriptional regulationmediator (Med6, S. cerevisiae, homolog of) /DB_XREF=gi:4885480 /UG=Hs.167738 RNA polymerase II transcriptional regulation mediator (Med6, S. cerevisiae, homolog of) /FL=gb:U78082.1 gb:NM_005466.1

202847_at -4.35 gb:NM_004563.1 /DEF=Homo sapiens phosphoenolpyruvate carboxykinase 2 (mitochondrial) (PCK2), mRNA. /FEA=mRNA /GEN=PCK2 /PROD=phosphoenolpyruvate carboxykinase 2(mitochondrial) /DB_XREF=gi:4758885 /UG=Hs.75812 phosphoenolpyruvate carboxykinase 2 (mitochondrial) /FL=gb:BC001454.1 gb:NM_004563.1

219734_at -4.36 gb:NM_017699.1 /DEF=Homo sapiens hypothetical protein FLJ20174 (FLJ20174), mRNA. /FEA=mRNA /GEN=FLJ20174 /PROD=hypothetical protein FLJ20174 /DB_XREF=gi:8923170 /UG=Hs.114556 hypothetical protein FLJ20174 /FL=gb:NM_017699.1

205009_at -4.36 gb:NM_003225.1 /DEF=Homo sapiens trefoil factor 1 (breast cancer, estrogen-inducible sequence expressed in) (TFF1), mRNA. /FEA=mRNA /GEN=TFF1 /PROD=trefoil factor 1 (breast cancer,estrogen-inducible sequence expressed in) /DB_XREF=gi:4507450 /UG=Hs.1406 trefoil factor 1 (breast cancer, estrogen-inducible sequence expressed in) /FL=gb:NM_003225.1

211094_s_at -4.41 gb:D12625.1 /DEF=Human mRNA for NF1 protein isoform (neurofibromin isoform), complete cds. /FEA=mRNA /GEN=NF1 /PROD=NF1 protein isoform /DB_XREF=gi:219939 /UG=Hs.93207 neurofibromin 1 (neurofibromatosis, von Recklinghausen disease, Watson disease) /FL=gb:D12625.1

213307_at -4.44 Consensus includes gb:AF131790.1 /DEF=Homo sapiens clone 24903 mRNA sequence. /FEA=mRNA /DB_XREF=gi:4406618 /UG=Hs.12696 cortactin SH3 domain-binding protein

204734_at -4.45 gb:NM_002275.1 /DEF=Homo sapiens keratin 15 (KRT15), mRNA. /FEA=mRNA /GEN=KRT15 /PROD=keratin 15 /DB_XREF=gi:4504914 /UG=Hs.80342 keratin 15 /FL=gb:BC002641.1 gb:NM_002275.1

214078_at -4.48 Consensus includes gb:AF070581.1 /DEF=Homo sapiens clone 24540 mRNA sequence. /FEA=mRNA /DB_XREF=gi:3387953 /UG=Hs.153529 Homo sapiens clone 24540 mRNA sequence

204019_s_at -4.52 gb:NM_015677.1 /DEF=Homo sapiens hypothetical protein (DKFZP586F1318), mRNA. /FEA=mRNA /GEN=DKFZP586F1318 /PROD=hypothetical protein /DB_XREF=gi:7661669 /UG=Hs.25213 hypothetical protein /FL=gb:NM_015677.1

204891_s_at -4.53 gb:NM_005356.1 /DEF=Homo sapiens lymphocyte-specific protein tyrosine kinase (LCK), mRNA. /FEA=mRNA /GEN=LCK /PROD=lymphocyte-specific protein tyrosine kinase /DB_XREF=gi:4885448 /UG=Hs.1765 lymphocyte-specific protein tyrosine kinase /FL=gb:M36881.1 gb:U07236.1 gb:NM_005356.1

205576_at -4.54 gb:NM_000185.2 /DEF=Homo sapiens serine (or cysteine) proteinase inhibitor, clade D (heparin cofactor), member 1 (SERPIND1), mRNA. /FEA=mRNA /GEN=SERPIND1 /PROD=heparin cofactor II precursor /DB_XREF=gi:7262380 /UG=Hs.1478 serine (or cysteine) proteinase inhibitor, clade D (heparin cofactor), member 1 /FL=gb:M12849.1 gb:NM_000185.2

218983_at -4.56 gb:NM_016546.1 /DEF=Homo sapiens complement C1r-like proteinase precursor, (LOC51279), mRNA. /FEA=mRNA /GEN=LOC51279 /PROD=complement C1r-like proteinase precursor, /DB_XREF=gi:7706082 /UG=Hs.98571 complement C1r-like proteinase precursor, /FL=gb:AF178985.1 gb:NM_016546.1

217678_at -4.68 Consensus includes gb:AA488687 /FEA=EST /DB_XREF=gi:2216118 /DB_XREF=est:ab38f03.s1 /CLONE=IMAGE:843101 /UG=Hs.284235 ESTs

214753_at -4.7 Consensus includes gb:AW084068 /FEA=EST /DB_XREF=gi:6039220 /DB_XREF=est:xc26c06.x1 /CLONE=IMAGE:2585386 /UG=Hs.110630 Human BRCA2 region, mRNA sequence CG006

219288_at -4.81 gb:NM_020685.1 /DEF=Homo sapiens HT021 (HT021), mRNA. /FEA=mRNA /GEN=HT021 /PROD=HT021 /DB_XREF=gi:10190735 /UG=Hs.47166 HT021 /FL=gb:NM_020685.1 gb:AF236158.1

220892_s_at -4.88 gb:NM_021154.1 /DEF=Homo sapiens phosphoserine aminotransferase (PSA), mRNA. /FEA=mRNA /GEN=PSA /PROD=phosphoserine aminotransferase /DB_XREF=gi:10863954 /UG=Hs.286049 phosphoserine aminotransferase /FL=gb:NM_021154.1 gb:AF113132.1

215123_at -4.99 Consensus includes gb:AL049250.1 /DEF=Homo sapiens mRNA; cDNA DKFZp564D113 (from clone DKFZp564D113). /FEA=mRNA /DB_XREF=gi:4499989 /UG=Hs.194637 BANP homolog, SMAR1 homolog

220518_at -5.02 gb:NM_024801.1 /DEF=Homo sapiens hypothetical protein FLJ21551 (FLJ21551), mRNA. /FEA=mRNA /GEN=FLJ21551 /PROD=hypothetical protein FLJ21551 /DB_XREF=gi:13376176 /UG=Hs.159231 hypothetical protein FLJ21551 /FL=gb:NM_024801.1

204086_at -5.06 gb:NM_006115.1 /DEF=Homo sapiens preferentially expressed antigen in melanoma (PRAME), mRNA. /FEA=mRNA /GEN=PRAME /PROD=preferentially expressed antigen of melanoma /DB_XREF=gi:5174640 /UG=Hs.30743 preferentially expressed antigen in melanoma /FL=gb:U65011.1 gb:NM_006115.1

212816_s_at -5.16 Consensus includes gb:BE613178 /FEA=EST /DB_XREF=gi:9894775 /DB_XREF=est:601452166T1 /CLONE=IMAGE:3855712 /UG=Hs.84152 cystathionine-beta-synthase

209921_at -5.19 gb:AB040875.1 /DEF=Homo sapiens hxCT mRNA for cystineglutamate exchanger, complete cds. /FEA=mRNA /GEN=hxCT /PROD=cystineglutamate exchanger /DB_XREF=gi:13516845 /UG=Hs.6682 solute carrier family 7, (cationic amino acid transporter, y+ system) member 11 /FL=gb:AB040875.1

215717_s_at -5.31 Consensus includes gb:X62009.1 /DEF=Homo sapiens partial mRNA for fibrillin 5. /FEA=mRNA /PROD=fibrillin 5 /DB_XREF=gi:31399 /UG=Hs.79432 fibrillin 2 (congenital contractural arachnodactyly)

203914_x_at -5.33 gb:NM_000860.1 /DEF=Homo sapiens hydroxyprostaglandin dehydrogenase 15-(NAD) (HPGD), mRNA. /FEA=mRNA /GEN=HPGD /PROD=hydroxyprostaglandin dehydrogenase 15-(NAD) /DB_XREF=gi:4504478 /UG=Hs.77348 hydroxyprostaglandin dehydrogenase 15-(NAD) /FL=gb:L76465.1 gb:NM_000860.1

218723_s_at -5.37 gb:NM_014059.1 /DEF=Homo sapiens RGC32 protein (RGC32), mRNA. /FEA=mRNA /GEN=RGC32 /PROD=RGC32 protein /DB_XREF=gi:7662650 /UG=Hs.76640 RGC32 protein /FL=gb:AF036549.1 gb:NM_014059.1

205047_s_at -5.38 gb:NM_001673.1 /DEF=Homo sapiens asparagine synthetase (ASNS), mRNA. /FEA=mRNA /GEN=ASNS /PROD=asparagine synthetase /DB_XREF=gi:4502258 /UG=Hs.75692 asparagine synthetase /FL=gb:M27396.1 gb:NM_001673.1

210286_s_at -5.42 gb:AF053755.1 /DEF=Homo sapiens bicarbonate transporter (BT) mRNA, complete cds. /FEA=mRNA /GEN=BT /PROD=bicarbonate transporter /DB_XREF=gi:6650103 /UG=Hs.132904 solute carrier family 4, sodium bicarbonate cotransporter, member 7 /FL=gb:AF053755.1

210587_at -5.42 gb:BC005161.1 /DEF=Homo sapiens, Similar to inhibin beta E, clone MGC:4638, mRNA, complete cds. /FEA=mRNA /PROD=Similar to inhibin beta E /DB_XREF=gi:13477368 /UG=Hs.279497 Homo sapiens, Similar to inhibin beta E, clone MGC:4638, mRNA, complete cds /FL=gb:BC005161.1

219121_s_at -5.53 gb:NM_017697.1 /DEF=Homo sapiens hypothetical protein FLJ20171 (FLJ20171), mRNA. /FEA=mRNA /GEN=FLJ20171 /PROD=hypothetical protein FLJ20171 /DB_XREF=gi:8923166 /UG=Hs.24743 hypothetical protein FLJ20171 /FL=gb:NM_017697.1

211549_s_at -5.68 gb:U63296.1 /DEF=Human 15-hydroxyprostaglandin dehydrogenase mRNA, complete cds. /FEA=mRNA /PROD=15-hydroxyprostaglandin dehydrogenase /DB_XREF=gi:2047312 /UG=Hs.77348 hydroxyprostaglandin dehydrogenase 15-(NAD) /FL=gb:U63296.1

205541_s_at -5.79 gb:NM_018094.1 /DEF=Homo sapiens hypothetical protein FLJ10441 (FLJ10441), mRNA. /FEA=mRNA /GEN=FLJ10441 /PROD=hypothetical protein FLJ10441 /DB_XREF=gi:8922423 /UG=Hs.59523 hypothetical protein FLJ10441 /FL=gb:NM_018094.1

212560_at -5.8 Consensus includes gb:AV728268 /FEA=EST /DB_XREF=gi:10837689 /DB_XREF=est:AV728268 /CLONE=HTCACH05 /UG=Hs.82845 Homo sapiens cDNA: FLJ21930 fis, clone HEP04301, highly similar to HSU90916 Human clone 23815 mRNA sequence

215083_at -5.81 Consensus includes gb:AL049263.1 /DEF=Homo sapiens mRNA; cDNA DKFZp564F133 (from clone DKFZp564F133). /FEA=mRNA /DB_XREF=gi:4500011 /UG=Hs.306292 Homo sapiens mRNA; cDNA DKFZp564F133 (from clone DKFZp564F133)

205584_at -5.84 gb:NM_024810.1 /DEF=Homo sapiens hypothetical protein FLJ23018 (FLJ23018), mRNA. /FEA=mRNA /GEN=FLJ23018 /PROD=hypothetical protein FLJ23018 /DB_XREF=gi:13376194 /UG=Hs.169078 hypothetical protein FLJ23018 /FL=gb:NM_024810.1

81737_at -5.95 Cluster Incl. AI424872:tg38f10.x1 Homo sapiens cDNA, 3 end /clone=IMAGE-2111083 /clone_end=3 /gb=AI424872 /gi=4270895 /ug=Hs.159375 /len=443

211548_s_at -6.37 gb:J05594.1 /DEF=Homo sapiens NAD+-dependent 15-hydroxyprostaglandin dehydrogenase (PDGH) mRNA, complete cds. /FEA=mRNA /GEN=PGDH /PROD=NAD+-dependent 15-hydroxyprostaglandindehydrogenase /DB_XREF=gi:1203981 /UG=Hs.77348 hydroxyprostaglandin dehydrogenase 15-(NAD) /FL=gb:J05594.1

209655_s_at -6.58 Consensus includes gb:AI803181 /FEA=EST /DB_XREF=gi:5368653 /DB_XREF=est:tc15a07.x1/CLONE=IMAGE:2063892 /UG=Hs.8769 Homo sapiens mRNA; cDNA DKFZp761J17121 (from clone DKFZp761J17121); complete cds /FL=gb:AL136550.1

206332_s_at -6.69 gb:NM_005531.1 /DEF=Homo sapiens interferon, gamma-inducible protein 16 (IFI16), mRNA. /FEA=mRNA /GEN=IFI16 /PROD=interferon, gamma-inducible protein 16 /DB_XREF=gi:5031778 /UG=Hs.155530 interferon, gamma-inducible protein 16 /FL=gb:M63838.1 gb:NM_005531.1

206081_at -6.97 gb:NM_004727.1 /DEF=Homo sapiens solute carrier family 24 (sodiumpotassiumcalcium exchanger), member 1 (SLC24A1), mRNA. /FEA=mRNA /GEN=SLC24A1 /PROD=solute carrier family 24(sodiumpotassiumcalcium exchanger), member 1 /DB_XREF=gi:4759127 /UG=Hs.173092 solute carrier family 24 (sodiumpotassiumcalcium exchanger), member 1 /FL=gb:AF062921.1 gb:AF062922.1 gb:NM_004727.1

209656_s_at -6.97 gb:AL136550.1 /DEF=Homo sapiens mRNA; cDNA DKFZp761J17121 (from clone DKFZp761J17121); complete

cds. /FEA=mRNA /GEN=DKFZp761J17121 /PROD=hypothetical protein /DB_XREF=gi:13276606 /UG=Hs.8769 Homo sapiens mRNA; cDNA DKFZp761J17121 (from clone DKFZp761J17121); complete cds /FL=gb:AL136550.1

213285_at -7.15 Consensus includes gb:AV691491 /FEA=EST /DB_XREF=gi:10293354 /DB_XREF=est:AV691491 /CLONE=GKCEEB10 /UG=Hs.85335 Homo sapiens mRNA; cDNA DKFZp564D1462 (from clone DKFZp564D1462)

201884_at -7.25 gb:NM_004363.1 /DEF=Homo sapiens carcinoembryonic antigen-related cell adhesion molecule 5 (CEACAM5), mRNA. /FEA=mRNA /GEN=CEACAM5 /PROD=carcinoembryonic antigen-related cell adhesionmolecule 5 /DB_XREF=gi:11386170 /UG=Hs.220529 carcinoembryonic antigen-related cell adhesion molecule 5 /FL=gb:NM_004363.1 gb:M29540.1

205857_at -7.43 Consensus includes gb:AI269290 /FEA=EST /DB_XREF=gi:3888457 /DB_XREF=est:qi25g05.x1 /CLONE=IMAGE:1857560 /UG=Hs.1813 solute carrier family 18 (vesicular monoamine), member 2 /FL=gb:L14269.1 gb:L09118.1 gb:L23205.1 gb:NM_003054.1

206290_s_at -7.64 gb:NM_002924.1 /DEF=Homo sapiens regulator of G-protein signalling 7 (RGS7), mRNA. /FEA=mRNA /GEN=RGS7 /PROD=regulator of G-protein signalling 7 /DB_XREF=gi:11140808 /UG=Hs.79348 regulator of G-protein signalling 7 /FL=gb:NM_002924.1 gb:AF090116.1

203913_s_at -8.41 Consensus includes gb:AL574184 /FEA=EST /DB_XREF=gi:12934146 /DB_XREF=est:AL574184 /CLONE=CS0DI039YJ22 (3 prime) /UG=Hs.77348 hydroxyprostaglandin dehydrogenase 15-(NAD) /FL=gb:L76465.1 gb:NM_000860.1

210762_s_at -8.63 gb:AF026219.1 /DEF=Homo sapiens HP protein (HP) mRNA, complete cds. /FEA=mRNA /GEN=HP /PROD=HP protein /DB_XREF=gi:2559001 /UG=Hs.8700 deleted in liver cancer 1 /FL=gb:AF026219.1 gb:AF035119.1 gb:NM_006094.2

221665_s_at -9.18 gb:BC004907.1 /DEF=Homo sapiens, Similar to RIKEN cDNA 4632407K17 gene, clone MGC:4642, mRNA, complete cds. /FEA=mRNA /PROD=Similar to RIKEN cDNA 4632407K17 gene /DB_XREF=gi:13436193 /UG=Hs.28907 hypothetical protein FLJ20258 /FL=gb:BC004907.1

205513_at -9.21 gb:NM_001062.1 /DEF=Homo sapiens transcobalamin I (vitamin B12 binding protein, R binder family) (TCN1), mRNA. /FEA=mRNA /GEN=TCN1 /PROD=transcobalamin I (vitamin B12 binding protein, Rbinder family) /DB_XREF=gi:4507406 /UG=Hs.2012 transcobalamin I (vitamin B12 binding protein, R binder family) /FL=gb:J05068.1 gb:NM_001062.1

209859_at -9.57 gb:AF220036.1 /DEF=Homo sapiens tripartite motif protein TRIM9 isoform alpha (TRIM9) mRNA, complete cds; alternatively spliced. /FEA=mRNA /GEN=TRIM9 /PROD=tripartite motif protein TRIM9 isoform alpha /DB_XREF=gi:12407402 /UG=Hs.75090 KIAA0282 protein /FL=gb:AF220036.1 gb:AF220037.1 gb:AF220038.1

202833_s_at -9.73 gb:NM_000295.1 /DEF=Homo sapiens serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1 (SERPINA1), mRNA. /FEA=mRNA /GEN=SERPINA1 /PROD=serine (or cysteine) proteinase inhibitor, cladeA (alpha-1 antiproteinase, antitrypsin), member 1 /DB_XREF=gi:4505792 /UG=Hs.297681 serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1 /FL=gb:AF130068.1 gb:M11465.1 gb:K01396.1 gb:NM_000295.1

201667_at -10.77 gb:NM_000165.2 /DEF=Homo sapiens gap junction protein, alpha 1, 43kD (connexin 43) (GJA1), mRNA. /FEA=mRNA /GEN=GJA1 /PROD=connexin 43 /DB_XREF=gi:4755136 /UG=Hs.74471 gap junction protein, alpha 1, 43kD (connexin 43) /FL=gb:M65188.1 gb:NM_000165.2

205856_at -14.94 gb:NM_015865.1 /DEF=Homo sapiens solute carrier family 14 (urea transporter), member 1 (Kidd blood group) (SLC14A1), mRNA. /FEA=mRNA /GEN=SLC14A1 /PROD=RACH1 /DB_XREF=gi:7706676 /UG=Hs.171731 solute carrier family 14 (urea transporter), member 1 (Kidd blood group) /FL=gb:U35735.1 gb:NM_015865.1

222145_at -15.7 Consensus includes gb:AK027225.1 /DEF=Homo sapiens cDNA: FLJ23572 fis, clone LNG12403. /FEA=mRNA

/DB_XREF=gi:10440306 /UG=Hs.201593 Homo sapiens cDNA: FLJ23572 fis, clone LNG12403 219855_at -19.09 gb:NM_018159.1 /DEF=Homo sapiens hypothetical protein FLJ10628 (FLJ10628), mRNA. /FEA=mRNA

/GEN=FLJ10628 /PROD=hypothetical protein FLJ10628 /DB_XREF=gi:8922558 /UG=Hs.200016 hypothetical protein FLJ10628 /FL=gb:NM_018159.1

204726_at -23.4 gb:NM_001257.1 /DEF=Homo sapiens cadherin 13, H-cadherin (heart) (CDH13), mRNA. /FEA=mRNA /GEN=CDH13 /PROD=cadherin 13, H-cadherin (heart) /DB_XREF=gi:4502718 /UG=Hs.63984 cadherin 13, H-cadherin (heart) /FL=gb:U59288.1 gb:U59289.1 gb:NM_001257.1 gb:L34058.1

218435_at -26.83 gb:NM_013238.1 /DEF=Homo sapiens DNAJ domain-containing (MCJ), mRNA. /FEA=mRNA /GEN=MCJ /PROD=DNAJ domain-containing /DB_XREF=gi:7019452 /UG=Hs.279884 DNAJ domain-containing /FL=gb:AF126743.1 gb:NM_013238.1

Supplementary Figure 1

Tumor formation by PC-3 derivative cell xenografts. A. PC-3 cells and derivative lines

were grown to 80% confluence in a Hyperflask under tissue culture conditions in IMEM

containing 10% FBS and 1.2mg/ml G418, trypsinized, and resuspended in IMEM

containing 10% FBS to deactivate trypsin. Following two additional washes in cold PBS,

a solution of 3x106 cells/100 l PBS were inoculated into the ventral surface of 5 week

old female NCr-nude mice and tumors (n=20) were measured in two dimensions once a

week for eight weeks. The graph shows average size of PC-3 cell tumors with standard

deviations. Tumors were resected at 8 weeks and analyzed by immunohistochemistry. B.

Immunohistochemical analysis of derivative PC-3 cell lines for NKX3.1 expression

Cultured PC-3 cells were embedded in 1% agarose before paraffin-embedding,

sectioning, and staining. Tumor xenografts were dissected at 8 weeks post-inoculation

and immediately immersed in 10% buffered formalin before paraffin embedding,

sectioning and staining. Slides were microwaved for 5 minutes and immersed in two

washes of xylene, followed by successive washes in 100%, 90%, and 70% ethanol,

followed by a 5 minute wash in PBS. Slides were steamed in 10mM citrate buffer before

being incubated in blocking buffer and NKX3.1 primary antibody solution, followed by

application of Biotin-anti-mouse secondary antibody solution. The Vectastain Elite ABC

and Vector VIP substrate kits were used for immunohistochemical staining. Slides were

visualized with a Zeiss Axioplan-2 microscope and photographs were taken with a Nikon

Coolpix 5000 digital camera. On the left are panels with photomicrographs of cultured

cells with nuclear expression of NKX3.1. On the right are the respective tumor

xenografts at 8 weeks. As a positive control for expression of NKX3.1 in a xenograft an

LNCaP tumor is shown at the bottom.

Variant NKX3.1 and Serum IGF-1 – Investigation of Interaction in Prostate Cancer

Erin Muhlbradt1, Jing Ma2, Gianluca Severi3,6, Elizabeth Ortner1, Vanessa Hayes4, Hoa N. Hoang3,6, Meir Stampfer2, Graham Giles3,6, Michael Pollak5, and Edward P. Gelmann1

1Departments of Medicine and Pathology Herbert Irving Comprehensive Cancer Center Columbia University 177 Ft. Washington Ave. MHB 6N-435 New York, NY, 10032 2Channing Laboratory Department of Medicine Brigham and Women’s Hospital And Harvard Medical School 181 Longwood Avenue Boston, Massachusetts 02115 3Cancer Epidemiology Centre Cancer Control Research Institute Cancer Epidemiology Centre, Cancer Council Victoria 1 Rathdowne Street

Carlton South 3053 Australia + 6 Centre for Molecular, Environmental, Genetic, and Analytic Epidemiology, The University of Melbourne, Australia 4Children’s Cancer Institute for Medical Research Po Box 325 Randwick NSW 2031 Australia 5Division of Cancer Prevention Department of Oncology, Lady Davis Research Institute McGill University Montreal, Quebec Canada

eem2126@columbia.edu jing.ma@channing.harvard.edu gianluca.severi@cancervic.org.au liz.ortner@yahoo.com vhayes@ccia.org.au Hoa.Hoang@cancervic.org.au mstampfe@hsph.harvard.edu Graham.Giles@cancervic.org.au 1address correspondence to Dr. Gelmann, gelmanne@columbia.edu

Supported by NIEHS grant ES09888 to EPG and by DOD grants W81XWH-07-1-0263 to EPG and PC-05-0590 to EM. PHS was supported by NIH grants CA42182, CA90598, DOD grants PC050569, CA097193. The RFPC study was supported by grants from the Australian National Health and Medical Research Council (#504700, and #504702) and by infrastructure from the Cancer Council Victoria.

2

Abstract

NKX3.1 is a hom eobox g ene t hat c odes f or a ha ploinsufficient pr ostate t umor

suppressor. NKX3.1 is down regulated in the majority of early prostate cancers resulting in

decreased tumor suppression. In cultured cells NKX3.1 suppresses cell growth in part b y

inducing I GFBP-3 a nd i nhibiting IGF-1 s ignaling. A S NP ( rs2228013) t hat r epresents a

polymorphic NKX3.1(C154T) and codes for a variant protein NKX3.1(R52C) is present in

10% of the population. The NKX3.1 polymorphism is related to prostatic enlargement and

is a m inor r isk f actor for pr ostate cancer. In this r eport w e expand our a nalysis of

NKX3.1(C154T) t o t wo popul ations. W e i nvestigated f urther t he r ole of r s2228013 i n

prostate cancer r isk for 937 prostate cancer cases and 1086 age-matched controls from a

nested case-control study within the prospective Physicians’ Health Study (Massachusetts,

USA) (PHS) and among 798 cases and 527 c ontrols retrospectively collected in the Risk

Factors for Prostate Cancer Study of the Victoria Cancer Council (Australia) (RFPCS). In

the PHS we found no overall association between carrying the variant T allele in rs2228013

in NKX3.1 and p rostate can cer r isk ( OR=1.25, 0.92 -1.71) relative t o me n w ith th e

homozygous C genotype. A subgroup analysis for cases diagnosed before age 70 showed

an increased risk (RR=1.55; 95%CI: 1.04-2.31) of overall prostate cancer. In this age-group

the risk of metastatic cancer at diagnosis or of fatal cancer was even higher in carriers of

the T allele (RR=2.15; 95%CI: 1.00-4.63). These associations were not replicated in the

RFPCS. Serum IGF-I levels were found to be a risk factor for prostate cancer in both study

populations. I GFBP-3 i s a know n i nhibitor of IGF-I s ignaling. The wild t ype N KX3.1

protein c an i nduced IGFBP-3 e xpression in vitro but t he v ariant NKX3.1(R52C) pr otein

cannot. Because of the association in vitro between NKX3.1 and IGFBP-3 expression and

IGF-I s ignaling, we investigated the interaction between serum IGF-I level, a known r isk

factor for prostate cancer, and NKX3.1 genotype in the populations from PHS and RFPCS.

3

We r eport t hat NKX3.1 genotype doe s not m odify t he association be tween s erum IGF-I

levels and prostate cancer risk.

4

Adenocarcinoma o f th e prostate, lik e many epithelial ma lignancies, in itiates in epithelial

cells t hat a cquire t he pr ecursor or gatekeeper m utations r equired f or de velopment of t he

malignant ph enotype. In t he majority of e arly pr ostate cancers a r egion of 8p21.2 i s l ost

resulting i n l oss of t he homeobox gene NKX3.1 that i s expressed s pecifically i n prostate

luminal epithelial cells (1-3). Somatic inactivation of NKX3.1 in prostate cancer is reflected

in decreased protein expression that is at first partial and then nearly complete at the time

prostate cancer progresses to hormone-independence and metastatic disease (3, 4).

Loss of NKX3.1 expression is a very early event in prostate carcinogenesis. Gene

targeting s tudies in mic e s howed th at Nkx3.1 haploinsufficiency a lone can pr edispose t o

prostate epithelial dysplasia and can cooperate with other oncogenic mutations to augment

prostate ca rcinogenesis (5, 6) . H eterozygous Nkx3.1+/- mice h ave approximately 2 /3 t he

Nkx3.1 protein levels of wild type mice. A similar reduction in NKX3.1 protein levels is

seen in human prostatic intraepithelial neoplasia and in primary human prostate cancer (4).

Not only is NKX3.1 down regulated in preinvasive prostate cancer, but NKX3.1 expression

is r educed in r egions o f in flammatory a trophy th at a re p recursors f or ma lignant

transformation (7). Inflammatory cytokines i n t hese l esions c an i nduce u biquitination of

NKX3.1 that t argets the protein for degradation in the proteasome (8). Thus decreases in

NKX3.1 can both predispose to and accompany prostate malignant transformation.

Although no s omatic mutations of NKX3.1 have been found in prostate cancer (9,

10), t here ar e two we ll-characterized genetic v ariants as sociated w ith p rostate can cer. A

missense mutation was found that altered the N-terminal cap amino acid of the third, DNA-

binding, he lix i n t he homeodomain f rom a t hreonine t o a n a lanine N KX3.1(T164A) t hat

conferred risk fo r e arly p rostate c ancer i n a family (11). A lso we ha ve de scribed t he

NKX3.1(C154T) pol ymorphism now know n as S NP r s2228013 t hat i s f ound i n

approximately 10% of the population equally distributed among races and alters the coding

5

sequence for the protein (12). The missense mutation that changes arginine 52 to a cysteine

affects propensity f or phos phorylation a t s erine 48 a nd m ay a ffect protein f unction.

Heterozygosity for this SNP has been suggested to be a risk factor for prostate cancer and

is a ssociated w ith p rostatic e nlargement (12, 13) . T he m echanism b y w hich t his g enetic

variant affects organ size or the occurrence of neoplasia is unknown.

Growth s uppression b y NKX3.1 i s a ffected, i n pa rt, b y i nducing e xpression of

insulin-like growth factor binding protein-3 (IGFBP-3), a known growth suppressor protein

and dow n r egulator of insulin-like g rowth f actor-I ( IGF-I) activity. I GF-I i s a pe ptide

growth f actor t hat r egulates c ell growth, di fferentiation, a nd a poptosis by binding t o t he

IGF receptor-I (IGFR-I) (14). IGFs are present in abundance in the circulation. Circulating

IGF-I i s bound m ainly t o IGFBP-3, one of t he m ost a bundant s erum pr oteins (15).

Although IGFBP-3 can inhibit the interaction of IGF-I with its receptor at the cellular level,

serum IG FBP-3 a lso s erves t o s tabilize c irculating IGF-I (16). S erum l evels of bot h

proteins vary with age, nutrition, and hormonal status (17). Because of the effects of IGF-I

on c ell g rowth, s urvival, a nd a poptosis, t he i nfluence of bot h s erum IGF-I a nd I GFBP-3

concentrations on c ancer r isk has been s tudied by a number of investigators (16). Serum

IGF-I levels are associated with an elevated risk of prostate cancer in a v ariety of s tudies

(18-26) that have been confirmed by meta analyses (27, 28). The risk that circulating IGF-I

confers for prostate cancer may be related t o i ts role a s a growth and survival f actor for

prostate cancer cells (29-32). Here we show that NKX3.1(R52C) and a protein engineered

for loss of the serine 48 phosphorylation site NKX3.1(S48A) do not activate expression of

IGFBP-3. C onsistent w ith t his l oss of f unction we h ypothesize t hat t he pr esence of t he

variant NKX3.1 protein may interact with circulating serum IGF-I to affect prostate cancer

risk. Determination of NKX3.1 genotype in two populations and analysis of serum IGF-I in

the same study subjects is shown.

6

Materials and Methods

Cell Culture and Reagents The prostate cancer cell l ines PC-3 and LNCaP, and the A172

human glioblastoma cell line were obtained f rom the American T ype Culture Collection,

Rockville, M D. P C-3 a nd A 172 c ell l ines a re g rown i n M odified IMEM ( Invitrogen,

Carlsbad, C A) c ontaining 10% F BS. LNCaP c ells a re grown i n M odified IMEM w ith

phenol r ed ( Invitrogen) c ontaining 10 % f etal bovine s erum ( FBS). P C-3 cel ls s tably

expressing t he N KX3.1 e xpression ve ctor a re continuously grown i n Modified IMEM

(Invitrogen) c ontaining 10% F BS a nd 1.2m g/ml G 418 (Invitrogen). LNCaP cel ls w ere

serum s tarved overnight in IMEM supplemented with 5% charcoal charcoal-stripped cal f

serum (CCS) and treated with 10nM R1881 for 48hr before harvesting.

Plasmids and Transfection Full length NKX3.1, NKX3.1(R52C), and NKX3.1(S48A) were

expressed from constructs in the mammalian expression vector, pcDNA3.1 (Invitrogen) as

previously described (33). T ransient and s table transfections were c arried out i n 75 c m2

cell culture flasks (Corning Inc., Corning, NY). Briefly, PC-3 and LNCaP prostate cancer

cells were grown to 40-60% confluence and 4g of plasmid DNA was transfected into the

cell lines using Lipofectamine and P lus r eagents ( Invitrogen) in Opti-MEM (Invitrogen).

After a 4 hr i ncubation, t he m edia w as r eplaced with IMEM containing 10% F BS f or an

additional 24 hour s. T he P C-3 c lones t hat s tably e xpress N KX3.1 were d erived b y

transfection. After 4hr incubation in transfection reagent, PC-3 cells were trypsinized and

seeded at a 1: 30 de nsity in Falcon Integrid 20 mm g rid t issue c ulture di shes ( Becton

Dickinson, F ranklin Lakes, N J) i n m odified IMEM c ontaining 10% F BS a nd 1.2m g/ml

G418 ( Invitrogen). T he m edia w as r eplaced e very 4 da ys unt il c olonies de rived f rom a

single cell could be seen with a l ight microscope. Individual colonies were isolated with

sterile c loning di sks ( Scienceware, P equannock, N J) s oaked i n 0.25% T rypsin-EDTA

7

(Invitrogen) and grown to confluence in 6-well t issue culture dishes (Corning) for further

study.

Western Blot Analysis. Cells were grown to 60-80% confluence and media was aspirated

from th e tis sues c ulture d ish. Immediately following me dia a spiration, ly sis b uffer w as

pipetted d irectly onto th e c ell mo nolayer a nd c ells w ere s craped f rom th e tis sue culture

flask. C ells w ere l ysed w ith r adioimmunoprecipitation a ssay ( RIPA) b uffer c ontaining

complete mini protease inhibitors (Roche, Nutley, NJ) and/or phosphatase inhibitors (Cell

Signaling, Danvers, MA) followed by brief sonication to complete lysis. Sixty to ninety g

of total cell lysate was boiled in Novex® 2X Tris-glycine SDS sample buffer (Invitrogen)

containing β-mercaptoethanol for six minutes and resolved on a 10-20% Tris-glycine SDS-

PAGE gel (Invitrogen) Protein was then transferred onto a nitrocellulose membrane (Bio-

Rad, Hercules, CA) and probed w ith primary antibody concentrations, as follows; β-actin

(Sigma, S t. Louis, M O) 1: 10,000; N KX3.1 (3) 1:2000; I GFBP-3 (s c-9028, S anta C ruz

Biotechnology, S anta C ruz, C A) 1: 8,000 a t 4°C ove rnight, followed b y t hree w ashes i n

PBST. H RP conjugated goat-anti-rabbit and goat-anti-mouse ( ImmunoPure® antibodies,

Pierce B iotechnology, R ockford, IL) s econdary antibodies i n 1% m ilk o r 1% B SA w ere

applied for 1 hour at room temperature. Signal detection was performed with Super-Signal

West Pico Chemiluminescent Substrate (Pierce Biotechnology).

Reverse Transcriptase PCR analysis Total RNA was extracted using the RNeasy Mini Kit

(Qiagen) and cells were homogenized using the Qiashredder (Qiagen) method. 125-250ng

of R NA w as a dded t o the R T-PCR ma ster mi x f rom O ne-step R T-PCR k it ( Qiagen)

(includes 5x buffer, DNTPs, and Taq polymerase). The following primers were used in the

RT-PCR reactions: β-Actin (Fwd 5’-GGC CAC GGC TGC TTC-3’ and Rev 5’-GTT GGC

GTA CAG GTC TTT GC-3’); NKX3.1 (Fwd 5’-GCC GCA CGA GCA GCC AGA GAC

A-3’ and Rev 5’-TTC AGG GCC GGC AAA GAG GAG TG-3’); IGFBP-3 (Fwd 5’-CGC

8

CAG C TC C AG GAA AT G-3’ and R ev 5’ -GCA TG C C CT TTC TTG A TG A TG-3’);

IGFBP-4 (Fwd 5’-TTA GCC CAA GAG GTC TGA GC-3’ and Rev 5’-CTG TGC TTC

AAG TCT TCC TTT G -3’); Lamin A/C (Fwd 5’-AAC TTC AGG AT G AGA TGC TGC

G-3’ and Rev 5’-GTC CAG AAG CTC CTG GTA CTC GT-3’). RT-PCR was performed

in a Techne Techgene PCR machine; 30 min. at 50°; 15 min. at 94°; 22-30 cycles of 30s-1

min. at 94°, 30s-1 min. at melting temperatures of 55°-65°, and 30s-1 min. at 72°; followed

by 15 m in. a t 72°. Samples were s tored on i ce unt il and mixed with 10x Blue Juice gel

loading buf fer (Invitrogen) and run on a 1.5% a garose gel containing 0. 1g/ml e thidium

bromide in TAE buffer. Gels were imaged on a luminometer and recorded using a Kodak

1D digital camera.

IGF-IR Activation and Signaling. Cells were plated in 100mm culture dishes and washed

twice with 1x phosphate buffered saline (PBS) before being serum starved for 14-16 hours

in Modified IMEM containing 1.2mg/ml G418 (Invitrogen). Cells were then washed once

with P BS a nd t reated for 3 m inutes w ith 100 pM IGF-I (a gift from D r. J . T oretsky,

Georgetown University, Washington, DC) in IMEM at 37°C. The media was immediately

aspirated a nd c ells w ere s craped f rom t he f lask a nd s uspended i n 2X C ell Lysis B uffer

(Cell S ignaling) c ontaining phos phatase i nhibitors a nd pr otease i nhibitors b y us ing

Complete Mini tablets (Roche). W estern blot analysis was completed as described above

using anti-IGF-I-R (#3027, Cell Signaling), anti-phospho-IGF-I Receptor(Tyr1131) (#3021,

Cell S ignaling), a nti-IRS-1 ( 06-248, U pstate), a nti-phospho-IRS-1(Y612) (44-816G,

Biosource) pr imary a ntibodies. B ands w ere qu antified b y S cion Imager s oftware a nd p -

values were assessed from t riplicate experiments by t -test analysis using Prism Graphpad

software. [ * i ndicates p -value of < 0.05, ** i ndicates p -value o f < 0.005, *** i ndicates p -

value of <0.001].

9

Cell Proliferation Assay PC-3 and derivative cell lines were seeded in triplicate in 96-well

plates at a co ncentration of 4000 cel ls per well in IMEM containing 10% FBS (PC-3) or

10% FBS plus 1.2mg/ml G418 [PC-3(pcDNA3.1) and PC-3(NKX3.1)] and incubated for

24 hr at 37°C. At 24, 48, 72, and 96 hr after seeding, wells were trypsinized, suspended in

IMEM, and immediately counted in a Beckman Coulter Z1 c ell counter. Doubling t imes

were calculated using Microsoft Excel and p-values were calculated by ANOVA.

Study Cohorts. Physicians Health S tudy: The participants of the Physicians Health S tudy

(PHS) w ho co mprised the p rostate can cer c ases a nd c ontrols ha ve be en pr eviously

described in papers describing the effect of serum IGF-I (34) and NKX3.1 genotype (12) on

prostate can cer r isk. T he cu rrent an alysis i ncludes 937 c ases a nd 1086 c ontrols, us ing a

prospective nested case-control design. Of the cases, 580 ha d Gleason score < 7, 334 ha d

Gleason score >= 7 and 23 cases had unknown Gleason scores. Among the cases, 647 were

T1/T2 and 197 w ere locally advanced or metastatic at presentation with the remaining 93

cases of unknown stage. Median age of cases at diagnosis was 70 years.

Risk F actors f or P rostate C ancer S tudy: T he Risk F actors f or P rostate C ancer S tudy

(RFPCS) i s a popul ation-based c ase-control study o f p rostate c ancer in A ustralia. P rior

approval of the study protocol was obtained from all relevant hospital and cancer registry

human research ethics committees in Melbourne and Perth. Eligible cases comprised male

residents of Melbourne and Perth diagnosed between 1994 a nd 1997 a nd recorded in the

population-based c ancer r egistries w ith a histopathology-confirmed di agnosis of

adenocarcinoma of t he prostate ( International Classification of D iseases, 9t h r evision,

rubric 185), e xcluding w ell-differentiated t umors ( defined as l ow grade, i.e., t hose w ith

Gleason scores <5). Cases had to be <70 years of age at diagnosis. Controls were randomly

selected f rom men on the current s tate electoral rolls and were f requency matched to the

predicted age distribution of the cases in a ratio of one control per case. Potential controls

10

were matched against the cancer registries at the time of recruitment to exclude men with a

known hi story o f pr ostate c ancer. C ontrols w ere i dentified a nd i nterviewed

contemporaneously with the cases over the period 1994 t o 1997. The cohort is comprised

>95% o f C aucasians. The l ack o f racial d iversity i s not cr itical t o t his analysis s ince t he

frequency of the NKX3.1 polymorphism does not vary between races (12). A total of 798

cases and 5 27 co ntrols were an alyzed. Of t he t otal cas es 5 82 w ere d escribed as l ow-to-

moderate grade a nd 21 6 a s hi gh g rade ( Gleason s core > 7 or poor ly differentiated or

undifferentiated tumors). Among the cases 545 were T1/T2 and 249 were locally advanced

or metastatic at presentation with the remaining 4 cases of unknown stage. Median age for

cases and controls was 62 years of age.

Serum IGF-I Assay. Serum IG F-I l evels w ere d etermined b y ELISA with r eagents f rom

Beckman Coulter (DSL, Webster, TX). All assays were performed in the laboratory of one

of us (M.J.P.). Reliability of laboratory assays of plasma levels are always checked before

measuring t he r eal s amples. T he m ean i ntra-pair c oefficients o f va riation f or bl inded

duplicate qua lity c ontrol s amples w ere 2.6 % f or IGF-I, a nd t he long-term in tra-person

correlation coefficient for these biomarkers was 0.66 for IGF-I (3 years apart) (22). Cases

and co ntrols w ere s eparated b y tertile of s erum I GF-I l evels. T he m edian va lues f or t he

IGF-I levels in the tertiles f rom the controls in each s tudy are reported. For the PHS the

IGF-I measurements were made at four di fferent times when batches of 92, 257, 73, and

105 control samples were assayed. Batch-specific cut off points were used for tertiles and

overall median values are reported as the mean of the three median values. Inclusion of the

IGF-I values for the cases as well as controls changed the overall means by less than 1%

for each tertile.

Statistical Analysis. For t he P HS, t he b aseline ch aracteristics an d i nformation at p rostate

cancer diagnosis for all the 937 cases and 1086 controls and for the subgroup of 673 cases

11

and 527 c ontrols w ith b oth t he ge notype da ta a nd pl asma IGF-I l evels are p resented i n

Table 1.

Using P earson’s goodness-of-fit te st, th e NKX3.1 SNP does not violated H ardy-

Weinberg Equilibrium (p>0.05). Because of the low prevalence of the variant T allele, SNP

was analyzed u nder a dominant m odel f or both m ain ef fect an alysis an d t he t est o f

interactions. Cases and controls were matched by age and follow-up duration, but not by

race. Because ex cluding n on-Caucasians or c onducting s ubgroup a nalysis l ed t o losing

some case-control pairs, we used an unconditional logistic regression model, to assess the

risk of incident prostate cancer according to genotype, adjusting for the matching f actors

(age at randomization, smoking status, and follow-up time). We also conducted a subgroup

analysis, comparing cases with Gleason score ≥8 or clinically advanced stage (T3, T4, N1,

or M1) to all controls.

We f irst c onducted case-control analysis assessing t he overall a ssociation of t he

NKX3.1 pol ymorphism with risk of de veloping prostate c ancer among all t he 9 37 cases

and 1086 controls. We also evaluated the associations separately by Gleason grade (<7 vs.

≥7), b y c linical s tage ( localized T 1/T2 vs . a dvanced T 3/T4/N1/M1), b y fatal pr ostate

cancer as outcome, and by year of the cancer diagnose (1982-1994 vs. 1997-2007) (Table

2). T hese an alyses w ere t hen r epeated b y m edian ag e at d iagnosis ( <70 v s. ≥70 y ears).

Finally, w e as sessed i nteraction b etween b aseline plasma I GF-I l evels and t he NKX3.1

polymorphism ( Table 5 ). W e t hen assessed t his interaction i n t he R FPC s tudy using t he

same s trategy. All s tatistics were calculated using SAS (version 9 .1.3; SAS Institute Inc,

Cary, NC), with a two-sided significance level of 0.05.

12

Results

NKX3.1(C154T) as a Risk Factor

Previously w e h ad s hown t hat a mong 1253 cases a nd c ontrols i n t he P HS

NKX3.1(C154T) ( rs2228013) t hat c odes f or N KX3.1(R52C) w as a m ild r isk f actor f or

prostate cancer (12). We expanded this sample set to include cases from the PHS diagnosed

more recently so that we now analyzed NKX3.1 genotypes from 937 prostate cancer cases

and 1086 age-matched controls. In this expanded sample set the NKX3.1(C154T) allele was

related t o p rostate can cer r isk to a s imilar de gree a s w e ha d pr eviously published (12)

(Table 2). Importantly, a mong men w ith prostate c ancer di agnosed b efore age 70, the

median a ge a t di agnosis i n t he P HS, rs2228013 was s ignificantly associated w ith h igher

risk of overall prostate cancer (RR=1.55; 95% CI: 1.04-2.31), Gleason <7 (RR=1.71; 95%

CI: 1.10-2.65), s tage T 1/T2 ( RR=1.67; 95% C I: 1.09-2.57), a nd a higher r isk of l ethal

cancer (metastatic cancer at diagnosis or fatal cancer during follow-up (RR=2.15; 95% CI:

1.00-4.63) (Table 3).

Effect of NKX3.1(R52C) on IGFBP-3 Expression and IGF-IR Activation

Amino acid 52 a ffected by rs2228013 is an arginine, located in a consensus motif

that is a s ite for phos phorylation at s erine 48. R eplacement of a rginine 52 w ith c ysteine

decreases phosphorylation at serine 48 by 70% (12). Thus a missense mutation at serine 48

potentially generates a protein w ith a nalogous, but m ore absolute, l oss of s erine 48

phosphorylation compared to NXK3.1(R52C). Expression of NKX3.1(R52C) in PC-3 cells

induced substantially less IGFBP-3 mRNA than did wild type NKX3.1 (Figure 1A). The

mutant N KX3.1(S48A) protein w as also a ttenuated i n IGFBP-3 induction, pe rhaps t o a

greater de gree t han N KX3.1(R52C) ( Figure 1B ). W estern bl otting c onfirmed t hat, as

expected, neither NKX3.1(R52C) nor NKX3.1(S48A) induced IGFBP-3 protein expression

in PC-3 cells (Figure 1C).

13

NKX3.1 e xpression a ttenuated IGFR-I a ctivation in P C-3 c ells vi a i nduced

expression of IGFBP-3. The e ffect of N KX3.1 o n IGFR-I a ctivation w as not s een when

Long R-IGF-I, a n IG FR-I l igand that does not b ind to IGFBP-3 was used, or when cells

were p retreated w ith IGFBP-3 siRNA (35). In c ontrast, n either N KX3.1(R52C) nor

NKX3.1(S48A) ha d a n e ffect on IGFR-I s ignaling ( Figures 2A a nd B ). M oreover,

signaling downstream from IGFR-I to IRS-1 is attenuated by NKX3.1 expression, but not

by NKX3.1(R52C) or NKX3.1(S48A) (Figure 2C).

NKX3.1 s uppresses cell pr oliferation i n c ulture, a n e ffect t hat i s a brogated b y

siRNA to IGFBP-3 (35). PC-3 cells have a doubling time of approximately 24 hrs that is

extended to approximately 30 hr s by expression of NKX3.1. Neither NKX3.1(R52C) nor

NKX3.1(S48A) a ffected P C-3 c ell doubl ing t ime ( Table 4) de spite l evels of N KX3.1

protein expression comparable to levels of wild type protein that suppressed proliferation

(Supplementary Fig. 1).

Analysis of NKX3.1 Genotype and Serum IGF-I

Since N KX3.1 r egulates l ocal IGFBP-3 e xpression i n pr ostate a nd I GFBP-3

attenuates I GF-I s ignaling w e as ked whether NKX3.1 genotype i nfluenced t he e ffect o f

IGF-I on pr ostate c ancer r isk. F rom pa rticipants in th e P hysicians’ Health S tudy w e

analyzed 673 p rostate cancer cases and 527 m atched controls for which we were able to

determine bot h NKX3.1 genotype a nd s erum l evels of IGF-I ( Table 5) . The m ajority o f

cases (69%) in this cohort had been ascertained prior to 1994 and thus had been diagnosed

prior t o t he widespread use of s erum P SA f or p rostate c ancer s creening. M oreover, t he

blood samples were collected in 1982, prior to the diagnosis of prostate cancer in the cases.

The f requency of rs2228013 a mong t he control participants with IGF-I d ata was 6.83%,

somewhat lower than the overall PHS controls (8.10%), and lower than the 11% we had

originally f ound i n our previous s tudy (12). T able 5 shows t he f requency of cas es an d

14

controls displayed by NKX3.1 genotype and distributed across three tertiles of plasma IGF-

I l evels. A mong pa rticipants hom ozygous f or w ild t ype NKX3.1 there w as n o ef fect o f

plasma I GF-I o n p rostate can cer o ccurrence. H owever, am ong p articipants w ith NKX3.1

variant T allele we found a 2.5-fold higher risk of prostate cancer comparing the highest to

the lo west te rtile o f p lasma IGF-I l evels. The positive t rend w as a pparent onl y among

prostate cancer cases diagnosed before 1993, but not among cases diagnosed 1994 and after.

NKX3.1 genotype and serum IGF-I levels did not have a statistically significant interaction

even among this subset probably due to the small sample size among T allele carriers (p for

interaction = 0.2673).

We an alyzed NKX3.1 genotype a nd s erum IGF-I i n a s econd group o f cases a nd

controls f rom t he R FPCS. T hese c ases w ere di agnosed b etween 1994 a nd 1997 a nd a re

therefore co nsidered l argely s creen-detected. T he c haracteristics of t his popul ation a re

shown i n t he r ight c olumn of Table 1 . N oteworthy i s t hat n o p rostate can cer c ases w ith

Gleason score < 5 were included in this cohort. In this population rs2228013 was present in

10.4% of t he pa rticipants. T hese s creened c ases ha d a t rend t oward a younger age of

diagnosis, l ower s tage distribution a nd l ower grade di stribution t han the P HS c ohort.

Moreover, blood samples were drawn after the diagnosis of prostate cancer, not years prior

as ha d be en dow n w ith the P HS s tudy s amples. A mong t hese pa rticipants t here w as no

effect o f NKX3.1 genotype o n p rostate can cer r isk. T here w as al so n o i nteraction w ith

levels o f s erum IGF-I (Table 6) . H owever, t he e ffect of s erum IGF-I levels a lone on

prostate cancer risk was seen in this population (Supplementary Table 1).

Discussion

NKX3.1 is important for prostate epithelial cell development, growth control, and

differentiation (5, 36) . M urine Nkx3.1 is ha ploinsufficient a nd l oss of a s ingle a llele

manifests a phenotype similar to homozygous deletion, but with longer latency (5). In early

15

human prostate cancer we have found that NKX3.1 expression i s dow n regulated over a

broad r ange o f expression l evels w ith a m edian expression i n p rimary p rostate can cer o f

0.67 the l evel i n adjacent normal cells (4). In t he course of de termining the pa thways of

tumorigenesis t hat a re a ffected b y N KX3.1 w e f ound that e xpression of IGFBP-3 i n t he

prostate is downstream of NKX3.1 and that the effects of NKX3.1 on cell proliferation are

mediated by IGFBP-3. In cultured cells NKX3.1 a ttenuates IGF-I s ignaling b y activating

IGFBP-3 e xpression (35). I mportantly, IGFBP-3 mRNA i s a mong t he g enes m ost

commonly down regulated in prostate cancer t issues compared to normal prostate t issues

suggesting that its down regulation may play a role in prostate cancer pathogenesis (37).

NKX3.1 ha ploinsufficiency affects c ell t ransformation, a t l east i n part, b y

downstream e ffects on t ranscriptional t argets. N KX3.1 bi nds t o D NA a nd s uppresses

expression of genes do wnstream f rom c ognate DNA bi nding sites (33). W e h ave yet t o

identify a p romoter th at is tr anscriptionally activated b y d irect b inding o f N XK3.1 to it s

cognate D NA –TAAGTA- sequence. In f act, o ur ex periments w ith r eporter co nstructs

containing NKX3.1 binding DNA suggested that NKX3.1 alone cannot initiate assembly of

a tr anscriptional c omplex (33). N KX3.1 i s kno wn t o i nteract w ith ot her t ranscription

factors s uch as s erum r esponse f actor ( SRF) an d s erves as a s ynergistic co activator o f

promoters with serum response elements such as smooth muscle γ-actin (12, 38). Therefore

the effect of NKX3.1 on gene expression is complex and is likely mediated by a number of

cofactors. Because other NK homeodomain protein f amily m embers l ike Nkx2.5 i nteract

with SRF, the physical interaction of NKX3.1 a nd SRF has be en s tudied as a model for

transcription factor interactions of NKX3.1. SRF is a widely expressed transcription factor

involved i n or chestrating di sparate pr ograms of g ene e xpression l inked t o m uscle

differentiation and cellular growth (39). It is likely that different targets of transcriptional

16

activation ar e affected b y the i nteraction o f N KX3.1 w ith s everal d ifferent t ranscription

factors.

We ha ve s hown an i ndirect l ink b etween N KX3.1 a nd t ranscription o f IGFBP-3

mRNA. In cultured cells with NKX3.1 over expression we have shown a mechanistic link

between NKX3.1, IGFBP-3 expression, IGF-IR activation, and cell proliferation. IGF1-R

signaling i s af fected b y m any f actors t hat r egulate IGF-I a vailability a nd in tracellular

signaling d ownstream f rom th e I GF-IR. T herefore, t he i nteraction be tween N KX3.1 a nd

IGFBP-3 expression in vivo is likely to be part a more complex system regulating the effect

of IGF-I on prostate epithelial cells. T he IGFBPs have functions that can compensate for

one a nother m aking i t d ifficult t o de termine s pecific f unctions of a s ingle IGF bi nding

protein b y s tudies o f gene-targeted m ice (40, 41) . W hether t he s ame c ompensatory

activation of IGF bi nding p roteins o ccurs i n p rostate ep ithelial cel l t hat h ave r educed

NKX3.1 expression was not determined.

The presence of a variant NKX3.1 allele was associated with prostate cancer risk in

one prospective cohort but not in a second group of men assembled after the diagnosis of

prostate cancer. Despite our observations from in vitro models that NKX3.1 blocks IGF-IR

activation via IGFBP-3 we could not demonstrate a consistent interaction between NKX3.1

genotype and ci rculating l evels o f IGF-I i n t he t wo s tudy populations. NKX3.1 genotype

did affect Gleason score <7 tumors especially in men younger than 70. This observation is

consistent with the notion that high-grade tumors are autonomous in their growth and less

influenced b y h ost factors, s uch as circulating IGF-I, o r NKX3.1 expression. In c ontrast,

tumors with lower Gleason scores may have greater dependence on such factors. It is also

worth not ing t he NKX3.1 polymorphism w as a ssociated w ith a n i ncreased r isk of l ethal

prostate cancer among those diagnosed prior to age 70.

17

Differences in the association between NKX3.1 genotype and prostate cancer risk in

the two studies we analyzed may be due to the effect of over diagnosis of prostate cancer.

The Physicians Health Study population includes a large fraction of cases diagnosed prior

to mid-1990 and therefore prior to the adoption of widespread PSA screening for prostate

cancer. On the other hand, the Risk Factors for Prostate Cancer Study includes only cases

diagnosed between 1994 and 1997. H istologic foci of prostate cancer are concomitants of

aging and are found in all men. PSA screening is a h ighly sensitive test that has caused an

increase in the total number of cases diagnosed each year contributing to a substantial over

diagnosis. Some estimates identify as many as 42% or more of all cases as over diagnosed

(42). Thus many cases diagnosed during the PSA era may be biologically different from the

bulk of t hose di agnosed be fore t he a doption of s creening on a l arge s cale, w hen m ost

diagnosed cases were clinically meaningful and carried a more serious prognosis. Ours is

not the only study to find disparate results between case-control groups from the pre- and

post-PSA screening era and i t i s l ikely that PSA screening has al tered the biology that i s

being analyzed in large case studies collected after the mid 1990s (43, 44).

The PHS and RFPCS also differed in the timing of blood collection that was used

for s erum IGF-I de terminations. T he P HS group w as a n ested case c ontrol s tudy, with

prospectively collected samples. IGF-I levels were determine on samples collected before

the di agnosis of c ancer. In c ontrast, f or the R FPCS cas e-control s tudy, t he bl ood w as

collected after diagnosis and perhaps after treatment had been initiated. Thus, in the case-

control setting, one is always concerned that either the disease, or treatment, or both could

affect the blood levels.

Down r egulation of N KX3.1 pr otein pe r s e i s s ufficient t o pr edispose c ells t o

malignant t ransformation. In addition w e ha ve de scribed a f amily i n which he reditary

prostate c ancer c osegregated w ith a T 164A m issense m utation i n t he N KX3.1

18

homeodomain that reduced DNA binding by 95% (11). Haploinsufficiency is a reflection

of the dominant nature of regulation by NK family members. Both missense and truncation

mutations i n N KX2.5 a re a utosomal dom inant de terminants o f c ongenital c ardiac

abnormalities (45, 46). Similarly, mutations in NKX2.1/TTF cause pulmonary and thyroid

developmental abnormalities (47). Paradoxically, NKX2.1 is amplified in a subset of lung

cancers a nd N KX2.1 ov er e xpression c ontributes t o c ell t ransformation and onc ogenesis

(48). W e a rgue t hat t umor s uppression b y N KX3.1 i s e xerted i n a r elative m anner b y

modulation of dow nstream t argets t o di fferent de grees. O ur f inding t hat IGFBP-3

expression in human prostate cancer cells correlates quantitatively with NKX3.1 expression

levels is r eminiscent o f f indings th at Nkx3.1 gene d osage d etermines t he d egree o f

transcriptional effects in gene targeted mice (49). Analysis of downstream targets of Nkx3.1

identified a num ber of ge nes r elated t o di fferentiation, but di d not i dentify Igfbp-3 (50).

We, on t he other hand, showed that prostatic Igfbp-3 mRNA levels correlate with Nkx3.1

gene c opy num ber i n gene-targeted mic e (35). F urther s tudies w ill id entify additional

NKX3.1 t argets a nd e lucidate t heir r ole i n pr ostate c ancer s uppression a nd, pe rhaps,

prevention.

Acknowledgements

We thank Dallas English and John Hopper, principal investigators of the Risk Factors for

Prostate Cancer Study, for their contributions to this work.

19

Table 1 Characteristics of Two Study Populations PHS

- overall (%)

PHS with IGF-I

(%)

RFPCS (%)

Participants 2023 1200 1325 Cases 937 673 798 Dx prior to 1994 532(57) 465(69.09) 0 Dx after 1994 405(43) 208(30.91) 798 Age at Diagnosis <55 21( 2.24) 17( 2.53) 110 (13.8) 55-64 258(27.53) 204(30.31) 421 (52.7) 65-69 242(25.83) 169(25.11) 267 (33.5) 70-74 221(23.59) 160(23.77) ≥ 75 195(20.81) 123(18.28) Stage T1/T2 647(69.05) 461(68.50) 545 (68.3) T3/T4 150(16.01) 114(16.94) 249 (31.2) N1/M1 47( 5.02) 39( 5.79) Missing 93(9.93) 59 (8.77) 4 (0.5) Grade Gleason<7

Low/Med Grade 580(61.90) 414(61.52) 582 (72.9)1

Gleason≥7, High Grade

334(35.64) 239 (35.51)

216 (27.1)

Missing 23( 2.45) 20( 2.97) NKX3.1 codon 154

C/C 844 604 719 (90.1)

C/T or T/T 93( 9.92) 69 (10.25) 79 (9.9) IGF-I (ng/ml) Tertile 1 133.72 52.3 Tertile 2 186.4 68.0 Tertile 3 243.7 86.4 1All cases with Gleason score < 5 were excluded. 2For details on calculation see Materials and Methods.

20

Table 2 Odds ratios of Prostate Cancer by NKX3.1 Genotype in the PHS

Genotype Case (n) Case (%)

Control (n) Control (%) Odds ratio

Overall C C 844 90.1 998 91.9 1.00

C T 91 9.7 84 7.7

T T 2 0.2 4 0.4

C T/T T 93 9.9 88 8.1 1.25 (0.92-1.71)

Dx 1982-1993 C C 481 90.4 998 91.9 1.00

C T/T T 51 9.6 88 8.1 1.21 (0.83-1.77)

Dx 1994-2007 C C 363 89.6 998 91.9 1.00

C T/T T 42 10.4 88 8.1 1.22 (0.77-1.94)

21

Table 3 Odds ratios of Prostate Cancer by NKX3.1 Genotype Among Men With Age<70 yrs at Diagnosis: results from the PHS

Genotype Cases (%) Controls (%) Odds ratio

Overall C C 460 88.3 564 92.2 1.00

C T/T T 61 11.7 48 7.8 1.55 (1.04-2.31)

Gleason<7 C C 296 86.8 564 92.2 1.00

C T/T T 45 13.2 48 7.8 1.71 (1.10-2.65)

Gleason≥7 C C 156 91.2 564 92.2 1.00

C T/T T 15 8.8 48 7.8 1.14 (0.62-2.10)

Stage T1/T2 C C 324 87.3 564 92.2 1.00

C T/T T 47 12.7 48 7.8 1.67 (1.09-2.57)

Stage T3/T4/N1/M1 C C 110 91.7 564 92.2 1.00

C T/T T 10 8.3 48 7.8 1.12 (0.54-2.29)

Metastatic or fatal prostate cancer

C C 62 86.1 564 92.2 1.00

C T/T T 10 13.9 48 7.8 2.15 (1.00-4.63)

Year of diagnosis 1982-1993

C C 259 90.2 564 92.2 1.00

C T/T T 28 9.8 48 7.8 1.30 (0.78-2.19)

Year of diagnosis 1994-2007

C C 201 85.9 564 92.2 1.00

C T/T T 33 14.1 48 7.8 1.80 (1.03-3.15)

22

Table 4 Effect of NKX3.1 Expression on Cell Proliferation

Cell Type Doubling Time p-valuePC-3 25.34 ± 1.91 0.1716PC-3(Control) 24.26 ± 2.05 *

PC-3(NKX3.1)-1 32.24 ± 5.91 0.0037PC-3(NKX3.1)-2 38.88 ± 7.82 0.0002PC-3(NKX3.1)-8 30.24 ± 2.55 0.002

PC-3(NKX3.1)(S48A)-25 22.19 ± 1.31 0.1368PC-3(NKX3.1)(S48A)-27 22.94 ± 0.98 0.3221PC-3(NKX3.1)(S48A)-28 22.42 ± 2.00 0.2053

PC-3(NKX3.1(R52C)-1 24.34 ± 1.50 0.9555PC-3(NKX3.1)(R52C)-26 25.94 ± 1.48 0.2264PC-3(NKX3.1)(R52C)-27 26.41 ± 1.69 0.1357

The cell doubl ing t ime, in hours, of parental PC-3 cel ls, PC-3(pcDNA3.1) cells, and PC-

3(NKX3.1) clones was assayed by cell counting. Cells were counted at 24, 48, 72, and 96

hours post-seeding and doubling t imes were calculated. In the lower section of the table

PC-3(pcDNA3.1) and PC-3(NKX3.1)-1 cells were treated with transfection reagent alone,

the missense siRNA oligonucleotide, and the IGFBP-3 siRNA oligonucleotide for 24 hours

before the f irst cel l count was t aken. p -values were cal culated in comparison to the PC-

3(pcDNA3.1) cell doubling time, using ANOVA. NS = not significant.

23

Table 5 Odds ratios of Prostate Cancer by NKX3.1 Genotype and IGF-I Level in the Physicians Health Study

* Adjusted for baseline age, smoking status, and follow-up duration.

Genotype IGF-I tertile

Case/ Control Odds ratio* p-interaction

Overall: CC 1 197/ 162 1.00 ( ref) 0.24

2 203/ 166 1.029 (0.77-1.38)

3 204/ 163 1.07 (0.79-1.45)

C/T or T/T 1 12/ 12 0.82 (0.36-1.87)

2 25/ 11 1.93 (0.92-4.05)

3 32/ 13 2.04 (1.03-4.04)

Dx 1982-1993: CC 1 135/ 162 1.00 (ref.) 0.27

2 144/ 166 1.23 (0.87-1.73)

3 140/ 163 1.31 (0.92-1.85)

C/T or T/T 1 9/ 12 0.98 (0.38-2.55)

2 14/ 11 1.63 (0.70-3.83)

3 23/ 13 2.49 (1.16-5.32)

Dx 1994-2007: CC 1 62/ 162 1.00 (ref) 0.57

2 59/ 166 0.56 (0.34-0.93)

3 64/ 163 0.69 (0.42-1.14)

C/T or T/T 1 3/ 12 0.39 (0.09-1.65)

2 11/ 11 2.68 (0.96-7.52)

3 9/ 13 0.92 (0.31-2.75)

24

Table 6. NKX3.1 Genotype and Serum IGF-I Levels in Risk Factors for Prostate Cancer Study Participants

Genotype IGF-I (teriles) Case/

Control Odds ratio* p-interaction Overall: CC T1 216/161 1.00 ( ref) 0.18

T2 200/153 0.97 (0.72 - 1.33)

T3 303/154 1.39 (1.04 - 1.87)

C/T or T/T T1 25/22 0.76 (0.40 - 1.44)

T2 30/17 1.39 (0.72 - 2.69)

T3 24/20 0.86 (0.44 - 1.64)

25

Figure Legends Figure 1. T he effect of N KX3.1 va riant pr oteins on IGFBP-3 expression i n P C-3 cel l

clones. A and B. RT-PCR analysis of 250ng total mRNA isolated from PC-3 cel l clones.

A172 is a positive control for IGFBP-3 mRNA expression and LNCaP is a positive control

for NKX3.1 mRNA expression. C. Western b lot analysis of 60g whole cell l ysate f rom

PC-3(pcDNA3.1), P C-3(NKX3.1), P C-3(NKX3.1 R 52C), a nd P C-3(NKX3.1 S 48A) c ell

clones. A172 cell line was used as a positive control for IGFBP-3 protein expression.

Figure 2. T he e ffect of N KX3.1 va riant pr oteins on I GF-IR a ctivation in P C-3 cel ls. A .

Western bl ot a nalysis of 90g of t otal pr otein e xtracted f rom P C-3(pcDNA3.1) a nd P C-

3(NKX3.1)(R52C) stable cell clones that were serum starved for 16 hours and treated with

100pM IGF-I. The values in the graph are the means from three separate experiments. A

representative western blot is shown in the inset. B. Western blot analysis of 90g of total

protein extracted from PC-3(pcDNA3.1) and PC-3(NKX3.1)(S48A) stable cell clones that

were serum starved for 16 hours and treated with 100pM IGF-I. T he values in the graph

are the means from three separate experiments. A representative western blot is shown in

the i nset. C . W estern bl ot a nalysis of 90 g o f to tal p rotein e xtracted f rom P C-

3(pcDNA3.1), P C-3(NKX3.1)-1, P C-3(NKX3.1)(R52C)-1, a nd P C-3(NKX3.1)(S48A)-28

clones that were serum starved for 16 hours and treated with 100pM IGF-I. The values in

the graph are the means from three separate experiments. A representative western blot is

shown in the inset. * i ndicates a value different from the PC-3(pcDNA3.1) control with a

p<0.001.

Supplementary Figure 1. Expression of NKX3.1 in derivative PC-3 cell clones. Panels from

western blots of -actin and NKX3.1 are shown from exponentially growing cultured cells

from w hich e qual a mounts of t otal pr otein w ere l oaded ont o a g el. N umbers i ndicate

26

identities of i ndividual independently d erived c lones. A c ell e xtract f rom P C-3 cel ls

transfected with the empty vector is shown at the far left as a negative control.

27

Supplementary Table 1 : Serum IGF-I Levels and Prostate Cancer Risk in Risk

Factors for Prostate Cancer Study Participants

Log (IGF-I) (Quantiles) Case/Controls OR (95% CI) P-value2 P-het3

1st quantile 173/130 0.04

2nd quantile 171/134 1.01 (0.72 to 1.41) 0.963

3rd quantile 176/123 1.10 (0.78 to 1.54) 0.590

4th quantile 278/140 1.48 (1.07 to 2.03) 0.016

Log (IGF-I) (Tertiles) Case/Controls OR (95% CI) P-value2 P-het3

1st Tertile 241/183 0.05

2nd Tertile 230/170 1.05 (0.78 to 1.40) 0.76

3rd Tertile 327/174 1.37 (1.04 to 1.81) 0.025

Log (IGF-I) (Median) Case/Controls OR (95% CI) P-value2 P-het3

< Median 344/264 0.03

≥ Median 454/263 1.30 (1.03 to 1.63) 0.028

28

Reference List

(1) Swalwell JI, Vocke CD, Yang Y, Walker JR, Grouse L, Myers SH, et al. Determination of a minimal deletion interval on chromosome band 8p21 in sporadic prostate cancer. Genes Chromosomes Cancer 2002;33:201-5.

(2) Lapointe J, Li C, Giacomini CP, Salari K, Huang S, Wang P, et al. Genomic profiling reveals alternative genetic pathways of prostate tumorigenesis. Cancer Res 2007;67:8504-10.

(3) Bowen C, Bubendorf L, Voeller HJ, Slack R, Willi N, Sauter G, et al. Loss of NKX3.1 expression in human prostate cancers correlates with tumor progression. Cancer Res 2000;60:6111-5.

(4) Asatiani E, Huang WX, Wang A, Rodriguez OE, Cavalli LR, Haddad BR, et al. Deletion, methylation, and expression of the NKX3.1 suppressor gene in primary human prostate cancer. Cancer Res 2005;65:1164-73.

(5) Bhatia-Gaur R, Donjacour AA, Sciavolino PJ, Kim M, Desai N, Norton CR, et al. Roles for Nkx3.1 in prostate development and cancer. Genes and Development 1999;13:966-77.

(6) Kim MJ, Cardiff RD, Desai N, Banach-Petrosky WA, Parsons R, Shen MM, et al. Cooperativity of Nkx3.1 and Pten loss of function in a mouse model of prostate carcinogenesis. Proc Natl Acad Sci U S A 2002;99:2884-9.

(7) Bethel CR, Faith D, Li X, Guan B, Hicks JL, Lan F, et al. Decreased NKX3.1 protein expression in focal prostatic atrophy, prostatic intraepithelial neoplasia, and adenocarcinoma: association with gleason score and chromosome 8p deletion. Cancer Res 2006;66:10683-90.

(8) Markowski MC, Bowen C, Gelmann EP. Inflammatory cytokines induce phosphorylation and ubiquitination of prostate suppressor protein NKX3.1. Cancer Res 2008;68:6896-901.

(9) Voeller HJ, Augustus M, Madlike V, Bova GS, Carter KC, Gelmann EP. Coding region of NKX3.1, prostate-specific homeobox gene on 8p21, is not mutated in human prostate cancers. Cancer Res 1997;57:4455-9.

(10) Ornstein DK, Cinquanta M, Weiler S, Duray PH, Emmert-Buck MR, Vocke CD, et al. Expression studies and mutational analysis of the androgen regulated homeobox gene nkx3.1 in benign and malignant prostate epithelium. J Urol 2001;165:1329-34.

(11) Zheng SL, Ju JH, Chang BL, Ortner E, Sun J, Isaacs SD, et al. Germ-Line Mutation of NKX3.1 Cosegregates with Hereditary Prostate Cancer and Alters the Homeodomain Structure and Function. Cancer Res 2006;66:69-77.

(12) Gelmann EP, Steadman DJ, Ma J, Ahronovitz N, Voeller HJ, Swope S, et al. Occurrence of NKX3.1 C154T Polymorphism in Men with and without Prostate Cancer and Studies of Its Effect on Protein Function. Cancer Res 2002;62:2654-9.

(13) Rodriguez-Ortner E, Hayes RB, Weissfeld J, Gelmann EP. Effect of homeodomain protein NKX3.1 R52C polymorphism on prostate gland size. Urology 2006;67:311-5.

(14) Khandwala HM, McCutcheon IE, Flyvbjerg A, Friend KE. The effects of insulin-like growth factors on tumorigenesis and neoplastic growth. Endocr Rev 2000;21:215-44.

(15) Jones JI, Clemmons DR. Insulin-like growth factors and their binding proteins: biological actions. Endocr Rev 1995;16:3-34.

(16) Pollak MN, Schernhammer ES, Hankinson SE. Insulin-like growth factors and neoplasia. Nat Rev Cancer 2004;4:505-18.

29

(17) Rajaram S, Baylink DJ, Mohan S. Insulin-like growth factor-binding proteins in serum and other biological fluids: regulation and functions. Endocr Rev 1997;18:801-31.

(18) Harman SM, Metter EJ, Blackman MR, Landis PK, Carter HB. Serum levels of insulin-like growth factor I (IGF-I), IGF-II, IGF-binding protein-3, and prostate-specific antigen as predictors of clinical prostate cancer. J Clin Endocrinol Metab 2000;85:4258-65.

(19) Chan JM, Stampfer MJ, Ma J, Gann P, Gaziano JM, Pollak M, et al. Insulin-like growth factor-I (IGF-I) and IGF binding protein-3 as predictors of advanced-stage prostate cancer. J Natl Cancer Inst 2002;94:1099-106.

(20) Chokkalingam AP, Pollak M, Fillmore CM, Gao YT, Stanczyk FZ, Deng J, et al. Insulin-like growth factors and prostate cancer: a population-based case-control study in China. Cancer Epidemiol Biomarkers Prev 2001;10:421-7.

(21) Oliver SE, Gunnell D, Donovan J, Peters TJ, Persad R, Gillatt D, et al. Screen-detected prostate cancer and the insulin-like growth factor axis: results of a population-based case-control study. Int J Cancer 2004;108:887-92.

(22) Platz EA, Pollak MN, Leitzmann MF, Stampfer MJ, Willett WC, Giovannucci E. Plasma insulin-like growth factor-1 and binding protein-3 and subsequent risk of prostate cancer in the PSA era. Cancer Causes Control 2005;16:255-62.

(23) Stattin P, Bylund A, Rinaldi S, Biessy C, Dechaud H, Stenman UH, et al. Plasma insulin-like growth factor-I, insulin-like growth factor-binding proteins, and prostate cancer risk: a prospective study. J Natl Cancer Inst 2000;92:1910-7.

(24) Stattin P, Rinaldi S, Biessy C, Stenman UH, Hallmans G, Kaaks R. High levels of circulating insulin-like growth factor-I increase prostate cancer risk: a prospective study in a population-based nonscreened cohort. J Clin Oncol 2004;22:3104-12.

(25) Li L, Yu H, Schumacher F, Casey G, Witte JS. Relation of serum insulin-like growth factor-I (IGF-I) and IGF binding protein-3 to risk of prostate cancer (United States). Cancer Causes Control 2003;14:721-6.

(26) Wolk A, Mantzoros CS, Andersson SO, Bergstrom R, Signorello LB, Lagiou P, et al. Insulin-like growth factor 1 and prostate cancer risk: a population-based, case-control study. J Natl Cancer Inst 1998;90:911-5.

(27) Shi R, Berkel HJ, Yu H. Insulin-like growth factor-I and prostate cancer: a meta-analysis. Br J Cancer 2001;85:991-6.

(28) Renehan AG, Zwahlen M, Minder C, O'dwyer ST, Shalet SM, Egger M. Insulin-like growth factor (IGF)-I, IGF binding protein-3, and cancer risk: systematic review and meta-regression analysis. Lancet 2004;363:1346-53.

(29) Iwamura M, Sluss PM, Casamento JB, Cockett AT. Insulin-like growth factor I: action and receptor characterization in human prostate cancer cell lines. Prostate 1993;22:243-52.

(30) Angelloz-Nicoud P, Binoux M. Autocrine regulation of cell proliferation by the insulin-like growth factor (IGF) and IGF binding protein-3 protease system in a human prostate carcinoma cell line (PC-3). Endocrinology 1995;136:5485-92.

(31) Burfeind P, Chernicky CL, Rininsland F, Ilan J, Ilan J. Antisense RNA to the type I insulin-like growth factor receptor suppresses tumor growth and prevents invasion by rat prostate cancer cells in vivo. Proc Natl Acad Sci U S A 1996;93:7263-8.

(32) Ngo TH, Barnard RJ, Leung PS, Cohen P, Aronson WJ. Insulin-Like Growth Factor I (IGF-I) and IGF Binding Protein-1 Modulate Prostate Cancer Cell Growth and Apoptosis: Possible Mediators for the Effects of Diet and Exercise on Cancer Cell Survival. Endocrinology 2003;144:2319-24.

30

(33) Steadman DJ, Giuffrida D, Gelmann EP. DNA-binding sequence of the human prostate-specific homeodomain protein NKX3.1. Nucleic Acids Res 2000;28:2389-95.

(34) Chan JM, Stampfer MJ, Giovannucci E, Gann PH, Ma J, Wilkinson P, et al. Plasma insulin-like growth factor-I and prostate cancer risk: a prospective study. Science 1998;279:563-6.

(35) Muhlbradt E, Asatiani E, Ortner E, Wang A, Gelmann EP. NKX3.1 activates expression of insulin-like growth factor binding protein-3 to mediate insulin-like growth factor-I signaling and cell proliferation. Cancer Res 2009;69:2615-22.

(36) Abdulkadir SA, Magee JA, Peters TJ, Kaleem Z, Naughton CK, Humphrey PA, et al. Conditional loss of Nkx3.1 in adult mice induces prostatic intraepithelial neoplasia. Mol Cell Biol 2002;22:1495-503.

(37) Rhodes DR, Barrette TR, Rubin MA, Ghosh D, Chinnaiyan AM. Meta-analysis of microarrays: interstudy validation of gene expression profiles reveals pathway dysregulation in prostate cancer. Cancer Res 2002;62:4427-33.

(38) Carson JA, Fillmore RA, Schwartz RJ, Zimmer WE. The Smooth Muscle gamma -Actin Gene Promoter Is a Molecular Target for the Mouse bagpipe Homologue, mNkx3-1, and Serum Response Factor. J Biol Chem 2000;275:39061-72.

(39) Miano JM. Serum response factor: toggling between disparate programs of gene expression. J Mol Cell Cardiol 2003;35:577-93.

(40) Ning Y, Schuller AG, Bradshaw S, Rotwein P, Ludwig T, Frystyk J, et al. Diminished growth and enhanced glucose metabolism in triple knockout mice containing mutations of insulin-like growth factor binding protein-3, -4, and -5. Mol Endocrinol 2006;20:2173-86.

(41) Wood TL, Rogler LE, Czick ME, Schuller AGP, Pintar JE. Selective Alterations in Organ Sizes in Mice with a Targeted Disruption of the Insulin-Like Growth Factor Binding Protein-2 Gene. Mol Endocrinol 2000;14:1472-82.

(42) Draisma G, Etzioni R, Tsodikov A, Mariotto A, Wever E, Gulati R, et al. Lead time and overdiagnosis in prostate-specific antigen screening: importance of methods and context. J Natl Cancer Inst 2009;101:374-83.

(43) Richiardi L, Fiano V, Vizzini L, De ML, Delsedime L, Akre O, et al. Promoter Methylation in APC, RUNX3, and GSTP1 and Mortality in Prostate Cancer Patients. J Clin Oncol 2009.

(44) Giovannucci E, Liu Y, Platz EA, Stampfer MJ, Willett WC. Risk factors for prostate cancer incidence and progression in the health professionals follow-up study. Int J Cancer 2007;121:1571-8.

(45) Benson DW, Silberbach GM, Kavanaugh-McHugh A, Cottrill C, Zhang Y, Riggs S, et al. Mutations in the cardiac transcription factor NKX2.5 affect diverse cardiac developmental pathways. J Clin Invest 1999;104:1567-73.

(46) Kasahara H, Lee B, Schott JJ, Benson DW, Seidman JG, Seidman CE, et al. Loss of function and inhibitory effects of human CSX/NKX2.5 homeoprotein mutations associated with congenital heart disease. J Clin Invest 2000;106:299-308.

(47) Iwatani N, Mabe H, Devriendt K, Kodama M, Miike T. Deletion of NKX2.1 gene encoding thyroid transcription factor-1 in two siblings with hypothyroidism and respiratory failure. J Pediatr 2000;137:272-6.

(48) Weir BA, Woo MS, Getz G, Perner S, Ding L, Beroukhim R, et al. Characterizing the cancer genome in lung adenocarcinoma. Nature 2007;450:893-8.

(49) Magee JA, Abdulkadir SA, Milbrandt J. Haploinsufficiency at the Nkx3.1 locus. A paradigm for stochastic, dosage-sensitive gene regulation during tumor initiation. Cancer Cell 2003;3:273-83.

31

(50) Song H, Zhang B, Watson MA, Humphrey PA, Lim H, Milbrandt J. Loss of Nkx3.1 leads to the activation of discrete downstream target genes during prostate tumorigenesis. Oncogene 2009;28:3307-19.

32

β-actin

NKX3.1

IGFBP-3

HO 2

A17

2

LNC

aP

PC

-3

PC

-3(p

cDN

A3.

1)

PC

-3(N

KX

3.1)

PC-3(NKX3.1) (R52C)

1 26 27

β-actin

NKX3.1

IGFBP-3

HO 2

A17

2

LNC

aP

PC-3

PC-3

(pcD

NA

3.1)

PC-3

(NK

X3.

1)

PC-3(NKX3.1) (S48A)

25 27 28

A

B

C

β-actin

NKX3.1

IGFBP-3

A17

2

PC

-3(p

cDN

A3.

1)

PC

-3(N

KX

3.1)

PC-3(NKX3.1)

1 26 27(S48A) (R52C)

25 27 2850kDa-

Muhlbradt et alFig 1

33

0

0.5

1.0

1.5

2.0

2.5

phos

phoI

GF-

IR Y

1131

:

T

otal

IG

F-IR

β

β-actin

NKX3.1

pIGF-IR Y1131

IGF-IRβ

Supplemented media

-+

-

--

-

-+

-

--

-

-+

-

--

-

++

+

++

+

++

+Serum-free

IGF-I (100pM)

phos

phoI

GF-

IR Y

1131

:

T

otal

IG

F-IR

β

Supplemented media

-+

-

--

-

-+

-

--

-

-+

-

--

-

++

+

++

+

++

+Serum-free

IGF-I (100pM)

β-actin

NKX3.1

pIGF-IR Y1131

IGF-IRβ

*

phos

phoI

RS-

1 Y

612:

Tota

l IR

S-1

+-

-+

+-

-+

+-

-+

++ -

-Serum-free

IGF-I (100pM)

β-actin

NKX3.1

IRS-1

pIRS-1 Y612

A

B

C

Muhlbradt et alFig 2

34

β-actin

NKX3.1

PC

-3(p

cDN

A3.

1)

PC-3(NKX3.1)

PC-3(NKX3.1)

11 262 278(S48A) (R52C)

25 27 28

Muhlbradt et alSupplementary Fig 1