10.1128/AEM.69.12.7009-7018.2003.

2003, 69(12):7009. DOI:Appl. Environ. Microbiol. Clare Bird and Michael Wyman Expression

Geneof Nitrogen Source and Availability on sp. Strain WH 8103: EffectSynechococcus

Marine Picoplanktonic Cyanobacterium Nitrate/Nitrite Assimilation System of the

http://aem.asm.org/content/69/12/7009Updated information and services can be found at:

These include:

REFERENCEShttp://aem.asm.org/content/69/12/7009#ref-list-1at:

This article cites 30 articles, 16 of which can be accessed free

CONTENT ALERTS more»articles cite this article),

Receive: RSS Feeds, eTOCs, free email alerts (when new

http://journals.asm.org/site/misc/reprints.xhtmlInformation about commercial reprint orders: http://journals.asm.org/site/subscriptions/To subscribe to to another ASM Journal go to:

on January 11, 2014 by guesthttp://aem

.asm.org/

Dow

nloaded from

on January 11, 2014 by guesthttp://aem

.asm.org/

Dow

nloaded from

APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Dec. 2003, p. 7009–7018 Vol. 69, No. 120099-2240/03/$08.00�0 DOI: 10.1128/AEM.69.12.7009–7018.2003Copyright © 2003, American Society for Microbiology. All Rights Reserved.

Nitrate/Nitrite Assimilation System of the Marine PicoplanktonicCyanobacterium Synechococcus sp. Strain WH 8103: Effect of

Nitrogen Source and Availability on Gene ExpressionClare Bird and Michael Wyman*

School of Biological and Environmental Sciences, University of Stirling, Stirling FK9 4LA, United Kingdom

Received 30 June 2003/Accepted 11 September 2003

The genes encoding the structural components of the nitrate/nitrite assimilation system of the oceaniccyanobacterium Synechococcus sp. strain WH 8103 were cloned and characterized. The genes encoding nitratereductase (narB) and nitrite reductase (nirA) are clustered on the chromosome but are organized in separatetranscriptional units. Upstream of narB is a homologue of nrtP that encodes a nitrate/nitrite-bispecificpermease rather than the components of an ABC-type nitrate transporter found in freshwater cyanobacteria.Unusually, neither nirA nor ntcA (encoding a positive transcription factor of genes subject to nitrogen control)were found to be tightly regulated by ammonium. Furthermore, transcription of glnA (encoding glutaminesynthetase) is up-regulated in ammonium-grown cells, highlighting significant differences in nitrogen controlin this cyanobacterium. Nitrogen depletion led to the transient up-regulation of ntcA, nirA, nrtP, narB, and glnAin what appears to be an NtcA-dependent manner. The NtcA-like promoters found upstream of nirA, nrtP, andnarB all differ in sequence from the canonical NtcA promoter established for other cyanobacteria, and in thecase of nirA, the NtcA-like promoter was functional only in cells deprived of combined nitrogen. The ecologicalimplications of these findings are discussed in the context of the oligotrophic nature of oceanic surface watersin which Synechococcus spp. thrive.

Cyanobacteria of the genera Synechococcus and Prochloro-coccus dominate the photosynthetic picoplanktonic biomassover vast tracts of the world’s oceans (21, 27). Collectively, theyaccount for a considerable fraction of marine primary produc-tion and are key players in the global carbon cycle. While theyare often found as mixed populations, Prochlorococcus spp. areconsiderably more abundant than Synechococcus spp. in thehighly stratified surface waters of the tropics and subtropics.Synechococcus spp., by contrast, are much more numerous inless oligotrophic waters and have a broader ecological rangethat extends to temperate and subpolar latitudes (20). Notleast among the ecophysiological factors that may account forthe differential oceanic distribution of these marine cyanobac-teria are biogeochemically significant differences in their ca-pacity to assimilate oxidized forms of combined nitrogen (18,20).

The overwhelming majority of Synechococcus spp. can uti-lize both nitrate and nitrite as sole N sources, whereas mostProchlorococcus strains cannot grow on either (18). Exceptionsin the former case are three recent isolates from the Red Seathat cannot utilize nitrate (6) and Synechococcus sp. strain MITS9220, which can utilize nitrite only. This phenotype is alsodisplayed by several low-light-adapted Prochlorococcusecotypes but not by others or by any high-light-adapted strainsexamined to date. Only one Prochlorococcus isolate (PAC 1)examined to date appears to have the capacity to grow onnitrate (18). Given their differential distribution, this suggeststhat Prochlorococcus spp. are likely to be more efficient scav-

engers of ammonium and, perhaps, of other reduced forms ofnitrogen (32) in the warm, nutrient-poor surface waters inwhich they dominate. By contrast, Synechococcus spp. seem togain a greater foothold in somewhat less stable water columnswhere nitrate or nitrite concentrations are sufficient to meet orat least augment their N requirements. It is probable, there-fore, that only Synechococcus spp. are likely to incorporateappreciable new nitrogen (nitrate N as opposed to remineral-ized forms of N such as ammonium and urea) into the oceanicfood web.

Ammonium concentrations in oceanic surface waters dom-inated by Synechococcus spp. are frequently in the submicro-molar range. Under these nutrient-depleted conditions, largereukaryotic phytoplankton are capable of utilizing nitrate nitro-gen in addition to ammonium (7). Whether this is true of openocean cyanobacteria has not been investigated; although atnanomolar concentrations, the picoplankton size class shows aclear preference for ammonium (10). This is not unexpected,perhaps, since in such highly oligotrophic waters nitrogen up-take is likely to be dominated by the more abundant Prochlo-rococcus spp. rather than by Synechococcus spp. Whether ni-trate/nitrite uptake by Synechococcus spp. is inhibited at low orvery low concentrations of ammonium remains uncertain, al-though there is some field evidence to suggest that it is not (9).At much higher concentrations, however, ammonium does in-hibit nitrate and nitrite uptake in the marine Synechococcus sp.strain WH 7803 (9, 14), presumably by repressing the genesinvolved in nitrite (and nitrate) assimilation.

Ammonium control of the genes involved in nitrate/nitriteassimilation in freshwater cyanobacteria has been studied ex-tensively and involves the regulatory transcription factor NtcA(11). In Synechococcus sp. strain PCC 7942, ntcA is up-regu-lated in the absence of external ammonium and activates ex-

* Corresponding author. Mailing address: School of Biological andEnvironmental Sciences, University of Stirling, Stirling FK9 4LA,United Kingdom. Phone: 44 01786 467784. Fax: 44 01786 464994.E-mail: mw4@stir.ac.uk.

7009

on January 11, 2014 by guesthttp://aem

.asm.org/

Dow

nloaded from

pression of the nirA operon that includes the genes encodingnitrite reductase (NiR; nirA), a nitrate/nitrite ABC-type trans-porter, and nitrate reductase (NR; narB). By contrast, whileboth nirA and narB are repressed by ammonium in Synecho-cystis sp. strain PCC 6803, the abundance of ntcA mRNA issimilar in nitrate- and ammonium-grown cells (2). Full expres-sion of nirA and narB is dependent on the enhancer NtcB,although ntcB mutants retain the capacity to grow on nitrate,albeit at substantially reduced rates compared to the wild type(1). NtcB is also implicated in enhancing expression of the nirAoperon in Synechococcus sp. strain PCC 7942 (11), but unlikeSynechocystis sp. strain PCC 6803 (1), positive regulation isabsolutely dependent on the presence of nitrite supplied exog-enously or generated endogenously via the reduction of ni-trate.

Nitrogen assimilation in cyanobacteria occurs mainly via theglutamine synthetase (GS)/glutamate synthase pathway (11).The glnA gene (encoding GS) is ammonium repressible inSynechococcus sp. strain PCC 7942 and is up-regulated approx-imately sixfold in nitrate-grown cells (14). Ammonium has aless dramatic negative effect on glnA expression in Synechocys-tis sp. strain PCC 6803 (23), although like Synechococccus sp.strain PCC 7942, transcription is NtcA-regulated. Both ofthese nondiazotrophic cyanobacteria contain a second GS (en-coded by glnN) that is specifically induced under nitrogen de-privation (23). In both cases, however, the NtcA-like promot-ers found upstream of glnN differ from the canonical GTAN8

TAC-N22-TAN3T binding sequence found for other NtcA-activated genes (11).

The effect of N source and availability on expression ofthe nitrate/nitrite assimilation machinery of marine Syn-echococcus spp. has not been investigated in as much detailas that of freshwater cyanobacteria. However, ammoniumcontrol of ntcA expression in Synechococcus sp. strain WH7803 is similar to freshwater Synechococcus spp. in thatammonium represses transcription substantially (13). Ni-trate uptake is negligible in ammonium-grown cultures ofthis strain but is rapidly induced as ammonium is exhaustedfrom the growth medium (8).

In the present study, we investigated the effect of nitrogensource and availability on the expression of genes involved innitrogen assimilation in Synechococcus sp. strain WH 8103.Unlike strain WH 7803, which has a biliprotein complementthat is characteristic of Synechococcus spp. found in shelf wa-ters, strain WH 8103 is representative of open ocean strains. Itis motile, produces phycoerythrins with high ratios of urobilinto erythrobilin chromophores, and is able to utilize urea as anitrogen source (19, 21). Our results show that there are po-tentially ecologically important differences in N regulation inthis marine cyanobacterium in comparison to freshwaterstrains and, in the case of ntcA at least, Synechococcus sp. strainWH 7803. These differences may reflect adaptations to life ina low-nutrient environment in which N concentrations arerarely, if ever, in great excess of demand.

MATERIALS AND METHODS

Culture conditions. Stock cultures of Synechococcus sp. strain WH 8103 wereincubated at 25°C under constant irradiance (20 �mol of photons m�2 s�1) inASW medium (31). Experimental cultures were grown in modified ASW me-dium containing either 0.5 mM NaNO3 or 2 mM NH4Cl under the same condi-tions. In experiments in which NaNO2 (0.9 mM) was also supplied as the sole Nsource, cultures were incubated at a higher irradiance (60 �mol of photons m�2

s�1). Experimental cultures were maintained in the logarithmic phase of growthby regular dilution with fresh medium. For studies of the effect of nitrogendeprivation, cells from nitrate-grown cultures were collected by gentle filtrationonto 90-mm-diameter, 0.6-�m-pore-size polycarbonate filters (Osmonics) andwashed with several volumes of N-free ASW medium. The washed cells wereresuspended to the original culture density in fresh N-free ASW medium andincubated under the same experimental conditions (continuous irradiance of 20�mol of photons m�2 s�1; 25°C) for up to 24 h.

Isolation of genomic DNA. Cell material from mid-logarithmic-phase cultureswas harvested by centrifugation at 2,500 � g for 15 min at 4°C. Genomic DNAwas extracted from the resulting cell pellet by a modified cetyltrimethylammo-nium bromide extraction procedure and further purified by cesium chloridedensity gradient centrifugation (3).

Amplification of narB, nirA, and ntcA gene fragments by PCR. An �390-bpinternal fragment of narB was amplified from genomic DNA with fully degen-erate oligonucleotide primers (Table 1) targeting the conserved motifsTGQPNAM and MTNSER found in all cyanobacterial NarB peptide sequencesentered in the GenBank database at the start of this study. The reaction condi-tions were as follows: 10 ng of template DNA, 12 pmol of each primer, 1 mMconcentrations of each deoxynucleotide triphosphate, and 1 U of AmpliTaq

TABLE 1. Oligonucleotide primers designed and used in this study

Primer Size ofproduct (bp) Primer use(s) Sequence (5�–3�) Temp (°C)

narF 400 Isolation of narB fragment ACNGGYCARCCYAAYGCNATGnarR Isolation of narB fragment CKHCKYTCNSWRTTNGTCATntcAFor 462 Isolation of ntcA fragment, RT-PCR GAACGCAACAAGACGATTTTCTT 57.10ntcARev Isolation of ntcA fragment, RT-PCR GCTTCGGCAATGGCTTGATG 59.40glnAFor 405 RT-PCR CACCGGTGAACCTCGTCTAT 59.99glnARev RT-PCR TCGATCCAGTTGTCGATGAA 60.20narBFor 352 RT-PCR GTTGGGTTACACCGAGCAGT 60.04narBRev RT-PCR AGCACCAATGGGTAGGTGTC 59.85nirAFor 288 RT-PCR TCGAAAACTCTCCACGCTCT 60.13nirARev RT-PCR GGGAAACGCTGCAATAATGT 59.97nrtPFor 244 RT-PCR CCTGACCTTTGTGGTCTGGT 60.00nrtPRev RT-PCR GAACACCAGGATCGACGAGT 60.12rbcLFor 193 RT-PCR CACCGACCTCGACTTCTACA 58.88rbcLRev RT-PCR TGCGAGTTGATGTTCTCGTC 59.99nrtPtsp NAa Primer extension GTGAGGTGAAGGGTTCGGTA 59.40nirAext NA Primer extension CCCGGGGACCTTTGTCGCTA 63.50narBtsp NA Primer extension TCACGGCTTGACCTTTCAC 56.70

a NA, not applicable.

7010 BIRD AND WYMAN APPL. ENVIRON. MICROBIOL.

on January 11, 2014 by guesthttp://aem

.asm.org/

Dow

nloaded from

DNA polymerase taken up in 50 �l of amplification buffer containing 1.5 mMMg2� (Perkin-Elmer). After denaturation at 95°C for 2 min, template DNA wasamplified for 25 cycles (94°C for 1 min; 53°C for 1 min; 72°C for 1 min) followedby a final extension at 72°C for 10 min. PCR products were resolved on a 1.0%low-melting-point agarose gel, and fragments of the expected size were ligatedinto the T-tailed vector pCR2.1 and cloned in the Escherichia coli host strainINV�-F� supplied with the vector (Invitrogen). Recombinant clones were grownovernight in Luria-Bertani broth plus 100 �g of ampicillin ml�1, plasmid DNAwas purified with a commercial kit (Qiagen). The identity of the cloned fragmentwas verified by manual sequencing of both strands and by interrogating theGenBank database by using BlastP (National Center for Biotechnology Infor-mation [NCBI]) with the derived peptide sequence.

A fragment of the coding sequence of nirA was obtained by serendipity duringthe course of an earlier investigation (J. T. Davies and M. Wyman, unpublisheddata). Genomic DNA was amplified with fully degenerate primers designed totarget a 500-bp internal region of icfA (encoding carbonic anhydrase). PCRproducts of the expected size were isolated from a low-melting-point agarose geland ligated into pCR2.1 as described for narB, and several of the resulting cloneswere sequenced. An NCBI BlastX search of the GenBank database revealed thatthe translated sequence of one of these clones (designated pCA500) sharedsignificant similarity to the N terminus region of NirA from several other cya-nobacteria.

Primers ntcAFOR and ntcAREV were designed for the amplification of ntcAfrom Synechococcus sp. strain WH 8103 (Table 1) and correspond to amino acids43 to 50 and 190 to 196 of NtcA in Synechococcus sp. strain WH 8102. At anannealing temperature of 55°C, the primers amplified a single fragment of theexpected size of approximately 460 bp. This product was cloned in pCR2.1TOPO, transformed into competent E. coli TOP10F� cells (Invitrogen), andsequenced on both strands as described above to confirm its identity. This primerpair was further used for reverse transcription (RT)-PCR.

Isolation and characterization of narB and nirA. The cloned narB and nirAfragments were labeled with digoxigenin-dUTP (Roche) by PCR with either theoriginal gene-specific primers (narB) or a primer pair targeting pCR2.1 vectorsequences flanking the insert DNA (nirA). Probe DNA was run out in low-melting-point agarose gels to remove unincorporated nucleotides and recoveredwith a commercial kit (Hybaid) prior to use in Southern hybridizations.

Single- and double-restriction digests of genomic DNA were resolved in ana-lytical agarose gels and Southern blotted to nylon membranes (Roche). The blotswere hybridized overnight at 68°C with each of the labeled probes and subse-quently washed at high stringency in 0.1� SSC (1� SSC is 0.15 M NaCl plus 15mM sodium citrate, pH 7.5) and 0.1% sodium dodecyl sulfate (SDS) at 68°C for30 min two times. Hybrids were detected with alkaline phosphatase-conjugatedanti-digoxigenin in conjunction with the chemiluminescent substrate CDP-Staras recommended by the supplier (Roche). The resulting luminograms revealedthat the narB probe hybridized to a 9.4-kb HindIII-SalI fragment, whereas nirAwas localized to a 4.5-kb HindIII-SmaI fragment. Subgenomic libraries wereconstructed in pUC18 following digestion of genomic and vector DNA with eachrestriction enzyme pair, and the ligated fragments were transformed into com-petent cells of E. coli strain XL1-Blue.

The libraries were screened by colony hybridization with the hybridization andstringency wash conditions described above. Plasmid DNA was isolated fromovernight cultures of positively hybridizing clones and restriction mapped priorto the construction of a series of subclones for sequencing. Automated sequenc-ing was performed on an ABI prism 377 DNA sequencer with the Perkin-ElmerBig Dye PCR sequencing kit.

Experimental conditions and isolation of RNA. Cell material was pelleted bycentrifugation at 2,500 � g for 5 min at 4°C. Total RNA was isolated by a hotphenol extraction protocol and treated with DNase as described previously (29).For the preparation of RNA for RT-PCR, an equivalent concentration (1%wt/vol) of lithium dodecyl sulfate was included in the extraction buffer in pref-erence to SDS. Following purification, RNA was dissolved in deionized watertreated with diethyl pyrocarbonate and taken up in an equal volume of 4 M NaCl.RNA was precipitated overnight at 4°C and recovered the following day bycentrifugation at 12,000 � g for 20 min.

The integrity of all RNA preparations was verified by electrophoresis throughRNase-free nondenaturing gels stained with ethidium bromide. Total RNA con-centrations were estimated spectrophotometrically and by densitometry by usingthe 16S rRNA band as an internal standard following electrophoresis. Prior toexperimentation, RNA concentrations were normalized by adjusting the volumeof RNA added to the RT-PCR mixture after quantitative Northern analysis of adilution series of each RNA preparation with a digoxigenin-dUTP-labeled frag-ment of the 16S rRNA gene amplified from Synechococcus sp. strain WH 78703as described previously (30).

Preparation of probe DNA and analysis of gene expression by Northernblotting. Digoxigenin-labeled probe DNA was prepared by the PCR with acommercial kit (Roche), M13 primers, and the following templates: pCA500(nirA), pNar1.1 (narB), pNB4.21 (nrtP), pNtc1.1 (ntcA), pGlnA1.1 (glnA), andpRBGL1.3 (rbcL). The plasmids pCA500 and pNar1.1 respectively harbor thenirA and narB PCR products isolated in this study. pNB4.21 harbors a HindII-XhoI fragment that includes the 5� end of nrtP, whereas pNtc1.1 harbors the ntcAPCR product. The clones pGlnA1.1 and pRBGL1.1 contain gene internal frag-ments of Synechococcus sp. strain WH 8103 glnA and rbcL, respectively, and havebeen described previously (30).

For Northern blots, 10-�g aliquots of RNA were fractionated through 1.2%agarose gels containing 0.22 M formaldehyde and 0.1 ng of ethidium bromideml�1 and buffered with 20 mM morpholinepropanesulfonic acid (MOPS), 5 mMsodium acetate, and 1 mM EDTA. Prior to electrophoresis, RNA was denaturedat 68°C for 3 to 5 min in 4� gel running buffer containing 9 mM formaldehyde,0.8 mM EDTA (pH 8.0), 30% formamide, and 20% glycerol. Gels were run inthe gel buffer solution containing 0.25 M formaldehyde, and after a 20-min washin 0.05 M NaOH, RNA was transferred to positively charged nylon membranes(Roche) in 10� SSC. Hybridization was carried out at 50°C in digoxigeninEasyHyb solution (Roche), and stringency washes were performed at 68°C in0.05� SSC–0.1% SDS. Hybrids were detected by immunochemistry (as describedabove) and quantified by densitometry following exposure to Kodak Biomax MRfilm as described previously (30).

Analysis of gene expression by RT-PCR. RT-PCR was performed with theQiagen OneStep RT-PCR kit and primer pairs designed to amplify internalfragments of ntcA, rbcL, glnA, narB, nirA, and nrtP (Table 1). The nucleotidesequences of rbcL and glnA used to design the primers for these genes have beenpublished previously (29) while those of the remaining genes were determinedduring this study. RT was carried out at 50°C for 30 min in a 50-�l reactionmixture containing 0.1 to 1 ng of RNA and 30 pmol of each primer. Equalquantities of RNA were used for each set of experiments. HotStar Taq DNApolymerase was activated by incubation at 95°C for 15 min, and cDNAs wereamplified for 25 to 36 cycles (94°C for 1 min; 55°C for 1 min; 72°C for 1 min)prior to a final extension at 72°C for 10 min. The resulting products were resolvedby electrophoresis through 2.5% agarose gels stained with ethidium bromide andquantified by using a gel documentation system (model GDS8000) and theGelWorks one-dimensional advanced software package (UVP). For each exper-iment, the exponential phase of the PCR was determined empirically by varyingthe amount of RNA added at the start of the reaction and the number ofamplification cycles. The linear response range of the charge-coupled devicecamera used to capture the RT-PCR gel images was established by loading atwofold dilution series of products on the gel and selecting the appropriateloadings for each set of samples.

Primer extension analysis. RNA was extracted from nitrate- and ammoni-um-grown cells and from N-deprived cells and further purified as describedabove. The reaction conditions were as follows: 1 ng of total RNA (denaturedat 65°C for 5 min immediately prior to addition); 2 �l of 10� Omniscript RTbuffer (Qiagen); 10 �M sequence-specific primer (Table 1) (nrtPtsp binds 30bp downstream of the nrtP start codon; nirAtsp binds 59 bp upstream of thenirA start codon); 0.5 mM (each) dGTP, dTTP, and dCTP; 4 �M dATP; 12.5�Ci of [�-32P]dATP; 10 U of RNasin (Promega); and 8 U of Omniscriptreverse transcriptase in a total volume of 20 �l. The reaction mix was incu-bated at 37°C for 2 h. Plasmids pNB4 (nrtP) and pSma3 (nirA) were used togenerate sequencing ladders to run alongside the primer extension products.DNA sequencing reactions were performed with the same specific primerswith the AmpliCycle sequencing kit (Applied Biosystems) and labeled with[�-32P]dATP according to the manufacturer’s recommendations. The exten-sion products were resolved on a 6% gel polymerized with Sequagel XRdiluted in Sequagel ultra pure complete buffer reagent (National Diagnos-tics).

Primer extension reactions were also performed as described by Ausubel et al.(3) with the primers described above and a narB-specific primer, narBtsp (Table1), which binds between positions 82 and 101 of the coding sequence. To ascer-tain whether nrtP and narB are coexpressed, an RT-PCR was carried out withprimers nrtPFor and narBtsp. RT-PCR was performed with RNA from nitrate-grown cells, a DNA-only control, and the reaction conditions described above.

Nucleotide sequence accession numbers. The nucleotide sequences of nrtP,narB, and nirA from Synechococcus sp. strain WH 8103 have been submittedto GenBank (accession numbers AY377536, AF127144, and AFO65403, re-spectively).

VOL. 69, 2003 NITROGEN REGULATION IN MARINE SYNECHOCOCCUS SPP. 7011

on January 11, 2014 by guesthttp://aem

.asm.org/

Dow

nloaded from

RESULTS

Characterization of the narB, nrtP, and nirA genes of Syn-echococcus sp. strain WH 8103. The narB coding region is 2,229bp in length and determines a polypeptide of 756 amino acidresidues with a predicted molecular mass of 85.9 kDa. Thededuced peptide sequence shares 55% identity with NarB fromAnabaena sp. strain PCC 7120 and contains the two conserveddomains that are characteristic of NRs. A molybdopterin oxi-doreductase domain is located between amino acids 6 and 593that shares 32.8% identity with the consensus sequence deter-mined in the NCBI conserved domain database (data notshown). The second conserved region is toward the C terminusof the protein and is 37.8% identical to the 111-residue con-sensus sequence of molybdopterin dinucleotide binding do-mains (Fig. 1).

Upstream of narB and in the same orientation is a 1,542-bpopen reading frame that encodes a protein with an estimatedmass of 55.2 kDa (Fig. 2) that shares 91 and 61% identity withnrtP from Synechococcus sp. strain WH 7803 (accession num-ber AAG45172) and Synechococcus sp. strain PCC 7002, re-spectively, and which encodes a nitrate/nitrite permease (24).In common with other NRT2-type nitrate-nitrite porters(NNP), the derived peptide sequence of the putative nrtP genefrom Synechococcus sp. strain WH 8103 has an N-terminaldomain that is virtually identical to the NNP consensus se-quence (Fig. 1).

The nirA coding region is 1,539 bp and determines apolypeptide of 513 amino acid residues with a calculated mo-lecular mass of 58.7 kDa. Surprisingly, the percent G�C con-tent of the nirA gene (42%) is substantially lower than that of

narB (64.4%), which more closely reflects the average percentG�C content (55 to 62%) of the MC-A group of marineSynechococcus spp. to which strain WH 8103 belongs (21). Thededuced NirA peptide sequence is 48% identical to that ofPlectonema boryanum and contains the two conserved domainsfound in both NiRs and sulfite reductases. A nitrite/sulfitereductase ferredoxin-like half domain between residues 60 to130 shares 52.8% identity with the consensus while the secondhalf domain between residues 312 to 377 is 40% identical (Fig.1). Close to the C terminus (residues 393 to 456), a conserveddomain found in all higher plant and cyanobacterial NiRs andsulfite reductases includes the four conserved cysteine residuesinvolved in binding the 4Fe-4S prosthetic group (Fig. 1).

Restriction mapping and Southern blotting indicated thatnarB and nirA are quite closely linked on the chromosome(data not shown). Both genes are associated with a numberof open reading frames whose gene products are predictedto be involved in molybdenum cofactor biosynthesis (Fig. 2).These include mobA and moaA, which are upstream of nrtPbut in the opposite orientation, and cysG, moaB, and moaDupstream of nirA, in which moaB and moaD appear to bedivergently transcribed. The overall gene arrangement issimilar to that found in the recently sequenced genome ofSynechococcus sp. strain WH 8102 (http://www.jgi.doe.gov/JGI_microbial/html/).

Identification of putative NtcA-regulated promoters andprimer extension analysis. A putative NtcA-regulated pro-moter was identified 131 bp upstream of the nrtP translationalstart site with the structure GTAGCAATTCCAAC-N22-TTAACT, which closely matches the GTANCARNWRNTAC-N22-

FIG. 1. Alignments of conserved domains found in NarB, NirA, and NrtP from Synechococcus sp. strain WH8103. Conserved residues arehighlighted in boldface type; those (cysteine) conserved residues that are involved in cofactor binding are underlined. X, any amino acid.

7012 BIRD AND WYMAN APPL. ENVIRON. MICROBIOL.

on January 11, 2014 by guesthttp://aem

.asm.org/

Dow

nloaded from

TAN3T consensus binding site established for NtcA-regulatedpromoters (11). The �10 region and 3� flanking nucleotidesshare a primary structure (TTAACTGCCCGAG) similar tothe NtcA-regulated transcriptional start point (tsp [under-lined]) of the nirA operon of Synechococcus sp. strain PCC7942 (15). A putative E. coli-like �70 promoter with the struc-ture GTAGCA-N22-TTN3T is also present, in which the �35box overlaps the putative NtcA binding site, and is identical tothe �70-like promoter found upstream of ntcA in Synechococ-cus sp. strain PCC 7942 (15).

No recognizable promoters were identified in the 78-bp in-tergenic region between nrtP and narB, suggesting either thatthese genes are coexpressed from a common promoter up-stream of nrtP or that the narB promoter lies within the codingregion of nrtP. A sequence (GTGCTGTGACCTAC) that re-sembles an NtcA binding site is centered 197 bp upstream ofthe stop codon of nrtP but lacks a recognizable �10 box. Aswas the case with nrtP, no extension products that corre-sponded to initiation from a recognizable NtcA-regulated or�70-like promoter were identified for narB. Unlike the DNAcontrol, however, RT-PCR with ntrP and narB primers failedto yield a product. It seems likely, therefore, that narB istranscribed independently from nrtP from an as yet unidenti-fied promoter (data not shown).

A further putative NtcA binding site was identified centeredin a noncoding region 353 bp upstream of the start codon ofnirA with the architecture GTAN8AAC-N22-TAGAAA. LikenrtP, a second putative E. coli-like �70 promoter that has thestructure TTTACA-N24-TAN3T is located at �248 with re-spect to the first initiation codon of nirA. Primer extensionanalysis revealed several possible transcriptional start points,including one identified only in RNA isolated from N-deprivedcells that is flanked by the putative NtcA binding site and that

initiates at a guanidine residue located 12 bp downstream ofthe �10 region (Fig. 3).

The influence of nitrogen source and nitrogen deprivationon transcriptional regulation of the nitrate/nitrite assimila-tory system. Northern analyses of rbcL and glnA revealed thatboth genes are substantially up-regulated in ammonium-growncells (Fig. 4). The major rbcL transcript (2.3 kb) and that ofglnA (1.8 kb) are at least two- to threefold-more abundant incomparison to nitrate-grown cells. Northern blots probed withnrtP, narB, or nirA all produced smeared hybridization signalsthat were difficult to quantify (data not shown) and whichsuggested that the mRNAs originating from these three genesare turned over rapidly. Therefore, a quantitative RT-PCRprotocol was developed to investigate the expression of thesegenes and also that of rbcL, glnA, and ntcA.

A very pronounced negative effect of ammonium on theabundance of narB and nrtP mRNAs was observed in low-light-grown cells; the abundance of both transcripts was �10% ofthat found in nitrate-grown cells (Fig. 4). By comparison, am-monium had a much smaller inhibitory effect on the abundanceof nirA and ntcA mRNAs which were present at about half theconcentrations found in nitrate-grown cells. Consistent withthe results of the Northern analysis, RT-PCR confirmed thatrbcL and glnA were both up-regulated in ammonium-growncultures.

A similar effect of ammonium on the abundance of glnA andrbcL mRNAs was also observed in high-light-grown cells (Fig.5). Likewise, nirA mRNA was at �50% of the concentrationsfound in nitrate-grown cells, but surprisingly, ammonium had afar less pronounced negative effect on the transcription of nrtPand narB under this light regimen. The abundance of nrtPmRNA was �60% of that found in nitrate-grown cells whilethat of narB was just under 40% (cf. �10% for both transcripts

FIG. 2. Map of the genomic regions harboring narB (top) and nirA (bottom) in Synechococcus sp. strain WH 8103.

VOL. 69, 2003 NITROGEN REGULATION IN MARINE SYNECHOCOCCUS SPP. 7013

on January 11, 2014 by guesthttp://aem

.asm.org/

Dow

nloaded from

under low light). With the exception of nrtP, which was down-regulated somewhat, the overall abundance of transcripts ofthe other five genes investigated in nitrite-grown cells wasintermediate between that found in ammonium- and nitrate-grown cells.

The influence of nitrogen-deprivation on gene expressionwas also investigated by RT-PCR. Apart from a steady increasein the abundance of rbcL mRNA, little change in the overallpattern of gene expression was detected during the first 4 h ofN deprivation (Fig. 6). The abundance of ntcA, glnA, nirA,narB, and nrtP transcripts all increased over the next 4 h,whereas conversely, rbcL expression declined somewhat. After8 h the abundance of glnA and nirA mRNAs had increased

�10- and �3-fold, respectively, whereas ntcA and nrtP tran-scripts had increased �10- and �5-fold, respectively, in com-parison to nitrate grown cells. Expression of ntcA and nrtPmRNAs was still elevated after 24 h, at which time point theabundance of narB mRNA reached the highest concentrationobserved, increasing a further 2.5-fold over that found at 8 hand �10-fold in comparison to unstarved cells.

DISCUSSION

Isolation and characterization of nirA, narB, and nrtP fromSynechococcus sp. strain WH 8103. The genes involved in ni-trate and nitrite assimilation in Synechococcus sp. strain WH8103 were isolated and characterized during the present study.The identities of nirA, narB, and nrtP were inferred by se-quence similarities to known genes and by interrogation of theNCBI conserved domain database. Both nirA and narB containthe conserved domains found in other NiRs and NRs, and theirpeptide sequences share significant identity with those fromother cyanobacteria. Together with nrtP, which is 90% iden-tical to the homologue present in Synechococcus sp. strain WH7803, these genes constitute the structural components of thenitrate/nitrite assimilation apparatus of this marine cyanobac-terium.

Like the euryhaline Synechococcus sp. strain PCC 7002 (24)and the marine diazotrophic, filamentous cyanobacterium Tri-chodesmium sp. strain WH 9601 (26), the narB gene of Syn-echococcus sp. strain WH 8103 is closely linked with an openreading frame homologous to nrtP. This gene encodes a ni-trate/nitrite permease rather than the component genes(nrtABCD) of an ABC-type nitrate/nitrite transporter foundupstream of narB in most freshwater cyanobacteria. The pres-ence of nrtP in Synechococcus sp. strain WH 8103 lends furthersupport to the prediction that there are significant differencesbetween the nitrate/nitrite transporters present in marine andfreshwater cyanobacteria (24). A copy of nrtP is also foundupstream of narB in the recently completed genome of theclosely related isolate, Synechococcus sp. strain WH 8102. In-triguingly, components of an ABC-type transporter with sig-nificant similarity to nrtABCD are also present in the genomeof Synechococcus sp. strain WH 8102 (http://genome.ornl.gov/microbial/syn_wh/embl/syn_wh_P_cogs.html). Whether thesegenes are functional remains to be investigated, but in Syn-echococcus sp. strain PCC 7002 at least, NrtP has been shownto be the primary bispecific transporter (24).

In Synechococcus sp. strain PCC 7002, nrtP and narB occurin the same orientation (24) as that found for Synechococcussp. strain WH 8103. Unlike Synechococcus sp. strain WH 8103,however, both genes have NtcA-like promoters in their up-stream regions in this euryhaline strain and Northern analysesconfirmed that nrtP and narB are transcribed as monocistronicmRNAs (24). The lack of a recognizable promoter in the muchshorter intergenic region (78 bp) located between nrtP andnarB in Synechococcus sp. strain WH 8103 suggested that thesegenes might be coexpressed from a common promoter up-stream of nrtP. Despite a number of attempts to map the 5� endof nrtP and narB mRNAs by primer extension, it was notpossible to verify this experimentally. The failure to amplify theintergenic region between these genes by RT-PCR, however,

FIG. 3. Primer extension analysis of the promoter region of nirA.(A) The left hand lane shows the extension product (arrow) obtainedfrom RNA isolated from N-starved cells while the other lanes containa sequencing ladder produced by using the same primer. (B) Thenucleotide sequence upstream of the nirA transcriptional start point(base underlined). The nucleotide bases in boldface type are the pu-tative NtcA binding site and associated �10 region and are separatedby 22 nucleotides.

7014 BIRD AND WYMAN APPL. ENVIRON. MICROBIOL.

on January 11, 2014 by guesthttp://aem

.asm.org/

Dow

nloaded from

strongly suggests that these genes are transcribed indepen-dently.

Although the transporter is different, the overall arrange-ment of the genes encoding the nitrate/nitrite assimilation sys-tem in Trichodesmium sp. strain WH 9601 (nirA, nrtP, andnarB) resembles that of Synechococcus sp. strain PCC 7942(26). The nirA gene is in a separate transcriptional unit fromnarB in Synechococcus sp. strain WH 8103, however, and thecomparatively minor negative effect of ammonium on nirAtranscription when compared to its freshwater counterpart in-dicates that unlike Synechococcus sp. strain PCC 7942, nirAand narB are differentially regulated in this marine cyanobac-terium. Mapping of the 5� end of nirA mRNA identified atranscriptional start site (tsp) 353 bp upstream of the initiationcodon that has an NtcA-like promoter in the upstream flankingsequence. This tsp was only detected in N-starved cells, how-ever, in which nirA is transiently up-regulated. This suggeststhat this promoter is active only under nitrogen deprivationand that it differs from the constitutive promoter active inunstarved cells.

The NtcA-binding site upstream of nirA and its 5� and 3�flanking sequences has a structure AATCGTAATTCCATCAACAGAA that deviates in a number of nucleotide positions(matches underlined) from the NtcA consensus promoter andtherefore is unlikely to bind NtcA with the same efficiency (11).Nevertheless, this NtcA-like promoter should be functional atthe elevated NtcA concentrations that are likely to be presentunder N deprivation (25), since ntcA is itself substantially up-regulated. The effect of prolonged N deprivation on the overallabundance of the nirA message was not as dramatic as thatobserved for nrtP, narB, or glnA; however, this might be be-

cause expression of nirA is comparatively high in unstarvedcells irrespective of the N source supplied for growth.

Intriguingly, the moles percent G�C content of the codingregion of nirA (42%) is considerably lower than that typical ofthe genomes of the MC-A group of Synechococcus spp. (mol%G�C, 55 to 62) (22). Phylogenetic analysis of nirA, includingthe draft nirA peptide sequence submitted to GenBank duringan earlier part of this study, revealed that the Synechococcussp. strain WH 8103 gene grouped more closely with higherplant and green algal sequences rather than with typical cya-nobacterial NiRs (26). While the overall topology of the treesvaried slightly after several sequencing ambiguities had beencorrected post-primary sequence submission, our own phylo-genetic analyses confirmed the relatedness with eukaryotic se-quences (4). Horizontal gene transfer appears to have oc-curred comparatively recently in marine Synechococcus spp.(28), but whether the nirA gene has been inherited in thismanner or is an example of convergent evolution is a matter ofconjecture.

Effect of nitrogen source and availability on gene expres-sion. In addition to the comparative lack of ammonium controlin regulating transcription of nirA, a further remarkable fea-ture of nitrogen metabolism in Synechococcus sp. strain WH8103 is the up-regulation of glnA in ammonium-grown cells. Inboth Synechococcus sp. strain PCC 7942 and Synechocystis sp.strain PCC 6803, glnA is substantially down-regulated by am-monium, although to a lesser extent in the latter case (23).Why Synechococcus sp. strain WH 8103 differs in this regard isnot clear. The growth rate of Synechococcus sp. strain WH8103 utilizing ammonium is a little higher than that with ni-trate, but it seems unlikely that the observed increase in glnA

FIG. 4. Influence of nitrogen source on the expression of genes involved in carbon and nitrogen assimilation in Synechococcus sp. strain WH8103 grown under low irradiance. The results of the Northern analyses are shown on the left side of the figure while the panels on the right showthe results of the RT-PCR experiments conducted with equal quantities (1 ng) of RNA from cells grown with either nitrate or ammonium as thesole N source.

VOL. 69, 2003 NITROGEN REGULATION IN MARINE SYNECHOCOCCUS SPP. 7015

on January 11, 2014 by guesthttp://aem

.asm.org/

Dow

nloaded from

mRNA abundance could be due entirely to global effects ontranscription. Interestingly, GS activity in Prochlorococcus ma-rinus strain PCC 9511 is not enhanced when switched fromammonium to nitrogen-free medium (5), indicating that unlikeother cyanobacteria (17) GS is not subject to N control in thiscyanobacterium. Like Synechococcus sp. strain WH 8103, tran-scription of ntcA is up-regulated during N-deprivation,whereas amt1, encoding a high-affinity ammonium transporter,is not (12).

One possible explanation for the observed up-regulation ofglnA by ammonium in Synechococcus sp. strain WH 8103 isthat NR and NiR compete with RubisCO for photosyntheti-cally generated reductant in nitrate-grown cells. In comparisonto ammonium-grown cells, this may limit the supply of 2-oxo-glutarate that is essential for the incorporation of nitrogenthrough the GS/glutamate synthase pathway (11). Since at thetranscriptional level at least, glnA expression is not regulatedby the N source, enhanced transcription may be a response tothe greater availability of C skeletons for glutamate synthesis inammonium-grown cells. The lack of competition for reducingpower to support CO2 fixation may also explain why rbcL isalso up-regulated by ammonium. In natural populations ofSynechococcus spp., the steady accumulation of photosynthateduring the first few hours of sunlight and the effect this has onthe cell C-N balance has been put forward as an explanationfor the observed increase in the abundance of glnA mRNAduring the latter half of the of the diel cycle (29).

The lack of repression of glnA and the relatively high levelof expression of nirA and ntcA in ammonium-grown cells

FIG. 5. Influence of nitrogen source on the expression of genesinvolved in carbon and nitrogen assimilation in Synechococcus sp.strain WH 8103 grown under high irradiance. The panels show theresults of RT-PCR experiments conducted with equal quantities (1 ng)of RNA from cells grown with either nitrate, nitrite, or ammonium asthe sole N source.

FIG. 6. Influence of N deprivation on the expression of genes involved in carbon and nitrogen assimilation in Synechococcus sp. strain WH 8103.RNA was extracted from cells at the times indicated, up to 24 h after transfer to N-free medium. The abundance of mRNAs was determined byRT-PCR with 30 (top panel) or 36 (bottom panel) cycles of the PCR.

7016 BIRD AND WYMAN APPL. ENVIRON. MICROBIOL.

on January 11, 2014 by guesthttp://aem

.asm.org/

Dow

nloaded from

point to some unique features of nitrogen control in thismarine cyanobacterium. All of the genes involved in N as-similation that were investigated are responsive to nitrogendeprivation and in most cases are up-regulated substantiallyin what appears to be an NtcA-dependent manner. BothnrtP and narB are also tightly regulated by ammonium (andparticularly so under low irradiance), but this is clearly notthe case for either glnA, nirA, or indeed, ntcA itself. Thelesser degree of ammonium inhibition of nrtP and narBtranscription at higher irradiance is of interest and suggeststhat the expression of these genes might be redox-respon-sive, as has been shown for glnA and ntcA in Synechocystissp. strain PCC 6803 (2, 22).

None of the genes sequenced in this study have a canonicalNtcA-type promoter, but the putative promoter located up-stream of nrtP is likely to bind NtcA far more efficiently thanthat identified for nirA (11). This variability in the degree ofconservation in the putative NtcA-like promoters for nrtP andnirA might help explain why the response to ammonium differs.The nrtP promoter should compete for NtcA much more ef-fectively than that for nirA at the considerably lower concen-trations of this transcription factor likely to be found inN-replete cells. Perhaps surprisingly, a search of the ge-nome sequence of the closely related Synechococcus sp. strainWH 8102 revealed only one putative promoter and its associ-ated �10 box (GTAATAACTACTAC-N22-TAATTT) thatmatches the NtcA consensus sequence. Intriguingly, this wasfound upstream of ntcA.

Concluding remarks. The present study has shown that,unusually, nirA is expressed at comparatively high levels inthe presence of ammonium in Synechococcus sp. strain WH8103 and that there is at least the potential for coutilizationof both ammonium and nitrite. What remains to be estab-lished is whether the nirA message is translated in ammo-nium-grown cells and whether they do indeed maintain acapacity to utilize nitrite. We are investigating this currently,and since we have shown that nrtP is down-regulated byammonium, one part of this investigation will examinewhether there is a second nitrite-specific active transportsystem, as has been shown for Synechococcus sp. strain PCC7942 (16). In view of the low N concentrations and abundantenergy supply available in well-illuminated oceanic surfacewaters, the potential competitive benefits of retaining a ca-pacity to coutilize different forms of combined N may offsetthe obvious biosynthetic and maintenance costs involved.The majority of Prochlorococcus spp. appear to haveadopted a quite different strategy by losing the capacity toutilize oxidized forms of combined N and reducing mainte-nance costs by compacting the genome such that it is nowthe smallest of any known photosynthetic prokaryote.

ACKNOWLEDGMENT

This research was supported by a studentship to C.B. (ref. GT04/97/280/MAS) from the Natural Environment Research Council of theUnited Kingdom.

REFERENCES

1. Aichi, M., N. Takatani, and T. Omata. 2001. Role of NtcB in activation ofnitrate assimilation genes in the cyanobacterium Synechocystis sp. strain PCC6803. J. Bacteriol. 183:5840–5847.

2. Alfonso, M., I. Perewoska, and D. Kirilovsky. 2001. Redox control of ntcA

gene expression in Synechocystis sp. PCC 6803. Nitrogen availability andelectron transport regulate the levels of NtcA protein. Plant Physiol. 125:969–981.

3. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A.Smith, and K. Struhl. 1992. Current protocols in molecular biology. WileyInterscience, New York, N.Y.

4. Bird, C. 2001. Molecular cloning and characterisation of genes involved innitrate/nitrite assimilation in the marine cyanobacterium, Synechococcus sp.strain WH 8103. Ph.D. thesis. University of Stirling, Stirling, United King-dom.

5. El Alaoui, S., J. Diez, L. Humanes, F. Toribio, F. Partensky, and J. M.Garcia-Fernandez. 2001. In vivo regulation of glutamine synthetase activityin the marine chlorophyll b-containing cyanobacterium Prochlorococcus sp.strain PCC 9511 (Oxyphotobacteria). Appl. Environ. Microbiol. 67:2202–2207.

6. Fuller, N. J., D. Marie, F. Partensky, D. Vaulot, A. F. Post, and D. J. Scanlan.2003. Clade-specific 16S ribosomal DNA oligonucleotides reveal the pre-dominance of a single marine Synechococcus clade throughout a stratifiedwater column in the Red Sea. Appl. Environ. Microbiol. 69:2430–2443.

7. Glibert, P. M., J. C. Goldman, and E. J. Carpenter. 1982. Seasonal variationsin the utilisation of ammonium and nitrate by phytoplankton in VineyardSound, Massachusetts, USA. Mar. Biol. 70:237–249.

8. Glibert, P. M., and R. T. Ray. 1990. Different patterns of growth and nitro-gen uptake in two clones of marine Synechococcus spp. Mar. Biol. 107:273–280.

9. Glover, H. E., B. B. Prezelin, L. Campbell, M. Wyman, and C. Garside. 1988.A nitrate dependent Synechococcus bloom in surface Sargasso Sea water.Nature 331:161–163.

10. Harrison, W. G., L. R. Harris, and B. D. Irwin. 1996. The kinetics of nitrogenutilization in the oceanic mixed layer: nitrate and ammonium interactions atnanomolar concentrations. Limnol. Oceanogr. 41:16–32.

11. Herrero, A., A. M. Muro-Pastor, and E. Flores. 2001. Nitrogen control incyanobacteria. J. Bacteriol. 183:411–425.

12. Lindell, D., D. Erdner, D. Marie, O. Prasil, M. Koblizek, F. Le Gall, R.Rippka, F. Partensky, D. J. Scanlan, A. F. Post. 2002. Nitrogen stress re-sponse of Prochlorococcus strain PCC 9511 (Oxyphotobacteria) involvescontrasting regulation of ntcA and amt1. J. Phycol. 38:1113–1124.

13. Lindell, D., E. Padan, and A. F. Post. 1998. Regulation of ntcA expressionand nitrite uptake in the marine Synechococcus sp. strain WH 7803. J.Bacteriol. 180:1878–1886.

14. Luque, I., A. Contreras, G. Zabulon, A. Herrero, and J. Houmard. 2002.Expression of the glutamyl-tRNA synthetase gene from the cyanobacteriumSynechococcus sp. PCC 7942 depends on nitrogen availability and the globalregulator NtcA. Mol. Microbiol. 46:1157–1167.

15. Luque, I., E. Flores, and A. Herrero. 1994. Molecular mechanism for theoperation of nitrogen control in cyanobacteria. EMBO J. 13:2862–2869.

16. Maeda, S., M. Okamura, M. Kobayashi, and T. Omata. 1998. Nitrite-specificactive transport system of the cyanobacterium Synechococcus sp. strain PCC7942. J. Bacteriol. 180:6761–6763.

17. Merida, A., P. Candau, and F. J. Florencio. 1991. Regulation of glutaminesynthetase activity in the unicellular cyanobacterium Synechocystis sp. strainPCC 6803 by the nitrogen source: effect of ammonium. J. Bacteriol. 173:4095–4100.

18. Moore, L. R., A. F. Post, G. Rocap, and S. W. Chisholm. 2002. Utilisation ofdifferent nitrogen sources by marine cyanobacteria Prochlorococcus and Syn-echococcus. Limnol. Oceanogr. 47:989–996.

19. Olson, R. J., S. W. Chisholm, E. R. Zettler, and E. V. Armbrust. 1988.Analysis of Synechococcus pigment types in the sea using single and dualbeam flow cytometry. Deep Sea Res. 35:425–440.

20. Partensky, F., J. Blanchot, and D. Vaulot. 1999. Differential distribution andecology of Prochlorococcus and Synechococcus in oceanic waters: a review.Bull. Inst. Oceanogr. 19:457–476.

21. Partensky, F., W. R. Hess, and D. Vaulot. 1999. Prochlorococcus, a marinephotosynthetic prokaryote of global significance. Microbiol. Mol. Biol. Rev.63:106–127.

22. Reyes, J. C., and F. J. Florencio. 1995. Electron-transport controls transcrip-tion of the glutamine-synthetase gene (glnA) from the cyanobacterium Syn-echocystis sp. PCC 6803. Plant Mol. Biol. 27:789–799.

23. Reyes, J. C., I. Muro-Pastor, and F. J. Florencio. 1997. Transcription ofglutamine synthetase genes (glnA and glnN) from the cyanobacterium Syn-echocystis sp. strain PCC 6803 is differentially regulated in response to ni-trogen availability. J. Bacteriol. 179:2678–2689.

24. Sakamoto, T., K. Inoue-Sakamoto, and D. Bryant. 1999. A novel nitrate/nitrite permease in the marine cyanobacterium Synechococcus sp. strain PCC7002. J. Bacteriol. 181:7363–7372.

25. Vaquez-Bermudez, M. F., A. Herrero, and E. Flores. 2002. 2-Oxoglutarateincreases the binding affinity of the NtcA (nitrogen control) transcriptionfactor for the Synechococcus glnA promoter. FEBS Lett. 512:71–74.

26. Wang, Q., H. Li, and A. Post. 2000. Nitrate assimilation genes of the marinediazotrophic, filamentous cyanobacterium Trichodesmium sp. strainWH9601. J. Bacteriol. 182:1764–1767.

27. Waterbury, J. B., S. W. Watson, F. W. Valois, and D. G. Franks. 1986.

VOL. 69, 2003 NITROGEN REGULATION IN MARINE SYNECHOCOCCUS SPP. 7017

on January 11, 2014 by guesthttp://aem

.asm.org/

Dow

nloaded from

Biological and ecological characterization of the marine unicellular cya-nobacterium Synechococcus. Can. Bull. Fish. Aquat. Sci. 214:71–120.

28. Watson, G. M. F., and F. R. Tabita. 1996. Regulation, unique gene organi-sation, and unusual primary structure of carbon fixation genes from a marinephycoerythrin-containing cyanobacterium. Plant Mol. Biol. 32:1103–1115.

29. Wyman, M. 1999. Diel rhythms in ribulose-1, 5-bisphosphate carboxylase/oxygenase and glutamine synthetase gene expression in a natural populationof marine picoplanktonic cyanobacteria (Synechococcus spp.). Appl. Envi-ron. Microbiol. 65:3651–3659.

30. Wyman, M., J. T. Davies, D. W. Crawford, and D. A. Purdie. 2000. Molecular

and physiological responses of two classes of marine phytoplankton (diatomsand prymnesiophytes) during the development of nutrient-stimulatedblooms. Appl. Environ. Microbiol. 66:2349–2357.

31. Wyman, M., R. P. F. Gregory, and N. G. Carr. 1985. Novel role for phyco-erythrin in a marine cyanobacterium, Synechococcus strain DC2. Science230:818–820.

32. Zubkov, M. V., B. M. Fuchs, G. A. Tarran, P. H. Burkill, and R. Amann.2003. High rate of uptake of organic nitrogen compounds by Prochlorococcuscyanobacteria as a key to their dominance in oligotrophic oceanic waters.Appl. Environ. Microbiol. 69:1299–1304.

7018 BIRD AND WYMAN APPL. ENVIRON. MICROBIOL.

on January 11, 2014 by guesthttp://aem

.asm.org/

Dow

nloaded from