https://www.ar15.com/media/mediaFiles/348/6394.JPG

http://www.sludgehornet.com/downloads/NavalAviation_Pubs/LSO.pdf

http://www.navair.navy.mil/img/uploads/

PMA213_2.jpg

http://www.navair.navy.mil/index.cfm?fuseaction=home.PhotoGalleryDetail&key=8E68C563-917F-4F68-9200-05AF2EA29C72

“Naval Air Traffic Management Systems Program Office (PMA213) is the Navy's Executive Agent that pro-vides program management and life cycle support for all naval Air Traffic management Systems. PMA213is directly responsible and accountable to Program Executive Officer, Tactical Aircraft Programs (PEO(T)).PMA213's mission is to: -maintain our fielded ATC and CID systems for our Warfighters today, - deliveradvanced Air Traffic Control and Landing capability both at sea and ashore, and - deliver improved IFFsecurity via Mark XIIA, Mode 5 upgrade.”

Naval Air Traffic Management Systemshttp://www.navair.navy.mil/index.cfm?fuseaction=home.PhotoGalleryDetail&key=8E68C563-917F-4F68-9200-05AF2EA29C72

“AUTOMATIC CARRIER LANDING SYSTEM TESTS 1963After a regular overhaul extending until April 1963 Midwaycontinued its role as a research and developmentplatform. In June 1963 an F-4A Phantom II and an F-8DCrusader made the first fully automatic carrier landingswith production equipment on board Midway off the WestCoast. The landings, made "hands off"with both flight controls and throttles operatedautomatically by signals from the ship, were theculmination of almost 16 years of research anddevelopment....”

USS Midway Museum Docent Reference Manual 2013 Editionhttp://www.volunteers-midway.org/assets/files/15557.pdf

U.S. NAVY AIRCRAFT As it happens, the hands-off carrier landing capability has been around for a long time, with the first aboard a

carrier being accomplished more than 50 years ago and used operationally since 1965. However, the X-47B system

has to provide greater functionality—for example a hands-off bolter (a touch down with no arrestment)—and much

greater reliability. since there is no pilot to take over when the electrons and ones/zeros begin to lose their way.

The impetus for a hands-off system in 1950 was the desire to minimize the shortcomings of jets with respect to

all-weather operations and the amount of time that a carrier was unable to operate aircraft due to ship motion or

ceiling/visibility. In those days, before inflight refueling, jets were unable to wait out poor weather due to their

limited endurance.

Bell Aerospace won a competition with Honeywell and began developing the system in the early 1950s. It was

ship-based, with a computer using radar data to determine the airplane's location relative to the glide slope and

then sending corrections to the airplane's autopilot to alter its flight path to fly to and on the glide slope at the

proper approach speed. All the pilot had to do was fly the airplane through an imaginary gate four miles aft of the

ship on final approach and verify that the airplane was being guided by the ALCS, All-weather ( or Automatic)

Carrier Landing System.

The first automatic landing of the Navy test airplane, a Douglas F3D Skyknight, took place in May 1954 at the

Niagara Falls Airport, New York.

One addition required to the airplane in addition to an auto throttle was a corner reflector, seen above just in

front of the nose landing gear doors, to insure the best possible radar data for the ship-based system.

http://thanlont.blogspot.com.au/2011/07/look-no-hands.html

Part of the interval between the successful demonstration at Bell and the first landing aboard a carrier was

dedicated to developing a ship-motion compensation capability. During the last 12 seconds before the touchdown,

ship motion was included in the computations; a second or two from touchdown, the corrections to the autopilot

ceased and it simply maintained pitch and bank.

The first at-sea demonstration was on Antietam in 1957. At the time, the system was housed in large vans and not

ready for deployment in the operating environment aboard an aircraft carrier. Redesign and environmental

(shake, vibration, EMI, etc.) qualification testing was required now that proof of the concept had been demonstrated.

A production contract was finally awarded to Bell in March 1960 for the SPN-10 ALCS. NATC accomplished the first

fully automated landings with the production system in June 1963 on Midway with an F-4 Phantom and an F-8

Crusader, modified for the capability. However, another round of development and improvements were required

so the first operational use was delayed to late 1965, when operational evaluations were accomplished with F-

4Gs, ALCS-modified F-4Bs, aboard Kitty Hawk. The capability was subsequently retrofitted to F-4Bs and

incorporated in new production F-4Js. After a Vietnam deployment aboard Kitty Hawk with VF-213, the 11

surviving F-4Gs (one was shot down) became F-4Bs again. (Either the Navy's F-4G's existence was

forgotten/considered irrelevant or used to disguise the purpose of yet another F-4 variant, the Air Force F-4G

Wild Weasel.)

The radar reflector on the aircraft was substantially reduced in size and made retractable. On the F-4, it was

attached to a door that opened just forward of the nose gear.

On the F-111B, it was mounted on the upper link of the nose gear torque scissors so it deployed into position

when the gear was down in flight.

When the system was working, the performance was brilliant, the airplane coming down the glide slope toward a

three-wire arrestment like it was on rails. As might be expected from the vacuum-tube-based technology of the

time, however, reliability proved to be a problem. A field change was made to improve SPN-10 reliability but at

the expense of its automatic touchdown capability: the pilot had to take over at weather minimums and make the

final corrections before touchdown.

In 1966, Bell received a contract to "digitize" the system with solid state electronics and computers and restore

full functionality. The redesigned system was designated the SPN-42. A subsequent improvement, the SPN-42A,

incorporated an X-Band radar for better system performance in heavy precipitation. It was operationally approved

in 1968.

Development of the next ALCS generation, the SPN-46, was begun in 1980 to take advantage of advancements in

gyro, computer, and radar technology. It was declared operational in 1987 after an operational evaluation

involving Kennedy and F-14s. It is being continually improved but will eventually be replaced by a GPS-based

system being developed as a joint service program, JPALS (Joint Precision Approach and Landing System).

http://thanlont.blogspot.com.au/2011/07/look-no-hands.html

O

ww

W

t

t

t

f

I

f

i

i

D

g

i

s

F/A-18 Carrier Landing System

http://preserve.lehigh.edu/cgi/viewcontent.cgi?article=1018&context=etd

A fuzzy logic based aircraftcarrier landing systemMarc Steinberg; Lehigh University 1991

Side View Carrier Landing

System Ship Capability Description AN/SPN-46 ACLS CV/CVN - Mode I: Hands-off approach to touchdown.

- Mode IA: Hands-off approach to ¾ NMI, pilot takeover. - Mode II: SPN-46 radar provides azimuth and elevation guidance- Mode III: Ground-controlled approach utilizing the SPN-46

radar for skin track. - Mode I, IA, and II capabilities require aircraft to have a radar

beacon and an on-aircraft data link. AN/SPN-41 ICLS CV/CVN

LHA, LHD

- SPN-41 radar provides azimuth and elevation guidance - Stand-alone instrument landing system or independent monitor

for ACLS approaches. - Requires receiver in aircraft

AN/SPN-35 PAR LHA, LHD - Ground-controlled approach using radar skin track - No on-aircraft systems required.

ATC&LS testing is currently focused on certification of the PALS onboard LHD, LHA, and CV/CVN class ships. PALS capabilities are further described in Table 1. The ATC&LS Branch also certifies shore-based installations of the ACLS and ICLS and tests Instrument Landing Systems on all Navy/Marine Corps aircraft. Upcoming work is focusing on service life improvements of the current systems and development of the Joint Precision Approach Landing System (JPALS). JPALS will be used by all U.S. Services to provide shore-based and shipboard precision approach capability using relative GPS technology. The JPALS T&E program will be a large challenging program that will, in the end, enable a change to the concept of operation for the carrier air traffic control system and be the major enabling technology for UCAS shipboard launch and recovery operations. This branch is also heavily involved in new aircraft development programs such as the F-35B/C JSF airplanes and in the development of modifications to current airplanes such as the new Digital Flight Control System (DFCS) for the EA-6B.

Table 1:PALSCapabilitiesDescription

ShipSuitabilityTesting –Preparing

for theFuture

http://ftp.rta.nato.int/public//PubFullText/RTO/MP/RTO-MP-SCI-162///MP-SCI-162-07.pdf

c.2005

http://www.neptunuslex.com/2011/03/06/whisper-still-life/

http://www.neptunuslex.com/wp-content/uploads/2011/03/IMG_0117-1.jpg

W H I S P E R —STILL-LIFE

DayCase IIIRecovery

“Case III explanation (‘Whisper’). During instrument meteorological conditions (IMC), (and always at night) weexecute a Case III recovery, more specifically the CV-1 approach. It is basically an all inclusive holding,penetration, and instrument approach procedure that drops you off on a 3.5 degree glideslope behind the ship.”

“CASE III: This approach shall be utilizedwhenever existing weather at the ship isbelow Case II minimums and during all flightoperations conducted between one-halfhour after sunset and one-half hour beforesunrise except as modified by the OTC orcarrier commanding officer. Night/IMCCase III recoveries shall be made with singleaircraft. Section approaches will be approv-ed only when an emergency situation exists.Formation penetrations/ approaches by dis-similar aircraft shall not be attempted exceptin extreme circumstances where no saferoptions are available to effect a recovery.”CV NATOPS 2009 NAVAIR 00-80T-106

TYPE APPROACH MINIMUMS

JET NON-PRECISION

600–1-1/4

ICLS 300–3/4

ICLS/ILMW/SPN-42/46MONITOR

200–1/2

MODE I AS CERTIFIED

MODE IA, II, IIT, III 200–1/2

http://

info.publicintelligence.net/F18-ABCD-000.pdf

Carrier ControlledApproach (CCA)

A1-F18AC-NFM-000NATOPS FLIGHT MANUAL

NAVY MODEL F/A-18A/B/C/D

CCAhttps://www.cnatra.navy.mil/ebrief/documents/TW1/references/COLUMN%202/T-45C%20NATOPS/CV%20NATOPS.pdf

What?MeWorry?

http://www.neptunuslex.com/wp-content/uploads/2011/03/IMG_0087-1.jpg

‘Whisper: Still Life’ By Whisper, on March 6th, 2011http://www.neptunuslex.com/2011/03/06/whisper-still-life/#comments

Whisper, March 6, 2011 at 4:32 pm: Reply: http://www.neptunuslex.com/2011/03/06/whisper-still-life/comment-page-1/#comment-696277“On a four wire boat, the ace is almost always a no grade. Not so on the three wire boats. When you’re targeting in front of the two, it’spossible to get a fair or even OK one wire. But yeah, both of those guys pulled-out an ace. For me, there’s really only two grades on aday like that: Stopped and Didn’t Stop. Come across the ramp safe and predictable and paddles will get you in the wires every time.”

Click forMiniscule

Videos

ACL Mode 2 ApproachA1-F18AC-NFM-000

ACL Mode 1 & 1A ApproachesA1-F18AC-NFM-000

A1-F18AC-NFM-000 NATOPS FLIGHT MANUALNAVY MODEL F/A-18A/B/C/Dhttp://info.publicintelligence.net/F18-ABCD-000.pdf

AUTOMATIC CARRIER LANDING SYSTEM (ACLS)by Don Femiano

“LOOK MA NO HANDS.” This was the slogan on a jacket patch created by Bell Aerosystems on the occasion of the US Navy’s Operational Certification of Bell’s Automatic Aircraft Landing System (ACLS). It contains the caricature of a pilot flying a plane with his arms folded as he approached an aircraft carrier. Unfortunately, the patches are not around any more, but the Bell ACLS is in operational use on all Navy aircraft carriers to this day.

This success didn’t happen over night. It was the result of several years of effort by many at Bell starting in 1953 when Bell, using a feasibility model landing system, won a fly off competition with Minneapolis Honeywell. Following this win, Bell won a contract to build a shipboard feasibility model system, designated AN/SPN-10 (XN-3), for testing aboard Navy aircraft carriers. Using the (XN-3) system, the first automatic landing with a Navy aircraft took place in 1954, at the Niagara Falls Airport, adjacent to the Bell facility in Wheatfield New York. In 1957, the first automatic-landing-to-touchdown, on a carrier, was accomplished with the (XN-3), by a Navy pilot in an F-3D aircraft on USS Antietam (CV-36).

After the USS Antietam sea trials, Bell worked on designing the system to conform to the stringent requirements for shipboard operation (shock, vibration, EMI, etc), and in 1960 Bell was awarded a production contract for the AN/SPN-10 All Weather Carrier Landing System (AWCLS). This is when Bell Aerosystems became a division of Textron and was renamed Bell Aerospace Textron; it is also when I began my career on landing system programs that spanned 35 years.

In 1962, the first production systems were installed on USS Midway (CV-41) and USS Independence (CV-62) and, in 1963, after certification testing at sea on USS Midway, AN/SPN-10 was certified for operational use. Over the next several years, production systems were installed on the Navy’s aircraft carriers operating at that time.

Unfortunately, the reliability of the system was low because it consisted of more than thirty units of electronic equipment, containing hundreds of vacuum tube operational amplifiers, to perform ship motion stabilization and the aircraft control computations. As Bell and the Navy sought ways to improve the system, it was obvious that digital computers and solid-state electronic technology were the only solutions to the reliability problems. In 1966 Bell received a contract to “digitize” the AN/SPN-10. The new system was subsequently designated AN/SPN-42.

While the AN/SPN-42 was in development, an AN/SPN-10 field change that reduced electronic equipment to improve reliability was installed in the system. Unfortunately, this change eliminated the automatic touchdown capability, but the system would still control aircraft to carrier approach minimums, and the pilots would land the aircraft manually.

In the AN/SPN-42, UNIVAC 1219 digital computers replaced the vacuum tube analog computers that performed the flight control computations, and the Ka-Band (33.2 GHz) radar tracking subsystem was converted to an all solid-state electronic design. This design reduced

the number of electronic units to less than half of the units used in AN/SPN-10 and, subsequently, improved the reliability.

During the AN/SPN-42 development, the Navy directed Bell to incorporate an X-Band (9.3 GHz) receiver modification into the radar subsystem to improve radar performance in heavy precipitation, and the system was then designated AN/SPN-42A. In 1968, OPEVAL (operational evaluation) tests with several aircraft were successfully performed on the AN/SPN-42A aboard USS Saratoga (CV-60), and the system was awarded Operational Approval.

For the next ten years, Bell built AN/SPN-42A systems for the new carriers as they were commissioned, and converted AN/SPN-10 systems to AN/SPN-42A system for reinstallation on the existing carriers. From the mid sixties to the end of the Vietnam War, AN/SPN-10 and AN/SPN-42A played a major roll in all carrier operations in Southeast Asia.

However, once again technology obsolescence raised its ugly head and the AN/SPN-42A became difficult to maintain because of the unavailability of replacement parts. So in 1980, the Navy contracted with Bell to design and develop a new automatic carrier landing system, designated AN/SPN-46(V)1.

The AN/SPN-46(V)1 uses six AN/AYK-14 Navy standard airborne computers for the radar and aircraft control processing, and Navy Standard Electronic Modules (SEM) for the supporting electronic equipment, thus resulting in fewer units and better reliability than AN/SPN-42A. The Navy MK-16 MOD 12 Ring Laser Gyro replaced the gyro controlled ship motion stabilization unit, used in both AN/SPN-10 and AN/SPN-42A.

In 1984, extensive testing of the AN/SPN-46(V)1 was conducted at the Naval Air Warfare Center Aircraft Division (NAWCAD), Patuxent River, MD, with several Navy aircraft.

In 1985, the first system was installed on USS John F Kennedy (CV-67) and OPEVAL sea trials were conducted in 1986 and 1987 with F-14 Tomcats. In 1987 The Navy awarded the AN/SPN-46(V)1 Operational Approval for full automatic control from aircraft acquisition at ten nautical miles to touchdown on the deck and production of the system was started.

From 1987 to 1991, Bell delivered five systems to the Navy and was working on the sixth system when Textron Corporate decided to combine Bell Aerospace Textron with Textron Defense Systems (TDS) and move the Bell operations to Wilmington MA. This appeared to the Navy to be an impossible task considering the work in progress at Bell, and the fact that the engineering, manufacturing and quality people at TDS had never worked on an AN/SPN-46(V)1 system.

The most critical work in progress was a system for USS Constellation (CV-64) that had to be delivered by the end of the year to meet the ship’s departure date from the shipyard. The people at Bell delivered a monumental effort to the task, getting the vast amount of equipment and material associated with the program shipped, and assisting TDS in establishing

www.tsretirees.org/

memory/Femiano.doc

manufacturing and testing facilities. They did this even though many knew that their jobs were gone when the move was completed.

With hard work and determination to succeed, the Bell/TDS team came through with flying colors, and the system was delivered on time. Production was up and running, at Wilmington, by the end of 1991. During the next several years, seven more systems were built at TDS and delivered to the Navy for replacement of the AN/SPN-42A, and for two new carriers commissioned in the late nineties.

In 1998, TDS phased out the AN/SPN-46(V)1 program and delivered the engineering data base NAWCAD at Patuxent River, MD and a new era of Navy Automatic Carrier Landing began.

Since taking over the program, NAWCAD has been developing new configurations of the system with support of subcontractors. They are developing a land based trainer system, designated AN/SPN-46(V)2, for use at Naval Air Stations. The (V)2 functions the same as the (V)1 but the MK 16 Mod 12 shipboard stabilization units are removed and a 7-foot diameter antenna replaces the 4-foot antenna used on the (V)1 for better low angle radar tracking on long Naval Air Station runways. NAWCAD is also upgrading the installed shipboard systems to improve system operability and reliability by installing modifications kits, some of which were developed at TDS under the Product Improvement Program. This new shipboard system configuration is designated AN/SPN-46(V)3, and has been successfully tested on several carriers to date.

NAWCAD is also working on a Life Cycle Extension (LCE) Program for the system. A new radar subsystem unit was designed during the first phase of the LCE program. The new subsystem unit uses specially designed circuit cards in place of the Navy Standard Electronic Modules and microprocessors to provide an enhanced radar tracking capability. The new radar subsystem unit is presently undergoing system testing at NAWCAD and at Sea. LCE program work in progress includes replacing the AN/AYK-14 computers with power PCs using C computer program language, upgrading the operator control console and ancillary display units and redesigning the radar receiver to replace obsolete and unprocurable components.

The LCE program plan is to keep AN/SPN46(V) operating on the carriers until 2025 when the Navy’s GPS based carrier landing system (JPALS) is scheduled to be operational.

The “LOOK MA NO HANDS” patches, and many of the Bell people who worked so hard to make Navy automatic carrier landing a reality, are gone now, but the system survives and will provide Navy pilots with a safe all weather automatic landing capability for decades to come.

ShipD

egreesofFreedom

:The

shiprotationaldegrees

offreedomare

termed

roll,pitch,&yaw

.Inthe

translationaldegrees

offreedom,up

anddow

nm

otionis

calledheave,forw

ardto

aftmotion

iscalled

surge,&portto

stbdm

otionis

calledsw

ay.”http://w

ww

.dtic.mil/cgi-bin/G

etTRD

oc?Location=U

2&doc=G

etTRD

oc.pdf&

AD

=AD

A469901

‘Autom

atedC

arrierLandingofan

Unm

annedC

ombatA

erialVehicleU

singD

ynamic

Inversion’

F/A-18C HUD CARRIER APPROACH STEERING INDICATIONS

http://www.users.on.net/~jase_ash/styled-9/styled-12/index.html

The approach started off like mostnight carrier approaches I hadexperienced. Tonight, it was dark,

late and my second flight of the day. Wewere in the middle of a major multinationalexercise. I had been flying a lot and felt verycomfortable in the aircraft. I was nightcurrent and qualified to make a Mode IACLS, hands-off landing. I had made oneACLS two nights earlier and had a lot ofconfidence in the system.

Marshal and dirty-up at 10 miles wereuneventful. I completed the landing check-list and got the Hornet trimmed and lined upas quickly as possible. ACLS lock-on camejust inside of six miles, and the jet coupledup for the approach and automatic landingon the first attempt just outside of five miles.

The ride was smooth, and the Hornetresponded crisply and accurately to ACLScommands.

The tipover at three miles was right onthe money. The ACLS “tadpole” was in themiddle of the velocity vector, and I thoughtI had it made. All I had to do was sit back,monitor things and enjoy the ride.

At the start of cruise, I had planned tomake every other night landing a Mode IACLS approach and “hand fly” the othernight landings for currency requirementsand proficiency. I was on track through thefirst four weeks of cruise and my plan wasworking just as I had envisioned it. Thisparticular ACLS approach was rock-soliduntil I reached the in-close position.

I detected a slight hesitation by the jet.The nose seemed to stop moving andresponding to commands for just an instant.As I closed my hand around the paddleswitch to take over manually, the aircraft’snose pitched down violently. I instinctivelypulled the stick all the way back andselected full afterburner, just as the LSOscreamed, “Power!” then, “Waveoff!”

Time seemed to slow down, but theaircraft responded, and as soon as I realizedthe aircraft was climbing (in a very nose-high attitude), I aggressively reset theproper landing attitude with forward stick.My adrenaline was really pumping by thistime, and I’m not sure when I deselectedafterburner, but I blew through 1,200 feet,the normal night Case III pattern altitude,and managed to somehow get the Hornetlevel at 3,000 feet.

Fortunately, it was extremely dark, andI didn’t see how close I had come to flyinginto the back of the ship and hitting theramp on the waveoff. My basic survivalinstincts stopped the first possibility fromhappening, and aggressively resetting theproper landing attitude prevented thesecond.

Despite my actions, however, parts ofthe aircraft still managed to get belowflight-deck level following the pitchover,and the hook missed the ramp by what theLSOs estimated as two feet on the waveoff.

I managed to compartmentalize and gotaboard without more problems a few

minutes later. I knew I had a close one butdidn’t realize how close until I saw all thepeople waiting for me in the ready room towatch the PLAT replay. The sequence willalways be burned into my memory.

To summarize the rest of the story, allequipment involved in the Mode I ACLS onthat aircraft and the ship was checked, andno discrepancies were found. Two monthslater, the carrier-suitability section of thePatuxent River Test Center duplicated thesequence of events at a safe altitude severalmiles behind the ship. They discovered theproblem was caused by a malfunction in thedata link’s receive-decode-transmit equip-ment and an inadequacy in the flight-controlcomputer’s software pitch-rate and pitch-magnitude limiting. As a result, a fleet-widemaintenance bulletin was issued and aNATOPS change submitted.

Since this incident, I have flown severalMode I approaches to the ship at night andnumerous Mode I’s before. I no longer takethe system or the Mode I sequence of events

lightly. What I relearned from a pilot andLSO perspective is that you can neverbecome too comfortable in the carrierenvironment no matter how routine aparticular activity becomes. Although Ireacted by instinct, the LSOs were on topof the situation and provided accurate andtimely power and waveoff calls.

If your squadron does Mode I ACLSapproaches, set up a formal academic andsimulator training syllabus to not onlyunderstand, practice, and simulate thecorrect procedures for a successful Mode IACLS approach, but to also practice,experience and handle the things that cango wrong.

While a good Mode I ACLS approachmay appear to be the ultimate E-ticket ride,you don’t have the luxury or option to takea passive role. A pilot must stay ahead ofthe aircraft, closely monitor every aspect ofthe approach, and anticipate and be pre-pared for the unexpected.

Cdr. Sizemore is the CO of VFA-86.

APPROACHNov 1999

Couple up: the fog -ging was so severe the HUD’s combin-ing glass was coat-ed with conden sation, which caused the symbology to fade under the moistureApproach, May-June, 2009

Chad A. Gerber

The Hornet often is described as so advanced the only limiting factor is the pilot at the controls. The aircraft has all the bells and whistles expected of a modern

-plicity suitable for a single-seat aviator. On a late-night recov-ery onboard USS Ronald Reagan

-ercised to the fullest extent of its capability saved not only the

pilot.

The ship had wrapped exercis-es near Hawaii a week earlier and just had moved into the Guam operating area to conduct large-force-strike training. The ship was about 150 miles from the near-

-der a “blue water” mindset. The

about to get the best of me. That

to land aboard the carrier with my eyes closed – not where you want to be.

and mission execution went ex-

worked out an excellent recov-

deck.”As soon as the launch was

made ready to recover aircraft.

all aircraft to recover as soon as their tasking was complete. The overall success of my mission could be measured in the man-agement of fuel and ultimate recovery of all aircraft. First to recover were the mission tankers and the suppression-of-enemy-

-

the last aircraft to recover. The

(CATCC) did a super job cycling the initial 10 to 15 aircraft down through the marshal stack. How-

-graded to vectors.

for recovery. Turn right to 330

you are following a Rhino in the hook at six miles.”

Just moments before this call

With my standard penetration

icy-cold-cockpit conditions a sec-

nose-down. The aggressive de-

The throttles came up from idle

system began to work overtime

sea level.

-pit defog handle from any posi-tion other than vertical/straight

preheating the cockpit before penetrating an approach. Most other Hornet pilots today will tell you the same thing. The typical

Case 3 recovery consists of a -

-mental-control system (ECS) to compensate for changes in out-side-air temperature and humid-ity. The ECS works as advertised 99.9 percent of the time. Unfor-

the other 0.1 percent.MY HORNET TRAINING

HAS TAUGHT ME to complete -

both hook and heat. Remember-ing to put down your hook is the easy part. Preheating the cockpit and throwing your defog handle forward is less intuitive because

-fore without having to make an

-edging the “H” check as com-

never had failed me.

the vectors brought me nicely

ECS ducting and visible mois-

creep” on the canopy was insidi-

caught myself leaning forward in the seat to get a better look at

primary attitude instrument. The

combining glass was coated with

symbology to fade under the moisture.

The consoles were soaking wet and water was running down the displays. There was so much moisture it practically was raining in the cockpit. Now at six miles

moved the canopy defog handle to full forward – a step that was too little too late. The moisture

-

and tipped over at three miles

hoping for a silhouette of the

-lated sections of the forward windscreen would be clear. Un-

--

the NATOPS pocket checklist to back me up. Nothing seemed to work. The air coming out of the ECS vents was extremely warm and very moist – exactly what

“MAN” on the ECS panel seemed -

hopes the outside air was drier

only exacerbated the situation.

--

gas to get to an isolated island -

tee my perceived ECS problems would subside by then. Carrier

left with no other viable option.“Approach, 301, re-

quest Mode I,” I called.

automatic-carrier-landing sys-

Hornet pilot understands but rarely exercises. Many carrier aviators would be happy to go their entire career without ever

-dicament is a shining example of

-

made the decision to land in my

up for safety.” The ride down was

shoulder never looked so good.

Paddles monthly A DD R E S SI NG T H E N E E D S O F T H E L S O C O M MU N IT Y

T HROU G H S AF ET Y D I S CU S S IO N S, O P E R AT ION A L U P D AT E S , A ND H I ST O R IC A L R E A DI NG S .

September 2012

“A QUICK ARB REFRESHER” ARB DRILL FOR A BARRICADE RECOVERY...WILL YOU BE READY?

(by LT “Smuggla” Johnson)

What will this look like on the IFLOLS itself? Each source cell on the IFLOLS is 0.13 deg, which would put the ball about halfway down the "bottom center" cell (Fig. 2). Is this perceivable to the average pilot? I think so. Remember to scan across the top of the datums and don't just stare at the picture below.

What's the big deal? A 0.05 deg difference translates to about 7" of hook to ramp and about 4 feet at the start. Are those differences in the noise? One could certainly argue that they are, particularly because a single cell is over 10 ft at the start and ACLS is measured to less than a foot. The bottom line is with respect to an on and on ACLS pass, the differ-ences translate to a slightly sagging ball, and there's no life below the datums, right?

As pilots, our truth source is the ball (excepting pitching deck or another extenuating circumstance where paddles be-comes the truth source). We teach pilots to fly the ACLS at the bottom of the Velocity Vector anyway, so when the ball and needles don't match up perfectly, why does it even matter? I don't know if it does. But I know some people like to put the thing on the thing, and centered needles should mean center ball; others like to ride the MODE I all the way to touchdown, and even a sagger is uncomfortable. What if the new guy breaks out at mins with centered needles and sees a sagging ball? Is he/she going to overcorrect? I did when I was a nugget, though I can't guarantee needles were per-fect; they probably were.

So is it a big deal? Do we change the tolerances? The tolerances used to be bigger when we had FLOLS. Regardless, I hope you gained a little knowledge of why things sometimes are the way they are. That being said, if any PALS system is doing something that you don't like, ask us about it. We have loads of data on every boat out there and engineers to look through all of it. Please feel free to email/call with any questions. Keep 'em off the ramp.

-LT Luke “Smuggla” Johnson is a test pilot with VX-23. He can be reached at luke.r.johnson@navy.mil

ACLS Is Dropping Me Off Low! (cont.)

Figure 2: IFLOLS Sagger with 3.55 deg

ACLS Is Dropping Me Off Low!!! As many of you have probably seen, one of our jobs in the glamorous world of carrier suitability flight test is conducting Precision Approach and Landing Systems (PALS) certifications for the carriers any time they come out of the yard or have an issue with PALS. We're basically the FAA certifiers for ACLS and ICLS; we make sure you can safely shoot an approach to the appropriate mins for each system (look 'em up if you're not positive) as well as take MODE I's to the deck. PALS cert is often conducted in conjunction with deck cert, so we try to make certain that all are happy (or at least satisfied) with the performance of needles and bullseye. What we often find is airwings complain that an "on and on" ACLS approach will drop you off at the start with a slightly sagging ball when the system was certified that very day. Hopefully we can shed some light on why this is sometimes the case.

Every landing system on the boat must fall within certain tolerances to be certified for arrested landings; the IFLOLS is no exception. We at carrier suitability cannot adjust the basic angle of the IFLOLS, but we do measure it precisely and we can easily contact the people who can adjust it. Prepare yourself for the beeps and squeaks. When the IFLOLS is measured for certification, it must fall within +/- 0.05 deg of exactly 3.50 deg. More often than not, the IFLOLS falls within tolerance but it's normally on the high end (3.55 deg basic angle vice 3.50). ACLS cannot be adjusted to a 3.55 deg basic angle but it can be measured very precisely (accuracy less than 1 ft at the start). The ACLS glideslope can only be adjusted by engineers at the beginning of each certification to provide a pre-cise 3.50 deg glideslope; otherwise, the glideslope on all PALS (IFLOLS, ACLS, ICLS) can only be set in 0.25 deg increments (3.5 and 4.0 in the case of ACLS).

No approach is perfect, whether it be MODE II, IA or I; however, a coupled approach should provide a glideslope extremely close to 3.50 deg (particularly prior to interaction with the burble). If you fly ACLS coupled and/or on and on, and the actual basic angle of IFLOLS is 3.55 deg, then you should be flying just below the centerline of the datums. Figure 1 shows a rudimentary pictorial repre-sentation of this concept.

“ACLS IS DROPPING ME OFF LOW!!!” LT LUKE “SMUGGLA” JOHNSON DISCUSSES THE FINER POINTS OF ANACLS CERTIFICATION.

http://www.hrana.org/documents/PaddlesMonthlySeptember2012.pdf

We'll start with the ICLS antennas; the azimuth antenna is located along the drop lights, but we're not terribly concerned with that right now. The elevation antenna, however, is located on a stand that is about even with the 3-wire, aft of the island on the starboard side of the boat and a little more than 18 ft high. I'm going to try for the short version of this sto-ry – 18 ft is higher than the average hook to eye value, plus the antenna is forward of the normal HTDP. Also, the ICLS antenna is about 4 ft below our eyes in the cockpit (assuming a Hornet or Rhino).

What do all of these numbers mean? For all intents and purposes it means the center of bullseye is about 7 ft above the beam of light in the center cell of IFLOLS (see Figure 1, which I know is not to scale - thank you, former test guys). Obviously, 7 ft of difference at the ramp is a lot; so that's why you wouldn't want to fly the ICLS to the deck, because if my arithmetic is correct that would be about 21 ft of hook to ramp (I went to TPS, no big deal). This is also why the ICLS is NOT a 200 – 1/2 system; it's a 300 – 3/4 system – if that was a surprise, grab your CV NATOPS and look those weather mins up. Finally, the ICLS coverage volume is obviously finite and doesn't lie on top of the IFLOLS center cell,so as you approach the in close position, you should see bullseye race up and off of the display (if they race down, you're really high). I'm guessing you all knew this, but hopefully this was a good refresher as to the why.

VX-23 PALS Discussion At the risk of geeking out too hard on Precision Approach and Landing Systems (PALS) after last

month's article, "ACLS is Dropping Me Off Low!!", this month I'd like to throw out a few nuggets of information with respect to ICLS. During our last PALS cert on the Truman, several pilots remarked that flying bullseye on a Case 3 ap-proach seemed to get them to that (HX) for which we all strive, while the needles got that little sagger (refer to last month's article) for which hopefully none strive. Chances are you all learned the reasons for the comfy ICLS start (is it ever at night?) at LSO school, but if you're at all like me, you may have crammed that knowledge in a hard to reach spot to make room for something else like directions to work, your wife's phone number (even though it's stored in your phone) or in exceptional cases the latest Top Gun standard timeline.

‘Paddles Monthly’ October 2012

Continued

Figure 1: ICLS/IFLOLS Differences

-LT Luke “Smuggla” Johnson is a test pilot with VX-23. He can be reached at luke.r.johnson@navy.mil

VX-23 PALS Discussion

So the bottom line is that if you fly a center (or even cresting) ball pass, then bullseye elevation should start to creep up-wards around 1 mile from touchdown and will really take off IC. And for one last parting shot, does it work as gouge for a decent start during CASE 1? It can, but depending largely on groove length and whether or not CATCC switched the ICLS to the correct glideslope after the IFLOLS got set to 4.0 deg for high winds, you could be in for a surprise. So use with caution. Thanks to anyone who cared enough to read and keep 'em safe, paddles. Also, I promise this will be my last PALS article… at least for a bit.

http://www.hrana.org/documents/PaddlesMonthlyOctober2012.pdf

Sierra Nevada to provide upgrade kits for carrier precision-approach landing systemsBY John Keller MILITARY & AEROSPACE ELECTRONICS

JANUARY 2015

JOINT BASE MCGUIRE-DIX-LAKEHURST, N.J.—U.S. Navy carrier aviation experts needed upgrade kits to improve the AN/SPN-46 automatic carrier landing system. They found their solution from Sierra Nevada Corp. in Sparks, Nev.

Air Warfare Center Aircraft Division, Lakehurst, at Joint Base McGuire-Dix-Lakehurst, N.J., announced an $8.2 million contract to Sierra Nevada to provide as many as 16 Block III receiver upgrade kits for the AN/SPN-46.

The Block III receivers are critical components on the AN/SPN-46 shipboard-based precision approach and landing system. The AN/SPN-46 precision approach landing systems from Textron Inc. in Providence, R.I., are installed on all U.S. Navy aircraft carriers.

The AN/SPN-46 employs low-probability-of-intercept technology to decrease the probability of passive detection by hostile forces. The AN/SPN- 46 employs an X-band coherent transmitter and receiver using monopulse tracking and Doppler processing on received signals for clutter rejection and rain attenuation at an operating range of eight nautical miles.

The AN/SPN-46 precision approach landing system (PALS) includes the Textron SPN 46 (V)1 and (V)2

automatic landing systems for aircraft carriers and amphibious assault ships. The system

landing guidance for aircraft during day/night operations and adverse weather conditions.

The precision approach landing system can control as many as two aircraft simultaneously in a leapfrog pattern; as each approaching aircraft, being assisted by the system lands, another can be acquired.

The AN/SPN-46 radar provides a Mode 1 approach. When engaged a PALS approach provides a hands-

Pilots reportedly do not use it often, preferring not

aircraft’s controls to a computer but it is important for controller to be able to take control when all other systems fail....

monthly A DD R E S SI NG T H E N E E D S O F T H E L S O C O M MU N IT Y T HROU G H S AF ET Y D I S CU S S IO N S, O P E R AT ION A L U P D AT E S , A ND H I ST O R IC A L R E A DI NG S .

February 2013

Couple-Up for Safety!! I heard a story a few days ago that reminded me of that simple phrase “Couple-up for Safety!” A Hornet was re-turning to the ship for a standard night Case III recovery. Having been flying at high altitude for an extended period of time, the aircraft rapidly descended to the ship into the hot, humid air that is the Gulf of Oman. Not surprisingly, the pilot ended up IFR in the cockpit with little relief from defogging attempts. The first attempt at recovery was terminated early when the pilot relayed that he could not see the ship at the ball call. So here’s where our simple phrase came into play. With recommendation from Paddles, the pilot coupled up for an ACLS Mode 1. The cou-pled approach, closely monitored by Paddles, resulted in an uneventful arrestment, demonstrating one of the exact situations for which the system was designed. We are taught early by our senior Paddles and the schoolhouse that the Mode 1 is to be used when the pilot’s ability to land the aircraft safely is degraded; be it IFR in the cockpit, inju-ry, 0-0 conditions, old guys & Marines (editor’s addition), or maybe even just returning to the ship after an 8 hour mission over Afghanistan. Depending on your airwing, you may not see many mode 1s at the ship. So how do you really know that it’s going to be working correctly for these situations?

Paddles http://www.hrana.org/documents/PaddlesMonthlyMarch2013.pdf

...continued in: http://www.hrana.org/documents/PaddlesMonthlyMarch2013.pdf

Recovery operationsAs with departures, the type of recovery is based on the meteorological condi-tions and are referred to as Case I, Case II, or Case III.

Case IAircraft awaiting recovery hold in the “port holding pattern”, a left-hand circle tangent to the ship’s course with the ship in the 3-o’clock position, and a maximum diameter of 5 nmi. Aircraft typically hold in close formations of two or more and are stacked at various altitudes based on their type/squadron. Minimum holding altitude is 2,000 feet, with a minimum of 1,000 feet vertical separation between holding altitudes. Flights arrange them-selves to establish proper separa-tion for landing. As the launching aircraft (from the subsequent event)

area becomes clear, the lowest aircraft in holding descend and

for landing. Higher aircraft descend in the stack to altitudes vacated

descent from the bottom of the stack is planned so as to arrive at the “Initial” which is 3 miles astern the ship at 800 feet, paralleling the ship’s course. The aircraft are then

the landing pattern, ideally estab-lishing at 50-60 second interval on the aircraft in front of them.

If there are too many (more than 6) aircraft in the landing

a “spin”, climbing up slightly and executing a tight 360° turn within 3 nmi of the ship.

The break is a level 180° turn made at 800 feet, descending to 600 feet when established

lowered, and landing checks are completed. When abeam (directly aligned with) the landing area on downwind, the aircraft is 180° from

the ship’s course and approximately 1.5 miles from the ship, a position known as “the 180” (because of the

closer to 190° of turn required at this point). The pilot begins his

beginning a gentle descent. At “the 90” the aircraft is at 450 feet, about 1.2 nmi from the ship, with 90° of

the pilot is crossing the ship’s wake, at which time the aircraft should be

and at ~350 feet. At this point, the pilot acquires the Optical Landing System (OLS), which is used for the terminal portion of the landing. During this time, the pilot’s full attention is devoted to maintaining proper glideslope, lineup, and “angle of attack” until touchdown.

Line up on landing area center-line is critical because it is only 120 feet wide, and aircraft are often parked within a few feet either side. This is accomplished visually during Case I using the painted “ladder lines” on the sides of the landing area and the centerline/drop line.

Maintaining radio silence, or “zip lip”, during Case I launches and recoveries is the norm, breaking

issues.

Case IIThis approach is utilized when weather conditions are such that

conditions during the descent, but visual conditions of at least 1,000 feet ceiling and 5 miles visibility exist at the ship. Positive radar con-trol is utilized until the pilot is inside 10 nmi and reports the ship in sight.

Flight leaders follow Case III approach procedures outside of 10 nmi. When within 10 nmi with

to tower control and proceed as in Case I.

Case IIIThis approach is utilized whenever existing weather at the ship is below Case II minimums and during all

Case III recoveries are made with single aircraft, with no formations except

in an emergency situation).All aircraft are assigned holding

180° from the ship’s Base Recovery Course (BRC), at a unique distance and altitude. The holding pattern is a left-hand, 6-minute racetrack pattern. Each pilot adjusts his hold-ing pattern to depart marshal pre-cisely at the assigned time. Aircraft departing marshal will normally be separated by 1 minute. Adjustments may be directed by the ship’s

(CATCC), if required, to ensure proper separation. In order to main-tain proper separation of aircraft,

Aircraft descend at 250 knots and 4,000 feet per minute until 5,000 is reached, at which point the descent is lessened to 2,000 feet per minute. Aircraft transition to a landing

10-nmi from the ship.Since the landing area is angled

approximately 10° from the axis

heading (Final Bearing) is approxi-mately 10° less than the ship’s

heading (Base Recovery Course). Aircraft on the standard approach (called the CV-1) correct from the

20 miles. As the ship moves through the water, the aircraft must make continual, minor corrections to the

the ship makes course correction (which is often done in order to make the relative wind (natural wind plus ship’s movement generated wind) go directly down the angle deck, or to avoid obstacles), lineup to center line must be corrected. The further the aircraft is from the ship, the larger the correction required.

Aircraft pass through the 6-mile

speed. At 3 nmi, aircraft begin a gradual (700 foot per minute or 3-4°) descent until touchdown. In order to arrive precisely in position to complete the landing visually (at 3/4 nmi behind the ship at 400 ft), a number of instrument systems/procedures are used. Once the pilot

acquires visual contact with the optical landing aids, the pilot will “call the ball”. Control will then be assumed by the LSO, who issues

ball” call. When other systems

approach will continue their descent using distance/altitude checkpoints (e.g, 1200 ft at 3 nmi, 860 ft at 2 nmi, 460 ft at 1 nmi, 360 ft at the “ball” call). Pilots are taught to always back up their other approach systems with this basic procedure.

ApproachThe Carrier Controlled Approach is analogous to ground-controlled approach using the ship’s precision approach radar. Pilots are told (via voice radio) where they are in rela-

(e.g., “above glideslope, right of centerline”). The pilot then makes a correction and awaits further infor-mation from the controller.

The Instrument Carrier Landing System (ICLS) is very similar to civilian ILS systems and is used on virtually all Case III

approaches. A “bullseye” is displayed for the pilot, indicat-ing aircraft position in relation to

The Automatic Carrier Landing System (ACLS) is similar to the ICLS, in that it displays “needles” that indicate aircraft position in

bearing. An approach utilizing this system is said to be a “Mode II” approach. Additionally, some aircraft are capable of “coupling” their autopilots to the glideslope/azimuth signals received via data link from the ship, allowing for a “hands-off” approach. If the pilot keeps the autopilot coupled until touchdown, this is referred to as a “Mode I” approach. If the pilot maintains a couple until the visual approach point (at 3/4 mile) this is referred to as a “Mode IIA” approach.

The Long Range Laser Lineup System (LLS) uses eye-safe lasers, projected aft of the ship, to give pilots a visual indication of their lineup with relation to centerline. The LLS is typically used from as much as 10 nmi until the landing

area can be seen at around 1 nmi.Regardless of the case recovery

-tion of the landing (3/4 mile to

up with the landing area is achieved by lining up painted lines on the landing area centerline with a set of lights that drops from the back of

maintained using the Fresnel lens Optical Landing System (FLOLS), Improved Fresnel Lens Optical Landing System (IFLOLS), or Manually Operated Visual Landing Aid System (MOVLAS).

If an aircraft is pulled off the approach (if the landing area is not clear, for example) or is waved off by the LSO (for poor parameters or a fouled deck), or misses all the arresting wires (“bolters”), the pilot climbs straight ahead to 1,200 feet to the “bolter/wave-off pattern” and waits for instructions from approach control....”

http://en.wikipedia.org/wiki/Mod-ern_United_States_Navy_carrier_

air_operations#Recovery_operations

http://www.navair.navy.mil/img/uploads/Truman1_1.JPG

Navy carriers prepare for X-47B unmanned aircraft arrival next yearhttp://www.navair.navy.mil/index.cfm?fuseaction=home.NAVAIRNewsStory&id=5068

Air traffic controllers aboard USS Harry S.Truman receive training and provide fleetfeedback on Navy Unmanned Combat Air

System Demonstration software during recentcarrier sea trials. (U.S. Navy photo) Jul 19, 2012

CATCCcarrier air traffic control center

“Sailorscontrol

aircraft ondeck inside

of carrierair traffic

controlcenter

aboard theaircraft

carrier USSTheodoreRoosevelt(CVN-71).

(U.S. Navy photo)”https://news.usni.

org/wp-content/uploads/2018/03/1000w_q95-4.jpg

L-CLASS PRECISION APPROACH AND LANDING SYSTEM (PALS) CERTIFICATION"Carrier suitability testing frequently

which is certainly the case for certi-fying amphibious assault ships (LHA and LHD classes). These ships have a Precision Approach and Landing System (PALS) similar to those cur-rently found on any aircraft carrier

-tion every two years. As VX-23

L-Class ships have a TACAN and

-

SPN-46 Automatic Carrier Landing

a SPN-35 which provides a precision approach capability. They also have an optical lens which appears similar

it’s located on the starboard side of the ship and on the back side

have a “tramline” which pilots use to

reference their lateral position.The goal of an L-Class PALS

that they get the pilot safely to the point where he can take over and

of an aircraft carrier. Obviously

approaches are terminated no later than 200 feet. The pattern is similar

a higher airspeed on downwind. The

cross-checking and reporting TACAN range and radar altitude on the radio. Simultaneously test engineers onboard the ship monitor the SPN-35 to ensure that it matches what the pilot is reporting. Technicians are capable of making near real-time adjustments if errors in the system are detected.

straight-deck boat is an interesting experience. Since there is no possi-

to the right of the wake and make the sight picture look like a CVN is almost irresistible. The location of the lens on the starboard side of the ship also contributes to the tenden-cy to drift right. Combine all these factors and add in the requirement

simultaneously reporting range and

quickly becomes a challenging task.To all those who get to enjoy

don’t get to interact with you as

VX-23 are dedicated to ensuring that you have the most accurate and reliable landing aids pos-sible. Please let us know if you have any concerns with your ship’s systems.

may not help us increase our trap -

LT Matt “Brasso” Davin VX-23 Ship Suitability"

http://www.hrana.org/documents/PaddlesMonthlyFebruary2012.pdf

Chief Air TrafficController

Ronesha Q. Nation,right, assigned to the

future amphibiousassault ship USSAmerica (LHA 6),

supervises Air-TrafficController 1st Class

Fernando Monteswhile he stands

approach controllerwatch from the ship’samphibious air traffic

control center. (U.S.Navy photo by Mass

CommunicationSpecialist 3rd Class

Huey D. Younger Jr./Released) http://

www.navy.mil/ah_online/america/

index.html# [6/10]

Bad-weather CV approaches – ORMcorner – operational risk management and constant velocity by Brian SchrumTrapping aboard the carrier has to be the most thrilling challenge experienced by carrier-based naval aviators. The last 15 to 18

However, the Case I, II, or III approach leading up to the ball call, at three-quarters of a mile, requires as much concentra-tion and discipline as the trap. Perfecting the skills to operate in this environment puts aviators to the test each day and night, in all weather conditions.

During our squadron ORM sessions, we learn how to iden-tify hazards and risks, make risk decisions, implement controls, evaluate our changes, and offer recommendations to avert

disaster and foster a safer evolu-tion. I hope this article spurs ready-room conversations on a topic not often discussed dur-

LSO lectures: Low-ceiling and low-visibility approach hazards. A recent air-wing recovery showed how inclement weather caused havoc to an unprepared naval aviator and LSO.

I had not given much thought to approach minimums during a Case III arrival to the boat until, as an LSO, I experienced the mass confusion that can occur during bad weather. We often work in a benign weather envi-ronment, but we always should be prepared to handle weather contingencies.

We were deployed on board USS George Washington (CVN 73) in the Northern Arabian Sea, in support of Operation Enduring Freedom. It was the end of July,

week of ops. ‘Throughout the

week, a low-pressure system dominated the area with ceilings at 1,000 feet or less, and visibil-

and haze. Because of the poor weather, we conducted Case III approaches every recovery.

when the weather is less than

visibility, or during night CV operations. The approach typically consists of marshalling aircraft behind the ship at vari-ous altitudes and distances. Each aircraft is given an approach time to sequence to the deck in a safe and expeditious manner.

3.5-degree glide slope at three miles--that should lead to an on-and-on start. Once inside seven miles, pilots can reference ILS (bull’s-eye) and/or ACLS (automatic-carrier-landing system or “needles”) to guide them. If the pilot does not have either

ILS or ACLS, he then relies upon

azimuth and glideslope calls, plus his self-contained approach numbers, to get him to an on-and-on start. On a standard

aids to get aboard. If one aid is malfunctioning, the approach may be off parameters. If we factor bad weather into the mix, a pilot could have their hands full, as they did on our LSO team’s particular wave day.

During these poor conditions, the CAG and squadron paddles step up and keep their fellow aviators off the ramp. Normally, paddles only passes “roger ball” and the occasional “power” calls to approaching aircraft. But, under degraded conditions, a paddles talk-down can be a rewarding experience. Such was the case that July afternoon when weather conditions sud-denly deteriorated to one one-quarter-time visibility and ceilings

at 350 feet or lower.Our team was scheduled to

wave a midday recovery and found the weather to be a safety factor. Paddles made the call for all aircraft to have their taxi light on, so the aircraft would

plane arrived at the ball call--at one and a half miles--we would break out and make an arrest-

on and on at three-quarters of a mile, and told the pilot to call the ball. “Clara” was all we heard. Cricket…. Cricket….

The hairs on the back of our collective necks stood straight up. We heard nothing for two or three seconds until, suddenly, a

moments away from taking a trap. CAG paddles gave appropri-ate calls to the pilot and received good responses; he safely trapped. Great, we have one aboard and seven more to go. We brought three more aircraft

down before the weather closed in on the ship, and we went below minimums. With more aircraft left to land, we thought about our options. The ship was working blue-water operations, and our nearest suitable divert

Aircraft were returning from long missions, some with ord-nance aboard, which presented us with low-fuel states and maximum-trap weights. Fuel was airborne but in short supply. The next event’s launch was on hold while the ship and air-wing leadership decided what to do. Vulture’s row saw more action as people wanted to watch the excitement and experience the deteriorating weather. Meanwhile, four aircraft tried to break out

Let’s stop right here and ask the question, “With the weather minimums continuing to drop,

can we wave an aircraft without

a paddles contact?”“Paddles contact” refers to a

call the LSOs can make to “grab” an aircraft from CATCC and talk him down to the landing area. To help answer this question, here are some ORM controls for the bad-weather hazard:

1. Weather minimums for our approach.

a. For an ACLS approach and ILS with PAR monitor, the

half-mile visibility.

b. If ACLS and ILS are not

feet, one and one-quarter

one mile for props.

2. CAG and squadron paddles experience levels.

3. Individual pilot training and experience levels.

4. CATCC equipment and crew experience.

5. LSO platform equipment.

6. Ship’s instrument-approach equipment.

What was the status of these controls during our recovery? Approach minimums, like those

don’t see our landing area and cannot complete a safe landing, we wave off--as mandated in OPNAV 3710. Both CAG paddles were on the platform, providing experienced inputs throughout the event. The pilots were mostly cruise-experienced and made

the pilots-in-command. CATCC was doing its best to provide glide slope and azimuth calls and had been working Case III con-trol for two months of our cruise. The LSO-platform equipment

operated properly, with the exception of the LSO HUD used for platform correlation of the ACLS. With this subsystem inop-erative, it took away one item the LSOs could have used to help wave the aircraft. Finally, bull’s-eye was down as the ship was

-craft remained airborne, and we contunued to push our approach minimums.

A COD diverted before get-

approach. A Hawkeye was given a talkdown approach by CATCC that

side of the ship, despite being

waveoff call from CAG paddles kept him from getting too close for comfort. Our last Hornet made his way to the ball call. After four agonizing seconds went by, with no sight of him, we waved him off. We never saw him break out of the haze but heard him climb off the port

side. Fortunately, everyone had enough fuel to make it to our

eventually cleared later in the day, and it was ops normal once again.

How far can we wave an aircraft in deteriorating weather conditions? The textbook answer is as far as the approach mini-mums allow. If CATCC does not hear “paddles contact” or “roger ball” from the LSOs. CATCC is instructed to keep glide slope and azimuth calls coming until the aircraft reaches weather minimums.

What if no divert was avail-able? Our plan was to tank every available aircraft in extremis, even calling in big-wing tanking to help until the ship found clear sea space. If a clear area was not found, and no tanking was avail-able, then we were to bring the aircraft lower than the minimums

near the ship.

a Mode 1 approach (basically an autopilot approach to the car-rier deck)? The letter of the law states that even Mode 1s can

minimums. A deviation would require a waiver from higher authority.

After evaluating the day’s events, I believe we had, and continue to have, controls in place that are more than adequate to respond to adverse-weather conditions. However, we do have to make sure the controls are operating correctly. The responsibility relies on great communication between the pilots, LSOs and the ship. As LSOs, we have to train the air wing and keep them up to

approach minimums.Pilots must be familiar with

how far to take an approach before waving off and must have

bring them aboard when they

hear “paddles contact.” Through good ORM, this knowledge may save your life one day. Fly a good, solid instrument approach in bad weather; this can mean the dif-ference between getting aboard or spending the night at your divert.

CATCC tends to take the heat for many issues regarding the Case III approach. The key to addressing any issues with

a pilot-debrief form. That stop in CATCC will get the techs on the case and repairs in the works. Timely feedback will assist the

a well-written aircraft gripe.As a paddles, I gained valu-

able experience on the platform, waving in adverse weather conditions. I also gained an even

as naval aviators.

http://www.navair.navy.mil/img/uploads/DSCN0036_1.JPG

“USS Abraham Lincoln (CVN 72) air traffic controllers conduct tests at Navy Un-manned Combat Air System Aviation/Ship Integration Facility (NASIF) in October atPatuxent River, Md. Using the program's Carrier Air Traffic Control Center (CATCC)simulator, controllers demonstrated the ability to operate manned and unmannedaircraft in a carrier environment using new digital message technology. (U.S.N. photo)”

By David A. Fulghum

Researchers are analyzing data from the first "hands-off" live-fly operations around an aircraft carrier--information thatcould lead to a specially modified F/A-18F Super Hornet landing on a ship without a pilot touching the controls in as littleas two years.

A pair of Boeing test pilots just completed a series of unannounced landing approaches and waveoffs with the USS HarryS. Truman operating near Norfolk, Va., on May 17-18. They closed to within 420 ft. of the carrier before conducting aship-controlled waveoff. The test aircraft--the first two-seat F/A-18F built--has been reconfigured as a surrogateunmanned combat air system (UCAS). The project parallels the company's effort to design a demonstrator for the Navy'sUCAS-D competition. However, company officials contend the demonstration wasn't designed specifically for thecompetition or for Boeing's new X-45N design.

The test was aimed at validating three crucial areas: networking of advanced radios between the aircraft carrier andaircraft, autonomous flight of dark and bad-weather carrier traffic patterns, and integration of aircraft position data into theshipboard air traffic controller's console.

After government officials canceled the Air Force's UCAS program in favor of a new manned bomber, they directedBoeing to work on a Navy-only effort.

"We made a company decision to leverage everything we'd learned [into] a surrogate UCAS-D demonstration using theF/A-18F-1 to prove our software for autonomous command and control [C2]," says Darryl Davis, vice president andgeneral manager of Boeing Advanced Precision Engagement & Mobility Systems (see p. 47). "We wanted to show that thetechnology is easily transferable from the X-45A [fighter size UCAS] and X-45C [bomber size] programs to [unmanned ormanned aircraft and] put ourselves in a credible position for the Navy's UCAS competition." However, company emphasishas shifted to make the autonomous landing capability a separate program and thereby applicable to any manned aircraft aswell.

Company specialists also built on 2006 demonstrations of an advanced radio--the Tactical Targeting Network Technology(TTNT)--as the primary command and control communications link. Coupled with the X-45 work, they had theunderpinnings for a surrogate UCAS that could be landed on an aircraft carrier.

Land-based demonstrations began at NAS Patuxent River, Md., in November. The modified aircraft flew approaches to avirtual carrier positioned in Chesapeake Bay. Boeing researchers ensured that their mission control element could interfacewith the Navy's shipboard air traffic control system (land-based at Patuxent River) and that the ship's system couldcommand the aircraft, in the pattern, in both visual and instrument weather approaches.

Last month, the demonstrations shifted to the Truman, which was integrated into the system with TTNT radios and themission control element. The Super Hornet flew to the ship as a piloted aircraft, but then it was coupled to the autonomousC2 system and the aircraft answered to commands issued by the shipboard operator through the ship's ATC system.

For the Truman test, there was a requirement to stay 660 ft. away from the emitters on the island as the aircraft went by theship, Davis says. Shortly before final approach, either the ship's ATC or the Navy UCAS control operator on the ship couldissue a waveoff command. The low approach to the ship demonstrated the ability of a tactically sized aircraft to operate ina carrier-relevant situation and "the ability of our C2 software to command the aircraft in a completely hands-off mode,"he says.

There were no changes to the flight control laws of the F/A-18F for this phase of the program.

"This was mostly about autonomous command and control with an existing, carrier-qualified platform and demonstratingwe could control it from the ship," Davis says. "For future activities, we may incorporate modifications to make the SuperHornet more representative of a tailless flying wing."

That may differ very little from a manned aircraft's approach, except that an unmanned aircraft can operate at a higherangle of attack because there's no need for a pilot to have forward vision.

"This design would actually approach the ship slower [less than 140 kt.] than the Super Hornet does today," says GeorgeMuellner, president of Advanced Systems within Boeing Integrated Defense Systems. "If you look at the Super Hornet andthe [F-35 Joint Strike Fighter], the actual come-across-the-end-of-the-deck characteristics are different from thestandpoint of what factors on the aircraft produce them. But the end results are very similar."

May's demonstration on the Truman was dictated by the flight characteristics of the Super Hornet.

"We were flying about an 8-deg. angle of attack, 3.5-4-deg. glideslope and an approach speed of about 135-142 kt.,"Davis says. "We weren't pushing the boundaries with this first set of demonstrations."

One of the most crucial areas for a tailless airplane as it approaches the back of the carrier is flying through the burble.(The burble is a region of turbulence created by the carrier.)

"In this set of demonstrations, we really didn't get to where that effect is encountered," Davis says. However, "the back ofthe carrier is one of those challenges we face in a tailless airplane." Nonetheless, researchers think they have sufficientwind tunnel data to suggest their tailless flying wing will have "plenty of roll power and longitudinal control."

"The difference in the F/A-18 and UCAS is not how much control power they need, but what effectors give it to you,"Muellner says. "Directional control power in an F/A-18 comes from a vertical tail. In a tailless airplane you get it fromother sources distributed across the airframe. The amount you need is driven by the aerodynamic and inertia characteristics.In reality, the farther out [on the wing] a differential control effector is [as with the UCAS design], the more control powerit has compared to something on the centerline."

"The burble isn't everything," Davis notes. "You can also add gusts and other turbulence. The carrier typically operates at10-15 kt. of wind over the deck, but you need to design your system so that it can handle up to 30 kt. In a low-speedapproach to a moving landing strip, you've got to show adequate control power all the way to arrestment. But all theanalyses show that we're in the high 90% compliance with the Navy's 'okay 3-wire' criteria--about 15-17 ft. of dispersionfor UCAS-D performance." During the demonstration, the aircraft actually encountered wind over the deck of "well over30 kt.," says Samuel Platt, project manager for the surrogate demonstration.

For the Truman demonstrations, Mike Wallace was the pilot in command. Platt flew as the weapons systems officer, onboard to monitor system health, signal strength and data link connectivity.

"If any contingencies had come up, they were there to uncouple the system and take over in a fully manned mode," Davissays. "So far, the pilots never had to take over control for any reason."

That record of no disengagements continued through the demonstration with no intervention from the aircrew during 14approaches over two days, which also included marshaling over the ship during visual operations (Case I) and to a remoteorbit during simulated dark and bad-weather approaches (Case III) before being vectored into a new approach. In fact,Platt says, the focus of the demonstration was primarily to exercise the entire set of procedures for both Case I and IIIoperations.

The system received praise from the ship's air traffic controllers and the aircrew. The data stream from the aircraftprovided much better situational awareness to ATC because it updates the aircraft's position continuously instead of onceevery 3.5 sec. as provided by the ship's radar. It also functions in the radar's 20-deg. blind spot that extends several miles infront of the ship. The aircrews liked the system because it monitors the ship's position and movement 20 times a second.As a result, ATC voice chatter is reduced substantially.

http://www.aviationweek.com/aw/jsp_includes/articlePrint.jsp?storyID=news/aw060407p1.xml&headLine=Super%20Hornet%20Demonstrates%20Unpiloted%20Approaches

Super Hornet DemonstratesUnpiloted Approaches03 June 2007

Researchers are analyzing data from the first "hands-off" live-fly operations around an aircraft carrier--inforrrrmatmm ion thhhhhhhaaaaatcould lead to a specially modified F/A-18F Super Hornet landing on a ship without a pilot touching the contrttrrroools in as llllllllittleas two years.

A pair of Boeing test pilots just completed a series of unannounced landing approaches and waveoffs with thehhhehe USS HarrrrrrrrryS. Truman operating near Norfolk, Va., on May 17-18. They closed to within 420 ft. of the carrier before connnnnddducting aship-controlled waveoff. The test aircraft--the first two-seat F/A-18F built--has been reconfigured as a surrogoooggateunmanned combat air system (UCAS). The project parallels the company's effort to design a demonstrator fofofofofoorrr the Navy'sssssssUCAS-D competition. However, company officials contend the d ddemoemoememoemom nstnnnstnstratratratratrratatioionionionionioni wawawaaaaaasn'snsnsn'nnn't dt dt dddddesiesiesis gnegnegngnegngnegnegnnened sd sdd pecpececifiifiififiifiififf calcccalcalccc ly lylylyly y forforforforfoforfor thththhhhhheeeecompetition or for Boeing's new X-45N design.

The test was aimed at vavavalidlidlidddatiatiatiatitiingnngngngnngngng thrthrthrthrthrthhhh ee eeeeeeeeeee crucrucccrruciaiiii l al al aaaarearerereareeaeassss: s networking of aaaaaaaaadvaddvdvdvadvadvdvaaanced radios between the airairairirircracracraccraaft ft ft ftft ftft fttt carrier andaircraft, auauauauutontontonononomoomoomoomoomoomoomomous usuuususus flifliflifflfl ghthhhth ofofofofofofoofof dark and bad-weateateaeateaeateatatherherherherheherhehere cacacaccacacacarrrir er traffic ppppppaaattaattaattatterneeereee s, and in gteggrataaaaationionionoonon ofofofofofofofof aiaiaaiaiiircrrcrrcrrcrrcrrcrrrcrrcraftaftaftaftafaaftafta popp sition data into theshihihiiipbopbopbopboppbopp ardardardardardardardrd aiir traffic controller'erer'er'r'r'r'r'r'ssss css onsole.

AftAfAftAftAftAfAAfteer eeee government officials canannnnnnncelcc ed the Air Force's UCAS S proproprproproooogragragragragragragragrarammmm imm n favovoooooor or or or or orr or oof aff aaa nenennenew mw mwwww mw maannaannannaanned eded bombobomberber, t,, theyyheyeeye dididirecrecrece tedtedtedtedddBoeingingingingingg totottotoo wowowowwwwoork rkrrk rk on on on onn a Na Na Na NNNNavyaaavyavavyy-on-on-ononooononoon yly y effort.

"We made a company decision to leverage everything we'd llearnedd [i[[[i[i[ ntontontooo] a]] a] a]]] sususurrorrorrorrorrogatgatgatgatgatgatgate Ue Ue Ue Ue UUUUCASCASCASCASCASCASCASCCAS-D -DDDDDDD dedemdemdemdemdeddememonstration using theF/A-18F-1 to prove our software for autonomous command and control [C2]," says Darryl Davis, viciiii e pe pe pee resresresideideidededededd nt nt nnnt nn andandaageneral manager of Boeing Advanced Precision Engagement & Mobility Systems (see p. 47). "We wanted to show ttw tthathathhh ththththttheeeetechnology is easily transferable from the X-45A [fighter size UCAS] and X-45C [bomber size] programs to [unmanned ormanned aircraft and] put ourselves in a credible position for the Navy's UCAS competition." However, company emphasishas shifted to make the autonomous landing capability a separate program and thereby applicable to any manned aircraft aswell.

Company specialists also built on 2006 demonstrations of an advanced radio--the Tactical Targeting Network Technology(TTNT)--as the primary command and control communications link. Coupled with the X-45 work, they had theunderpinnings for a surrogate UCAS that could be landed on an aircraft carrier.

Land-based demonstrations began at NAS Patuxent River, Md., in November. The modified aircraft flew approaches to avirtual carrier positioned in Chesapeake Bay. Boeing researchers ensured that their mission control element could interfacewith the Navy's shipboard air traffic control system (land-based at Patuxent River) and that the ship's system couldcommand the aircraft, in the pattern, in both visual and instrument weather approaches.

Last month, the demonstrations shifted to the Truman, which was integrated into the system with TTNT radios and themission control element. The Super Hornet flew to the ship as a piloted aircraft, but then it was coupled to the autonomousC2 system and the aircraft answered to commands issued by the shipboard operator through the ship's ATC system.

For the Truman test, there was a requirement to stay 660 ft. away from the emitters on the island as the aircraft went by theship, Davis says. Shortly before final approach, either the ship's ATC or the Navy UCAS control operator on the ship couldissue a waveoff command. The low approach to the ship demonstrated the ability of a tactically sized aircraft to operate ina carrier-relevant situation and "the ability of our C2 software to command the aircraft in a completely hands-off mode,"he says.

TheTheTheTheheh re rerere re werwerwerwerrre neeee nnno cooo hanges to the flight control laws of the F/A-18F for this phase of the program.

"Thhhhis is is is sss wawasaaasas mom stly about autonomous command and control with an existing, carrier-qualified platform and demonstratingwe cououould ldldldldld concocococcco trol it from the ship," Davis says. "For future activities, we may incorporate modifications to make the SuperHornet morererereree rrrepresentative of a tailless flying wing."

That may differfferererererr vvery little from a manned aircraft's approach, except that an unmanned aircraft can operate at a higherangle of attack bebebebeeeeccacccause there's no need for a pilot to have forward visiisiision.onon.

"This designgngngngngnnn wouldldldd acacacacacccctually approach the ship slower [less than 14141414440 0 k0 k0 k0 k0 k0 kkt.]t ] ththtththhhhan ann thethethethethethethee SuSuSuuSuSuperpperperppperperper Hornet does today," says GeorgeMuellner, prrrrrresieeeeee dent ooooof Af f Af Af Advanced Systems within Boeing Integregregrgrgrrrrateateaaateaa d Defense SySySySySyyyystes ms.ms.ms.ms.ms. "I""" f you look at the Super Hornet andthe [F-35 Jointntntntnntnn Strike FFFFFFFigigigigighter], the actual come-across-the--endendendendenendnnd-of-the-deck chchchchchhhharactectectecteteristics are different from thestandpoint of wwwwwwwhhhhhath factorsrsrsrsrs on oo the aircraft produce them. . . . ButBuBuBBututuut the end results asss ass a aare verererereereery similar."

May's demonstraaaatiotitiotitiotitii n on the ee TruTTTTTT man was dictated bd bbbby ty yyy ty tyy he flight characterisrisririisisistics ooooof tf tf f f tf tfff the hehe he he SuSSuper Hornet.

"We were flying abbbbbbbboutoooo an 8-degegegegegegeg.. a. ngle of aattattatatatataack,ckccckkk 3.5-4-deg. glideslopoppopopppppe aee nd an ananananananann approaaaaaccch speed of about 135-142 kt.,"Davis says. "We werenrererererereee 't pushing tggg tgg tg tthe bouuuuundandandandandandandaries with this first set ofofofofofofoof demonnnnnnnssstrsssss ations.""""

One of the most crucialalalalallll areas for a taitaittataitaitaiillelll ss airplane as it approachechechechechehheh s the bacbabacbabacbabaca k of the caraaararrier is flying through the burble.(The burble is a region of ofofofoofooff turbulence ccccccrrrrrear ted by the carrier.)

"In this set of demonstrations, we really didn't get to wherhh rre te te tttthathathathatat efeefeefefefeffecfecfecfecffect it it it it it iis s ess es s eeenconconcocccocouuntuuuunn ered,"d,,," DDaDDaDDaDDavisvisiiss sasasasasasays.yyys.ys.ys.ys. HoHoHoHoHowevwwwwe er, "the back ofthe carrier is one of those challenges we face in a tailless airplane." Nonethelellll ss,ss rererereeeeeseaseaseaearchrchrchrcrchchhherserserserseerserers thththththhiinkininkinkinknk thththhhey eeey eyeeyy hahavhahahhhha e sufficientwind tunnel data to suggest their tailless flying wing will have "plenty of roll ll powpowpowpowpowowowowwwer ereereerr and longiggggigigitudtudtudtudttudtudtudinainainaiinainanal cl cl cl cl contonontontontrol."

"The difference in ththtthe ee FFF/A/A/A/A-/AA 1818 andananandndndnd UCUUUCUCUCU AS ASAASSS is isisissss notnonotnottt hohohohhohoh w mwww uch contrntrntrntrnnntrrololoololololll powppoppop wwer they need, bbbbbutut ut utut ut utt whawhwhawhawhawhahat et et et et ett et eeffffffefffff ctors give it to you,"MueMM llnllllll er says. "Di"Di"D"Directional control power in an F/A-188 cococococoooomesmemmemememe frfff om a vertical taillll. I. I. I. I. I. I. IIn annn tatatatattaaiillilliillillilll esssss aaaiaaa rplane you get it fromother sources distributed across the airframe. The eeee amoamoamoamoamoamoamommountuun you need is driven bbbbby ty ty ty ty ty ty tthe hh aeaeaeraeraerererodyooodd namic iii andandandandandandndnd iini ertia characteristics.In reality, the farther out [on the wing] a ddddddiffiffiffiffiffiffff ereereereereereereeerential control effector is [[[[as aas asssss witwwwiwwiw h th t ttttthehehehehheheheh UCAUU S design], thehehehehehee more control powerit has compared to somethingg on the centerlinii e."e "e "e "e "

"Th"Th"T"ThThThThThe be e be bbbburburuuu le isnisnisnisnisisisn't everything," Davis notes. ". " "" "YYYou can alsosososososoooo add gustststs as as as ss as as nd nndndnnd othtther turtt bulb lb ence. TheThTh carrirrirriririiier eereereree typically operates at10-15 15 115 5 kt. of wiwiwiiiiiind ndnndndnd over the deck, but you needededededeed to design yyyyyyyourourourouroururr ssyssyysystestestem smm smm ssssoooo too hat it can handle up to 30 kt.t.ktktt.ktt. IIInIn a low-speedapproaaaaach cchchchh h to a moviovioviovioviovivinng landing strip, you've goooot tt t tt t t to show adddddddequeeqeqeqeq ate controloloo powpowpowpowpower all the way to arrestmennnnnnnt. t. t. t. t. But all theanalyses shoshssshshsh w that wewewwwwwee're in the high 90% compppppppplllilliaiii nce with hhh thettththtt Navy's 'okay 3y 3y 33333-wi-w-w-w-w-w-w re' criteria--about 15-17 f7 f7 f7 fftt.t. of dispersionfor UCAS-D pD pD pD pD performancananaanaann e." During the demonstratratrrarararaation, the aiaaaiaiiircrrcrrrr aft actually encououountentenntententered wind over the deck ok okkk ok ooff "well over30 kt.," says SSSamuamamamammm el Plaaatt,tttttt,tt,t,t,, project manager for theeeeee ssssurrogate ddddddddeeeeemonstration.

For the Truman demememememooonsonon tratioioioiiioons,nnnn Mike Wallace was theththethethehththee pilot in cocococommand. Platt flew as the wewewewweweweapoaapapap ns systems offiicercercercere ,, onboard to monitor systtem ememememmmm healthhhhhhhh, s, s, s, sssignal strength and daaaata tatatatattaa link connnnnnnnneeecte ivity.

"If any contingencies had c ccomeoomomom up, t, t, t, t, t, tttheyhhhh were there to uncncncnccccoooooouple theeeeeee ssssysystem and take over in a fully mannnnnednednednedned mode," Daviviissssays. "So far, the pilots never hr hr hhhhaaad aa to taktaktakttaktakake over control for anananananannyy ry eason.n.nn.n "

That record of no disengagements ss cococococococonco tinuedueueuedededd through the demonmoonoonoononstration nnnnnn witw h no intervention from the aircrew during 14approaches over two days, which alsolsosoo inininiinincludeddeddedddeddedded marshaling oveeeer tr tr tr trr tr trr ttheheheheheheheeee shishishishshishshh p dp dp dppp uring visual operations (Case I) and to a remoteorbit during simulated dark and bad-weaweaeaeaeaththeththth r aapprpprpppprpppppppp oaches (Case III) beforerereeee bbbbeing vectored into a new approach. In fact,Platt says, the focus of the demonstration wawawwwawawwass primiimimimimmmaarily to exercise the entirtittitirtirttire set of procedures for both Case I and IIIoperations.

The system received praise from the ship's air trafafafaffffficficficficficficficficc cooontrnnntnntntrnntrollers and the aircreeeeeew.www.ww ThThe data stream from the aircraftprovided much better situational awareness to ATTTTTC bC bC bbbbbecaecececeeeec usessesesessese it updates the aircrrrcrcrrcrrccrcrraftaftaftafaftf 's''''s's s position continuously instead of onceevery 3.5 sec. as provided by the ship's rradaadaadadaadaaddad rr.r ItItIIIt alsalsalsalslsoo fo fo fo ffununcuncuncunctiotiotiotioionsnsnsns in ininin innn thethethetheththh rarararadardardard 's's's's 20-20-2020-2 degdegddegdegddegd . b. b. bbbbllinl d spot that extends several miles infront of the ship. The aircrews liked the syssysysysyysystemtemmmm bebebebebeeeecaucaucaucaucausesesesese it itiii monmonmonmononitoitoitiitoitoitoit rsrsrsrsrs thethththethththh shshhhhip'ip'iiiip'ip'p s ps ps ps ps pppposiosiosiosiosiosiosiositiotiottiotion annnnnn nd movement 20 times a second.As a result, ATC voice chatter is reduced substantintiiiiallaaaa y.

http://www.aviationweek.com/aw/jsp_includes/articlePrint.jsppppppppp?s?storyID=news/aw060407p1.xml&headLine=Super%20Hornet%20Demonstrates%20Unpiloted%202020ApApApApApApApApApApApApprprproaoaoaoaoaaaachchchchchchchc eseeseesesese20Hornet%20Demonstrates%20Unpiloted%%%%%%2202020202020202020220ApApApApApApApApApprprprprprppp ooooo sssss

rrrattttttttttttttessUnpiloted Approaaaacccccchhhhhheeeeeeeeeees03 June 2007

By By By BB DavDavDavid ididi A.A.A.A FulFFuFulF ghughug mmmmSSSSSuper Hornet Demonsttt

Unpiloted Approaaaaccccc

"You take most of the unknowns away," Platt says. "You have complete situational awareness, and you don't have to talkto find any of this out."

While tests could have continued for three days--about 1.5 hr. at the carrier per day--the data points were all collected byearly in the second day. Expected approach times were falling within 1 sec. of those assigned. The test aircraft operatedwith manned aircraft in the pattern above them and on the flight deck. The demonstration also provided two areas of datathat could not be simulated adequately--the actual ship's motion and operation of the advanced radios once they were on aship, Platt says.

When X-45A operation started at Edwards AFB, Calif., controllers demanded a sterile air and ground operations. But asthey gained confidence, the aircraft was integrated into normal operations.

"This demonstration takes that confidence a step further by showing they can influence the vehicle in real time," Muellnersays. "Either of the two controllers can tell it to waveoff, and it's gone. This shows the repeatability that UAVs can giveyou" with autonomous response to contingencies the aircraft may encounter that are embedded in the mission managementsystem.

Flying to an arrestment on the deck will have to wait until a precision, Differential GPS system is installed on the aircraftand the ship. However, the follow-on phases are planned. The technology is expected to benefit not just the UCASprogram but virtually any aircraft that lands on an aircraft carrier. As a result, Boeing will help with risk reduction on theNavy's Precision Approach and Landing Systems (JPALS) development, as it would work with the Super Hornet and F-35Joint Strike Fighter. It then could be further modified to work with whatever design is selected for the advanced unmannedstrike program.

Boeing also has plans to integrate the aircraft with a new deck control device so that handlers can move aircraft around theship in an unmanned configuration.

"That would take some time and additional investment, but what we're doing has great applicability to Super Hornets andother naval aviation platforms," Davis says. "It's also applicable to the land-based Broad Area Maritime Surveillance[BAMS] unmanned reconnaissance aircraft."

As for follow-on phases, if Boeing's design is selected, Davis says that in an aggressive program the team could proceed toarrested landings and maneuvering around the deck in two more iterations at sea. "In the first, you will check everythingout, do a lot of low approaches, then go to touchdown and bolters. In the second, you fly to an arrestment. We could be atthe carrier arrestment in about two years."

There may be a place for the UAV management system in the U.S. Air Force as well.

"This system has great applicability to precision-navigation, autonomous aerial refueling in both the Air Force and Navy,"Davis says. "The Air Force Research Laboratory demonstrated it last summer using a tanker and a C-21 as a surrogateUCAS. The technology included TTNT, Differential GPS on the C-21 and KC-135 tanker. We flew it into the pre-contactposition in the refueling box. There's also the potential for unmanned-to-unmanned aircraft refueling.

"You could use this system for collaborative manned-unmanned operations, be it strike, electronic attack orreconnaissance," Davis says. "You could have two UCASs and a couple of Super Hornets much like we've shown you cando with the two X-45As. There are lots of extrapolations you could make. You could do ops with two Predators, BAMS orwhatever. That's why in the X-45A program we demonstrated multiple unmanned aircraft operating collaboratively toprosecute a target set in a preemptive, destructive and reactive suppression of enemy air defenses."

d you don't have to talk

ts were all collected bbbbbyyyyytest aircraft operated

vided two areaeaass os f datadios once theyheyheyhehe wewewewewerre on a

und operations. Buttttt as

in real timememememe,," MueMuMueueuellnery that UAVsss cacacacacan gn gn gnn iveiveiveiveivehe missiosioion n mn mmmaaanagemeeee ent

installed od od oon tn tn tn hehehe hh airirircraftt jussst tt tt tt he hhhh UCAUUCUCCC SSSSSth risisiisi k reductititiion n n on thee SupSupupuu er Hornetnnene aaand F-35the advadd ancancanccced ed ed ed ed unmunmunmunmuunmanned

move ve ve e e airairairrrcraaaaaft fft aaaround the

y to Super Horrrnnetnetnnetee sss anditime Surveillaaannnceee

he team couloululululd pd pd pd pd procroo eed towill check ck ck eveeveeveeveeverytytthinhh g

eststststmenmm t. tt WeWW could dd bbbe atatata

he Air Fooorcercrcercerce and NNNNavyavyavyaa ,,"C-21 a1 a1 aaas as as a susussusurrorrorror gatgatgatgatateeeee

w it iiintottt the ppprre-contactng.

attack orke we've shown you cancanantwo Predators, BAMS org collaboratively to

NATOPS

F/A-18E/F

http://www.vfa-41.net/media/FA-18EF%20NATOPS.pdf

Shipboard Automated Landing Technology InnovationProgram, John Kinzer Aircraft Technology ProgramOfficer ONR 351, 2 November 2011http://www.defenseinnovationmarketplace.mil/resources/USN%202011

%2011%202%20Shipboard%20Automated%20Landing%20Tech.pdf“Shipboard Automated Landing TechnologyInnovation (SALTI) — VISIONAll sea based naval aircraft, manned and unmanned, fixed wing androtary wing, will utilize optimally automated ship launch andrecovery to the operating limits of the ship / aircraft system• Flight operations Warfighter Payoff- Increased safety, reduction in mishaps- More operational flexibility through expanded shipboard operatingenvelopes and flexible flight deck usage- Reduced landing intervals, bolter and waveoff rate (shorterrecovery periods, reduced fuel consumption)- Increased shipboard sortie rates, reduced ship and aircraft fuelconsumption, recovery tanker “give” requirements, ship andsquadron personnel fatigue, etc.- Potential for common capability with DVE and obstructed LZ opsashore• Aircraft / ship design and maintenance- Reduced landing gear and related structure- Reduced number of wires / arresting gear engines- Reduction in ship support systems (landing aids, displays, etc)- Reduction in inspection and repair for hard landings- Increased fatigue life• Flight training- reduction in training time / cost (decrease in ship landing initialtraining, qualification, and currency requirements)- indirect benefits may include reduced environmental impact andpublic complaints due to FCLPs (noise), cost of equipping,maintaining, and manning outlaying landing fields, etc.&

SALTI Technical Objectives• Precise automated approach and glideslope control - Reduced susceptibility to wind gusts and turbulence - Accommodation of high sea states, higher winds from all directions,degraded visual environment - Precise, predictable touchdown: reduced scatter in sink rate,sideloads, touchdown spot, hook-to-ramp distance, centerline deviations• HCI for manned aircraft for optimal situational awareness, control, anddecision making• Ability to operate under night, degraded visual environment, andemissions control (EMCON) conditions• High integrity systems for naval seabased operations - Excursion: ability to conduct VTOL ops onto ships without specializedmodifications• Optimum commonality among aircraft and ship types, and ship / shoreapplications&• Technologies - Flight Control * Modified control laws for precision control * Gust sensing and alleviation - HCI and ship integration * Ship based pilot displays * Cockpit displays * GCS and ship systems interface * LSE interface - Navigation systems * GPS based precision landing algorithms being worked by JPALS,UCAS-D programs * Supporting / alternate systems (ship and/or aircraft mounted)• CVN: adapt existing systems/sensors, propose new sensors • VTOL: EO/IR, radar, LADAR - Deck motion prediction and compensation * CVN, L-class, and small decks – existing algorithms adequate? * Prediction and integration with aircraft control • CONOPS: adjustments to take advantage of enhanced precision,efficiency, safety, envelope expansion, reduced maintenance”

http://aviationspottersonline.com/landing-on-uss-george-washington-cvn-73/

USS Carl Vinson welcomes Pax River team 13 Feb 2015USS Carl Vinson public affairs http://www.thebaynet.com/articles/pdf/50493/1-

“Members assigned to Air Test & Evaluation Squadron (VX) 23, based at Naval Air StationPatuxent River, Maryland, embarked aboard USS Carl Vinson (CVN 70) to ensure the shipand its aircraft’s Precision Approach Landing System (PALS) and Automatic Carrier Land-ing System (ACLS) are operating at their full capabilities, Feb. 1.

Normally the VX-23 crew will maintain both systems before a ship departs for deploy-ment and upon its return to homeport, but due to the length of Carl Vinson’s current de-ployment, experts felt the need to inspect Vinson’s systems before the ship returnedhome.

“This was a very unique opportunity for NAVAIR [Naval Air Systems Command] and theship,” said Lt. Matthew Dominick, VX-23 Carrier Suitability Department project officer.

“We were able to conduct flight tests while having no impact on the ship’s missionreadiness and its support of Operation Inherent Resolve.”

During their visit, the team conducted 21 fully automaticcoupled landings with a 100 percent completion rate.

“Complex pieces of equipment such as these require a unique amount of maintenance,”said Kevin Nolin, NAVAIR Patuxent River senior technical specialist. “If we receive newsthat the systems aren’t as accurate as they should be, we have the capacity and experien-ce to address and fix any problem that may arise. We are confident that both systems willbe fully functional.”

Keep’em Safe Paddles Fellow BPF’s, Air Bosses, Mini’s, and supporters of the greatest vocation on the planet, The manager has asked for the ball, and has signaled for the lefty, CDR “Potzo” Pothier. Yours truly is moving on and hanging up the paddles, so I wanted to take one last opportunity to wax poetic from my seat as the Dean of the Navy’s finest institution of higher learning. As most of you know I’ve never been at a loss for words and this will NOT be the exception. It has been an interesting ride here at the school house and I would be remiss if I didn’t publically thank our very small staff for their dedication to providing the best training possible afforded by our shoe-string budget and limited manpower. During my tenure here, we’ve completely re-written the syllabus, superbly polished the MILCON where we reside, and grown as a staff by 100%. There have been hook slaps, landing mishaps, fouled deck landings, and most interestingly, a crusade aimed at yours truly for a change to NATOPS that ended up being rescinded. Despite the ebb and flow of the good and bad, I wouldn’t change a thing. Because in the end, the Paddles community has become more tightly connected than it has for many moons, and that had nothing to do with us. We simply created an environment in which YOU had a forum to fine tune our business and communicate freely with no fear of recourse or derision. And exciting times are on the horizon. During the course of the next few years, F-35’s will land on the boat, an un-manned vehicle will conduct a cat and trap, and at least 3 nations will join the ranks of tailhook aviation. Make no mis-take about it; I’d stick around if I could. With that being said, the community is in extremely good hands with the arrival of the new Dean.

In order to feel good about myself and feel validated about having come full circle. Let me share with you a few of the priorities I outlined within the first few weeks of my arrival: 1. Curriculum Overhaul – the entire syllabus (soup to nuts) has been updated, changed, and improved in order to offer

students the training that they need. 2. LSO & CV NATOPS rewrite – The 2011 release of both of these pubs were the largest single rewrite in the last 10

years. 3. LSO PCL publication – The beta version hit the fleet last year and we are working on version 2 currently. 4. LSO Standard Briefs – Available for download from the website, these briefs ensure that there is commonality of pur-

pose irrespective of air wing or coast. 5. LSO Reference Manual – The new manual was released in 2010 after more than a decade hiatus. It is our “Top Gun”

Manual and has all of the information an LSO needs in a searchable format (PDF).

“The New Dean Checks In” ...CDR MATT “POTZO” POTHIER TAKES THE REINS OF THE US NAVY LSO SCHOOL.

“KEEP’EM SAFE PADDLES” ...PARTING SHOTS FROM THE DEAN. “WEEDS” SIGNS OFF AS LSO SCHOOL OIC.

6. iMOVLAS – After nearly a decade of fighting for it, we finally got iMOVLAS fully funded. It will hit the fleet after I’m gone, but the dollars are there and it’s coming to a CVN near you. 7. iPARTS – You asked for a replacement to APARTS and the new system is going through DT and OT right now. We still have an uphill battle to get it fully funded and made a program of record but we’re fighting the fight. 8. LSOT Upgrade – We asked for better fidelity in the trainer and a 21st century solution to our synthetic training environment and we finally got the folks with the money to say yes. The upgrade to the trainer will begin later this year and will be fully functional sometime in 2013. These priorities were published on July 1st, 2009 (on our newly minted website), and I am extremely proud of the staff for getting this done. In the end, a rallying cry from you (the fleet) helped us achieve these goals. And for that I thank you. Like any reputable organization, we are focused on continuous improvement. And yes, I still have some itches that have yet to be scratched. In no particular order:

Shore-based IFLOLS. Despite our constant whining and nagging we can’t seem to convince the folks with the purse to get us more units. Please continue to fight this fight. To give up now would spell disaster as these things continue to age and become more and more prone to failure.

“Mea Culpa”. In the very recent past there has been a growing reluctance to share shortcomings or deficiencies with

our friends around the fleet and, quite frankly, it scares the hell out of me. The hallmark of our profession is that we only tell lies during the debrief. You have to reverse this trend and “open up the kimono” when re-quired so that others don’t have to learn the same lesson themselves.

Fiscal austerity. Unsure of what the near future holds, but make no mistake about it. There are many folks out there

that view “prep for ops” as low-hanging fruit and you will have to continue to fight for time in the pattern. Flight hours are not on the rise and many of you will have to be creative to get the folks that need it time in the pattern, in the simulator, and in the debrief so that we can continue to operate safely behind the boat.

Finally, your collective professionalism and talent has allowed us (the naval aviation enterprise) to enjoy one of the longest periods of mishap-free flying, behind the boat, in history. (I hope all of you are rapping your knuckles on wood right now). Now don’t f@#$ it up. In addition, the paddles community is one of the last bastions of fraternity-like communities left in the Navy. Please continue to cling to that tradition and wear the float coats proudly. I look forward to buying each of you a cold beverage should our paths cross with my retiree money and as usual… Keep ‘em off the ramp and in the spaghetti. V/R Weeds

Keep’em Safe Paddles (cont.)

Paddles monthly A DD R E S SI NG T H E N E E D S O F T H E L S O C O M MU N IT Y

T HROU G H S AF ET Y D I S CU S S IO N S, O P E R AT ION A L U P D AT E S , A ND H I ST O R IC A L R E A DI NG S .

July 2012 http://www.hrana.org/documents/PaddlesMonthlyJuly2012.pdf

‘HOOKSLAP’

Over Page

After hitting theramp, the hookpoint skippedalong the deck.It had to travelnearly 200 feetto get to the firstwire.

The two cuts inthe paint of theramp are wherethe sides of thehook pointtouched down.This is called a"hook slap".

A clearer view ofthe hook pointmarks on theround down.

The good newsis that he'scorrecting tocenterline.

The blackskid marksare wherethe jet'stirestoucheddown, lessthan 20feet fromthe ramp.

https://www.facebook.com/media/set/?set=ms.c.eJw9yskNADAIA8GOIpvDQP~_N5YGS52iXYghtyEZNH67hw6D7s5dFhb5z~%3B3zWdlx9zw~%3B5.bps.a.161460767247470.35282.161036483956565&type=1

CarrierLandingConsultantsApril 20, 2011‘HOOK SLAP’

Joint Precision Approach and Landing CVN Simulation JPALShttps://www.youtube.com/watch?v=ajZGPSVlWm4

JPALS Precision Approach and Landing Expeditionary for USAFhttps://www.youtube.com/watch?v=iTtVf-qZVro

See F-35C JPALS CVNCarrier ApproachSimulated HMDS Viewhttps://www.youtube.com/watch?v=tJ3lHvv-v0c

Northrop Grumman joins Honeywell in project to upgrade Navyshipboard aircraft landing systems – 10 Oct 2013 – John Kellerhttp://www.militaryaerospace.com/articles/2013/10/northrop-jpals-upgrade.html-

“PATUXENT RIVER NAS, Md., 10 Oct. 2013. Air traffic control experts at the Northrop Grumman Corp. Elec-tronic Systems segment in Woodland Hills, Calif., is joining the Honeywell Inc. Aerospace sector in Clear-water, Fla., on a project to upgrade precision landing systems aboard U.S. Navy aircraft carriers & amphib-ious assault ships. Officials of the Naval Air Systems Command (NAVAIR) at Patuxent River Naval Air Stat-ion, Md., have announced their intention to award five-year contracts to Northrop Grumman and Honeywellto upgrade & improve Navy Precision Approach Landing Systems (PALS) on carriers & big-deck amphibs.

The contracts to Northrop Grumman and Honeywell have yet to be negotiated, and should be awarded inFebruary, Navy officials say. The contracts, which will be basic ordering agreement (BOA), will be for ser-vices and materials to fabricate, modify, repair, replace, upgrade, and improve PALS components, assemb-lies, and associated hardware. PALS provides precision landing information to air traffic controllers andpilots during final approach while landing aircraft aboard aircraft carriers and amphibious assault ships.

Northrop Grumman and Honeywell are to return the [PALS] system to a level of serviceability compar-able to a new system, and will include previously produced and delivered navigation and communicationsystems and equipment, to include fault isolation, assembly, disassembly, and refurbishment of parts, com-ponents, assemblies, and material for the PALS navigation and communication systems. Northrop Grum-man and Honeywell are the original manufacturers of the navigation, communication, and guidance equip-ment, and the companies are the only qualified providers of the necessary work, Navy officials say.

JPALS is an all-weather landing system based on real-time differential correction of theGPS signal, augmented with a local area correction message, and transmitted to the uservia secure data links. The onboard receiver compares the current GPS-derived positionwith the local correction signal to deliver a three-dimensional position that is accurate en-ough for all-weather approaches via an instrument landing system (ILS)-style display....”

https://gps.stanford.edu/research/early-research/jpals

JPALS Guides An F/A-18A Hornet To First Automatic Landing Aug. 30, 2000 Raytheon PR

Raytheon Company completed a major milestone last month during shore-based flight trials of its Joint Precision Approach and Landing System (JPALS) technology demonstrator. The flight trials, conducted by the Naval Air Systems Command(NAVAIR) at NAS Patuxent River, Md., achieved the first automatic landings in an F/A-18A Hornet using the Global Positioning System (GPS)-based JPALS system for guidance.

The JPALS system combines the satellite-based GPS, data link and computer technology to yield an integrated, multi-function air traffic control system that provides landing, sur-veillance, TACAN-like navigation and two-way data comm-unication. The result is a simple, low-cost and highly reliable system that is compatible with the Navy's future ship de-signs and aircraft equipage. The above deck,

-

-

Glenn Colby, the Navy's technical director of the JPALS pro-gram, said, "During this first phase of JPALS, the primary focus was to achieve the accuracy and robustness neces-sary to support shipboard approaches, including fully auto-matic landings."

Colby further said, "The Navy and Raytheon have been working together to develop the necessary techniques to make this system a reality. The ship stabilization and air-craft integration processing has been implemented in a system developed by NAVAIR called the Naval Avionics Platform Integration Emulator (NAPIE), which allowsthe decision makers to evaluate operationally relevant per-formance early in the test program."

Captain Jim Campbell, head of Air Traffic Control System Development at NAVAIR, said, "We had only planned to be post-processing data from the flight tests at this time. In-stead, the maturity of the Raytheon prototype & the NAPIEintegration system have allowed us to perform production-representative Mode I landings on shore well ahead of plan. We are now scheduled to conduct flight tests aboard the USS Enterprise in November 2000. This is a significant acc-omplishment given the extreme difficulty of developing a shipboard auto-land system and demonstrates what can be achieved when top technical talent from the Navy and its contractors work as a team."

https://tinyurl.com/y4etclmbhttp://www.defense-aerospace.com/article-view/release/2840/f_18a-makes-automatic-landing-with-jpals-(aug.-31).html

Who’s on the Ball- communication breakdown while landing on carrierby Jeff Blake…from high above the glides-lope to well below, all to the tune of blood-curdling

the waveoff. In the cockpit, I heard none of it…

We’ve reached the midpoint of our deployment to the Mediterranean and the Arabian Gulf. After an uneventful night OPFOR hop, I’m spending my time in marshal with the typical excitement and apprehension of the upcoming night trap. I’m

with a full-up system and no problems of note (later analysis will reveal an intermittent IFF). Also airborne and playing a vital

I’ve commenced a normal

Case III approach and, reaching

to assigned button 17 (chan-

intermittent Mode II from my aircraft is about to produce mass confusion. With no Mode

on the approach. I proceed on the approach. At three miles, I commence tipover on the ILS bullseye, disappointed that

aircraft for the ACLS approach.

from the bolter pattern two miles in trail.

my aircraft, only one other

his screen, which of course is

-

mile, I get indications of ACLS

other aircraft.You can imagine the confu-

sion on the platform when

lens, and paddles radios have

channel A. Paddles desperately scrambles to reset the gear and

of the incorrect lens setting,

Unfortunately, the LSO radios are never switched to channel

comment (on channel A) and interprets it as a ball call.

-

focused on the needles. At half a mile, I realize nobody has told me to call the ball. As I transition my scan to the ball, I’m surprised to see the lens showing what appears to be a nearly clara high pass, with the ball barely visible on the

correct the high but receive no response. Again I call the ball--now it’s coming down toward the center. Still no response

ball call, then push the throttles to mil for an in-close waveoff

me that paddles agrees with that decision.

As I clear the ship and climb

symbology of needles remain-

Strange! Confusion sets in; I deselect the needles and con-

convinced that I must have lost my radios. In the boiler pat-tern abeam the ship, my radios

sorry about that… we had a little problem with the lens,

everyone, including the boss and the captain of the ship,

unfolds, and it becomes very apparent how close tonight

camera replay tells a chilling

from high above the glideslope to well below, all to the tune of blood-curdling power calls,

saw a stable centered-needles

waveoff only because I hadn’t -

ber the ball coming down but did not recognize how rapidly it was falling.

chain of events was the waveoff lights from paddles and a sense

have been severed earlier? First, an intermittent transponder was the catalyst to this entire melee.

your IFF is being called intermit-tent or inoperative, you may be susceptible to a sequencing problem on the approach. One

training and oversight, to prevent the inadvertent ACLS

also decided that the Air Ops status board should list recov-ering aircraft in order, rather than by aircraft type. Also, the departure controller, previously

will now assist in correlation and

What could I have done? First, I could have listened to

clearly predicated by a call from

was at three miles, not one. I heard the call and reported the needles, but never made the correlation between the

called. I heard what I wanted to hear, not what was actually

hear the discrepancy on their

made a sarcastic comment and deselected the ACLS. If you’re aware that something’s wrong,

might end up saving your own life, or the life of one of your air-wing buds.

it, and the ultimate responsibil-ity for this near-miss rests with

yourself to use everything at your disposal: ILS and ACLS correlation, self-contained

and, ultimately, the world’s greatest glideslope indicator, the fresnel lens. As a nugget

my scan was unfortunately still developing. On this approach, I’d put all my marbles into one bag, the ACLS; after all, nee-dles don’t lie, right? Well, that night they weren’t lying, but the story they were telling was not intended for me.

mi_m0FKE/is_7_46/ai_78333957/

http://www.afceaboston.com/documents/events/cnsatm2011/Briefs/03-Wednesday/Wednesday-PM%20Track-1/01-Faubion-JPALS%20Prog%20Overview-Wednesday%20Track1.pdf

“‘Salty Dog 110’ from Naval Strike Aircraft Test Squadron 23 (VX-23) prepares to land on USS Theodore Roosevelt (CVN-71).This picture was possibly taken in April 2001, when the Joint Precision Approach Landing System (JPALS) test

team successfully performed the first global positioning system (GPS)-based automatic landing to an aircraft carrier.Based on GPS, JPALS is intended for military aircraft including manned and unmanned fixed-wing, vertical takeoffand landing (VTOL), and rotary-wing aircraft, and is designed to replace tactical air navigation (TACAN) systems andaugment the current automatic carrier landing system (ACLS) and instrument carrier landing system (ICLS).”http://www.navsource.org/archives/02/71.htm

1

SHIP SUITABILITY PRECISION APPROACH & LANDING SYSTEM (PALS)

[VX-23 Strike Test News 2010] Lt Daniel “Butters” Radocaj

CVN PALS CERTIFICATION & MEMost of us have seen or will see a VX-23

-

-

-

-

-

-

--

-

-

-

-

-

-

2

JOINT PRECISION APPROACH AND LANDING SYSTEM (JPALS)

J -

-

-

--

-

--

---

-

-

-

--

-

--

--

--

-

-

http://www.navair.navy.mil/nawcad/index.cfm?fuseaction=home.download&id=824

PALS Certification• SPN-46 Automatic Carrier Landing

System (ACLS)– All CV/CVN ships

• Includes “hands-off” automatic landing

• SPN-41 Instrument Control Landing System (ICLS)– CV/CVN and LHA/LHD ships

• Provides “needles” indication

• AN/SPN-35 Precision Approach Radar– LHA/LHD ships

• Provides ship-based controller “talk down”

approach capability to all aircraft http

://w

ww

.dtic

.mil/

ndia

/200

7te

st/F

isch

er_S

essi

onH

4.pd

f

STRIKE TEST NEWS Air Test and Evaluation Squadron 23 Newsletter 2012 IssueJOINT PRECISION APPROACH AND LANDING SYSTEM (JPALS) LT Luke “Smuggla” Johnson [page 19]”...Shore-based testing began in early July 2012 with a Beechcraft King Air 100 series aircraft provid-ing a low cost airborne testing lab-oratory for JPALS. Further shore-based testing with legacy F/A-18’s

-cal year with at-sea tests beginning in spring of 2013 onboard CVN-77. Though a fully integrated JPALS air wing is not expected for sometime, both contractor and VX-23 person-nel are already working closely with

-sets to ensure delivery of a quality system that will provide enhanced

SHIP SUITABILITY PROJECT TEAM LCDR Robert “Timmay!” Bibeau, Ship Suitability Department Head

”...MANAGING MODE I EXPECTATIONS [page 17-18]

We usually do this about every two

years, early in the workup cycle as -

tion. Our goal is to verify that the IFLOLS, SPN-41 (Instrument Car-rier Landing System, or ICLS) and SPN-46 (Automatic Carrier Landing System, or ACLS) function proper-ly, are aligned with each other, and lead the pilot to a good start. We check the average ACLS Mode I hook touchdown point and tweak it if necessary. As part of this process

over a three day period. Additional-ly, VX-23 troubleshoots PALS anom-alies when they occur. Sometimes there is a hardware-related root cause which needs to be corrected, but sometimes concerns result from pilot misconceptions or unrealistic expectations.

Whether or not you’re a fre-quent Mode I user, it is a valuable “tool” with the capability to recov-

-ditions. Understanding a few basic concepts about how the system op-erates is crucial. The “99 taxi lights on” call is too late to consider how

The ACLS can be set to either 3.5 or 4° glideslope, and it is nor-

-manded glideslope. Typical verti-cal error at ¾ nm is less than a foot. In fact, the ACLS is usual-ly more accurate and precise than the IFLOLS. The IFLOLS is aligned to a tolerance of +/-0.05°, which equates to almost 4 feet at ¾ nm, and a single IFLOLS cell at the same distance covers about 10 feet of elevation. Remember that there is no center cell on the IFLOLS: you are either looking at the high-center/”cresting” cell or the low-center/”sagging” cell. Most IFLOLS are aligned just a little on the high side, which means that more often than not during the Mode I you are on glideslope but looking at the low-center IFLOLS cell.

-cept being low, and are more likely

-coupled passes. Additionally, experi-enced pilots often try to “crest” the

-tween two adjacent cells in order to see ball movement and more

precisely determine glideslope. To a

uncoupled passes, a Mode I often looks a little low all the way, when the reality is that normal uncoupled passes tend to average a little high-er than the nominal glideslope.

Much like your FNG, the Mode I does not anticipate the burble. The

glideslope and reacts to any devia-tions as they occur. The system re-acts very quickly to very small de-viations, but there is still some lag

control/engine response time. Often this will result in a little settle as the aircraft passes through the burble. The magnitude of this settle tends to increase with the strength of the burble, and is more noticeable with axial or starboard winds.

Shortly before touchdown the SPN-46 antennas lose the ability to track the aircraft due to the rapidly changing line of sight. 1.5 seconds prior to touchdown the system en-

-tempt to hold the last commanded

and throttles will still move as the jet works to maintain this descent rate, but the system is no longer actively updating the descent rate to target the desired hook touch-down point. Any unpredicted dis-

-

around the ship) are not correct-ed for. The system is often still re-acting to the burble when it enters

settled in the burble, the command-

Put all of these effects together, and a “typical” Mode I pass on most ships looks a little low all the way, with a little settle in close and a lit-

attempt to tune the Mode I touch-down point for ideal winds. When winds are less than perfect Mode I performance tends to degrade. As winds become more starboard the strength and position of the bur-ble change, and the magnitude of

the trends noted above increases. Settles tend to increase in magni-

-ter at the ramp, overcorrecting for the settle in the burble and often landing long and right with the oc-casional bolter. Hornets try to do the same, but often don’t have the power to recover from the settle and tend to land a little short.

These behaviors are gener-al trends. Ultimately it’s up to the pilot and LSO to decide the accept-able magnitude of deviation during a Mode I, and the pilot must always be ready to take over manually when required. Understanding the normal behavior of the ACLS Mode I can help manage expectations and better prepare the pilot and LSO for deviations when they occur. VX-23 is always available to discuss PALS performance. If you notice a trend of questionable Mode I performance, or experience even a single un-safe Mode I, please don’t hesitate to contact us....”

http://www.navair.navy.mil/ nawcad/index.cfm?fuseaction

=home.download&id=670

1

STRIKE TEST NEWS Air Test and Evaluation Squadron 23 Newsletter2013 Issue [produced 11 Oct 2013]Precisions Approach & Landing System (PALS) Mode I Performance & Winds

LCDR Pat “ WHO?” Bookey

You’ve probably seen us borrowing -

-

-

-

-

--

-

--

-

-

-

--

-

-

--

-

--

--

-

MORIAH

2

-

--

-

--

-

-

-

Hornet tends to settle into early wires

-

On one ship, the dif-ference in wind direction/magnitude measured from the STBD anemome-ter to the actual WOD in the LA was large enough to create an adverse starboard wind condition strong enough to degrade Mode I perfor-mance to the point where the ship

thought something was wrong.

--

--

-

-

--

-

--

---

-

http://www.navair.navy.mil/nawcad/index.cfm?fuseaction=home.download&id=767

Ideal No.3 CDP Arrest EA-18G VIDEOhttp://www.youtube.com/watch?v=BqZWXuRFX6Y

How to get an Ideal No.3 CDP Arrest EA-18G VIDEOhttp://www.youtube.com/watch?v=MZ6ECPe7VRI

http://issuu.com/rockwellcollinshorizons/docs/horizonsvol14issue3/1

Using the new LDGPS under jamming conditions, the C12J readies to touch down atHolloman AFB, NM, on April 5. The system’s nominal accuracy is about 2 m.

These two trailers contained the

station used for the LDGPS testflights. Two external differential-GPS receivers are located in the

field about 150 ft away. Electronics in the trailers picked up the local

jamming signals, mitigated them, and generated clean differential-

GPS data that was sent to theaircraft by data link.The NAV

Pallet of ARINC’sLDGPS isprepared for a ground test. After groundtesting was completed in March, thepallet shown was placed on board a USAFC12J for the flight tests.

In early April, ARINC EngineeringServices successfully flight tested anew precision approach and landingsystem designed to withstand elec-tronic jamming that military aircraftmay encounter in combat situations.The flight tests were conducted atHolloman Air Force Base, NM.

A U.S. Air Force (USAF) C12Jaircraft equipped with ARINC’s newLocal Area Differential GlobalPositioning System (LDGPS) mademultiple precision approaches whileelectronic jamming was activated. TheLDGPS used for the flights is atechnology demonstration testbeddesigned to provide a verticalaccuracy for Category II approachesof 5.3 m, even when subjected toGPS jamming. Ground tests of thesystem were completed at HollomanAFB in March.

“Many weapons systems today relyheavily on GPS positioning, and thatmakes the threat of GPS jamming akey risk area,” said Tom Sanders,

ARINC’s Director of Satellite Naviga-tion and Air Traffic Control &Landing Systems.

The technology uses multiple jam-resistant GPS receivers on the groundand a single anti-jam GPS receiver inthe air to provide an accurate“differential GPS” position. Theaircraft receives needed GPS correc-tions from the ground over a VHFdata link system.

The USAF LDGPS project is part ofthe Joint Precision Approach andLanding System (JPALS) program that

is a joint effort to develop a next-generation precision approach andlanding system for the Department ofDefense. LDGPS is focused onenhancing flight operations on land.

In a parallel effort, ARINC isdeveloping a Shipboard Relative GPS(SRGPS) demonstration system aimedat enhancing naval shipboard flightoperations. According to the com-pany, JPALS is currently in a technol-ogy maturation and risk-reductionphase, with system developmentplanned for fiscal year 2006.

ARINC’s jam-resistant JPALS demo takes flightelectronics testbed and ground Aerospace Engineering June 2004

https://www.sae.org/aeromag/techfocus/06-2004/2-24-5-25.pdf

JPALS

US Navy to guide JPALSback on track 01 JUN 2004 STEPHEN TRIMBLE

The US Navy is working to get a $2.3 billion project to develop a GPS-aided landing system for aircraft on ship decks back on track after funding shortfalls delayed initial fielding by six years. Interested companies will be briefed on the revised schedule next month, while the navy plans a new round of risk-reduction flight tests for early next year.The navy version of the Joint Precision Approach Landing System(JPALS) was to become operational in fiscal year 2007 but is not now expected to come online until at least 2013, says navy pro-gramme manager Capt Pete Riester. A land-based version of the system is also being developed for the US Air Force.

How JPALS will be fielded initially - as either a land-, aircraft- or ship-based system - is still under debate, but the basic concept is"more than likely that a [Boeing F/A-18] Hornet must be able toland on one of my carriers," says Riester. Plans to add JPALS to helicopters, cruisers and destroyers have been delayed indefinitely for funding reasons.

Riester's staff has nearly two years to refine the operational plan for JPALS. In April 2006, the programme faces a go-ahead decis-ion to enter a four-year system development and demonstration phase. At that point, says Riester, the navy programme may be merged into the same contract as the USAF version, which has already been awarded to Raytheon.

Although stuck in pre-development, navy JPALS has already achieved several breakthroughs. First, its relative GPS signal technology - linking an F/A-18 and the USS Theodore Roosevelt - completed the first "hands-off" carrier landing three years ago.Last month, ARINC also tested a secure VHF datalink thatshould permit JPALS transmissions despite jamming attempts.

Baseline requirements for JPALS include transmitting the ship's location out to 370km (200nm), allowing an aircraft carrier to trackup to 50 aircraft within 50nm and providing precise location data on landing to within 15cm (6 in). The system is based on the Ship-borne Relative GPS (SRGPS) signal which establishes a fixed point on the carrier as the ground-truth for navigation and broad-casts the co-ordinates and error readings to aircraft with JPALS-equipped receivers.

Because the technology can correct for the aircraft carrier's move-ment in six axes of motion, SRGPS also is considered a primecandidate to guide unmanned air vehicles during formation flying and autonomous refuelling. Sierra Nevada, which designed the SRGPS signal used during the F/A-18 hands-off landing in 2001, plans to perform an autonomous refuelling mission later this year.

https://www.flightglobal.com/news/articles/us-navy-to-guide-jpals-back-on-track-182368/

https://www.militaryaerospace.com/articles/2015/08/collins-differential-gps.html

JPALS: Not Just LAAS in Navy Uniformby William Reynish | Oct 1, 2002 | http://www.aviationtoday.com/print/av/issue/feature/JPALS-Not-Just-LAAS-in-Navy-Uniform_12893.html--

"The seagoing Joint Precision Approach and Landing System for the U.S. Navy provides much more thanGPS differential accuracy corrections. It uses data link to give pilots a plethora of data from a host ofsources. When the U.S. Department of Defense opted for the Joint Precision Approach and Landing System(JPALS) in the mid-90s, most observers understood that this would be the military’s version of the GPS-based Local Area Augmentation System (LAAS), which is being developed for the Federal AviationAdministration (FAA). And to a certain extent, it will be. When deliveries commence around 2010 to the Army,Air Force, Marine Corps and Navy, land-based JPALS installations will closely resemble the FAA system.

Extraordinary Environment [Full article on next page+1]But the seagoing JPALS will be a horse (or a LAAS) of a different color. One of the biggest differences will beits data links. For, as development has evolved, carrier-based JPALS has become a generic term applied to awider data link environment than just the automatic landing portion.... In fact, the Navy’s seagoing JPALS willbe the centerpiece of a dedicated, data link-based, communications, navigation and surveillance/air trafficmanagement (CNS/ATM) system, which will be aboard each of its 12 carriers. The Navy needs such a capa-bility to provide safety, airspace management and, of course, surveillance protection against adversaries, asthe vessel moves away from the mainland and across oceans, often towards unfriendly territory.

In a way, it will be like picking up a complete FAA air route traffic control center (ARTCC) from the main-land, along with all its radars and infrastructure, and shoehorning it into an aircraft carrier. And since thecarrier’s raison d’etre is to extend military air power in all weather, you could even say that the seagoingJPALS’ ultimate purpose is to thread the tip of an autolanding aircraft’s arrester hook through an imaginary9-square foot (0.83-square meter) box centered precisely 14 feet (4.3 meters) above the pitching and rollingstern of a carrier in very low visibility, by day or night....

Distribution A. SPR 11-875UNCLASSIFIED / 7

60 NM

10 NM

200 NM

Marshal

Approach Coverage

CCA Coverage

Ship Location Coverage

Ship to Air broadcast allows aircraft to find ship under conditions out to 200 nm

Two-way datalink with ship when within 60 NM supports NATOPS requirements under all conditions. Position

reports supplement radar and IFF data in Carrier Control Area (CCA) displays

Supports precision approach within 10 NM, 360 deg around the ship, Downlink to ship provides for

CATCC/AATCC, LSO and Primary Flight Control to monitor approach. Supports autoland (ACLS

replacement)

1

2

3

1

2

3

GPS Satellites

Supports At Least 50 Aircraft

ATC* and Surveillance Data

ATC* and GPS Augmentation, Navigation Data

A

B

AB

Satellite Based Augmentation System

(SBAS)

SBAS Signals

GBAS VHF Data Broadcast (VDB)

Ground-Based Augmentation

System (GBAS)

Collocated Nets

Wave off

* CATCC/AATCC is capable

http://www.afceaboston.com/documents/events/cnsatm2011/Briefs/03-Wednesday/Wednesday-PM%20Track-1/01-Faubion-JPALS%20Prog%20Overview-Wednesday%20Track1.pdf

Joint Precision ApproachandLanding System (JPALS)

Program Update 15 June 2011

���������� ���������

����������� ������������������������ ����������������� ������������������������� ������������������������� ������������������������������ ������������������ ��!�� � ������ ��"���������� � ���� �������������������� ���� ���� �William Reynish

�������������� ����������������������������������������������������� ��� ��� ������������������������������� �!�������"���#����$������������ ������%�$&��"��������&�� ��'��#��������������(��" ������� &���� ��$����� ���������������!�%��������"�������#�&�������������)���� &��#� �������������� ����� )�� ��������� ����� ����*����!����%�&&�"���������&�#��������������� ��$��+ , ������������!�����)����!�- �����.����� ���/ #�!�& ���" ������������ && ������%�&&��&���&�������"&������ )�� �������#$�����������#���������0$�������� �����������%�&&�"�� ����������� ��������� �������������&���1����������"�������������������%�&&�"������ � �&��2��)��!� ����#�&�������� ���#�&#��!�� ������" ���������� ��"������ �������������� ��&������� %������ � �&��2���#����������� ��3$������� $��� ����& �������������

� ���" ����$�����%�&&�$����������#������ &!�����&��45)�� � �&��2������ ������&�� &����������� &�(�� ��$� �����������������& ������ ���� ���0$�� "� ��� �� ���� ���� �����!� ��$� ���������������%�&&�"��3$����������� ���&���������� �����&�*�� � �&��2���#���������6���/ #������*� ������������#��������� ��$�������" ������������������� ���������&���������������� �������#�&�������� ���������� ���� ��!������"������� 2�������� ����& �����

7��� ��!�����/ #�'���� �����������%�&&�"��������������������� ������ ���!�� � �&��2�" ���!�����$��� �����!� #�� ����� ����$�#��&& ���8 ����� ������ � ��������./8�6-��������!�%�����%�&&�"�� "� ���� ����������,+� �������6���/ #���������$��� �� � "�&����������#����� ����!� ���� ���� � ������� ��!������$���!�$�#��&& ��������������� � ����� �#��� ����!� ������#����&���#��� % ������������ ��& ��� ��� ��������� ��!��������% ����$�������&�����������

7�� �% �!����%�&&�"��&�2�����2����$�� �����&����)��� �����$����� �����������&����������96..������������ ��& ��! &����%���� &&������ � ��� ������� ���$��$��!� ����������������������� �� ���� ���� ��������������������� �����'���������� ����������*�������&�� ��� �����%������ &&�%� ����!���$���$&���#���� ���� �������� ����������'$&��� ����$���������������� ������������� �� $��& ������ ���� ��'�� �����������2�����$��� ���� ��� ������:$ �������� ;<��:$ ����������"�*�����������������&��,=�������=<��������� "�#��������������� �����&&������������ �� ���������#����&�%�#���"�&���!�"��� ����������

�� �'������!����� ���� ��� �������&��)�,=�6��� ��� ���)8��,;�5������!����"��3��������������$�$���"�$�� ��������" �� ���#����&�����.�4��� ������������2��)����������)���6���/ #�'�������%�&&�"�� �� ��������������������" ������"&����

#� ��������������%���������������� ������������������$�$���,��>!�%������������ ���'��������9�:$���������1#��������.�$���&��91.�����$�������?��������������� ������?�6�������$������ &&�������? �� ���&�����&�� "&�!� �#�����%� ����! �#��������� ��!��$�#�# "&�!�� ��� �� "&�� ������������ "&������������ ���� ��� ���& ������������!����& �� ��� ���� !��� ���$�����������% ���������%�������&���� ���#���"�&���� ���&��������� �����?

���&���� ����$����� ������ ����� ������!�����������&����#�� �&���%����/ #��% ������������������!�%�������� ������ ���$�$��� ���� ���� ���������� ������%�$&��"������&�� $��� ���� �������&�����$���"$�� �� ������������� �������"&��. � �$&��& $������ ������2�& �������%�$&��"���$&&�� $��� ����.���$��� �����!�� #�� ���� ����$�#��&& ����%�$&�����&������$���� � �&��2��� ���������������������$�$��� � �&��2���������������� �� ���� ��!������"������& $������� �����& �����!�%�$&����� �&����� �����#�� &&��&������ ����

)����$������ &&�������� ���� ���#���!����% �������$����������������&��"�&��������%����& �������$�� ������������������ ���������2!�%������������ &&��� ��"���������� ���������� ������&���������#�!�����/ #�'���$�������/8�/�=,� ����=@������$����� ��� $��� ����� ������& ���������������7.�� ����.��� ���#���$ &&���� ��� &���� ���6���� ������������&�������� ��������������#�� &&�� ������� �2����������� ��� ���������&����$��$�����������������������% #���� ������"� ���/�=,���������� � ��" �����/�=@���� ��$� ������$����������� $��& ����:$��������

/ #���& �����!���%�#��!�� %��� ��������&�� �������!���#�&�����"�� 9 ������ !���$&��"���������������&����������������� ��� ���������&����%��2����������$�$���� ������� �2�������!� &���$��� ��$"�� ��� &� ��$�������#�&�������%�$&��"����:$�����6������3���������%������������������ �# �������#�&��������� �������������� &���������� ��������� ���� &��� �$�� �������������������� ��!��������� ���� �����#�&������������� ���*����������� #���������A> ���&&���!� �������$������ ���� ����� ��������������$���+ +>� �������� ������� ��� ��$���A>B ���&&����

��&�'��"��� ��%�&&�����/ #�������������������C�D������ &&�!��������#����%�&&������#�� ����$��!�&�%����" "�&�������������������7�!�%���" ����5)�� � �&��2����%��2����� ���������� ���� ���� �������D ���� ������" �������%��2%�&&������� ��� &&� ��������������$��� �����!�� #�� ����� ����$�#��&& ���!��&$�� ����� ������ � ������!��$���� �� ��$�����+ �� $��� &���&���������&&����� &��%�&&�� #�������$�� ���� ���!�%������������������� ���� $&���&�� ����6������%��2�%�&&�$�����#���!� ���3 ��������&������ ���?�� �$��&���?����� ��������$���� �����������������������#���� �#��� ��������������������������������'��&�� �����7��%�&&��$����������&����� ���&�#�&����� � �&��2���#��������������������� �������+ !�> � ���+ ���� ��$�������� �����

6���$���$������+ ����� ��$�!�� ��� ���� ��'�������� &�� #�� ����8(���������%�&&�"�� $��������"���������� ���� � �&��2���#�� ���������#��������� ��$� ��������������!�"������& ��#���������� ������ ������������ ���� ��������� �� !��$��� ��� �2�������3���������� &������������������"�������������������������� ��?6�.�/�&�2�!?������������������$������$�����������5)�� ���� &� ���� #�� ������6�.�/��������!�%��������#�������&����%������� ���� ���"� ����������� ��������������� ������5�%�#������������� &8(�8� � �&��2����"�� �����%�&&����#����$�������������� ����� ���%�&&����& ���6�.�/!�%������ ��� � �&���� �����!� &����%����������������$����#$&��� "�&�����

)�������������� ������ � �&��2���$������������ �����!���&����%�&&�"�� "&�����������������%��&�� ��� ����$�� ������������������$&���$����������2��������& �������� ����������� ������.�67��6��������� ����� &���%�&&����&$������&�� �������������� ���� ��!�%������ #��"�������������"�������$�#��&& ����� � �������$�&������ ������� �2������#����&�� ���� � �&��2���$���6���$������������#����&�'�� � ������� ����$& �&��# &$ "&��%��������� �����'�� � ��� �����$����%����� ���������� ����#����������6 ���������������"��� ���&&���� ��"�����% ������ ��������&������������.�� ���� ���%�&&�"��� � �&��2��� �����!� ��%�&&��&&�?������&�?�.�67�� ������%�&&!������$���!� ����������#����������� ����!����������������7))��� ���D ��� ���� ��� &���%�&&�� ������&&������ #��� ���� #������!%�����%�&&��������������$���$������ ���� ����$�����+ ���� ��!� � ��!��������������� &������������.�67

������� "�$��> ������������ �����!�� ����� ���$�� ����� ���� ���%�&&������$������%��% ��������&&�����&��� � �&��2�����$��� �������.���.����#�� ����������#����&'�� ����� �����������&���6.���������)������$�����$������!�#���������$��� ������%�&&�"���������� ���������$���#�����������������?����% &&�?����"������� &&���������E���6���� �����'���6.�� ��&���� &���%�&&� ��$� ��&���� �2�� ��� ���� ���#� � $��� ��������������$�#��&& ���������7����������> ����E���!� �����$� ����� � ������� ����� �������������D-�6��� � �&��2%�&&��"� ���� ������$������ ���� ��'����������!��$�&��� ��!�%� ������� �$�� ���������� ������6���D-�6�&��2�%�&&�������������� ���� ��'�������$���������� ���# &!�& ��������������� ������3������& ������%�����!� �����:$������������ ���$����������� &F& ���$��!�&�����$��!� &���$��� �������F ���# &��� ��������� ������ ����� ��$�� ����� ���� ���D-�6� &���%�&&������� ������� ���# &� ������ ��$����&�%�!� &���$�������& �����%�&&�"��&������ �����

��� �+ ����� �������������� �����!����� $��& ���&�#�&����� � �&��2����� ������2��2�������&��2���� � �%�&&���&$���& ������%� ���������������!��$��� ������ &&������� ���%���������� ��������������#�������� ���������2!�&$������������$�$�&��$�� ����(������������ &� ��$� �������������������& �������������:$��������� �����&�2����������� ���� ���6���������������%�&&�"������& ��"$��%�����$���������� ��$� ����� ��������$�����������������������" ���������$����

#$��������������6�� ��$��������* ���������������������� ���� ��'�� �����������2�%����������#������ &&� �� ��������� ���������2!����/ #���$�������������������� &��$�#������$����'���� &������2���� �����96G��(��������:$�!�%�����$�������� �������� ����������(������ &����� ����#�� ��$� �����%������������������6���/ #����:$���������E��� & ���#����� &� ��$� ��������&������ ��,>�����>���������!�%�������������� ��$� ����������������� ��,,��������<@����������������, ���&&����& ������

9����"����� ���� ��� ������:$ ��������"�*C�6���/ #��� �����#����� �� ��$� ������������������ ��������"&���� $��& �������*��������%����)8��,;�� ��������� ���� ������� ������� ���& ���� ��&�����!�$����� ���������!����������������������������3$�������%����96G�6������#���� &���� ���������� ��������������'�����$�������(��3 �����

. ��������&���!���%�#��!� &����$�����������%���������� &&��������& ��������� �#���������� ���#����� ���%�$�% ���� �� &���� ���������"��������!�� &&���!���&&���� ���� %����"��� �������� ������� ��� "�$�������$����%������%��&������������!�������$��� &����� ���* ��&����������������&���!������������� ���� ��� ���� �2��3$���+ �������@,��������������������%������

0$�������� ������ ��%�������!�����9� &�������������������������2���#�����!�����#������������� �����'������� &�� #�� �����������!� ���������$ &&��$�&��2������ �� ���� ��!� ������ 2���������� &� ���� ���6�������������� �������������� $��& ���������!�%������ 2��� ����$��� �3$�������� &&�����% �������$����%�F��!������������&�!������������������& ��������� �����������2��* ��&��"��%��������������� ��������� �������� "&��!���$�����%����� ������������� �������������2�= �������,++��������� � ��������%�&&�"���� ��%�&&�������?"�&���!?��� ����&���$&��*���������$����"��� # &� #� ��������� �� ���� ���%����� �����������2������������� "&�� ����������������� 2�� �������� ���� ���0$������������%'��/ #�!�"�&������ ������&��"�� ��$������ "&���������������=�!�������������� ������&�%�

6����� ���� ������$�����������"$���������������������� �F����� ������������������#��$ &&��0$�!����� ���$��������&�!�������� ��E ������� ��� ���& ���� �&� �������&�����������#�&������� ����������������������'����&�*�����% �������97/.�7��!���� ��&��!�-���%%% ������������ 3����& �������������� ���%��&���� ��&���� #������!��97/.� &���� ��# ����*������������ #� ������ � �&��2�!����������� �&������ ���������� ��"��������$��� ������ ���������� ����������������������.�9������$�$�����#�&� #� ���������� &�� � �&��2��0$�����% ��������"������*��&&�������� &&����"���������������� ���� ���� ��� $������������ ���'���������� �� ���E ���������� ��1���������1�����������������+ ,���1������#�������% �������������������� �

http://www.aviationtoday.com/print/av/issue/feature/JPALS-Not-Just-LAAS-in-Navy-Uniform_12893.html

http://www.aviationtoday.com/print/av/issue/feature/JPALS-Not-Just-LAAS-in-Navy-Uniform_12893.html

http://www.aviationtoday.com/print/av/issue/feature/JPALS-Not-Just-LAAS-in-Navy-Uniform_12893.html

http://www.aviationtoday.com/print/av/issue/feature/JPALS-Not-Just-LAAS-in-Navy-Uniform_12893.html

is consideredthe most critical part offlight, we are responsiblefor a safe approach dur-ing a terminal phase offlight," said Air TrafficController 3rd Class KyleEberhart. "PALS worksby locking onto theaircraft & verifying ‘theneedles’, & it sendscommands to land theaircraft safely."

Air traffic controllersoperated two types ofradar, the "Easy Rider"AN-SPN 46 & the "Bullseye" AN-SPN 41, for thecertification.

The AN-SPN 46 radarlocks onto the aircraft &uses 3 different modes tosafely guide the pilotback to the ship.

Mode 1 takes completecontrol of the aircraft &its landing.

Mode 1A takes controlof the aircraft & transferscontrol back to the pilot30 seconds prior to thelanding.

Mode 2 allows forcomplete pilot control."-

https://shopping.advcs.com/articles/Bullhorns/Bullhorn42.htm

“PALS

200 FT DHCAT I

100 FT DHCAT II

2,862 ft

0 FT DHCAT III

150 ft 954 ft

Requirements• Service Interoperable• Multiple Runway Configuration• Mobile; Supports all Landing Ops• Replaces Legacy Systems (ACLS, PAR, ILS)

New Project: Land-Based Joint Precision Approach & Landing SystemJ m

http://www.afceaboston.com/

documents/events/nh09/653%20ELSW.pdf

DH = DecisionHeight (Landor NOT)

This graphic depicts the concept of operations for the JointPrecision Approach and Landing System, or JPALS. Theland-based JPALS program recently had its funding restoredand a request for information was sent out March 2, 2011.An Industry Day will be held April 5, 2011. (Courtesygraphic)

Land-based precision approachsystem program resumes by Patty Welsh66th Air Base Group Public Affairs

3/10/2011 - HANSCOM AIR FORCE BASE,Mass. -- The land-based Joint Precision Approach andLanding System, or LB JPALS, is getting back on trackafter budget cuts. In January 2011, the deputy secretaryof Defense issued the Resource Management Directive-700 which restored full funding to the program.

JPALS is a family of systems that will provide precisionapproach and landing capability for all of theDepartment of Defense. It will operate in land-basedfixed and tactical environments, sea-basedenvironments and, eventually, a back-packable systemwill support special operation environments.

While the Navy is the lead executive service for the JPALS family of systems and working on the sea-basedversion, the Air Force is responsible for the LB JPALS that will provide this GPS-based approach and landingcapabilities.

"Today, each service - the Army, the Navy, the Air Force - has one or more unique solutions," said Col. JimmieSchuman, Aerospace Management Division senior materiel leader. "JPALS is an interoperable system that willbe used by all the services and civil aircraft."

The underlying technology is a differential global positioning system, the same technology Honeywell used fortheir civil product that was certified for use in September 2009 by the Federal Aviation Administration (FAA).

The program office is working toward procuring a military version of this technology, which will includeemploying an encrypted data link and GPS P(Y) code, or secure military code, with anti-jam capability. Work isalso being done to ensure interoperability with the civil community.

"Currently you have to install an ILS [instrument landing system] for every runway end," said Brian Pierce,aircraft integration lead, Jacobs Technology. "With JPALS, you would only need one system to support theentire airfield."

With this smaller footprint, LB JPALS would require less manpower to set up or maintain than current systems.

Other services also currently use precision approach radar, but these systems are not compatible with civilaircraft and are planned to be among the first systems that will be phased out and replaced by JPALS.

Some remotely piloted vehicles also use the same GPS-based technology, and fielding JPALS would providethem the ability to land at any DoD airfield.

"We want to try to collaborate to get to as common a solution as possible across all services, and across allaircraft within the Air Force, as well," said Mr. Pierce. "We want to meet everybody's needs."

LB JPALS capability would be installed in existing navigation system avionics. Avionics risk reduction effortsare ongoing across all the services, and there is an Aircraft Integration Working Group that meets quarterly tocoordinate these efforts.

"We are looking forward to be able to do flight demonstrations with our prototype data link and civil capabilitymilitary avionics toward the end of the calendar year," said Mr. Pierce. "The goal is to drive down integrationcosts by sharing the same basic technology across the services."

Collaboration with the FAA has also been in the works, leading to a possible interagency procurement of theFAA civil technology to provide the civil interoperable portion of the LB JPALS.

"Since the technology is so mature, our primary focus is managing our way through the various acquisition andmilestone processes, and collaborating with the FAA," said Sandy Frey, deputy program manager.

Some recent successes the program has seen were technology readiness affirmation from the Director ofDefense Research & Engineering and selection of a data link standard that will be the key to JPALSinteroperability between all the services.

In the future, plans are for the LB JPALS to support not only straight-in approaches to the runway, but curved,segmented approaches or specialized approaches.

"This will provide much more flexibility for the warfighter to react to their current situation," said Ben Brandt,JPALS lead engineer, MITRE.

The program office is currently working on a draft acquisition strategy. A request for information was sent outon March 2 and an Industry Day is being planned for April 5.

"We have been waiting a long time to get to this point and we're ready to move along to the next steps," saidMs. Frey. "We want to ensure the goal of common solutions becomes a reality."

http://www.hanscom10 March 2011

“...In the future, plans are for the LB JPALS to support not only straight-in approachesto the runway, but curved, segmented approaches or specialized approaches....”

.af.mil/news/story_print.asp?id=123246189

http://www.navsource.org/archives/02/027135.jpg“‘Salty Dog 110’from Naval StrikeAircraft TestSquadron 23(VX-23) prepares toland on USSTheodoreRoosevelt (CVN-71).Official US Navyphoto.

This picture waspossibly taken inApril 2001, whenthe Joint PrecisionApproach LandingSystem (JPALS)test teamsuccessfullyperformed the firstglobal positioningsystem (GPS)-based automaticlanding to anaircraft carrier.Based on GPS,JPALS is intendedfor military aircraftincluding mannedand unmannedfixed-wing, verticaltakeoff and landing(VTOL), and rotary-wing aircraft, and isdesigned to replacetactical airnavigation (TACAN)systems andaugment thecurrent automaticcarrier landingsystem (ACLS) andinstrument carrierlanding system(ICLS).”http://www.navsource.org/archives/02/71.htm

M. B. Suhrahmanyam, Finite Horizon H and Related Control Problems:“Design of the F/A-18A Automatic Carrier Landing System: Ch.6: The aircraft needs to arrive at the touchdown point with proper sink speedand position in space to closely match the position and vertical motionof the carrier deck touchdown zone. Aircraft hook should impact thedeck between No. 2 and No. 3 arresting cables. The sink speed must be10-14 ft /sec....”

A Robust GPS/INS Kinematic Integrity Algorithm for Aircraft LandingAlison Brown and Ben Mathews, NAVSYS Corporation: http://www.navsys.com/Papers/06-09-002.pdf-

“ABSTRACTNext generation GPS receivers will take advantage of Spatial processing from a Controlled Reception Pattern Antenna(CRPA) and Ultra-Tightly-Coupled (UTC) and Tightly–Coupled GPS/inertial signal processing to improve their robust-ness to interference and their performance in a multipath environment. This introduces the potential for failure modesto be introduced into the GPS solution from the Spatial processor, GPS signals or Inertial Measurement Units (IMUs).For high integrity applications such as nonprecision approach or precision approach, the integrated GPS/Inertial receiv-er must be designed to perform fault detection and exclusion of any hazardously misleading information....INTRODUCTIONThe Joint Precision Approach and Landing System (JPALS) Shipboard Relative GPS concept (SRGPS) is illustratedin Figure 1. The goal of the SRGPS program is to provide a GPS-based system capable of automatically landing anaircraft on a moving carrier under all sea and weather conditions considered feasible for shipboard landings. Thepresently utilized Aircraft Carrier Landing System (ACLS) is a radar-based system which was developed more than30 years ago and has a number of limitations that make the system inadequate to meet present and future ship-based automatic landing system requirements. The goal of SRGPS is to monitor and control up to 100 aircraft sim-ultaneously throughout a range of 200 nautical miles from the landing site. Integrity monitoring is especially impor-tant for the last 20 nm of an approach and accuracy requirements are 30 cm 3-D 95% of the time.

The SRGPS architecture provides a precision approach and landing system capability for shipboard operationsequivalent to local differential GPS systems used ashore, such as the FAA's Local Area Augmentation System(LAAS). A relative navigation approach is used for SRGPS with the "reference station" installed on a ship movingthrough the water and pitching, rolling, and yawing around its center of motion. In addition, the ship's touchdownpoint may translate up/down (heave), side-to-side (sway), and fore and aft (surge). Since the shipboard landing en-vironment is much more challenging than ashore, the SRGPS approach must use kinematic carrier phase tracking(KCPT) to achieve centimeter level positioning relative to the ship’s touchdown point.

Next generation GPS systems designed for JPALS and SRGPS operations are expected to have performanceadvantages over previous generation user equipment (UE). While these designs will meet the objective of high anti-jam (A/J) and high accuracy performance, they must also implement integrity monitoring to be able to use theKCPT solution to support precision approach and landing....”

http://www.navsys.com/Papers/06-09-002.pdf

Northrop Grumman's inertial measurement unit selected for JointPrecision Approach and Landing Systems program – 22 May 2010John McHale http://www.militaryaerospace.com/articles/2010/05/northrop-grumman-s.html--

“WOODLAND HILLS, Calif., 22 May 2010. Raytheon selected Northrop Grumman Corp. tosupply the inertial measurement solution for the Joint Precision Approach & Landing Sys-tems (JPALS) Shipboard Reference program. Under this contract, Northrop Grumman'sNavigation Systems Division will deliver 18 LN-270 inertial navigation systems (INS) for theengineering and manufacturing development phase of the JPALS Increment 1A ShipboardReference System (SRS). Future production orders are anticipated to be considerable,Northrop Grumman officials say. The first LN-270 unit will be delivered in early 2011.

JPALS, designed and developed by Raytheon under a U.S. Navy contract, is an all-weather, all-mission, all-user landing system based on local area differential Global Posit-ioning System (GPS). JPALS works with GPS to provide accurate, reliable, landing guid-ance for fixed and rotary wing aircraft and supports fixed-base, tactical, and shipboard ap-plications. For the SRS, each JPALS-equipped ship will employ three Northrop Grummanfiber optic gyro-based LN-270 INS units to measure the ship's motion.

"Northrop Grumman's LN-270 is a versatile solution for any application that requireshighly accurate navigation, pointing or dependable stabilization -- whether it be on land orsea," says Gorik Hossepian, vice president of navigation and positioning systems forNorthrop Grumman's Navigation Systems Division. The in-production LN-270 INS is a nav-igation system with low lifecycle costs because it requires no scheduled maintenance dur-ing its rated lifetime, company officials say.”

Ship Degrees of Freedom:The ship rotational degrees of freedom are

termed roll, pitch, & yaw. In the translationaldegrees of freedom, up and down motion iscalled heave, forward to aft motion is called

surge, & port to stbd motion is called sway.”http://www.dtic.mil/cgi-bin/GetTRDoc?Location=U2&doc=GetTRDoc.pdf&AD=ADA469901

‘Automated Carrier Landing of anUnmanned Combat Aerial Vehicle

Using Dynamic Inversion’

EMALS TESTING Carrier Launch System Passes Initial Tests Jun 7, 2010By Bill Sweetman http://www.anahq.org/articles/Bullhorns/Bullhorn76July152010.htm#F35-

“...The carrier will be part of the process of introducing a landing guidance system to theNavy: the Joint Precision Approach and Landing System (Jpals). It will be one of the firstships with Jpals, which is slated to be on all carriers and large amphibious transports by2018. The second Ford-class ship, CVN-79, is due to be the first carrier without SPN-41and SPN-46 radars, which provide carriers with an automatic landing capability.

Adoption of Jpals is urgent for the Navy because current radars will not besupportable after the early 2020s. Jpals is also associated with the F-35C, becausethe fighter's reduced radar cross-section means that current radar-based autoland-ing systems cannot acquire it. The installation of Jpals on carriers will match ser-vice entry of the F-35C. The first increment of Jpals will be qualified for flight guid-ance down to 200 ft. and 0.5-mi. visibility. Accuracy is intended to be sufficient foran automatic landing, and that capability is being demonstrated as part of theNorthrop Grumman X-47B Navy Unmanned Combat Air System program.

The key to its accuracy is shipboard-relative GPS, which uses two GPS receivers– one forward of the island on the starboard side and the other on the portside stern.The space between the sensors and their relative location allows the system tomeasure the position of the ship accurately and track its movement-speed, pitch, rolland heave – with the aid of three Northrop Grumman LN-270 inertial reference units.Using the same differential GPS technique, Jpals also provides an accurate aircraftposition. A data link allows the system to transmit automatic landing guidance.”

[JPALS] Airfields Afloat: The USA’s New Gerald Ford Class Super-CarriersJun 05, 2013 Defense Industry Daily staff https://www.defenseindustrydaily.com/design-preparations-continue-for-the-usas-new-cvn21-supercarrier-01494/-

“May 29/13: JPALS. Raytheon in Fullerton, CA receives a $14.6 million cost-plus-incentive-fee contract modification for the Joint Precision Approach and Landing System (JPALS),maintenance Design Phase II. They want to change the design to allow for increased organ-izational level maintenance (i.e. on board ship) of JPALS Increment 1A ship systems....

...May 24/13: JPALS. The Pentagon finally releases its Dec 31/12 Selected AcquisitionsReport external link [PDF]. For JPALS, which began development in 2008:“Joint Precision Approach and Landing System (JPALS) Increment 1A – Program costsincreased $106.8 million (+10.7%) from $996.0 million to $1,102.8 million, due primarilyto additional engineering effort for algorithm refinement and developmentof an alternate configuration for the JPALS Inc 1A ship system variant,resulting in a smaller footprint for air capable ships (small combatants)(+$84.5 million). Additional increases were attributable to an extension of the procurementand installation profile from FY 2018 to FY 2020 (+$15.3 million) and a related increase insupport costs (+$2.3 million), and a quantity increase of 1 system from 26 to 27 systems(+$7.5 million) and associated estimating allocation (-$1.4 million). These increases wereoffset by a decrease in initial spares requirements (-$1.5 million).”

The GPS-centric JPALS will be installed well beyond the Ford Class external link – in-deed, beyond the US Navy. This technology may become a separate article, but for now we’readding it here as a key CVN-21 technology, which will play a critical role in handling F-35fighters and UAVs. A JPALS 1A Milestone C production decision is expected in Fall 2013”

The Navy’s VX-23 air test and evaluation squadron flew 60 autolands to the deck of the USS Theodore Roosevelt using the Joint Precision Approach and Landing System. (Photo: Navair)

BILL CAREY

The U.S. Navy recently completed engineering and manufacturing (EMD) development of the ship-based component of the Joint Precision Approach and Landing System (Jpals). The EMD

phase of Jpals Increment 1A for ship systems included auto landings by F/A-18C Hornets to the deck of the aircraft carrier USS Theodore Roosevelt. The Increment 1B phase calls for integrating the system on aircraft.

Jpals is a GPS-based precision approach and landing system that will help ship- and land-based aircraft land in all weather conditions, providing guidance to 200 feet decision height and half-nautical-mile visibility. It is a tri-service program with multiple increments to include Air Force and Army requirements, eventually replacing “several aging and obsolete aircraft landing systems with a family of systems that is more affordable and will function in more operational environments,” according to the Department of Defense (DoD).

The Navy conducted EMD demonstrations aboard the Roosevelt from November 9 to 19, logging approximately 30 flight test hours and 60 completed autolands to the deck using two F/A-18Cs operated by its VX-23 air test and evaluation squadron. The jets were equipped with Jpals “functionally representative” test kits.

The Jpals ship system includes multiple racks of equipment inside the ship and multiple GPS and UHF antennas on the mast, according to the Naval Air Systems Command (Navair), the contracting authority for sea-based Jpals. The system includes integrated processing, maintenance and monitoring systems and redundant UHF

datalinks, inertial sensors and GPS sensors to achieve high reliability and availability. “Jpals is networked with legacy shipboard landing systems, but is capable of operating independently of those systems,” Navair said.

Arinc, which served as lead technical contractor to the Navy during technology development of the system, said Jpals will integrate with the AN/TPX-42 air traffic control console, the AN/SPN-46 automatic carrier landing system, the AN/SPN-41 instrument landing system, the landing signal officer display system, the improved Fresnel lens optical landing system, the aviation data management and control system, and the Moriah Wind System. Last year, Rockwell Collins acquired Arinc.

In July 2008 Navair awarded Raytheon a $232 million contract for Jpals system development and demonstration, to include the delivery of eight ship system engineering development models and four aircraft system test avionics sets. Rockwell Collins, a major subcontractor, provides its digital integrated GPS anti-jam receiver.

Defense budget uncertainty has delayed a Milestone C decision that would begin low-rate production of the system, according to Navair. Congress authorized $194.7 million for the program in the Fiscal Year 2014 National Defense Authorization Act passed in December, some $10 million less than the President’s request. The DoD has programmed funding for Jpals over the entirety of its five-year future-years defense program.

Future development efforts are focused on supporting integration of Jpals with the F-35 Joint Strike Fighter and on improving support for unmanned aircraft systems, Navair said.

http://www.ainonline.com/aviation-news/ain-defense-perspective/2014-01-03/us-navy-completes-jpals-ship-based-emd-phase

Joint Precision Approach and Landing System, Increment 1A (JPALS Inc 1A)

Prime Contractor:

Executive Summary:

Mission and System Description:

Systems Engineering Activities Systems Engineering Plan (SEP)

Requirements

Life Cycle Management

Program Protection Plan (PPP)

oo

oRisk Assessment

Performance

Schedule

Reliability

Software

Manufacturing

Integration

Conclusion:

Assessments DASD(SE) Assessments

https://www.scribd.com/doc/261315401/SE-FY14-Report

Data as of 4th quarter FY 2014 - DoD Systems Engineering FY 2014 Annual Report

Inc-1A(SRGPS)

200 ft/ ½ NMShipboard Relative GPS

CVNLH-CLASSDDG-1000

200 ft/ ½ SM – Land-Based Fixed and Tactical/MobileLocal Differential GPS (FAA certifiable, Auto-Land)

Inc-2(LDGPS)

• Current CDD includes Increments 1 and 2• Only Increment 1 validated by JROC

Future Landing SystemIncremental Precision/Capability

Overarching Joint Program Strategy

Inc-3 100 ft/ ¼ SM – Auto-Land Mobile/Fixed –LDGPS

200 ft/ ½ NM – Auto-Land Sea-Based –SRGPS

Inc-1B Sea-Based Lead PlatformsOperational A/C Integration

Inc-4 100 ft/ ¼ NM – Auto-Land Sea-Based –SRGPS(UAV Support)

Inc-5 Man-Pack –LDGPS(Marine Corps/Army)

Inc-6 AutonomousEnhanced Vision System (EVS)

Inc-7 Upgrade to Sea-Based back-up system

Joint A/CIntegration Guide

(DoD and CivilInteroperability)

1

2

22

3

3

3(DoD and Civil

Interoperability)

11

22

2222

33

33

33

Medium Earth Orbit

Three System Components:GPS Ground Station A/C Integration11 22 33

JPALS End State

JPALS Overarching Joint Program Strategy

SRGPS

m

http://www.afceaboston.com/documents/events/cnsatm2008/Briefings/Thurs/Track%203-PM/1%20JPALS%20CNS%20ATM%206.23-26.08.pdf

JPALSat SeaCONOPSOver-view

http://www.f-16.net/f-16_forum_download-id-17065.html ALSO

AN/SPN-41/41A ICLS(Instrument Carrier Landing System)

AN/TPX-42A(V)14 DAIR(Direct Altitude and Identity Readout)

AN/SPN-43C ASR(Air Surveillance Radar)

AN/SPN-46 ACLS(Automatic CarrierLanding System)

AN/SPN-35B/C PAR(Precision Approach Radarfor LHA/LHD class ships)

TACAN JPALS will replace legacy radar-based

PAL systems

SPN-46

SPN-35

TACAN

Shipboard ATC Systems

Sea-Based JPALS requires 22x and 94x greater accuracy than JSOW and JDAM, respectively

Joint Direct Attack Munition (JDAM)

3

6

9

12

15

3 6 9 12 15 18

-3-6-9-12-15

-3

-6

-9

-12

-15

Land-Based JPALS meters

metersJoint Standoff

Weapon (JSOW)

Sea-Based JPALS 21 24 27 30 33 36 39

JPALS Compared to GPS Guided Munitions JPALS Accuracy RequirementsJPALS Requires Augmented GPSBetter Guidance Quality (GQ) required as the aircraft gets lower and closer

Even better GQ requiredwhen the runway is small and/or moving (e.g., an aircraft carrier)

Protection Levels

Alert Limits

• Accuracy• Integrity• Ao/Continuity

SRD Threshold: 200 ft/ ½ mi SOO Objective: AutoLand Demo

GQ

• Cat I• DH

• Cat II• DH

4

JPALS Overview

• A network-centricconcept to support landing ashore and allphases of flight in the shipboard environment• Covert, secure, anti-jam• Low latency, high

integrity, fault-tolerant• Responsibility for all

approach modes with vertical navigation

• Interoperable• Services• Allies• Civil airspace

Technologies Conference Briefing 1 May 2002

http://acast.grc.nasa.gov/wp-content/uploads/icns/2002/09/Session_D2-4_Wallace.pdf

I-CNS

5

Future Carriers (CVNX)

• No rotators; lower RCS• Eliminate unique signals• Increase growth margin• Reduce workload

JPALS(Navy Applications)

General: Recoveries with no limitations due to sea stateor weather

• Automatic Landing• Position/trend to CATCC, LSO• Approaches for all aviation ships• Shore DoD/ Civil interoperability

Naval UCAV

• Very high safety and reliability• Fully automatic flight in CCA• ATC control via digital data • See and avoid manned aircraft

Joint Strike Fighter (JSF)

• Land to any spot (LH)• Primary mode: automatic takeoff

and landing• 360 deg coverage

6

Concept of Operationsfor the Carrier at Sea

30 nmICAO/ NATO compatibleapproach capability within 30 nm of airfield

Ashore

200 nm‘TACAN’ coverageShip to Air data linkprovides relative nav (TACAN) to 200 nm5 m relative accuracy20 nm

State reports provide Collision Avoidance and Cockpit Display of Traffic Information (CDTI)

Collision Avoidance

50 nmTwo-way data commto ship within 50 nm;ADS position reports1-2 m relative accuracy

Marshal

ATC coverage

Standard NATOPSarrivals or direct4-D routing (besttime/ fuel mgmt)

20 nmApproachcoverageLanding SystemAccuracy (0.3m 95%)in 360 deg, 20 nm

CASE II/III, CASE I,bolter and waveoffpatterns supported

Guidanceoff the cat& departure

20 nm

Landing SystemAccuracy (0.3m 95%)in 360 deg, 20 nm

50 nm

30 nm

ICAO/ NATO compatibleapproach capability within 30 nm of airfield

Two-way data commto ship within 50 nmADS position reports1-2 meters relative accuracy

Marshal

Approachcoverage

Ashore

‘TACAN’ coverageATC coverage

CASE II/III, CASE I,bolter and waveoffpatterns supported

Guidanceoff the cat& departure

Standard NATOPSarrivals or direct4-D routing (besttime/ fuel mgmt)

Ship to Air data linkprovides relative nav (TACAN) to 200 nm5 m relative accuracy

State reports provide Collision Avoidance and Cockpit Display of TrafficInformation (CDTI) at 20 nm

Collision Avoidance

7

Inertial Navigation System data used to compensate for ship’s motion

Yaw

Surge

RollPitch

Heave

Sway

How JPALS Works

Translation

Differential GPS gives relative position with high accuracy and integrity

COMSEC and “Featureless” Spread Spectrum protect the signals

?

8

VHF

Fixed/Civil/International

Tactical/Special Mission

Shipboard Y/M Code, Beam-forming Anti-Jam

Two-Way UHF LPI data link

ATC & Landing

C/A-CodeWAAS & LAAS

DataLink

MissionComputer

Display

GPS/INS

Antenna

VHF

UHF

G round Equ ipmen t

Y/M Code, Beam-forming Anti-Jam

VHF Data Broadcast

JPALS Architecture

Ai rborne Equ ipmentA i rborne Equ ipment

Electronics

9

JPALS CNS/ATM Functions

• JPALS Performs Four Primary Functions:• Communications• Navigation• Surveillance• Air Traffic Management

• JPALS Replaces or Enhances Today’s Systems:• Provides LPI Communications• Replaces Navigation: TACAN, ACLS, ICLS• Enhances Surveillance: AN/SPN-43, AN/UPX-29• Provides ATM: Assists ATC Controller Tasks

• JPALS Employs/Integrates Technologies:• GPS/INS• Digital Data Link• Voice Synthesis/Voice Recognition• Fault-Tolerant Processors• ATC Application-specific Algorithms

Test results of F/A-18 auto-land trials for aircraft carrier

operations - Abstract:Raytheon and the US Navy con-ducted aircraft carrier precision

approach trials using the F/A-18 asthe test platform. These trials are

part of the Navy Joint Precisionand Landing System (JPALS) ef-fort to demonstrate Global Posi-

tioning System (GPS) technologyfor aircraft carrier precision ap-proach. The team achieved the

historic milestone of the first fullycoupled approach and landing to

the ground in an F/A-18 using aGPS-based navigation solution….

The test and analysis results showthat GPS technology provides thequality needed to perform relative

precision approaches in an aircraftcarrier environment.”

http://ieeexplore.ieee.org/xpl/freeabs_all.jsp?arnumber=931358

10

Shipboard Relative GPS Functions

SRGPSCommunication

Services

Navigation Surveillance

FlightInformation

Air TrafficManagement

Controller-PilotData Link

EnduranceManagement

AirspaceManagement

CCASurveillance

CDTI

Service

ApproachMonitor

Ramp StrikePrevention Sys

Ship RelativeNavigation

PrecisionApproach

SRGPSCommunication

Services

Navigation,G&C Surveillance

FlightInformation

Air TrafficManagement

Controller-PilotData Link

EnduranceManagement

AirspaceManagement

CCASurveillance

CDTI

Traffic Inform.Service

ApproachMonitor

Ramp StrikePrevention Sys

Ship RelativeNavigation

PrecisionApproach

DeckOperations

Functions have derivedGPS Nav requirements

G&C: Guidance and Control

CCA: Carrier Control Area

CDTI: Cockpit Display of Traffic Information

Automatic Carrier Landing System (ACLS) “The ACLS issimilar to the ICLS, in that it displays “needles” thatindicate aircraft position in relation to glideslope andfinal bearing. An approach utilizing this system is said tobe a “Mode II” approach. Additionally, some aircraft arecapable of “coupling” their autopilots to the glideslope/azimuth signals received via data link from the ship,allowing for a “hands-off” approach.

If the pilot keeps the autopilot coupled until touchdown, this isreferred to as a “Mode I” approach. If the pilot maintains acouple until the visual approach point (at ¾ miles) this isreferred to as a “Mode IIA” approach.”http://en.wikipedia.org/wiki/Modern_United_States_Navy_carrier_air_operations

10

11

JPALS ATM Services

• Flight Information Service (FIS): Automated meteorological data, including wind speed and direction over deck, temperature, humidity, barometric pressure.

• Traffic Information Service (TIS): Primary and secondary radar tracks from off-board sensors providing CDTI and collision avoidance.

• Controller Pilot Data Link Control (CPDLC): A set of commands to the airborne platform which can be initiated either via manual operation, by voice command, or automatic via Auto ATM. Proper handling of “transfer of contfor unmanned operations.

• Endurance Management Air Traffic System (EMATS): Given a flight plan, algorithms compute optimum time of arrival, schedule unmanned platforms with other manned aircraft. A display tool provides time of arrival status information to the controller or Mission Control System (MCS) operator with 4-D routing.

• Airspace Management: Automated system assigns airspace regions to aircraft.System monitors the aircraft, projects aircraft state appropriately. Upon detection of impending spill-out, the system generates alarm to CPDLC, MCS operator, or to the unmanned platform itself.

12

JPALS Surveillance Services

• Shipboard Tracking: Within 50 nm, JPALS displays manned and unmanned platforms on controller consoles from integrated dependentsurveillance SRGPS track information with primary radar and IFF.

• Cockpit Display of Traffic Information (CDTI): Includes embedded collision avoidance function for manned and unmanned platforms. Operators have information on all local traffic, including 3-D relative range, bearing, and acceleration.

• Shipboard Approach Monitor: Airborne platforms are accurately monitored with automated CAS functions, MCS display, and/or finalapproach display.

• Ramp Strike Prevention System: An approach monitor function which includes projection of aircraft state and variable alarm limits for LSO monitoring and/or as a part of vehicle flight control system integration.

13

NAV

SURV

ATM

COMM

VOICE

Transmit Range (nm)

Link System Design and Navigation Service

• Ship State 200• Ship State 50• Ship State 20• GPS Block ID• GPS Pseudorange• GPS Carrier Phase• Ship Motion 20 Hz• Ship Motion 1 Hz• Ship Motion 0.2 Hz• Air State Report• Air Monitor Report• ATM Uplink 50• ATM Uplink 20• ATM Uplink 10• Request/Reply

Low-Rate LPI Uplink Data to 200 nmLow-Rate Uplink/Downlink data to 50 nm

Medium-Rate Air-Air Data

Medium-RateUplink/Downlink Data within 10 nmLOS range approx 30-40nm

Navigation Service:• En route (GPS stand alone) guidance to 10m lateral, 20 m vertical

• Relative Shipboard Approach Guidance<5m lateral guidance out to 200 nm < 15 cm 3-D guidance within 10 nm<2 m lateral guidance within 50 nm < 10 cm deck handling navigation

10 20 50 100 200

14

Examples of Data Link messages

Log-offTanker hawk / position & guidance / CAF / SA

Hot/dropareasCAF/SA

CAF/ SA / tanker position

CollisionAvoidanceFunction(CAF)

SituationalAwareness(SA)

Maintenancedata & deck troubleshoot

Maintenance / WX data

Weapons / systems / fuel status

Maintenance dataWeight Off Wheels

(BIT) Built In Test

BITWeight / approach data

CPDLCMarshal

Updated CLNC/ WX/Position of IntendedMovement (PIM)

StatusShipsInformation(D-ATISequivalent)

Weight On Wheels

4D guide & CPDLC arrival reports

D-ATIS / PIM

TAC- AN

4D guide, CPDLC departure reports

WeightLog-on

Trap / Maint

ApproachCheck-in

MsnDepartureTaxi /Launch

Start / Alert

15

Navigation System Performance

• Shipboard landings require more stringent levels of accuracy and integrity than ashore.• Accuracies of less than 15 cm

with integrity assurance of no more than 1.1 meter error in 10 million landings.

• Also require high levels of availability in the presence of hostile or own interference.

• Current anti-jam techniques sacrifice accuracy and are not compatible with high integrity or carrier phase systems.

Lab Tests Threat Scenarios

Performance Simulations

Flight Test Results

One of two F/A-18C Hornets from Air Test and Evaluation Squadron (VX) 23 lands aboard USS George H.W. Bush (CVN 77) during the recently com-pleted round of Joint Precision Approach and Landing System (JPALS) testing this spring. JPALS is an all-weather landing system based on differ-ential GPS information for land- and sea-based aircraft. (U.S. Navy photo) Jun 27, 2013 http://www.navair.navy.mil/img/uploads/JPALS_landing_1.PNG

MARINE AIR COMMAND AND CONTROL SYSTEM (MACCS) PLAN | MARINE AVIATION PLAN 2015 | Precision ApproachLanding Capability Roadmap – “This effort has been established as a transition from precision approach radar (PAR) systems toemerging Global Positioning System (GPS) technology in order to provide Marine Corps Aviators a self-contained cockpit “needles”precision approach in all operational environments (expeditionary, ship, and shore). Joint Precision Approach Landing System(JPALS), due to the current fiscal environment, was dramatically scaled back to fund ship systems only. For the Marine Corps, thiswill provide a precision capability on all LHA and LHD amphibious carriers to support the F-35B, and on all CVNs to support theF-35C. Marine aviation will leverage maturing GPS technology to bring a self-contained precision approach landing capability (PALC)that is world-wide deployable.” https://marinecorpsconceptsandprograms.com/sites/default/files/files/2015%20Marine%20Aviation%20Plan.pdf

NAVAIR Flight Ready: Joint Precision Approach and Landing System 29 Jan 2014“Engineers at Naval Air Station Patuxent River, Md., discuss the successful evolution of the Joint Precision Approach and Landing System(JPALS). Learn more about this innovative technology from inception to the first shipboard landing on USS Theodore Roosevelt (CVN-71).”

https://www.youtube.com/watch?v=B6q49h_dC0U

Requirements For GPS-Based Aircraft Carrier Precision Approach & LandingSep 15-18, 1998 Greg Johnson & Ian Gallimore https://www.ion.org/publications/abstract.cfm?articleID=2983

Abstract: The FAA is currently developing requirements and specifications for a Category I-IIIapproach and landing system. The Navy also requires an equivalent approach and landing system foraircraft carrier flight operations. However, there are several challenges for a GPS based shipboardlanding system over and above its shore-based counterpart. The touchdown point and GPS referencestation are in motion through six degrees of freedom. No assumptions can be made on the dynamicsof the ground station because the ship's acceleration bandwidth is as wide as a typical aircraft onapproach, which makes correcting for data link latency difficult. The multipath environment is muchmore complicated because of the multitude of reflecting surfaces on the aircraft carrier. The ship-board landing system must be much more accurate than the Category III shore based landing system,because the touchdown window only is only 40 meters long. The aircraft must be traveling at a speedthat will not stall the aircraft, because the aircraft must be able safely fly away from the deck in theevent it fails to attach its tail-hook to one of four arresting wires. Because of the high speed and shortlanding window, the position solution must not be in error by more that one foot vertical. The data linkmust be able to support high rate GPS and inertial measurement data that is required for approach &landing in addition to exhibiting Low Probability of Intercept (LPI) characteristics. Raytheon Navigation& Landing Systems has developed prototype approach and landing system which features an LPI datalink and a high accuracy carrier phase based position solution. This prototype has been tested anddelivered to the Naval Air Warfare Center (NAWC), Patuxent River, MD. This paper will describe thetechnical requirements of a ship-based approach and landing system and the past test activities, us-ing the NAWC prototype, that support the development of these requirements.-

Published in: Proceedings of the 11th International Technical Meeting of the SatelliteDivision of The Institute of Navigation (ION GPS 1998) Nashville, TN Pages: 541-550

Why Accuracy is so important!

Summary• The shipboard component of JPALS combines state of the art navigation technologies• GPS surveying technology• Aviation integrity concepts from civil aviation• Advanced military beam-forming anti-jam systems• Integration of kinematic GPS with inertial systems• Increases safety, efficiency and reduces vulnerability with CNS technologies

provided with a LPI link• Meets critical mission need for future aircraft and ships (JSF, UCAV, CVNX...)

U.S. NAVY AIRCRAFT HISTORYHow Hard is It to Land on an Aircraft Carrier?

I was recently asked "How hard is it to land on an aircraft carrier?" I regret to say that I don't know personally.

My only pilot experience in that regard is making an approach and landing a Lockheed S-3 in a Navy flight

simulator. My only actual carrier landing was as self-loading freight facing backwards in the cabin of a Grumman

C-2 Greyhound transport. (I can say in that case there was an unsettling amount of flight control activity and

throttle changes on short final before a very firm arrival and impressively short stop.)

However, I have a lot of second-hand knowledge based on reading books/articles, an overnight stay on an

aircraft carrier being used for day and night carrier qualifications, listening to naval aviators, etc. The degree of

difficulty also depends on the era. In the beginning, landing speeds were much slower and crashes less dramatic,

at least as far as the pilots were concerned. As airplanes got bigger and heavier, higher landing speeds were

required and crashes became much more colorful. The introduction of jets reached the upper limit of

practicality and the Navy was in danger of exceeding it.

The angled deck and the mirror-landing concept were adopted just in time to restore a reasonable amount of

repeatability to the landing process. (The fact that carriers were getting bigger and bigger was also beneficial.)

The latest automated landing systems now being qualified promise to make the carrier landing a non-event, the

equivalent of the self-driving car.

For the time being, however, a carrier landing requires a high degree of precision with potentially fatal

consequences for getting it wrong, similar to a high-wire circus act without a net or safety harness. The

precision required is akin to flying under a low bridge, a high-risk and foolhardy maneuver. Hitting the bridge, its

supports on either side, or the water is likely to be fatal.

The penalty for being too high in the event of a carrier landing is not fatal but means not being able to land on

that approach. Another is required, prolonging the time the carrier has to spend on that course and potentially

delaying the subsequent launch cycle.

Being a bit too far off to the left or right on a carrier landing is almost as bad as hitting the bridge supports. It

risks a crash into parked airplanes on either side of the landing area and/or going off the deck into the water.

Being too low is the worst, resulting in a ramp strike. A bit too low might just mean damaging the tail hook,

which requires a diversion to a shore base or a landing on the carrier using the barricade which again disrupts

carrier operations. Hitting the ramp with the airplane itself is frequently fatal.

The width of the opening is constrained by the imperative to keep either wingtip safely distant from the "foul

line" that other airplanes and equipment are kept behind. In other words, the naval aviator can touch down as

much as 10 feet on either side of the center line as long as the sideward drift, if any, is toward the center line

and not away from it.

However, simple passing through the imaginary opening about 20 feet high and 20 feet wide is not sufficient. At

that instant the airplane must also be traveling at the target airspeed and with the target rate of descent so as

to put the tailhook on the deck between the second and third wires. Being too fast or at too shallow a rate of

descent means touching down beyond the last of the four wires and boltering; too high a rate of descent, while

insuring that the hook touches the deck before the last wire, risks exceeding the strength of the landing gear.

How big is the opening? About 20 feet by 20 feet. The target height for the end of the tail hook at the target

angle of descent is about 14 feet above the ramp. Being only four feet or so higher means missing the last wire

and having to take off again, a bolter.

http://thanlont.blogspot.com.au/2016/09/how-hard-is-it-to-land-on-aircraft.html

The rate of change of a big-deck carrier from one extreme to another is also usually relatively slow.

Nevertheless, under certain sea conditions, the ramp can move about 20 feet, the height of the imaginary

opening, or more in only 10 seconds.

Moreover, unlike an opening under a bridge, the one that the naval aviator must pass through is moving. Even

the biggest carriers are affected by stormy or ocean-swell conditions: depending on the sea state, a carrier can

move in six different ways—pitch, roll, yaw, heave, sway, and surge—in various combinations. Although the ship

movement isn’t quite random, it is not really predictable either. The current big-deck carriers, at least, don’t

move quite as much as the smaller ones did.

Although the naval aviator is alone in the cockpit, he or she is assisted by the advice and counsel of a Landing

Signal Officer (LSO) standing on the deck who monitors the approach and can often detect an unacceptable

trend developing with it or with carrier motion before the aviator does. The LSO's command to abandon the

attempt, a wave off, must be complied with.

There is also the added degree of difficulty of having to fly "under the bridge" at night from time to time, with

only a few lights as guidance as to the location of the opening. As a result, the final approach is then lengthened

to about 25 seconds.

Tom Wolf in his book, The Right Stuff, observed that test pilots and race car drivers are not preternaturally

brave or foolhardy but instead have convinced themselves that they have the skill and knowledge to not crash as

opposed to those who have. Prospective naval aviators go through a training program that is designed to instill

that level of confidence in them. It also ruthlessly eliminates individuals potentially inadequate to the task. (For

more on this, see my book, Training the Right Stuff, HERE.)

The naval aviator prowess at carrier landing continues to be closely monitored during his career by the LSOs,

squadron commanders, and the Carrier Wing Commander for poor performance at sea. The result is a very low

crash and casualty rate in what is widely regarded as the most demanding aviator skill, the carrier landing.

It helps that the target rate of descent, while high—about eight knots or nine miles per hour—is not much more

than one third of the demonstrated capability of the landing gear. Landing gear strength is one of several

differentiators between airplanes designed for carrier operations versus those that fly from airfields. The

stronger landing gear means that the naval aviator does not have to, in fact should not, flare to decrease the

rate of descent as part of the landing because not flaring increases touchdown accuracy.

It doesn't help that a lot of time is not allowed to get lined up with the opening and stabilized at the target

airspeed and rate of descent. There is often a compelling reason to get all the airplanes aboard in as short a

time as possible (for one thing, the carrier has to be headed into the wind for landings and that may very well

not be the direction that the battle group needs to go). As a result, the time allotted for the final approach is on

15 to 18 seconds in daytime.

JPALS Test Aboard USS Abraham Lincoln[video: night landing stress quote]

https://www.youtube.com/watch?v=ey4qs-8TjfY

1740 ft Between Wires

Targeted Hook Touch Down PointBetween 2 & 3 Wires

3.5° Glide Slope

1 Wire2 Wire

3 Wire

4 Wire

Carrier Deck Landing Area

-60-40-200204060

-40

-30

-20

-10

0

10

20

30

40

Runway X-Coordinate(feet)

Runway Y-Coordinate

(Feet)

Touchdown Points - Coupled to the DeckApril 23-24, 2001 - USS Theodore Roosevelt (CVN-

Target Touchdown Point

Wire 1 Wire 2 Wire 3 Wire 4

18

Automatic Shipboard Landing Civil Interoperability

JPALS Testing Success

• Flew LAAS avionics (FedEx 727) using the JPALS Ground Station to perform 10 auto-coupledlandings Aug ‘01.

• Conducted shipboard test of SRGPS aboard the USS Roosevelt (CVN-71) accomplishing 10 fully auto-coupled landings in Apr ‘01.

Precision Approach in Jamming

• Completed 276 approaches at Holloman AFB in clear air and jamming conditions Jul-Aug’01.

19

International Cooperation

• UK has companion program(UK-JPALS)• MOU in work with United States• UK testing STOVL implementation

to support JSF• Data Exchange agreement with

Germany• Interest within Spain, Italy, and France

• NATO• Precision Approach and Landing System decision

planned for Oct 2002• New group established to work ship standards

Flight Testing of JPALS Autolandsin UK VAAC Harrier

JUMP to VAACHARRIER INFO

����� �()**��+�",� �& �� ��� ���� ���� �� ��,���'���������+&'(*)����������9��2%�&&�.�&&���������� &&����&�"� ���������������$&&�� �������$��������&�#�����������9.�+, �96�,�<��.��(���� �����>�� ��������-��+ �!����� ������" ���&�������������� ������������������/ # &������������.��� ������& �������&!����� �2��� ��&�������6���� ���#���% ���������� �������� ����������������� ������9.�+, �H������������ ��"���������% ������������ ���������������� �2��!I�� ���6����0�$�2!9��2%�&&�.�&&�������������������!����"�����.���$��� ����������$�����$��� �%��2� �&���!��-��+ ������&����� ���#��%��� ����$�������(��>�� �����������:$��������!�� 2������� # �& "&����������$�������"���&����$�����$���������/ # ������$����������� ��6����9.�+, �(��>�� ������� ��$&���" ��!��$&������������#����� ������������� �����������48�5)����:$������ ���!����#�������*���������#�� ��������< �����=,�-5E������&�� ��� ����$"&������#����� ����" ����9��2%�&&�.�&&����� ����&�#����������� ��< ! ��9.�+, �� �����$�������,;+��& ������������������� ��������������$��&�������,�� �6���� ����� ���#�&#����#����$������#������� ������%������%� � "�&������ ���������$�������% ���$�� ���6���(��>�� ������ �$���� �����% ���������������$��� ������ ��������$���$����������$&���&��% #������� �����"����������� �� "&���������� ���!������������&�� ��� ��"������� �����#�����������!� ������������9��2%�&&�.�&&����7��%�&&�$�������������������� ���� &����$���#����!������� ����% #�����!����" ������� ��� �����&������ ����% #������� � "�&�����H6����9.�+, �(��>�� ��������������������� �2�����&$������ � "&��������#��������%��2���� ������������������ ������$������ &������ ����������&�� ���������������� ��"������& ������!I�� ���0�$���G���!�9��2%�&&�.�&&��������� &�� � ������.���$��� ����������$����H7�����#����� ��&� ��� ��% ������������� �������������������� �:$���� �� ����� "&�!���&� "&�� ������$������%��2������&$��������� ���������� ���� ��I

http://www.ainonline.com/news/single-news-page/article/paris-2011-rockwell-collins-delivers-first-software-defined-arc-210-radio-30178/

June 21,2011 By:Bill Carey

JPALS next page

0�$��2�� ���9��2%�&&�.�&&���� &�� �������� ���������5)� ��"������ �2����� ��!%���������9.�+, ��������������H�������� ������ �� ���� ���I����������/ #�� ��������)�����6������� ��� &����$��&���������� ������������������� ����.� ���($ ��7���$�����&������$��&������ ��&��������$��������� ������9.�+, �96�,;>,�.��� ���!2��%�� ��H6���� �����!I����������/ #�� ���������)����!� ��%�&&� ����������������� ������ �����D#���$ &&�!�����$���������������$��������� ������ ����%�&&"��������� �����%�!�0�$��2�� ���7���� &��& ��������*�������������&���������(��>�� ���!� ������ ����������& ������������*�������� ����!� �������-5�@ ��&�������!�4�++���&������� ���)8��,;!�)�,>� ���)�,@���������6������� ����*�����������&�#��� "�$��< �(��>�� ������������ �!����&$������ &�%�� �������� &�����$��������97�������&��1��������� !�+ �%������&�#���������-�+ �� ���B �����-��+,<!������ # &� ����� ������ � �������������������� ���������-��+,<�����$����������3��������������� ���� ��� ���& ������������������������ ��6���$�������!�%������������ � "&�����������#�&� ��(��&�� &� �� $����� �����������!� ���� ���%�&&������#������������ &�(������������������� ����"� ����� �����#� �� � &��2!����#��������/ #�� ���� ���� �������%���� &&�%� �����& ������� � "�&����9��2%�&&�.�&&����������&������������� ��"������5)� � &��2������������������9.�+, �(��>�� ���7�������"���+ ;!�9 �������% �� % ����� �A+<<���&&��������� ������������������������#�&������� ����������� ������� ��!��� ����� ��� �����&$�����9��2%�&&.�&&���!�/��������(�$�� �� ����7.�9 �����������������������������"� �������� ������������������0�$��2�� ���9��2%�&&�.�&&���� ������ ���� ������ ��������/ # ����������� ��"������������������)���������% �����&�#����%�$&��"������$&��+ ,+!� &&�%�����$�������#�&������� �������������� ��"����� �������"�����&��2��6�������������� ��#�&�%�$&��"�������� ��������������&����������� &�+ ,=

JPALS

PMA-213 Celebrates New GPS-Based Landing System Progresshttp://www.thebaynet.com/news/index.cfm/fa/viewstory/story_ID/25955 | Patuxent River, MD - Jan/24/2012-

“The latest in a series of Engineering Development Models (EDM) of a technology that promises torevolutionize how the DoD safely lands its aircraft was unveiled by the Naval Air Traffic ManagementSystems Program Office (PMA-213) during a dedication ceremony here Jan. 11.

“We now have real, testable hardware after several years of conceptual modeling and design,”Capt. Darrell Lack, PMA-213 program manager, told the group gathered to celebrate the latestadvancement of the Joint Precision Approach and Landing System (JPALS).

“We will retire aging, radar-based, precision-approach and landing systems that are experi-encing increasing obsolescence issues and evolve into a GPS-based precision-approach andlanding system,” Lack said. “This system will provide secure performance at sea, on land andin expeditionary environments with increased operational availability and interoperability.”

PMA-213 received the second JPALS EDM in October and plans to install it on all CVN, LHDand LHA class ships as part of “Increment 1A.” The system offers critical enabling technologyfor the CVN-78 ship class, F-35 Lightning II Joint Strike Fighter & Navy unmanned air systems,while allowing retirement of costly, radar-based systems, Lack said. JPALS-compliant aircraftwill be compatible with the civil aviation, GPS-based infrastructure when fielded.

EDM-2 is the initial production representative unit of the AN/USN-3(V)1 JPALS, consisting of fourshipboard-suitable equipment racks and multiple GPS and UHF data-link antennas. A team, includingthe JPALS prime contractor Raytheon Network Centric Systems and NAWCAD Research & Engineer-ing personnel will integrate the unit into the System Integration Lab at the Landing Systems TestFacility for further development.

With Navy, Air Force and Army participation, JPALS will provide a family of interoperable systemsfor civil and multinational, manned and unmanned aircraft. A JPALS increment 1A Test ReadinessReview is scheduled for April and a Milestone C review to enter production is planned in fiscal 2013.”

3. Funded Enhancements and Potential Pursuits.Digitally Augmented GPS-based Shipboard Recovery (JPALS). (2015) JPALS is

a joint effort with the Air Force and Army. The Navy is designated as the Lead Service and is responsible for implementation of shipboard recovery solutions (Increment 1). JPALS will be installed on the newest carrier and its air-wing aircraft (F/A-18E/F, EA18G, E-2C/D, and MH-60 R/S). F-35 Joint Strike Fighter (JSF) Block 5 will be equipped with a temporary solution that will provide needles to the operator to enable a “JPALS assisted” approach. However, the interim solution will not equip the aircraft to broadcast its position in a manner that can be monitored by JPALS equipment on the ship. Legacy radar will have to be used for the shipboard monitoring of the approach. JPALS will eventually replace the ACLS on carriers, SPN-35 radars on LH Class Amphibious ships, and ILS, TACAN, and Precision Approach Radar (PAR) systems at shore stations. JPALS will be interoperable with civil augmentation and FAA certifiable. Shipboard JPALS will use Differential GPS (D-GPS) to provide centimeter-level accuracy for all-weather, automated landings. D-GPS provides a SRGPS reference solution for the moving landing zone. A JPALS technology equipped F/A-18 has demonstrated fully automated recoveries to the carrier. JPALS will also enable silent operations in Emission Control (EMCON) environments. http://www.navair.navy.mil/pma209/_Documents/Camp_2011.pdf

NavAirSysCom Core Avionics Master Plan 2011

JPALS team wins DoD award Nov 13, 2012 http://www.navair.navy.mil/index.cfm?fuseaction=home.NAVAIRNewsStory&id=5175-

“NAVAL AIR SYSTEMS COMMAND, PATUXENT RIVER, Md. — NAVAIR’s Joint Precision Approach & LandingSystems (JPALS) team was recognized Oct. 25 as one of the Defense Department’s top five systems engineer-ing teams during a ceremony in San Diego. The team, part of Naval Air Traffic Management Systems ProgramOffice (PMA-213), was presented the award by the National Defense Industrial Association. The award repre-sents the recognition of significant achievement in Systems Engineering by teams of industry and governmentpersonnel. “Each year, we recognize excellence in the application of systems engineering discipline andimplementation of systems engineering best practice that result in highly successful Department of Defenseprograms,” said Steve Henry, National Defense Industrial Association Systems Engineering Division chair-man. “The selection of the Joint Precision Approach & Landing System (JPALS) Increment 1A Ship Systemprogram reflects highly on the collaboration & engineering efforts of the JPALS government & contractor team.”

JPALS uses GPS and two-way data links for navigation and landing approaches forcarrier-based aircraft and helicopters landing in harsh weather. “One of the best practices thatwon the team this award is that the JPALS program required the use of Modeling and Simulation whererequirements validation via test and demonstration was impossible,” said Michael Primm, JPALS guidancequality lead, PMA-213. “Given the importance of the M&S program to JPALS, extensive verification, validationand accreditation was completed upfront and early to ensure a robust and accurate M&S environment wasavailable.” “I could not be prouder of our JPALS team,” said Capt. Darrell Lack, PMA-213’s program manager.“This first time award validates the dedicated work of PMA-213 and our industry partners.”

JPALS is a critical technology for the Navy that will allow ship and land based aircraft to safely landin all weather conditions and in conditions where enemy forces may try to jam GPS signals, added Lack.“This award represents the outstanding teaming relationship that has existed since the JPALS 1A contract wasawarded in 2008,” said Lee Wellons, JPALS government chief engineer. The government JPALS 1A team withour industry partners Raytheon and Rockwell Collins not only utilized the solid systems engineering practicesbut also demonstrated exceptional organizational alignment and communication processes, Wellons said.

The next significant milestone for the JPALS team is reaching Milestone C in the fall of2013. Milestone C is the decision to authorize full production & fielding of the JPALS system.”

Navy Completes Initial Development of New Carrier Landing System

22 Nov 2013 Dave MajumdarThe U.S. Navy has completed the initial development of the Joint Precision Approach and Landing System (JPALS), Naval Air Systems

USNI News.The system is designed to aid pi-

lots landing in inclement weather conditions and will eventually replace the current Instrument Carrier Land-ing System (ICLS) and the Automat-ic Carrier Landing System (ACLS) onboard the service’s aircraft carri-

“The current Engineering and Manufacturing Development (EMD)

with the highly successful ship-board autoland testing on USS The-odore Roosevelt (CVN-71),” NAVAIR spokeswoman Marcia Hart said in a

The core of the JPALS technology is an extremely precise ship-relative GPS-based system which is much

more accurate than the existing pilot

The Navy had tested the JPALS onboard the USS George Bush (CVN-77) earlier in July to verify the system’s capability to support man-

-board the Roosevelt was to demon-strate the system’s ability to support

For the Navy, the development of the JPALS is the huge step for-ward for integrating new aircraft into

cannot support UAS [Unmanned Air Systems], and [the Lockheed Mar-tin Joint Strike Fighter] F-35 was de-

Increment 1 is based on ship relative

While the initial development is now complete, the Navy still has

-

system will also eventually support -

NAVAIR’s immediate focus

however will be to continue devel-opmental work for supporting the F-35C and unmanned aircraft on-

important for the Unmanned Carrier Launched Airborne Surveillance and

While the Northrop Grumman X-47B Unmanned Combat Air Sys-tem Demonstrator (UCAS-D) uses a similar prototype ship-relative GPS-based landing system technology, it is not the same system as an opera-

-

in support of the UCLASS and F-35 programs as well as multi-platform

-

sequestration and continuing reso-lution associated budget uncertainty

Eventually, the USAF and the USMC will also use the JPALS for

The F-35 Cooperative Avionics Test Bed (CATBird) supports software development for upcoming F-35B/C developmental and operational tests, including the elements of the Joint Precision Approach and Landing System (JPALS). When fully implemented, JPALS will benefit carrier-based air traffic control by enabling automatic carrier landings (auto-land), enhancing aircraft position reporting, and increasing Tactical Air Navigation (TACAN) functionality. (U.S. Navy photo courtesy of Lockheed Martin)

May 28, 2015 NAVAL AIR SYSTEMS COMMAND, PATUXENT RIVER, Md. – Teamwork between government and industry teams advanced the Navy’s capability to recover aircraft in all weather conditions — a vital solution aimed at protecting people and equipment while enhancing the flexibility, power projection, and strike capabilities of carrier air wings.

The F-35 Cooperative Avionics Test Bed (CATBird), a modified Boeing 737-330, accomplished initial connectivity and datalink testing between the F-35

Team members of the F-35 Lightning II Cooperative Avionics Test Bed (CATBird), a modified Boeing 737-330...

Collaborative efforts yield essential data,reduce risk during early CATBird JPALS testing

PEO(T) Public Affairs

Lightning II and a Joint Precision Approach and Landing System (JPALS) test facility at Naval Air Station Patuxent River, Maryland in 2014.

Over the past three months, the Landing Systems Test Facility also hosted

CATBird to prepare for the second developmental test (DT-II) ship trials of

the F-35C Lightning II scheduled for later this year.

“Initial testing with the JPALS ship system was very successful and met F-35 Lightning II primary test objectives,” said Lt. Cmdr. Chris Taylor, co-lead for the JPALS Integrated Product Team at the Naval Air Traffic Management Systems (PMA-213) program office. “Follow-on testing in April and May was also successful in capturing essential data that will deliver F-35 UDB risk reduction to developmental testing with the JPALS ship system.”

A key feature of the former commercial airliner is its ability to transport a team of test engineers in its flying laboratory specially equipped to integrate, test, and validate mission systems avionics for the F-35 Lightning II. The use of CATBird enables the team to test mission systems in a dynamic environment and apply real-time modifications the same day or even hours after a test flight.

At present, CATBird is supporting the development of software scheduled

for release this year. The software is part of the Block 3F software build for upcoming F-35B/C developmental and operational tests.

The F-35 is currently integrating the UHF Data Broadcast (UDB) radio with

the JPALS ship system as an interim solution during development of an auto-land capability into the JPALS ship system. This capability will allow the Navy to recover aircraft in all-weather conditions by removing human error from the carrier landing process.

To date, UDB tests have been a success due to the collaboration between PMA-213 and industry partners, Taylor noted.

http://www.navair.navy.mil/index.cfm?fuseaction=home.NAVAIRNewsStory&id=5937

PAX PIONEERSJuly 2018 Jamie Hunter

BAE Systems has played a central role in the F-35 Integrated Test Force and will continue to do so as future capabilities are rolled out. Jamie Hunter spoke to two

team….…As part of the SDD, the test

team conducted six at-sea de-tachments and performed more than 1,500 vertical landing (VL) tests with the F-35B. The develop-

183 weapon separation tests, 46 weapons delivery accuracy (WDA)

tests, which included numerous multi-ship missions that pitted up to eight F-35s against advanced threats….

down slightly, and due to obsoles-cence issues new aircraft are ex-pected to join the test force from 2023….

…Carrier trialsBAE Systems leads the operations

on the F-35B. First-of-class tri-als for the Queen Elizabeth-class carrier (QEC) with the F-35B are scheduled to begin in late Sep-

onto the ship with around 200 personnel from Pax,” says Peters, with assistance from No 17 TES

test F-35Bs from here aboard the Queen Elizabeth this year for two periods of approximately four week trials, which will be conducted back-to-back with a short break in the middle. Another six-week pe-riod will follow next year in the au-tumn timeframe.”

‘Wizzer’ Wilson is set to play a

been to three prior F-35B ship tri-

the project pilot for QEC – that is Sqn Ldr Andy Edgell – but I’ll be one of the four pilots.”

Clearly, Wilson’s prior experi-ence will be very important as the

the huge new Royal Navy aircraft

every day for six days a week and

that I’ll have keen interest in; for example, the shipboard rolling ver-tical landing [SRVL] is where the engineering is both complex and fascinating.”

35B will land on HMS Queen Eliza-beth, Wilson says that it will be a vertical landing (VL) onto the deck.

step to VL and we don’t expect any surprises. We’ve done a lot of this type of work before – there’s enough read-across between the

Queen Elizabeth – so we know how the jet operates around the ship and we are comfortable with the modelling and that events will go as the simulator shows us.

through the systems automation that we have in the F-35. The pi-lot essentially invokes the level of augmentation they want. So, there’s a fairly large matrix of test

-

you’d expect to start out with mini-mum levels of augmentation.

The aircraft cannot ‘hook up’ to the Queen Elizabeth at this point – the F-35 has the capa-bility but the ship doesn’t yet have JPALS [the GPS-based Joint Precision Approach and Landing System]. However, some systems on the aero-plane can interpret data from the carrier, such as determin-ing its speed. JPALS is ulti-mately designed to give the F-35 auto-land capability; the pilot would simply press a but-ton and the aircraft lands.

-treline for SRVL, and our modelling for this work is very good, but we know we are going to learn some things when we actually get to the

ship. The main challenge is physi-

in a safe fashion. It’s all about the

deck, the visual landing aids and how the helmet mounted display [HMD] performs.”

Previously known as the Bed-ford Array, the SRVL Array is a set of visual aids on the deck that the pilot must line up with the HMD symbology. Wilson says that align-

-ing out the SRVL modelling isn’t a focus of the initial embarkation, Wilson says if the conditions are right, there may be a chance for an early look at this.

In addition, the ski jump will also feature on every launch. Wil-son says the F-35 suits the ski

forward manoeuvre for the pilot.”Peters adds a little more detail:

the ship, with fairly nominal winds down the deck and steady ship motion. But, by the time we’ve

completed the third phase of test-

up to sea state 6 with 50kts of wind over the deck, with big cross-winds and the ship pitching and rolling.”

-tember is designed to provide suf-

-ances’, while the third is expected to pave the way for ‘full capability’.

-lator at Warton has full ship inte-gration and it’s played a large part in the pilot and LSO [landing sig-

prediction work.

is where we are all focused to build on that baseline SDD. For the

-time capability and expanding our combat potential.”

F-35 The Fighter Revolution Special Edition July 2018

Capability Delivery Plan April 2013

http://t.co/bkKAfGGsLA

USN IOC 2018 with 3F + JPALS Manual Landing

“... [US] Joint Publication 1-02 (JP 1-02) titled Department of Defense Dictionary of Militaryand Associated Terms provides standard US military and associated terminology for theDoD as a whole, including the joint activity of the US Armed Forces in both joint and alliedoperations... it defines IOC as: "The first attainment of the capability to employ effectively aweapon, item of equipment, or system of approved specific characteristics that is mannedor operated by an adequately trained, equipped, and supported military unit or force."...”http://www.dtic.mil/get-tr-doc/pdf?AD=ADA488114

EMI EMI

GPS

Tracking

Celestial

Star Trackers

Commercial Augmentations

Beacons

User Interface Orgs

Inertial

Clocks N

SEW

Space Comm & Nav Arch

EnvironmentWeather

Geo-politicalFiscal

SpectrumNavwar

Interference TechnologicalDemographics

WAAS GALILEOO

Cell Phone Networks

TASS

GAGAN

WAAS

GLONASS

EGNOSCommercial

Augmentationsentations

Time Transfer

WAGEZMDS

NigComsat -1 SBASComsat -1SBAS

Compass IRNSS

QZSS

Compa

MTSAT

SSSSSSSSSSSSSSSSS

Doppler TercomTerTT com

ASI

GDGPS

NDGPSMDGPS

eLORAN

IGS

VOR/DME, TACANILS, NDB

GBAS Cat-I

Time Transfer

Compass

Pedometers

CORS

JPALS

NAVCEN

GPSOC NOCC

Time Transfer

Yellow font = New compared to “As Is” 2007 ArchitectureUNCLASSIFIED

PNT Evolved Baseline (2025)

http://www.navcen.uscg.gov/pdf/cgsicMeetings/47/%5B06%5D%20PNT_Arch_brief_for_CGSIC_Conference_24Sep2007_for_public_release%5B1%5D.pdf

PNT = PositioningNavigation & Timing

Navy Ford (CVN-78) Class Aircraft Carrier Program: Background and Issues for CongressRonald O'Rourke, Specialist in Naval Affairs 09 Apr 2014 http://www.scribd.com/document_downloads/218874026?extension=pdf-

“...JPALS [Joint Precision Approach and Landing System]• The Navy has proposed to the USD(AT&L) Milestone Decision Authority that the program be restructured from its

current, land- and sea-based, multiple-increment structure to a single increment focusing on sea-based requirementsprimarily supporting JSF [Joint Strike Fighter; aka F-35] and future Unmanned Carrier Launched Airborne Surveillanceand Strike aircraft. Under this proposed restructuring scheme, there will be no retrofitting of JPALS on legacy aircraftand the Navy will need to maintain both the legacy approach and landing system and JPALS onboard each aircraft-capable ship.JSF

• The arresting hook system remains an integration risk as the JSF development schedule leaves no time for dis-covering new problems. The redesigned tail hook has an increased downward force as well as sharper design that mayinduce greater than anticipated wear on the flight deck.

• JSF noise levels remain moderate to high risk in JSF integration and will require modified carrier flight deck pro-cedures.

- Flight operations normally locate some flight deck personnel in areas where double hearing protection would beinsufficient during F-35 operations. To partially mitigate noise concerns, the Navy will procure new hearing protectionwith active noise reduction for flight deck personnel.

- Projected noise levels one level below the flight deck (03 level), which includes mission planning spaces, willrequire at least single hearing protection that will make mission planning difficult. The Navy is working to mitigate theeffects of the increased noise levels adjacent to the flight deck.

• Storage of the JSF engine is limited to the hangar bay, which will affect hangar bay operations. The impact on theJSF logistics footprint is not yet known.

• Lightning protection of JSF aircraft while on the flight deck will require the Navy to modify nitrogen carts to in-crease their capacity. Nitrogen is used to fill fuel tank cavities while aircraft are on the flight deck.

• JSF remains unable to share battle damage assessment and non-traditional Intelligence, Surveillance, and Recon-naissance information captured on the aircraft portable memory device or cockpit voice recorder in real-time. In addit-ion, the CVN-78 remains unable to receive and display imagery transmitted through Link 16 because of bandwidthlimitations. These capability gaps were identified in DOT&E’s FY12 Annual Report. The Combatant Commanders haverequested these capabilities to enhance decision-making....”

http://www.f-16.net/forum/download/file.php?id=23983

http://www.rand.org/pubs/monographs/MG1171z8.html

JPALS FUTURE

USN Program Guide 2013 Joint Precision Approach and Landing System(JPALS) https://www.navy.mil/navydata/policy/seapower/npg13/top-npg13.pdfDescriptionThe JPALS is a joint DoD effort with the Air Force and Army. The Navy assumed thelead service role in March 2007. JPALS fulfills the need for a rapidly deployable, ad-verse weather, adverse terrain, day-night, survivable, DoD/civil/internationally inter-operable, and mobile Precision Approach and Landing capability that can supportforward presence, crisis response, and mobility needs. Sea-based JPALS consistsof a GPS/INS-based precision landing system component (Shipboard Relative GPSor SRGPS) with a two-way data-link and an independent backup system. JPALSprovides critical enabling technology for several naval programs such as CVN/LHtype ships, JSF, and unmanned systems (UCLASS). *Sea-based JPALS will also beinstalled on all air-capable surface ships, carrier air wing aircraft, and DoD aircraftcapable of operating from Navy ships. JPALS will replace the Automatic CarrierLanding System (ACLS) on nuclear aircraft carriers, SPN-35 on LH type amphibiousships, and various approach systems ashore, including Instrument Landing Systems(ILS), TACAN, and fixed and mobile Precision Approach Radar (PAR). JPALS land-based systems and aircraft systems will also be civil interoperable andFAA certifiable. *[Since amended to ONLY F-35C/CVNs & F-35B/LHA/CVFs + UAVs]-

Status: JPALS completed MS B in June 2008, with contract award on September 15, 2008. Sea-based JPALS IOC is 2016. The system is on schedule for installation in CVN 78,

the lead ship of the Gerald R. Ford new-design aircraft carrier program. Developers: Raytheon Fullerton, California USA - Partnering developers include Rockwell Collins”

[JPALS] Aeronautics and Space Report of the PresidentFiscal Year 2014 Activities NASA https://history.nasa.gov/presrep2014.pdf“...Aircraft Safety and Survivability [JPALS on page 65]The Navy recently completed a technology demonstration of the Joint Precision Approach andLanding System (JPALS). The ship-based JPALS included auto landings by F/A-18C Hornets onthe deck of the aircraft carrier USS Theodore Roosevelt. JPALS is a GPS-based precisionapproach and landing system that will help ship-based aircraft land in all weather conditions,initially providing guidance to a decision height of 200 feet and half-nautical-mile visibility.While JPALS was originally a tri-service program with multiple in-crements, it has been restructured into one increment to supportthe F-35B and F-35C, as well as UCLASS aircraft. JPALS will allowfor coupled, auto-landing functionality via two-way data link.A dramatic reduction in pilot workload during F/A-18 carrier landings was demonstrated in flightsimulations at the Naval Air Warfare Center, Aircraft Division, Patuxent River, Maryland. Sponsored bythe Office of Naval Research, the Maritime Augmented Guidance with Integrated Controls for CarrierApproach and Recovery Precision Enabling Technologies (MAGIC CARPET) project developeda combination of integrated direct lift control, flight path control augmentat-ion, & ship-relative heads-up display, which allowed pilots to consistently conduct precision landings on the carrier with mini-mal pilot compensation. This capability is now planned for implementation in operational F/A-18E/F/G& F-35C [called DFP] aircraft. Greater ease in carrier landings will result in enhanced safety and theability to shift valuable training resources from carrier qualification to complex mission training....”

JPALS & GPS | Video Transcript: NAVAIR Airwaves – 11 Dec 2013 http://www.navair.navy.mil/index.cfm?fuseaction=home.download&key=0BF0F3FD-D94F-4266-A0F8-2886C2A166AD

“USS Theodore Roosevelt Sailors get a first-hand look at the carrier deck of the future as both X-47 unmannedaircraft get underway with the ship.... ...The future landing system for the Navy and Marine Corps exceeded ex-pectations during its latest test period at sea. Video: http://www.navair.navy.mil/index.cfm?fuseaction=home.VideoPlay&key=AE13198E-CAFF-473F-9B29-77E6FE1F02E4

JPALS is a precision based landing system based on GPS technology. Two surrogate F/A-18 aircraft wereoutfitted with the system and successfully performed multiple landings onto the deck of USS Theodore Roose-velt. The tests demonstrated JPALS ability to support hands-free auto land onto a moving carrier, which is im-portant for the systems’ future installation on the F-35 and unmanned aircraft.

Capt. Darrell Lack/program manager PMA-213, Naval Air Traffic Management SystemsWe had over 50 precision approaches and landings, primarily to a touch-and-gos just for speed of data. We alsohad some traps, some arrested landings, but the system on the performance that we saw it was landing precis-ely where we were asking it to land, where it had been programmed to land and the pilot reports that came backfrom the most recent test phase, it was very gentle, it was a gentle landing. It acted just like the legacy systemsonly a little bit better; right so, over all it was a very big success.

Paul Sousa/assistant manager for T&E JPALSWe are out there testing for a reason. We gathered all this data, which is going to be key to the future develop-ment of JPALS to support the future platforms like F-35 and UCLAS. So the data we did during this at-sea dem-onstration is key for future development of JPALS. JPALS is designed to be interoperable across aircraft plat-forms. It is an upgrade to the current landing system which relies on radar to calculate a touchdown point ontothe deck of a ship.”+ Video: http://www.navair.navy.mil/index.cfm?fuseaction=home.VideoPlay&key=54782BD3-210A-44F3-9D83-0705593983D5“GPS is a wonderful technology, but how do you navigate if you lose your satellite signal?

Scientists at the atomic magneto-optical trapping lab are trying to develop an ultra-precise technologythat will enable pilots to navigate in the absence of GPS. Lasers are used to cool atoms to within a few mil-lionths of a degree above absolute zero, which slows them down and makes them much easier to manipul-ate. When rotated or accelerated, the highly sensitive atom wave provides information about its surroundingenvironment. This same basic science can be used to detect magnetic fields. Once the basic science is dev-eloped, it will need to be engineered down to a portable size that can be used by the warfighter...”

Extreme Miniaturization: Seven Devices, One Chip to Navigate without GPS10 Apr 2013 http://www.darpa.mil/NewsEvents/Releases/2013/04/10.aspx-

“The U.S. Military relies on the space-based Global Positioning System (GPS) to aid air, land and sea navigation.Like the GPS units in many automobiles today, a simple receiver and some processing power is all that is need-ed for accurate navigation. But, what if the GPS satellites suddenly became unavailable due to malfunction, en-emy action or simple interference, such as driving into a tunnel? Unavailability of GPS would be inconvenientfor drivers on the road, but could be disastrous for military missions. DARPA is working to protect against sucha scenario, & an emerging solution is much smaller than the navigation instruments in today’s defense systems.

DARPA researchers at the University of Michigan have made significant progress with a timing & inertialmeasurement unit (TIMU) that contains everything needed to aid navigation when GPS is temporarily unavail-able. The single chip TIMU prototype contains a six axis IMU (three gyroscopes and three accelerometers) andintegrates a highly-accurate master clock into a single miniature system, smaller than the size of a penny. Thischip integrates breakthrough devices (clocks, gyroscopes and accelerometers), materials and designs fromDARPA’s Micro-Tech-nology for Positioning, Navigation and Timing (Micro-PNT) program.

Three pieces of information are needed to navigate between known points ‘A’ and ‘B’ with precision:orientation, acceleration and time. This new chip integrates state-of-the-art devices that can measure all threesimultaneously. This elegant design is accomplished through new fabrication processes in high-qualitymaterials for multi-layered, packaged inertial sensors and a timing unit, all in a tiny 10 cubic millimeter package.Each of the six microfabricated layers of the TIMU is only 50 microns thick, approximately the thickness of ahuman hair. Each layer has a different function, akin to floors in a building.

“Both the structural layer of the sensors and the integrated package are made of silica,” said Andrei Shkel,DARPA program manager. “The hardness and the high-performance material properties of silica make it thematerial of choice for integrating all of these devices into a miniature package. The resulting TIMU is smallenough and should be robust enough for applications (when GPS is unavailable or limited for a short period oftime) such as personnel tracking, handheld navigation, small diameter munitions and small airborne platforms.”

The goal of the Micro-Technology for Positioning, Navigation and Timing (Micro-PNT) program is to developtechnology for self-contained, chip-scale inertial navigation and precision guidance. Other recent breakthroughsfrom Micro-PNT include new microfabrication methods and materials for inertial sensors.”

-

-

eloped and demonstrated a new micro-Nuclear Magnetic Resonance Gyro (micro-

navigation requirements along with a successful prototype demonstration marks thefourth and final phase of DARPA’s Navigation-Grade Integrated Micro Gyroscopes(NGIMG) program. The culmination of the eight-year program is a micro-NMRG that offers near navigation-grade performance for the next generation of high-precision inertial sensors.

http://gpsworld.com/northrop-grumman-demonstrates-micro-gyro-prototype

-for-darpa-program/

Northrop Grumman’s micro-NMRG technology uses the spin of atomic nuclei to detect and measure rotation, providing comparable performance to a navigation-grade fiber-optic gyro in a small, lightweight, low-power package. Additionally, the gyro has no moving parts and is not inherently sensitive to vibration and acceleration. The technology can be used in any application requiring small size and low power precision navigation, including personal and unmanned vehicle navigation in GPS-denied or GPS-challenged locations. “Our miniature gyro technology offers unprecedented size, weight and power savings in a compact package, exceeding program requirements,” said Charles Volk, vice president of Northrop Grumman’s Advanced Navigation Systems business unit. “This important tech-nology can help protect our warfighters by offering highly accurate positioning information, regardless of GPS availability.”

The NGIMG effort is part of DARPA’s Micro-Technology for Positioning, Navigation and Timing program that aims to develop technology for self-contained, chip-scale inertial navi-gation and precision guidance. Northrop

� continued from page 17

“Basically we are dealing with a

completely different method of landing,"

said Pete Symonds of the Aircraft Carrier

Alliance.

“With STOVL landing you stop and

land; CV landing is land and stop. So

it’s a completely different set of lights

in completely different positions. Then

the aircraft is different. We’ve built a

new model into the system as clearly the

control laws are different with many

different characteristics including an

arrester hook.”

The team has adapted well to the

changes though. “From the ship point of

view it has been an easier task to organise

the lighting system as we are now

following how the Americans do it. The

American layouts have been our starting

point and we’re trying to improve on

them,” said Mr Symonds.

“And we’re helped by the fact that

the actual size of the carrier flight deck

was driven by the requirement to be

adaptable. The STOVL ship could have

been smaller but the adaptable design

was driven by the size of the runway,

which was needed to recover the aircraft.

We’ve taken the flight deck, and started

again. After the decision was made to

move to the Carrier Variant we had a

period of looking at variable equipment

selection before we started the work. We

now have the flight deck at what we call

level two maturity, so effectively the big

bits are already fixed. The design of the

flight deck is pretty well sorted.” Testing

will soon move to other simulators to test

recovery of helicopters to the carriers.

From DE&S’ Joint Combat Aircraft

point of view the F-35C will be equally

capable from sea or land. “The current

focus for the JCA team is ensuring the

aircraft is integrated onto the carrier in

the most optimal way,” said Wg Cdr Willy

Hackett, the team’s UK Requirements

Manager.

“This aircraft will be the first stealth

platform to operate from an aircraft

carrier which will bring new challenges.

Recovering an aircraft to a small moving

airfield, especially at night or in poor

weather, has always focused the mind of

any pilot who has flown at sea.

“The F-35 will bring new technology

which in time will make landing on an

aircraft carrier just another routine part

of the mission. On entry into service

the aircraft will be equipped with Joint

Precision Approach and Landing System

(JPALS) which will guide the aircraft

down to a point where the pilot can take

over and land the aircraft manually.

Future upgrades intend to allow JPALS

to actually land the aircraft without pilot

input in very poor weather.”

He added: “A new flight control

system, combined with new symbology

in the helmet mounted display, looks

to drastically reduce pilot workload

on a manually flown approach. This

technology is being investigated by the

US and UK, and if successful will see a

major reduction in the training required

to keep pilots competent at landing on

aircraft carriers from the middle of the

next decade.

“Once this new technology is invested

in the F-35C the pilot will be able to

focus on the mission to an even greater

extent than is possible now in the current

generation of carrier variant aircraft. UK

JCA squadrons will therefore be more

operationally focussed than current

generation sea-based aircraft and will

keep UK airpower at the front rank of

military powers.”

So who wins from the current carrier

Landing on the QEC carrier – what the pilot seesAIRCRAFT APPROACH the stern as the carrier steams into the wind. Pilots aim for the second or third of the arrester wires, the safest, most effective target, writes Steve Moore.

Aircraft are guided by deck personnel – the Landing Signal Officers – via radio and the collection of lights on deck.

When the aircraft has landed the pilot powers up the engines to make sure that, if the tailhook doesn’t catch a wire, the plane is moving fast enough to take off again.

Pilots will look at the Improved Fresnel Lens Optical Landing system – the lens – for guidance, a series of lights and lenses on a gyroscopically stabilised platform. Lenses focus light into narrow beams directed into the sky at various angles.

Pilots will see different lights, depending on the plane’s angle of approach. On target, the pilot will see an amber light in line with a row of green lights. If the amber light is above the green, the plane is too high; below green it is too low. Much too low and the pilot will see red lights.

So how did I do? My first attempt saw my F-35 scream way past the carrier, too fast, too high, and with no hope of landing. A second was just as wayward, overshooting by a distance and just missing the island superstructures necessitating a stomach-churning go-around.

A third and final approach needed a last-second drop in height, allowing me to find the last of the arrester wires, ending in a landing more akin to Fosbury than any of the elite pilots who have been using the simulator for their landings. What was that about four football pitches?

‘A win/win for the carrierand aircraft teams’

http

s://w

ww

.gov

.uk/

gove

rnm

ent/u

ploa

ds/s

yste

m/u

ploa

ds/a

ttach

men

t_da

ta/fi

le/3

3820

/des

ider

_44_

Jan2

012.

pdf

https://www.gov.uk/government/uploads/system/uploads/attachment_data/file/33820/desider_44_Jan2012.pdf

JPALS!included

testing? Back to Mr Symonds – “Well

actually it’s both the Aircraft Carrier

Alliance and the Joint Combat Aircraft

teams,” he said. “From the aircraft side

the team has to be satisfied it is safe to

operate the aircraft at sea efficiently.

So in terms of the JCA safety case, it is

critical that we are able to demonstrate

safe F-35C recovery operations.

“From the ACA perspective, we

have to prove that the ship is safe to

operate the aeroplane so we have to

provide sufficient visual landing aids

to demonstrate to our safety case that

it works. Both teams must be confident

that what we will be putting on the deck

works. We will be making sure it is a win/

win for both teams.”

The f l ight deck has about 250 metres

of r unw ay dis tance for l anding

aircr af t . A r unw ay on l and would be

around 12 t imes longer. A nd doesn’t

move.

L anding on a car r ier deck pi tching up

and dow n by up to 30 feet in a rough

sea can be daunting enough. A pi lot

has to pl ace the aircr af t ’s tai lhook in a

precise par t of the deck 150 feet long

by 30 feet w ide to catch the ar rester

w ires , and do i t at night too.

The ar resting w ire s ystem can stop

a 25 -tonne aircr af t tr avel l ing at 150

miles per hour in just t wo seconds in a

30 0 -feet l anding area. Deceler at ion is

up to 4 Gs.

Pictures: Andrew Linnett

“...the aircraft will be equipped withJoint Precision Approach & Land-ing System (JPALS) which willguide the aircraft down to a pointwhere the pilot can take over andland the aircraft manually. Futureupgrades intend to allow JPALS toactually land the aircraft withoutpilot input in very poor weather.”...”

A Message from Lorraine Martin 20 Aug 2015 https://www.f35.com/assets/uploads/documents/16121/f-35_weekly_update_8-20-15.pdf

“...Back in the states, CF-3 at Pax River completed the firstJoint Precision Approach and Landing System (JPALS)approaches with an F-35. This mission is an important partof the shore-based workups the Pax ITF team is required toaccomplish in preparation for the upcoming F-35C shiptrials this fall. JPALS will primarily be used by pilots duringnight time & poor weather ship board landing operations....”

Joint Precision Approach and Landing System (JPALS)

As of this writing, a JPALS engineering unit is being installed onboard the USS George H.W. Bush (CVN-77) for at-sea test and evaluation with an F/A-18, MH-60, and King Air test aircraft in early 2013. This takes the next step beyond the LSO OAG presentations, Fleet Project Team forums, and technology demonstrations, and gives Paddles the opportunity to view the next generation precision approach and landing system at work in the operational environment.

Designed to replace aging sea-based and land-based aircraft landing systems, JPALS is a GPS-based system to provide enhanced joint operational capability in a full spectrum of environments ranging from CAVU to Sea State 5 in all weath-ers in a hostile environment. By complying with the International Civil Aviation Organization (ICAO) for Ground Based Augmentation System (GBAS) and Space Based Augmentation Systems (SBAS), JPALS provides an interoperable civil divert capability. JPALS incorporates both encrypted data link and GPS anti-jam technology with high levels of accura-cy, reliability and capabilities beyond what we have today.

NAVAIR is developing JPALS with an incremental strategy to meet all requirements from replacing the SPN-46, SPN-35, and PAR for manned aircraft to landing unmanned aircraft both ashore and at sea. The first step of which is to achieve 200 ft. decision height with ½ NM visibility at CVN and L-Class ships.

System Overview

Figure 1 (on page 2) depicts the Operational Concept of the nodes and information exchange for JPALS Increment 1. The JPALS data link provides shipboard information for the aircraft to determine a Relative Navigation (RelNav) location to the ship.

The development schedule calls for two separate data links for JPALS. For Increment 1, the JPALS UHF data link is for the air wing aircraft (F/A-18 E/F, EA-18G, E-2D, C-2A, MH-60R/S and other future platforms) with a line of sight limit of 200 NM (for RelNav). Within 60 NM, the aircraft logs into the network and initiates two-way data link for aircraft parameters to be sent to the ship for surveillance and air traffic control. Within 10 NM, the high rate data link provides the required precision navigation (20 cm vertical accuracy). The F-35B/C requires an interim capability, a separate one-way data link, called the UHF Data Broadcast (UDB), which provides RelNav for the pilot out to 30 NM and supports precision approach out to 10 NM, as well as on-deck RF alignment.

Paddles monthly

December 2012

JPALS brings a number of benefits to the fleet, some of which are presented below for the fixed wing pilot/LSO per-spective:

Once the pilot tunes in and the aircraft is processing the data link, he gets instant feedback that JPALS is up and run-ning versus having to wait until flying into the ICLS/ACLS region behind the ship. JPALS slaves to the IFLOLS setting for nominal hook touchdown points for each cross deck pendant allowing the pilot to not only change glide slope, but even target a specific wire. For MOVLAS, JPALS uses the last command-ed IFLOLS HTDP setting prior to switching to MOVLAS. The legacy “System Waveoff” has been eliminated, so the pilot can degrade (and uncouple as applicable) to another approach means and not view a flashing W/O with a JPALS malfunction. Protection levels are established, but the platforms and aviation community are still developing specific degrades and alert indications. Air Boss/LSO initiated waveoff will continue to be displayed as a waveoff to the pilot within 1 NM and on final approach (except for F-35 with UDB). Although the system retains the legacy requirements of Closed Deck and CATCC waveoff, with the exception of the UDB system they are now displayed as a “Discontinue Approach.” The JPALS Incremental acquisition approach includes a non-GPS based back-up system.

Landing Signal Officer Display System (LSODS) Integration

JPALS interfaces with a number of legacy systems on the ship to provide operators the required information to conduct launch and recovery operations with JPALS equipped aircraft. The F-35 UDB does not have a surveillance downlink, so it depends on other systems to provide controller and LSO display information. As briefed at the LSO OAG this year, the F-35 UDB approach to the CVN will be limited to 300 ft. and ¾ NM, achieving only 200 ft. and ½ NM with an ACLS Mode III lock-on to display ACLS final approach data to the operators. The F-35 is implementing a flight direc-tor with UDB, but does not plan to couple the flight control system on UDB approaches.

Figure 1: JPALS Increment 1 Operational Concept Graphic

http://www.hrana.org/documents/PaddlesMonthlyDecember2012.pdf

Program Coordination

In addition to the at-sea testing onboard CVN-77, JPALS testing continues ashore at the Landing Systems Test Facility in Patuxent River, MD. Although production JPALS will begin with CVN installs in 2015, it will take time for the C-2A, E-2D, F/A-18 E/F, EA-18G, and MH-60R/S platforms to integrate JPALS. CVN-79 is expected to deploy without SPN-46, so until that time, both JPALS and SPN-46 will co-exist during the transition.

PMA213 looks forward to continue coordination with OPNAV, platform OEMs, the air traffic controller and the LSO community to field a system that meets the operator needs as the next generation precision landing system. LSO involvement is critical to success, and details of aircraft integration procedures will continue to be briefed to the fleet for feedback. - Ken “Waldo” Wallace is a former Tomcat pilot

and currently the JSF and JPALS liaison for Navy PMA-213 at Coherent Technical Services

The conventional display is portrayed on the right, showing tail number and button. With JPALS incorpo-rated, additional lettering to the right of the “button” shows: “JC” if JPALS Coupled (AFCS engaged), a “J” if JPALS aircraft not coupled, and the lower is SPN-46 Mode I, II, or III (III depicted). The lower panel of the LSO Workstation Control Panel continues to carry only a SPN-46 function, as there is no Lock-on orSystem Waveoff with JPALS.

JPALS data populates the LSODS to display an approaching aircraft very similar to the way SPN-46 depicts it today. The LSO School, NAWC Lakehurst, and Naval Air Traffic Management Systems (PMA213) coor-dinated to integrate a small change depicting JPALS equipped aircraft on approach and whether or not the aircraft is coupled. This is displayed in the line-up section of the LSODS screen, as shown in Figure 2:

http://www.hrana.org/documents/PaddlesMonthlyDecember2012.pdf

“...JPALS slaves tothe IFLOLS settingfor nominal hooktouchdown pointsfor each cross deckpendant allowingthe pilot to not onlychange glide slope,but even target aspecific wire....”

Core Avionics Master Plan 2012 Appendix A-3 - Navigation 3”...Baseline to Objective Transition Strategy (continued).Radars are currently the primary en-abler for precision approach and recov-ery in low ceiling, low visibility condi-

approach to the carrier deck using dif-ferential GPS has already been demon-strated using relative GPS. Insertion of

-

Program is developing these technol-ogies to replace the antiquated radar Automated Carrier Landing System

-lescence and driving high sustainment

-oped for rotary wing platform recovery to single spot ships, and is considered a key element of unmanned air vehi-

to replace precision approach systems at military installations and to provide a capability for all-weather recover to

platform cockpits to provide a Digital

of integrity to support precision naviga-

conditions.

-

modules incorporate Selective Availabil-

enhance security of crypto keys. Addi-tional robustness and enhancements are being achieved through the Nav-

with the integration of Controlled Re-

characteristics, such as the GAS-1 and Advanced Digital Antenna Production

--

ponents and be capable of processing -

--

integration will incorporate an en-hanced security architecture which pro-vides for layered information assurance

NAVWAR development are managed by the U.S. Air Force led GPS Directorate

Mandates and Milestones:JPALS Ship-based Initial Opera-tional Capability (IOC). (2017)

-

for the development of the shipboard

newest aircraft carrier and its assigned carrier aircraft, including C-2A, E-2D,

Required Navigational Perfor-mance (RNP)–2 above FL290 in National Airspace System (NAS). (2018) RNP is a form of performance-based navigation that calls for accura-cy of position location on a GPS route

-

-ty of position accuracy to ensure prop-

-rity using Receiver Autonomous Integ-

that all of the satellites being utilized to determine position are providing useful

-

the NAS (similar to Continental Unit-ed States – CONUS, but also includes

JPALS Land-Based IOC. (2018)Air Force is charged with development

Differential GPS will be used to provide an additional military PPS datum refer-

-talink, and an additional civil interop-erable SPS datum reference signal via

-sion approach capability. A deployable variant will be developed for remote locations....

...3. Funded Enhancements and Potential Pursuits.Digitally Augmented Ship Approach Sequencing (JPALS). (2018)will provide for increased ship-to-air-craft relative position accuracy to sup-port ship recovery operations using

launch and during recovery operations,

aircraft will utilize data-linked ship po-sition and altitude information to es-

-shalling procedures and approaches

-able the aircraft to perform very later-ally and vertically precise approaches to the ship in all weather and all tacti-cal conditions to minimize aircraft re-covery time. Utilization of tighter pat-terns has already demonstrated time and fuel savings in commercial airport operations, and should provide simi-

--

sion navigation will require 24 channel GPS receiver upgrades and processing upgrades that enable procesing both

--

shalling will be the Unmanned Carri-er-Launched Airborne Surveillance and

(2018)-

ly take advantage of improved ap-

are established at shore bases. Shore

planned to implement supplemental ground-based signals (Local Area Aug-

utilize one-way unique military data-link information for GPS augmenta-tion to enable precision approach capa-bilities, but that initiative and solution strategy has been deferred. Instead,

-form GPS augmented precision ap-

--

which will not require a datalink to re-ceive the correction signal. Air Force is

-ity and Combat Commands are negoti-ating the necessity and prioritization of

this functionality, but it is still currently tracking as a part of the program of re-

...D. Recovery.1. Current Capabilities.Current shipboard ACLS radars have critical reliability and obsolescence is-sues. Naval aircraft use Link 4A to conduct assisted approaches and

-covery. Only the largest surface vessels offer precision approach. Some air-craft employ Instrument Landing Sys-

-

-craft not equipped with ILS are limit-ed to locations with precision radar for alternative low weather ceiling emer-gency divert recoveries. Receivers that work ILS frequencies must be equipped

--

2. Advanced Research and Technology Development.Degraded Visual Environment (DVE) Recovery. (2010-2012)Naval Aviation Center for Rotorcraft Ad-

-gies and system options that can pres-ent an affordable near term solution

-

-sors that can “see through” airborne

will be to affordably leverage limit--

sign something that is small and light enough to practically integrate which

margins.

3. Funded Enhancements and Potential Pursuits.Digitally Augmented GPS-based Shipboard Recovery (JPALS). (2017)

-ignated as the Lead Service and is re-sponsible for implementation of ship-board recovery solutions (Increment

-ured platform. It will start with a tem-porary solution that will provide nee-

-tion will not equip the aircraft to broad-cast its position in a manner that can

the ship. Legacy radar will have to be

used for the shipboard monitoring of -

rier-Launched Aircraft Surveillance -

-stalled on air-wing aircraft (C-2A, E-

Class Amphibious ships, and may re--

with civil augmentation and FAA cer---

timeter-level accuracy for all-weather, automated landings. D-GPS provides a SRGPS reference solution for the mov-

-

fully automated recoveries to the car--

environments.

Recovery (JPALS). (2018) Every air--

bility for ship operations will automat-

GPS precision approaches. UCLASS

-

FAA’s WAAS, the Indian GPS and GEO

Augmentation System, or the European Geostationary Navigation Overlay Ser-

-

-

differential GPS to enhance GPS signal correlation for improved position accu-

-link to military approaches but the Civil approaches will utilize the unprotected SPS signal. Civil system interoperabili-ty will enable aviators to use hundreds

Air Force is designated to develop and --

-ing non-precision approach beacons and precision radars required for each

-pability for less capital investment and

-

that will enable precision recovery in

...2. Advanced Research and Technology Development.Military Space Signal and User Equipment Enhancements. (2010-2013) Smaller GPS antennas and AE are being developed for space-con-strained aircraft and small Unmanned

beam-steering AE is also being devel-

Appendix A-4 Coopera-tive Surveillance...Mandates and Milestones:Joint Mode 5 Initial Operational Ca-pability (IOC). (2015)

JPALS Ship-based Initial Opera-tional Capability (IOC). (2017)

-gram, and is responsible for the de-velopment of the shipboard solution

deployed on the newest aircraft carri-er and its assigned aircraft, including

JPALS Land-Based IOC. (2018)Air Force is charged with development

be used to provide an additional mil-itary PPS datum reference signal via

-

currently has precision approach capa-bility. A man-pack variant may be de-veloped for remote locations....

...2. Advanced Research and Technology Development.Military Collision Avoidance (Mode 5). (2011-2012) -

Air mode to perform aircraft collision avoidance functions within the bat-

-ly demonstrated by Spanish F-18 air-craft. Algorithms were developed to place a ‘range bubble’ around aircraft

-erating aircraft who was also operat-

separation.

3. Funded Enhancements and Potential Pursuits.Improved Ship and Shore Approach Sequencing (JPALS). (2018)and C early block deliveries will em-

-tion to facilitate Shipboard Relative GPS

datalink, which will enable ship control-lers to manage improved marshalling

of tighter patterns has already demon-strated time and fuel savings in com-mercial airport operations, and should

multi-spot amphibious ship operations. -

Fused Sensor and Tactical Data Collaborative Combat ID (CID). (2015) -

hosts software that combines and com-pares target track information obtained

from all on-board sensors, as well as from tactical information data-linked from outside sources. If multiple sensor track parameters are similar, a contact attribute can be considered more reli-able than if it were derived from a sin-gle source data point. Similarly, intel-ligence and sensor data combinations can be used to discount parameters that may not be as reliable from a sin-gle range or condition limited sensor, or one that may be getting spoofed. Auto-mated fusion will produce a higher con-

Appendix A-5 Flight Safety...Shipboard Recovery Animation. (2020)

program of record does not include -

opment required to enable the abili-ty to visualize takeoffs or landings in the highly dynamic shipboard environ-

to include enhancements that would in-corporate ship position and motion into the visualization module to enable ac-

-barked operations....

...Structural Prognostics and Health Management. (2015)

-

capability in support of mission sortie -

lessly downloaded parameters will in--

pendables state, and component health conditions requiring maintenance in order to minimize turnaround time. Real time, accurate down-link of spe-

-ness by enabling maintainers to move from time-scheduled removals and in-spections to removing items only when required. Removing components only when they have achieved their toler-ance limit of safe operations can also

their engineering estimates, there-by reducing the costs of repairs or re-

reduced requirements for spares in-ventories or deployed spare support footprints....”

http://www.navair.navy.mil/pma209 /_Documents/CAMP_2012_Final.pdf

Two U.S. arms programs face live-or-die reviews after costs jump18 Apr 2014 Andrea Shalal http://uk.reuters.com/article/2014/04/17/us-usa-military-arms-idUKBREA3G2II20140417

“...a precision ship-landing system built by Raytheon Coface mandatory reviews that could lead to their cancellat-ion after quantity reductions drove unit costs sharplyhigher in 2013, the Pentagon announced on Thursday....

...The cut in quantities of Raytheon's Joint Precis-ion Approach and Landing System (JPALS) cameafter the Army and Air Force decided to pull out ofthe joint program, which resulted in the need for 10fewer shore-based training systems, the report said.

The cost increase in the JPALS program also waspartly due to an extension in the development programaimed at increasing the capability of the system, andhigher material costs....”

DASD(DT&E) FY 2013 Annual Report

http://www.acq.osd.mil/dte-trmc/_Docs/DTE/DTE-FY2013-AnnualReport-March2014.pdf

Page 99 GAO-15-342SP Assessments of Major Weapon Programs

Joint Precision Approach and Landing System Increment 1A (JPALS Inc 1A)

JPALS Increment 1A is a Navy-led program to develop a GPS-based landing system for aircraft carriers and amphibious assault ships to support operations with Joint Strike Fighter and Unmanned Carrier-Launched Airborne Surveillance and Strike System. The program intends to provide reliable precision approach and landing capability in adverse environmental conditions. We assessed increment 1A, and as a result of restructuring, previously planned additional increments are no longer part of the program.

Development start

(7/08)

Restructureddevelopment start

(6/16)

Restructureddesign review

(3/17)

Restructured low-rate decision

(3/19)

Initialcapability

(TBD)

GAOreview(1/15)

Concept System development Production

Program EssentialsPrime contractor: RaytheonProgram office: Lexington Park, MDFunding needed to complete:

R&D: $641.5 millionProcurement: $525.8 millionTotal funding: $1,167.3 millionProcurement quantity: 17

Program Performance (fiscal year 2015 dollars in millions)

The latest cost data do not reflect the June 2014 restructuring of the program as a new acquisition program baseline has not been approved.

As of07/2008

Latest08/2014

Percentchange

Research and development cost $838.9 $1,563.6 86.4Procurement cost $225.8 $504.2 123.2Total program cost $1,072.1 $2,075.1 93.6Program unit cost $28.976 $76.857 165.2Total quantities 37 27 -27.0Acquisition cycle time (months) 75 TBD TBD

JPALS Increment 1A began development in July 2008, and both of the program's currently identified critical technologies were demonstrated in a realistic environment during flight testing in 2013. Program officials reported completing baseline software development as of April 2012. The program began system-level development testing in July 2012 and sea-based testing in December 2012, completing 108 approaches as of July 2013 with no major anomalies reported. According to program officials, no critical manufacturing processes have been identified as JPALS relies primarily on off-the-shelf components. In March 2014, the JPALS program reported a critical Nunn-McCurdy unit cost breach and a new cost and schedule baseline is currently being developed.

As of January 2015Resources and requirements match

● Demonstrate all critical technologies in a relevantenvironment

● Demonstrate all critical technologies in a realisticenvironment

● Complete preliminary design review

Product design is stable

● Release at least 90 percent of design drawings

● Test a system-level integrated prototype

Manufacturing processes are mature

● Demonstrate critical processes are in control

● Demonstrate critical processes on a pilot production line

● Test a production-representative prototype

Knowledge attainedKnowledge not attained

Information not available Not applicable

Attainment of Product Knowledge

Page 100 GAO-15-342SP Assessments of Major Weapon Programs

JPALS Inc1A ProgramTechnology, Design, and Production MaturityIn June 2014, the JPALS program was restructured to accelerate the development of aircraft auto-land capabilities. The program's technology and design maturity will need to be reassessed to account for this alteration of capabilities, and the program has not yet determined what changes are required.

Prior to this restructuring, the program had completed a number of activities to mature its technology and design. JPALS Increment 1A began development in July 2008, and, according to program officials, the two currently identified critical technologies were demonstrated in a realistic environment during sea-based flight testing in 2013. JPALS functionality is primarily software-based, and the program's baseline software development and integration efforts were complete as of April 2012. JPALS Increment 1A held a critical design review in December 2010 and released its all of its expected design drawings at that time. The program began testing a system-level prototype in July 2012, 19 months after its critical design review. Sea-based testing of the system in its current configuration began in December 2012, and program officials reported completing 108 approaches as of July 2013, with no major anomalies identified. The program also completed 70 ship-based auto-landing demonstrations using legacy aircraft as of November 2013. According to JPALS officials, the Increment 1A program has not identified any critical manufacturing processes, as the system's hardware is comprised primarily of off-the-shelf components. The program has accepted delivery of eight engineering development models, seven of which were considered production-representative.

Other Program IssuesIn 2013, the Navy conducted a review of its precision approach and landing capabilities to address budget constraints and affordability concerns. In light of these concerns, as well as other military service and civilian plans to continue use of current landing systems, the Navy restructured the JPALS program. The program was reduced from seven increments to one intended to support the Joint Strike Fighter and Unmanned Carrier-Launched Airborne Surveillance and Strike System. The Navy also accelerated the integration of auto-land capabilities originally intended for the

future increments, and eliminated both the integration of JPALS with other sea-based legacy aircraft and the land-based version of the system. These changes increased the development funding required for auto-land capabilities and reduced system quantities, resulting in unit cost growth and a critical Nunn-McCurdy unit cost breach reported in March 2014. The Under Secretary of Defense for Acquisition, Technology, and Logistics certified the restructured program and directed the Navy to continue risk reduction efforts to incorporate the auto-land capabilities and return for a new development start decision no later than June 2016. The Navy plans to conduct a preliminary design review for the new system in fiscal year 2016 and a critical design review in fiscal year 2017.

Program Office CommentsIn commenting on a draft of this assessment, the program noted that it concurred with our review. The Nunn-McCurdy unit cost breach was a direct result of a reduction in quantities and an acceleration of auto-land capability into the JPALS baseline. The quantity reduction was due to changes in the planned transition to GPS-based landing systems. The Navy decided to terminate both JPALS legacy aircraft integration efforts and ground based systems, and accelerate auto-land capabilities to meet Joint Strike Fighter and Unmanned Carrier-Launched Airborne Surveillance and Strike System requirements. The Joint Strike Fighter will utilize JPALS interim capability as part of its Block 3F software, and the Unmanned Carrier-Launched Airborne Surveillance and Strike System will utilize JPALS as a baseline capability for its precision approach landing requirement. The restructured JPALS eliminates future incremental development.

Mar 2015GAO DEFENSE ACQUISITIONS Assessments

of Selected Weapon Programs

http://www.gao.gov/assets/670/668986.pdf

A Message from Lorraine Martin 20 Aug 2015 Lorraine Martin LM PR“...Back in the states, CF-3 at Pax River completed the first Joint Precision Approachand Landing System (JPALS) approaches with an F-35. This mission is an importantpart of the shore-based workups the Pax ITF team is required to accomplish in prepar-ation for the upcoming F-35C ship trials this fall. JPALS will primarily be used bypilots during night time and poor weather ship board landing operations....”-

https://www.f35.com/assets/uploads/documents/16121/f-35_weekly_update_8-20-15.pdf-

A Message from Lorraine Martin 17 Sep 2015 Lorraine Martin LM PR“...In October, the USS DWIGHT D. EISENHOWER (CVN 69) will host CF-3 and CF-5, aswell as the Pax River test team for F-35C DT-II. The team is ready to get back out to seaand continue to expand the envelope for the carrier variant. The focus of the testing ison arrested landing, catapult performance and handling qualities, including max catap-ult shots up to 60,000 pounds with full internal weapons load. Other planned testing in-cludes crosswind catapults, Gen III helmet testing and assessment, and a wide range ofmaintenance activities, including engine runs. Upon completion of testing, the CarrierSuitability team from the ITF will be in a position to develop and release the first fleet-ready launch and recovery bulletins allowing future fleet F-35C pilots to safely train andoperate from NIMITZ-Class Aircraft Carriers. We look forward to completing this import-ant testing & I will report on the progress of the detachment once the ship is underway....”-

https://www.f35.com/assets/uploads/documents/16232/f-35_weekly_update_9_17_15.pdf

JPALS to Guide F-35, MQ-25 to Shipboard Landings19 Oct 2016 RICHARD R. BURGESSARLINGTON, Va. — The Joint Precision Approach and Landing System (JPALS) being developed by Raytheon will be guiding the F-35 Lightning II strike

as 2018 and, in the future, will be doing the same for the MQ-25 carrier-based refueling unmanned aerial vehicle.

The JPALS is scheduled to achieve early operational capability on two amphibious assault ships in 2018 and initial operational capability in mid-2020, Mark Maselli, JPALS deputy program manager, Raytheon Intelligence, Information and Services., told Seapower Oct. 18.

Positioning System (GPS) signals to guide an aircraft to the deck of a ship

under control of a human pilot in any kind of weather and in darkness. With triangular data links between the aircraft, ship and satellite continuously transmitting faster than a second, the ship’s positions are recalculated continuously as the aircraft approaches. The aircraft is not reliant

on a ship’s radars and beacons.The JPALS will be used by both

the F-35B and F-35C variants of the Lightning II and be part of the Block 3 software version on the aircraft. There are no additional avionics components for the F-35, just a portion of the F-35’s mission software.

JPALS has been tested in a Navy

taking the aircraft to carrier landings, said Bob Delorge, vice president of Transportation and Support Services at Raytheon’s Intelligence, Information and Services business, told Seapower. The F/A-18 made 38 landings on a carrier with JPALS. Raytheon has tested JPALS for 40,000 hours over the development program so far.

The original concept was for JPALS to take the aircraft down to 200 feet in altitude before the pilot resumed control. Under the current program, Raytheon will develop the capability for the aircraft — piloted or unmanned — to be guided all the way to the deck.

“The goal here is that the pilots [are] going to have a huge increase in

to return from a mission regardless of conditions that they’re coming back into,” Delorge said.

Under the concept, a signal is broadcast to the aircraft from the ship when the aircraft is 200 nautical miles away. The aircraft logs into the JPALS system at the 60-nautical-mile mark and starts two-way communication with the ship, Maselli said. The ship is receiving GPS data and accounting for pitch and roll of the ship in the sea. The aircraft also is receiving GPS data and sending it to the ship, which calculates relative position. At the 10-nautical mile mark the data transmission speed becomes multiple updates per second, with more data as well.

The hardened JPALS has anti-

security features, Maselli said.The original vision for JPALS

current program is limited to moving forward with the F-35 and the MQ-25 and any subsequent aircraft types, Maselli said.

The Navy in September awarded to Raytheon $255 million for the development and production readiness of JPALS. Exercise of all options would bring the contract value to $270 million.

http://seapowermagazine.org/stories/20161019-jpals.html

Raytheon Advances JPALS Landing Sys-tem for F-35B/Cs

20 Oct 2016 Bill Carey

The contract also calls for Raytheon to develop initial operational requirements for MQ-25 autoland.

The Air Force eventually withdrew from the JPALS program,

http://www.ainonline.com/aviation-news/defense/2016-10-20/raytheon-advances-jpals-landing-system-f-35b/cs

Rockwell Collins awarded $67 million contract to com-plete subsystem development for Navy’s next generation precision landing system

to bring JPALS into production

CEDAR RAPIDS, Iowa (Oct. 20, 2016) - Rockwell Collins has received a $67 million, six-year contract from Raytheon Company in support of the U.S. Navy and Naval Air Systems Command (NAVAIR) to complete the subsystem development required for production of its next generation Joint Precision Approach and Landing System (JPALS). Rockwell Collins is a major supplier to the program and is designing, developing, testing and producing the subsystems for navigation and communication. The

systems engineering support, as well as integrated logistics.

based precision approach and landing system that supports all-weather carrier-based operations

day or night across the spectrum from training to combat. JPALS utilizes Global Positioning System (GPS) technology and a secure two-way data link to provide surveillance, ship relative navigation and precision approach landing in and around the carrier controlled airspace.

“The JPALS system provides a new level of safety for carrier-based pilots that will help them accomplish their challenging missions,” said Troy Brunk, vice president and general manager for Communication, Navigation and Electronic Warfare Solutions at Rockwell Collins. “The accuracy provided by the system — supported by our datalink and GPS subsystems — was proven during carrier trials using combat aircraft.”

Hornets from the “Salty Dogs” of Strike Aircraft Test Squadron (VX- 23) successfully made more than 60touch-and-go landings on the USS

all, JPALS guided the Hornets to

landing to within approximately

20 centimeter accuracy. “JPALS is clearly a safety and

readiness- enhancing, game- changing capability which will extend the life of carrier- based aircraft, as well as allow the Navy to

Brunk.“JPALS is one of Rockwell

supporting the U.S. Navy,” said Phil Jasper, executive vice president

Government Systems at Rockwell

our team has been working to help ensure that Navy aircraft can successfully approach and land on a moving carrier in any environment.”

Rockwell Collins has been a major supplier to this program

contract phase will help the JPALS program complete development and prepare for production of the Navy’s

http://www.rockwellcollins.com/Data/News/ 2016-Cal-Yr/GS/FY16GSNR05-JPALS.aspx

Rockwell Collins Awarded Contract for JPALS Subsystem Development 20 Oct 2016

http://seapowermagazine.org/stories/20161020-jpals.html“CEDAR RAPIDS, Iowa — Rockwell Collins has received a $67 million, six-year contract from Raytheon Co. insupport of the U.S. Navy and Naval Air Systems Command to complete the subsystem development required forproduction of the next-generation Joint Precision Approach and Landing System (JPALS), Rockwell said in an Oct.20 release. Rockwell Collins is a major supplier to the program and is designing, developing, testing and producingthe subsystems for navigation and communication. The company also is providing significant systems engineeringsupport, as well as integrated logistics.

JPALS is a Navy-certified, ship-based precision approach and landing system that supports all-weather carrier-based operations day or night across the spectrum from training to combat. JPALS utilizes Global PositioningSystem (GPS) technology and a secure two-way data link to provide surveillance, ship relative navigation andprecision approach landing in and around the carrier controlled airspace. “The JPALS system provides a new levelof safety for carrier-based pilots that will help them accomplish their challenging missions,” said Troy Brunk, vicepresident and general manager for Communication, Navigation and Electronic Warfare Solutions at RockwellCollins. “The accuracy provided by the system — supported by our data link and GPS subsystems — was provenduring carrier trials using combat aircraft.”

During flight trials, F/A-18C Hornets from the “Salty Dogs” of Strike Aircraft Test Squadron successfullymade more than 60 touch-and-go landings on the USS Theodore Roosevelt. In all, JPALS guided theHornets to a “hands-off-the-stick” three-wire landing to within approximately 20-centimeter accuracy.

“JPALS is clearly a safety and readiness- enhancing, game- changing capability which will extend the life ofcarrier- based aircraft, as well as allow the Navy to focus training on warfighting, rather than take-offs and landings,”Brunk said.

“JPALS is one of Rockwell Collins’ most significant programs supporting the U.S. Navy,” said PhilJasper, executive vice president and chief operating officer for Government Systems at Rockwell Collins.“For the past eight years, our team has been working to help ensure that Navy aircraft can successfullyapproach and land on a moving carrier in any environment.” Rockwell Collins has been a major supplierto this program since it began in 2008. This latest contract phase will help the JPALS program completedevelopment and prepare for production of the Navy’s current and future fleet, including the F-35.”

On board the USS America (LHA-6), the team continues to expand the F-35B envelope for the fleet to utilize during deployments. The Joint Precision Approach and Landing System (JPALS) is an important feature the team successfully tested during this at-sea period. The JPALS system works on both the F-35B and the F-35C, enabling the jet to synchronize speeds with the ship, in the F-35B’s case, an amphibious assault ship.

In October 2015, the team first tested this same technology to land aboard the USS Eisenhower (CVN 69) with the F-35C model. The difference is the F-35B matches the speed and trajectory of the ship exactly to not only land on board, but to hover in parallel position, allowing the pilot to

17 Nov 2016Jeff Babione https://a855196877272cb14560

-2a4fa819a63ddcc0c289f9457bc3ebab.ssl.cf2.rackcdn.com/17295/

f35_weekly_update_11_17_16.pdf

DT-III AMERICA

JPALS to Guide F-35, MQ-25 To Shipboard Landings

Dec 2016 SEAPOWER Mag’n

BACKGROUNDThe Joint Precision Approach and Landing System (JPALS) is designed by Raytheon to guide aircraft to precision landings on an aircraft carrier or amphibious assault ship in any environment. The program, initially joint, now is Navy-sponsored.

SCOPEThe JPALS was envisioned for back-

now is focused on the F-35B/C

MQ-25A Stingray unmanned carrier aerial refueling system. The JPALS

versions of the aircraft as well as other future carrier aircraft.

TIMELINEThe Navy in September awarded Raytheon $255 million for the development and production readiness of JPALS. Rockwell Collins

contract in October from Raytheon

to complete the development of JPALS navigation and communication subsystems. JPALS is scheduled to achieve early operational capability in 2018. A decision for low-rate

2019. Initial operational capability is scheduled for mid-2020....

to guide an aircraft to the deck of a ship with precision in any kind of weather and in darkness. With data links between the aircraft, ship and satellite continuously transmitting faster than a second, the ship’s positions are recalculated continuously as the aircraft approaches. The aircraft is not reliant on a ship’s radars and beacons.

Under the concept, a signal is broadcast to the aircraft from the ship when the aircraft is 200 nautical miles away. The aircraft logs into the JPALS system at the 60-nautical-mile mark and starts two-way communication with the ship that is accounting for pitch, roll and heave.

At the 10-nautical mile mark, the

data transmission speed becomes multiple updates per second, with more data as well. The data link

capabilities built into it to make it secure.

The original concept was for JPALS to take the aircraft down to 200 feet in altitude before the pilot resumed control. Under the current program, Raytheon will develop the capability for the aircraft — piloted or unmanned — to be guided all the way to the deck.

JPALS has been tested in a Navy

taking the aircraft to carrier landings. The F/A-18 made 38 landings on a carrier with JPALS. Raytheon has tested JPALS for 40,000 hours over the development program so far.

The goal is that the pilots are going to have a huge increase in

going to return from a mission regardless of conditions that they’re coming back into. This is a mature solution set that we’re putting out there.http://www.seapower-digital.com/seapower/december_2016?pg=48#pg48

Jane's

JPALS concept display, as seen at World ATM Congress 2017. (Raytheon) 1699762[Continued in full version…]

Theodore Roosevelt

Jane's

[Continued in full version…]

[Continued in full version…]

[Continued in full version…]

http://www.janesairport360.com/images/assets/122/9122/JPALS_developer_considers_land-based_civil_applications.pdf

coming soon

Version 2008 probablynot same details in 2019

www.jpdo.gov/library/20080618AllHands/05_20080618_Brett_Easler.pdf

Deployed Man-Pack Prototypewww.jpdo.gov/library/20080618AllHands/05_20080618_Brett_Easler.pdf

2008

Man-Pack Prototypewww.jpdo.gov/library/20080618AllHands/05_20080618_Brett_Easler.pdf

2008

FlightDaily News

https://www.flightglobal.com/news/articles/paris-raytheon-talks-to-uk-over-us-navy-precision-l-438359/

http://www.f-16.net/forum/download/file.php?id=30726

Update: Raytheon developing expeditionaryland-based JPALS system 04 Sep 2018 Pat Hosthttps://www.janes.com/article/82763/update-raytheon-developing-expeditionary-land-based-jpals-system-

“ • Raytheon is developing a man-portable land-based JPALS system-

• The system would enable the USAF to land aircraft where it does not have bases-

Raytheon is developing a smaller, expeditionary, land-based version ofits Joint Precision Approach and Landing System (JPALS) for a demon-stration to the US Air Force (USAF), according to a company official.

CJ Jaynes, Raytheon executive technical adviser for precision land-ing, told Jane's on 22 August that the company is repackaging JPALS soit can be built with transit cases and transported on, or in, a truck, suchas a light armoured utility vehicle. The idea is that it can be mobile andexpeditionary, or carried by two people, as current JPALS equipment forUS Navy (USN) aircraft carriers are extremely large, Jaynes said, withfour avionics racks each 1.5 m tall by 0.8 m wide.”

Jane’s

https://www.janes.com/article/82763/update-raytheon-developing-expeditionary-land-based-jpals-system “four avionics racks each 1.5 m tall by 0.8 m wide”

https://www.janes.com/article/88614/raytheon-for-the-first-time-performs-complete-jpals-expeditionary-setup-and-demo

Sep 18, 201

F-35: USAF

Aerospace Daily & Defense Report

NATIONAL HARBOR, Maryland—Raytheon has proposed an expeditionary version of the U.S. Navy’s GPS-based Joint Precision Approach and Landing System (Jpals), which was developed to securely guide LockheedMartin F-35s onto carrier decks and Marine Corpsamphibious assault ships.

Brooks Cleveland, the company’s business development consultant for Jpals,says the landing system could support distributed basing of U.S. AirForce fighters and rotorcraft, beginning with the conventional takeoff and landing F-35A.

The land-based system is being touted as an alternative to radio-based instrument landing systems, which are set up at the end of runways to guide aircraft when visual contact with the runway cannot be established.

Cleveland, a naval aviator who continues to fly Navy aggressor FA-18s, says Jpals helps pilots land safety at nighttime or in poor visibility, and it would be particularly well-suited to distributed or disaggregated basing operations.

On Navy ships, safety standards are extremely high, and Jpals must compensate for the movement of the ship in turbulent seas. Cleveland says the Navy’s carrier-based F-35Cs and Marine Corps short-takeoff vertical landing F-35Bs are alreadyintegrated with Jpals, so the logical next step is the F-35A.

Raytheon is also pressing the Navy to integrate its primary strike fighter, the Boeing F/A-18E/F Super Hornet, along with the three variants of the Bell-BoeingV-22 Osprey.

Beyond the F-35 and V-22, Raytheon says Jpals could support next-generation precision approach for the Air Force F-16, HH-60G Pave Hawk and U.S. Army Sikorsky UH-60 Black Hawk.

“If they wanted to do dispersed basing, maybe a small unit of F-35s in a remotelocation instead of having everybody together, we could put an expeditionary ormobile version Jpals at any airfield or any site,” Cleveland says. “It will give you precision landing to 20

http://aviationweek.com/afa-national-convention/raytheon-pitches-jpals-precision-landing-f-35a

“...the system has a demonstrated reliability rategreater than 99% for automatic landings,including in harsh weather on pitching ships....”

JPALS PrecisionApproach and LandingExpeditionary for USAFhttps://www.youtube.com/watch?v=iTtVf-qZVro

Raytheon pitches USAF on F-35A auto-landing system

After successfully integrating its Joint Precision Approach and Landing System (JPALS) on F-35B fighters and a growing number of US Navy aircraft carriers and amphibious assault ships, Raytheon is pitching a modified version of the system to the US Air Force for auto-landing F-35A aircraft at expeditionary airfields.

https://www.flightglobal.com/news/articles/raytheon-pitches-usaf-on-f-35a-auto-landing-system-452040/

Precision Ship-Landing System Could Be Game-Changer at Bare Airfields

https://www.military.com/defensetech/2018/09/19/precision-ship-landing-system-could-be-game-changer-bare-airfields.html

Raytheon is spending its own money to upgrade the softwarein its Joint Precision Approach and Landing Systems (JPALS),

retired US Navy Rear Adm. C.J. Jaynes, executive technical advisor for precision landing systems at Raytheon Intellig-ence, Information, and Services, said on Thursday.

The company is currently trying to sell the Air Force on theidea of using JPALS, which uses GPS to help aircraft safely land on aircraft carriers and amphibious assault ships re-gardless of weather conditions or sea states, to support its expeditionary operations. More specifically, it hopes that US Air Forces Europe will utilize it for dispersed operations and US Pacific Air Forces will use it as part of its adaptive basing strategy. “The system enhances operations in harsh environ-ments, giving aircraft capability when it comes to precision landings in challenging terrain conditions,” the company’s website notes.

All three F-35 Lightning II fighter models—including the F-35A—are JPALS-capable, and the company is currently intalks with USAF about the possibility of conducting an F-35Alanding test at Edwards AFB, Calif., this fall.

JPALS currently “mirrors the ship system, which is single-run-way, single-approach,” Jaynes explained. “We want to make … that one a multiple-runway, multiple-approach system.”

Jaynes said the goal is for the system to ultimately have multi-aircraft capability, for it to allow aircraft to land up to 20 nautical miles away from a ground station, and for it to accommodate more than one touchdown point.

Using multiple touchdown points is meant to reduce the likelihood of damage to ship decks, Jaynes told Air Force Magazine in a subsequent interview, since JPALS’ consistency in leading aircraft to land within approximately 20 cm of its intended target during a recent test led to noticeable wear to the landing surface.

The company received FY19 funds to begin the software re-vamp, so its engineering team is currently “laying out priorit-ies” for the upgrade process, she continued. The company hopes to have the upgrades completed in time for the possible F-35A landing test at Edwards, she said.

Independent research and development funds will pay for the engineering of the software updates, and capital will cover the cost of putting the software onto the demonstration unit, she said.

http://www.airforcemag.com/Features/Pages/2019/February%202019/Raytheon-Investing-in-JPALS-Software-Upgrades-.aspx

— Rachel S. Cohen, Brian Everstine & Amy McCullough 10 Jun 2019

LE BOURGET, France—As Raytheon begins work under the first production contract for its Joint Precis-ion Approach and Landing System, it is planning more displays to convince the Air Force the system would help USAF aircraft touch down in austere locations.

The $235 million May contract award covers 23 systems for Navy carriers and amphibious ships. Currently,the system is developed for F-35Bs and Cs, but Matt Gilligan, Raytheon’s vice president for Intelligence,Information, and Services, said the company is pitching the system for aircraft such as C-130s that operate in locations without established runways.

The GPS-based system uses multiple antennas and data links to guide an aircraft to a precision touch downpoint on an airstrip. The company claims it “really revolutionizes precision landing in real austere condit-ions,” Gilligan said in an interview at the Paris Air Show.

Developed to help the fighters land in rough sea conditions, Raytheon has prototypes in transit cases thatcan be carried on C-130s or under helicopters and set up at an austere field within 90 minutes, Gilligan said.

The sea-based version lets aircraft securely acquire a signal from 200 miles away, and when the aircraft getswithin 60 miles those at the landing location will be notified the aircraft is on approach.

Raytheon demonstrated the technology to the Air Force, along with the other services and four internationalservices, earlier this year at NAS Patuxent River, Md. The company plans another demonstration late thisyear at Edwards AFB, Calif. So far, the company is developing the mobile prototype at its own cost.

http://www.airforcemag.com/Features/Pages/2019/June%202019/Raytheon-Pitching-its-Precision-Landing-System-for-USAF-Expeditionary-Aircraft.aspx

Precision recovery30 April - 6 May 2019 GARRETT REIM

“…The [JPALS] landing system can be added to any aircraft with a GPS, an inertial naviga-tion system, a software repro-grammable radio and enough computing power, says Jaynes [CJ Jaynes, Raytheon executive technical adviser for JPALS].

EXPEDITIONARY USEIn January 2019, Raytheon demonstrated a portable ver-sion of JPALS guiding in a USMC

-ing F-35B to a touchdown at Yuma Proving Ground in Arizona. In attendance were person-nel from the USN, USMC and US Air Force (USAF), says the company.

Those services are interested in JPALS as a way to rapidly set

-trol operations at expeditionary

bases, which are part of a Pen-tagon idea to make the position of air forces unpredictable – a strategy to keep near-peer ad-versaries such as China or Rus-sia on their heels should war break out. In particular, the USAF is showing strong interest, says Jaynes.

“The reason the air force is interested is they are devel-oping a concept of operations called ‘agile basing’, where they intend to bring in their air wing, maybe stay in a location for 24 to 48h, and then move the en-tire air wing to a new location,” she says.

The USMC is also interested because it could play a role in

-land. “This system is perfect for that island hopping,” he says.

The expeditionary version could be packed in rugge-dised cases or integrated into a Humvee or Polaris RZR light

tactical allterrain vehicle, either of which could be quickly air dropped.

“The goal is to have [a] multi-runway, multi-aircraft [capabil-ity], with the ultimate goal we envision an end space where you can handle up to 50 aircraft with that landing system,” says Jaynes. “And you could touch down [at] points within 20nm of that ground station.”

For a second demonstration of the expeditionary version of JPALS at NAS Patuxent River in Maryland on 8 and 9 May, Ray-theon has invited back all of the US military services, plus international development part-ners on the Joint Strike Fighter programme. “Any country that’s buying an F-35 – whether it’s an A, B or C model – is a po-tential customer for this,” says Jaynes.”30 April - 6 May 2019 Flight International Magazine

JPALS Set Up NAS Patuxent River Demonstration Sep 2019https://www.youtube.com/watch?v=RKVl2PdvONk

T he US Navy (USN) is preparing to place an order for Raytheon’s Joint Precision Approach and Landing System (JPALS), to be installed on

all of its aircraft carriers and amphibious assault ships.

The US Naval Air Systems Command (NAVAIR) on 25 March approved production of the system, the aircraft component of which is installed on all three variants of the Lockheed Martin F-35 Lightning II, and should sign a contract with Raytheon at the beginning of May. This will launch serial production of the technology, says Raytheon, and lead to JPALS being installed on 11 nucle-ar-powered aircraft carriers and eight amphi-bious assault ships, with the first units to be delivered in 2020.

JPALS is a differential, GPS-based precision landing system that guides aircraft to land on carrier or assault vessel decks. The navigation equipment is used by the F-35 and will also

be installed on the in-development Boeing MQ-25A Stingray unmanned in-flight refuel-ling tanker, while other USN aircraft will con-tinue to use the service’s existing tactical air navigation system.

“In layman’s terms, it provides a kind of a tunnel [on the head-up display] for the airplane to fly through to get at the same land-ing point every time safely,” says Brooks Cleveland, Raytheon’s senior aviation adviser for precision landing systems.

Raytheon promises that the system is 99% reliable, guiding an aircraft to a 20x20cm (8x8in) spot on a carrier’s deck in almost all weather and up to Sea State 5: an ocean sur-face condition where rough waves are crest-ing as high as 2.5m (8ft). JPALS uses an en-crypted, anti-jam data link to connect to software and receiver hardware built into F-35s and MQ-25A tankers, as well as an array of GPS sensors, mast-mounted antennas and shipboard equipment.

Pilots returning to a carrier for landing will first engage with JPALS at about 200nm

GARRETT REIM LOS ANGELES

US

Mar

ine

Cor

ps

Precision recoveryA new GPS-based landing system will guide F-35 pilots to pin-point carrier touch-downs – and a portable version may also support rapid deployment of expeditionary air units

(370km) away, where they start receiving range and bearing information. Then, at 60nm, the jet automatically logs into the JPALS queue, receiving more precise data while beginning two-way data-link communi-cation. At 10nm the pilot starts receiving pre-cision data for landing, following visual cues to land on an exact spot.

Using JPALS is more covert than relying on a legacy tactical air navigation system and radio transmissions between a pilot and air traffic control, says CJ Jaynes, Raytheon exec-utive technical adviser for JPALS. “You do not have to have an air traffic control tower. You don’t have to have anyone talking to you,” she says. “A system can be on the ground and a pilot can go all the way to his landing point without any communication whatsoever.”

Because the system relies on a direct en-crypted data link, the likelihood of interception

30 April - 6 May 2019Flight International

JPALS equipment has been trialled extensively on land using US Marine Corps’ B-model

AUTOMATED LANDING SYSTEMS AND THE US NAVY ARE OLD PALS

Technology will boost efficiency of embarked operations with

US Navy‘s newest fighter

❯❯

JPALS, the Raytheon-developed Joint Precision Approach and Landing System being readied for installation on all the US Navy’s (USN’s) aircraft carriers and US Marine Corps amphibious assault ships, brings the latest GPS technology to bear on the oldest problem in naval aviation: landing safely on the moving runway that is the deck of a “flat top”.

But the system, which should be de-livered from 2020, is not the first of its type – the navy has been using a prede-cessor system to address this problem since the 1980s.

This current PALS “electronic landing aid” is radar-based, and has been installed on every USN carrier starting with the USS John F Kennedy, where it was certified for service in 1988 follow-ing trials. Developed by Textron Systems, PALS operates in one of three modes: fully automatic; pilot manual control based on cockpit displays of glide slope and centreline error; and pilot control based on approach controller talk-down.

Two systems – one aircraft-based and one shipboard – operate indepen-dently, and must provide identical data to the incoming pilot. In a 2003 University of Tennessee master’s thesis assessing techniques for certifying that these independent elements are indeed providing identical information, John Ellis describes the system as “a vital component of modern naval aircraft recovery”.

Ellis notes that in the John F Kennedy trials “the benefits the system provided to naval aviation were immediately rec-ognised”.

PALS dates, ultimately, to the 1950s. A Textron retirees newsletter article notes that work by Bell – later a Textron division – led to the first automatic land-ing in 1954. The first automatic landing on a carrier deck was in 1957, with a navy pilot putting a Douglas F-3D down on the USS Antietam.

Production systems were certified for use from 1963, but early examples apparently suffered from reliability problems as they consisted of “more than 30 units of electronic equipment, consisting of hundreds of vacuum tube operational amplifiers”.

Subsequent digitalisation – and now the advent of GPS – have been welcome improvements. ■

– a risk with a broadcast, which could giveaway the position of the aircraft or ship – is alsolower, says Cleveland.

In July 2018, the USS Wasp amphibious assault ship used JPALS for the first time to guide a US Marine Corps (USMC) F-35B onto its deck. The USS Essex has also been using the system. Both assault ships carry engineering, manufacturing and development (EMD) units that will be replaced with production versions.

Raytheon says Italy also plans to buy the system for one of its aircraft carriers, and the UK Royal Navy has expressed an interest in buying two systems for its pair of Queen Eliz-abeth-class carriers.

Raytheon thinks the system has potential for other USN carrier-based aircraft too, in-cluding the Boeing F/A-18E/F Super Hornet, Bell Boeing V-22 Osprey and Northrop

Grumman E-2 Hawkeye. The landing system can be added to any aircraft with a GPS, an inertial navigation system, a software repro-grammable radio and enough computing power, says Jaynes.

EXPEDITIONARY USEIn January 2019, Raytheon demonstrated a portable version of JPALS guiding in a USMC short take-off and vertical landing F-35B to a touchdown at Yuma Proving Ground in Arizona. In attendance were personnel from the USN, USMC and US Air Force (USAF), says the company.

Those services are interested in JPALS as a way to rapidly set up and facilitate air traffic control operations at expeditionary bases, which are part of a Pentagon idea to make the position of air forces unpredictable – a strate-gy to keep near-peer adversaries such as

US

Nav

y

❯❯ China or Russia on their heels should war break out. In particular, the USAF is showingstrong interest, says Jaynes.

“The reason the air force is interested is they are developing a concept of operations called ‘agile basing’, where they intend to bring in their air wing, maybe stay in a loca-tion for 24 to 48h, and then move the entire air wing to a new location,” she says.

The USMC is also interested because it could play a role in the Pacific theatre, says Cleveland. “This system is perfect for that is-land hopping,” he says.

The expeditionary version could be

packed in ruggedised cases or integrated into a Humvee or Polaris RZR light tactical all-terrain vehicle, either of which could be quickly air dropped.

“The goal is to have [a] multi-runway, multi-aircraft [capability], with the ultimate

goal we envision an end space where you can handle up to 50 aircraft with that landing system,” says Jaynes. “And you could touch down [at] points within 20nm of that ground station.”

For a second demonstration of the expedi-tionary version of JPALS at NAS Patuxent River in Maryland on 8 and 9 May, Raytheon has invited back all of the US military servic-es, plus international development partners on the Joint Strike Fighter programme. “Any country that’s buying an F-35 – whether it’s an A, B or C model – is a potential customer for this,” says Jaynes. ■

Some military secrets are better kept than others. The emer-gence of Tokyo’s real plan for its pair of Izumo-class helicopter destroyers was always, to naval observers, more a matter of when than if. With their 248m (814ft) length, expansive flight decks and large hangars, the JS Izumo and her sister JS Kaga are the largest ships in the Japan Maritime Self-Defence Force (JMSDF) – and aircraft carriers in all but name.

The facade finally fell away in late 2018, when Tokyo confirmed that the two ships – whose official complement was a mere nine hel-icopters – would be modified to operate the Lockheed Martin F-35B, the short take-off and ver-tical landing (STOVL) variant of the F-35 family.

The US Marine Corps already operates the F-35B from its am-phibious assault ships, and the UK will fly the type from the Royal Navy’s (RN’s) pair of new flat tops, HMS Queen Elizabeth and Prince of Wales. Tokyo plans to obtain around 40 F-35Bs, topping off an eventual fleet of over 105 F-35As that will be operated by the Japan Air Self-Defence Force.

“It has been one of the worst-kept secrets that these ships have the potential to operate as light aircraft carriers with STOVL aircraft,” says Nick Childs, senior fellow naval forces and maritime security at the International Institute for Strategic Studies. “Given developments in naval capabilities around the region, this move was perhaps inevitable.

It was just a case of when and precisely how.”

Fully loaded, the Izumo class ships displace 27,000t, which compares with 22,000t for the RN’s former Invincible class. The ships will reportedly carry about 10 F-35Bs in addition to helicop-ters and, possibly, the Bell Boeing V-22 Osprey, which Japan is also obtaining. The deck has two large elevators leading to its spacious hangar deck.

Tokyo’s pacifist constitution precludes the acquisition of aircraft carriers, resulting in the linguistic gymnastics required for the “helicopter destroyer” designation.

Malcolm Davis, senior analyst, defence strategy and capability at the Australian Strategic Policy Institute, sees a strong rationale for an integrated JMSDF fixed-wing capability. He points to Japan’s complicated geography and “multi-axis” challenges from China, North Korea and Russia.

For Japan’s maritime and air forces, he says: “Power projec-tion within this maritime and ar-chipelagic space is essential. They can certainly rely on land-based airpower, but organic na-val air combat capability has a timeliness and operational flex-ibility in and around the Senkakus in the East China Sea, or maybe even the Ryukyus, that land-based air would lack.”

The crystallisation of Tokyo’s carrier plans comes amid increas-ing concern about the growing military might of China, which is developing a powerful blue water

navy. Beijing already has a single operational aircraft carrier, the 60,000t Liaoning, which operates the Chengdu J-15; a Chinese copy of the Sukhoi Su-33.

Beijing, leveraging its vast civilian ship-building capability, is also deploying new destroyers, cruisers and submarines, in addi-tion to its growing arsenal of land-based missiles and aircraft.

POWERFUL CAPABILITYIn addition to core F-35 attrib-utes such as stealth and sensors, Japan’s aircraft will have powerful anti-shipping capability in the form of the Kongsberg Joint Strike Missile – though the weap-on is too large for the STOVL F-35B to carry internally.

Despite the promise of fixed-wing carrier operations, taking complicated fifth-generation fighters to sea is no easy matter.

“There may be issues of hav-ing to provide extra workshop facilities, redesigning weapons magazines, and in particular pro-viding all the support for the F-35B’s surveillance and recon-naissance capabilities,” says Childs. “The Japanese may also have to decide whether or not they want to equip the Izumo class with a ski-jump ramp like the British, but unlike the Americans.”

The JMSDF’s addition of fixed-wing aircraft brings history full circle. Japan was a pioneer in naval airpower, using carriers to devastating effect in the Second World War, including at Pearl Harbor on 7 December 1941. ■

STRATEGY GREG WALRON SINGAPORE

Modifications to launch F-35B from Japan’s Izumo-class warships are no surprise

“The ultimate goal we envision is handling up to 50 aircraft with that landing system”CJ Jaynes Executive technical adviser for JPALS, Raytheon

Fran

ck R

obic

hon/

EPA

/REX

/Shu

tter

stoc

k

After updates, 27,000t vessel will carry more than helicopters

30 April-6 May 2019 I flightglobal.com

Blue skies for Lightning

As F-35 gives US naval aviation a lift, why Lockheed’s fighter is on the rise

Small Footprint Precision Approach and Landing Capability Design17 Oct 2019 USAF https://www.fbo.gov/index?tab=documents&tabmode=form&subtab=core&tabid=6e6e9cb9f5cba285d8e69687906b1b59-

“...II. Problem StatementThe USAF requires the ability to rapidly deploy forces in all weather conditions to en-sure freedom of movement, commitment to our partners and demonstration of our re-solve. Air Traffic Control and Landing System (ATCALS) provides vital mission sup-port to enable USAF forces to deliver responsive and effective global vigilance, glob-al reach and global power. ATCALS must respond to the joint operational need to de-ploy, employ, sustain, and redeploy aviation assets in multiple geographically separ-ated & environmentally diverse regions at will. There is an unmet need for a SF-PALCfor Agile Combat Employment (ACE) without impacting or requiring changes to air-craft avionics while minimizing the airlift capacity required to transport it.

The SF-PALC design must be capable of reliably withstanding world-wide deploy-able environmental conditions and the unique rigors of repeated world-wide deploy-ment cycles. The major constraints on the design of this system are: 1) there shall beno impact on aircraft instrumentation to include hardware or software and associateddesign changes and 2) ideally, the system should be capable of being transported inno more than one 463L pallet position on one C-130H. The SF-PALC project is dividedinto two separate phases: (1) conduct an initial evaluation of design tradeoffs andvalidate requirements for this system, and (2) the development of a prototype(s) foroperational assessment prior to full-rate production....”https://www.fbo.gov/index?s=opportunity&mode=form&tab=core&id=1c3ac34c17d9643381720b3fd59642ac

USAF looks for expeditionary precision landing system for Pacific18 OCTOBER, 2019 | SOURCE: FLIGHTGLOBAL.COM | BY: GARRETT REIM | LOS ANGELES

The US Air Force (USAF) is looking for a precision approach landing system to enable its aircraft to land at expeditionary air strips on islands in the Pacific Ocean.The service is asking military contractors to submit white papers that outline component-level designs and trade-off analyses to determine the right mix of requirements necessary for a Small Footprint Precision Approach and Landing Capability (SF-PALC) system, it says in an online notice on 17 October.

The USAF would use information from the white papers to set requirements for a separate contract to fund development of prototypes from one or more manufacturers. A production contract could follow the prototyping phase, says the service.

The expeditionary precision approach landing system is needed to help the USAF carry out its Agile Combat Employment (ACE) strategy in the Pacific Ocean. The strategy is a response to China’s precision, long-range missiles, which could hit US aircraft parked on the tarmac. To avoid losses on the ground, the USAF plans to fly from a greater number of air bases, of sizes small and large, so as to increase the number of targets an adversary would need to attack.

However, the agile-basing plan requires the service to constantly keep its aircraft on the move, so that the Chinese military doesn’t have time to spot and attack US jets.

“The ACE concept is basically having a jet land [at a remote location], then a team of maintainers re-arms and refuels the jet,and sends it back into the fight as quickly as possible,” says Master Sargent Edmund Nicholson of 67th aircraft maintenance unit, which is based at Kadena air base in Japan. He explained the concept via an USAF media release about an agile combat exercise at Fort Greely, Alaska in August 2019.

In order for a jet to land at a remote island air strip – a runway without the usual navigation and air traffic control infrastructure – the USAF needs portable equipment. The service wants its SF-PALC system to be small enough to fit onto one 463L pallet, which would be airlifted inside one Lockheed Martin C-130H cargo transport. The system must also be able to be setup and operated in a GPS-denied environment, says the USAF.

The SF-PALC system requirement comes after the US Navy awarded Raytheon a $235 million contract for 23 Joint Precision Approach and Landing Systems (JPALS) in May 2019. JPALS isa differential, GPS-based precision landing system that guidesaircraft to a landing spot, typically on an aircraft carrier deck,though a land-based expeditionary unit is in development aswell.

The navigation equipment is integrated into the Lockheed MartinF-35 Lightning II and will be installed on the in-developmentBoeing MQ-25A Stingray unmanned in-flight refuelling vehicle.Raytheon has said it plans to demonstrate expeditionaryversions of JPALS to the USAF.

https://www.flightglobal.com/news/articles/usaf-looks-for-expeditionary-precision-landing-syste-461599/

JPALS

TThis document does not contain technology or technical data controlled under either the U.S. International Traffic in Arms Regulations or the U.S. Export Administration Regulations.Photo courtesy of U.S. NavyCopyright © 2018 Raytheon Company. All rights reserved. Advanced Media 4469309 (10/18)

JOINT PRECISION APPROACH AND LANDING SYSTEM

JPALS IN ACTION

Joint Precision Approach and Landing System (JPALS) is the only military ground-based augmentation system in the world. Its mission is to provide rapid, precision guidance to aircraft landing in any weather or challenging terrain, day or night. The system is cyber-secured with anti-jam protection.

JPALS provides landing accuracy to less than 20 cm every time.

CAN SERVE

Foreign Military Services

U.S. NavyU.S. Air Force

U.S. Marine Corps

U.S. Army

PERFORMANCE IN ANY CONDITION

Low Visibility

Sandstorms

Fog

Challenging Terrain

Snow

Rain

200 NAUTICAL MILES(APPROXIMATELY)

Pilot will start receiving range and bearing from the landing zone, discretely telling the pilot what direction to fly and how far the runway is.

60 NAUTICAL MILES(APPROXIMATELY)

Jet will automatically log into the JPALS queue, receiving more precise data while beginning two-way data-link communication.

JPALS Deployment (Conceptual)

10 NAUTICAL MILES(APPROXIMATELY)

Pilot starts receiving precision data for landing.

https://www.raytheon

.com/news/feature/rtn_jpals

https://www.raytheon.com/sites/default/files/2018-10/4469309_JPALSinfographic_v4_Final.pdf

What appears to be this counter-intuitive proposition is being made by Raytheon,whose JPALS (Joint PrecisionApproach and Landing System) is in development for theU.S. Navy, who will use it to help F-35 pilots land on carrier decks. The system, whichuses GPS data to provide pilots with a landing spot measured in centimetres, will alsobe part of the landing technology utilized by the MQ-25 unmanned tanker program,regardless of

Raytheon's contract with the U.S. Navy was let in 2008: the carrier-borne iteration ofJPALS is currently in test, and is scheduled to achieve initial operating capability in2019. Clues to the system's utility on land go back to the roots of the program in the1990s, when the U.S. Department of Defense published a precision-landingrequirement. In 1996, following the deaths of all 34 people on board a USAF BoeingT-43A which crashed on a non-precision approach to Dubrovnik, efforts intensified to

Nov 11, 2017ShowNews

"The JPALS unit can talk to whatever aircraft can receive its waveform," says Raytheonconsultant and F-18 pilot Brooks Cleveland. "They need GPS, which almost everyairplane these days has; they need an inertial navigation system, which, again, mosthave; they need some spare processing power, typically found in the mission computer; and then the key piece is a radio that can recognise the JPALS waveform. That's nota new radio: it'll mean a software upgrade, or perhaps a chip in an existing radio."

The need for a new waveform has been driven by security requirements. The linksbetween the JPALS unit and the aircraft are encrypted, and designed to have a lowprobability of being observed or intercepted by a third party. Unlike the hemisphericalradio frequency "bubble" produced by a radar-based system, Cleveland says JPALS' RFfootprint is "virtually non-existent." To further minimize any chance of detection in adeployed ground operation, the unit can be placed up to 20 miles away from thedesired landing site.

JPALS is capable of guiding up to 50 inbound aircraft simultaneously, from ranges of up to 200 miles. Ray points out its utility in sandstorm or brownout conditions, whichthe company believes will be of interest to potential customers in the Middle East.

"This is tailor-made for special-forces-type missions," Cleveland says. "The landing sitedoesn't even need to be a flat surface if you had it on a helicopter. It can provide anapproach to spots typically unreachable by aircraft: it can build a curved approachbased on very precise GPS which allows us to go lower, and in tighter spaces thanpreviously seen."

The system's reliance on GPS may leave it susceptible to jamming - not of the linksbetween the unit and the aircraft, but of the signals from the GPS satelliteconstellation. The U.S. DoD has recognized GPS resilience as a potential area ofvulnerability, and as part of its mitigations it has contracted with Raytheon for thedelivery of a next-generation GPS ground station.

"Our customers will tell you that that's one of the hardest problems we've had to tackleacross the DoD," says Ray. "I think the architecture that we're delivering as part of theupgraded GPS will be able to meet those needs and provide more resilience againstthose low-end jam threats. And because JPALS is going to be accessing the GPSsystem, as GPS moves to the next-generation system it will make JPALS much moreresilient."

http://aviationweek.com/dubai-air-show-2017/raytheons-jpals-brings-precision-landing

JPALS combines three technologies—global positioningsystem (GPS), inertial navigation system (INS), and net-work—to provide pilots with highly accurate positiondata.With JPALS, pilots can use their instruments to safelyapproach and land in high-risk environments, such asthose with electronic jamming.

The system will be installed on nearly every aircraft inthe U.S. military inventory, every air-capable Navy andCoast Guard ship, and every U.S. military air station witha precision instrument approach. It also will support jointmilitary service, civil, and multinational interoperability.

JPALS is being developed jointly, withthe U.S. Air Force as the ExecutiveService. The Air Force is developingand testing the shore-based applica-tions, consisting of fixed-base, tactical,and special mission systems. The AirForce awarded a contract to Raytheonto develop airborne and ground-baseddemonstration systems.The Navy is devel-oping, testing, and integrating the shipboard ver-sion. The Navy portion was performed in-house by ateam consisting of government and contractor personnelwho developed the test beds and software used todemonstrate automatic landings on aircraft carriers. Theservices have coordinated their efforts to develop the pro-gram documentation, including cost data; the acquisition,engineering, and test plans; the work breakdown struc-ture; and the operational requirements document.

What Is JPALS?

JPALS will use GPS receivers with advanced antijamtechniques and inertial navigation systems, plus a covertwireless network at sea, to provide a rapidly deployable,maintainable, and interoperable precision approach andlanding capability on land and at sea. Deployable systemswill be ready to support tactical operations from allied air

bases and special missions operating out of austere air-fields worldwide. Pilots will use the same procedures forevery instrument approach, greatly reducing training costsand currency requirements.

JPALS does not add any equipment to the aircraft. It willmodify and improve a communications or data link radioto serve as a modem for its network requirements. It willuse the improved GPS receivers being modified by theGPS modernization program. It will modify the aircraftoperational flight program to process the information andprovide the displays for the pilot and the commands forthe autopilot.

On large aircraft carriers, JPALS will replace thelegacy Automatic Carrier Landing System

(ACLS) equipment with a few small antennashigh on the ships’ masts and two standard

equipment racks near the radio com-partment in the island. This will savethe ships more than 600 cubic feet and9,000 pounds above deck and will save

the Navy millions of dollars in operationsand support costs. On amphibious assault ships, JPALSwill replace the AN/SPN-35, saving 2,400 cubic feet and6,000 pounds above deck.

JPALS will replace the AN/URN-25 TACAN on allships and the AN/FPN-63 Precision Approach Radar onall Navy shore stations, saving many more millions of dol-lars in support costs. JPALS also can replace the Instru-ment Landing System (ILS) at Air Force bases and theprecision approach radar in deployable mission pack-upkits, greatly enhancing the nation’s ability to deploy aninstrument approach capability on short notice. As anadded benefit, it will provide a new capability for preci-sion instrument approaches on air-capable ships, such ascruisers, destroyers, amphibious transport docks, and com-mand ships.

JOINT PRECISION APPROACH AND LANDING SYSTEM(JPALS): MAKING HIGH-RISK AIRCRAFT OPERATIONS SAFER

by John B. Patterson

How Will JPALS Be Used?

Ashore, JPALS will use standard differential GPS tech-niques. The ground station will broadcast approach-pathinformation and GPS error data on a link that is compat-ible with the Federal Aviation Administration (FAA)Local Area Augmentation System (LAAS). The aircraftwill be able to receive that information when it is about10 to 30 miles from the runway.The aircraft will use theinformation from the data link and its own GPS receiversto determine its approach path and landing point within afew meters.

Using JPALS at sea is somewhat more involved. Itrequires a covert two-way data link to provide networkconnectivity and a technique known as Shipboard Rela-tive GPS (SRGPS). Under this technique, the aircraftcompares its position, determined by its onboard GPS andINS, with the location of the glide slope as transmittedover the network by the ship. The major GPS errorsources are common to the ship and aircraft, and only therelative position of the two platforms is important.As theaircraft approaches the ship, the GPS errors from the shipand aircraft systems cancel each other out, allowing

extremely accurate determination of relative position. Onamphibious assault ships, JPALS can support multipleapproaches simultaneously to different landing areas onthe ship (see above).

When the aircraft is within about 200 nautical miles ofany ship with JPALS, it will be able to pick up enoughinformation from the network to determine the rangeand bearing to the ship, eliminating the need for ship-borne TACAN stations.

As the aircraft approaches within about 50 nautical milesof the ship, the carrier air traffic control center or heli-copter direction center will be able to pick up the air-craft’s position from the network along with otherpertinent data such as fuel state, hung ordnance, andmaintenance status.This information can be used to vec-tor the aircraft to an appropriate position in the recoverypattern at an assigned time, avoiding the need for the air-craft to wait in the marshal stack and reducing the fuelrequired for holding.

As the aircraft approaches within about 20 nautical milesof the carrier (or other air-capable ship), it will begin

JJPALS Shipboard Concept of Operations

http://www.dsp.dla.mil/Portals/26/Documents/Publications/Journal/020701-DSPJ.pdf

receiving the detailed guidance information it needs forits approach and landing. In case it is waved off or fails toengage the arresting cable, the aircraft will receive guid-ance throughout the pattern as it flies downwind to itsnext assigned recovery position. This is essential forunmanned aircraft and very helpful to manned aircraft,especially in hazy conditions.

Not only will JPALS enable an aircraft to accuratelydetermine its position relative to the ship, but it willenable the aircraft to identify and locate other aircraft thatare within about 20 nautical miles.This will allow bettersituation awareness in heavy ACLS traffic, enhance theability to rendezvous without making radio transmissions,and enable unmanned combat air vehicles to operatesafely near manned aircraft.

On aircraft, such as the F/A-18 or Joint Strike Fighter,JPALS will do the following:

■ Provide an SRGPS capability for instrumentapproaches and landings on aircraft carriers

■ Expand GPS capability to make it compatible withFAA’s LAAS and Wide Area Augmentation System(WAAS)

■ Modify antijam compatibility to provide high integrityand availability in the presence of jamming for allphases of flight, including precision approach

■ Add standalone GPS capability to the lowest mini-mums possible under lateral precision approach withvertical guidance terminal instrument approach proce-dures, which are being developed by the FAA

■ Provide for a consistent set of instrument proceduresthat can be practiced ashore before deployment, asopposed to the current situation where training atAN/SPN-42T sites is extremely limited by the lack ofavailability at the three operational sites

■ Provide for decommissioning of current ACLS avionics,including the data link radio and aircraft radar beacon

■ Provide positive guidance for operations around theship in visual flight rules and emissions control(EMCON) environments

■ Provide two-way data link operation with air trafficcontrol (ATC) under “zip-lip” and EMCON condi-tions

■ Provide embedded surveillance data to the carrier forATC and enhanced landing signal officer monitoring,including use for collision avoidance and cockpit dis-play of traffic information.

Will JPALS Work?

JPALS is no longer just a concept.The Air Force and theNavy have successfully demonstrated the system in tests ofoperationally representative, high-risk instrumentapproaches—both at-sea autolandings and approaches in ajamming environment. The Air Force also demonstratedits interoperability.

In April 2001, the Navy team tested the SRGPS aboardthe USS Theodore Roosevelt (CVN-71), demonstrating 10fully auto-coupled landings with a Navy F/A-18 aircraft.During the tests, the landing dispersion (1 sigma) was 15feet, and the vertical system error averaged only 11 cm.Both of these values meet the JPALS operational require-ments for automatic landings at sea.

In August 2001, the Air Force successfully demonstratedmore than 120 precision approaches in a jamming envi-ronment at Holloman Air Force Base, NM. The JPALSantijam system performed so effectively that the aircrewcould not determine from the performance of the guid-ance system whether jamming was on or off during theapproach.

Strike Aircraft Test Squadron F/A-18A During InitialTesting of SRGPS on USS Theodore Roosevelt (CVN-71)on 23 April 2001

Conclusion

JPALS provides a covert, jam-resistant network-centricway to support instrument landings ashore and at sea. Itbrings tremendous new capabilities and high-qualitysafety features to the entire U.S. military aviation commu-nity and the fleet. Enabling military pilots to fly into anymilitary or civilian airfield with an instrument approachusing uniform procedures will make flying in bad weathermuch safer and will reduce training costs.

No longer will pilots have one set of procedures forapproaches using precision approach radar, another forILS approaches, another for ACLS approaches, and stillanother for TACAN approaches. Now pilots will have asingle procedure for all. Navy pilots will be able to prac-tice carrier instrument procedures ashore and to file andfly into Air Force bases. U.S. pilots will be able to conductthe same instrument approaches in America, Europe, andAsia.

Our Marines and Special Operations Forces will have arapidly deployable capability that can be set up on shortnotice in tactical and special mission scenarios.The Navywill be able to operate in low-visibility meteorologicalconditions without giving up the ship’s position and will,for the first time, have a precision approach capability onits small air-capable ships.

JPALS provides the only fully interoperable solutionamong the military services, the FAA, and internationalaviation. It provides a cost-effective and capable replace-ment for a number of systems nearing the end of theirservice lives and will enable the U.S. military to avoid bil-lions of dollars in operations and support costs for thelegacy systems it will replace.

Federal Express Boeing 727 with FAA LAAS DuringInteroperability Testing at Holloman AFB in August 2001

John B. Patterson works at the Naval Air Sys-tems Command, Patuxent River, MD. He is aretired Navy test pilot and program managerwith 28 years of military service. Mr. Patterson has been sup-porting the JPALS Team as a contractor for the last 5 years, andin February 2002, he became the JPALS Team Leader.�

About the Author

USAF 46th Test Group C-12J at Holloman AFB DuringTesting of the Raytheon JPALS Demonstration Systems inAugust 2001

In addition, during the flight testing at Holloman, theAir Force demonstrated civil interoperability using LAASavionics installed in a Federal Express Boeing 727. Thisaircraft performed 10 auto-coupled landings at Hollomanusing the FAA’s airborne LAAS receiver and Raytheon’sJPALS ground-based demonstration system.

Wasp

Activity

Essex

Mission

Major Contractor

Executive Summary

System

F Y 1 8 N A V Y P R O G R A M S

Lincoln

Assessment

Recommendation

http

://w

ww

.dot

e.os

d.m

il/pu

b/re

port

s/FY

2018

/pdf

/nav

y/20

18jp

als.

pdf

SEE NEXT PAGE

The JPALS OV-1 description:“The OV-1 describes a Sea-BasedJPALS program that will secure themninimum acceptable capability tosupport the joint military require-ment and safeguard the futureprecision approach and landingcapability of any JPALS-equippedaircraft (e.g., F-35B/C and MQ-25A)during operations at sea in virtuallyany weather condition withinplatform limitations”

http://www.dote.osd.mil/pub/reports/FY2018/pdf/navy/2018jpals.pdf

RRockwell Collins awarded $67 million contract to complete subsystemm development for Navy’s next generation precision landing system

Work will support ongoing efforts to bring JPALS into production

CEDAR RAPIDS, Iowa (Oct. 20, 2016) - Rockwell Collins has received a $67 million, six-year contract from Raytheon Company (NYSE: RTN) in support of the U.S. Navy and Naval Air Systems Command (NAVAIR) to complete the subsystem development required for production of its next generation Joint Precision Approach and Landing System (JPALS). Rockwell Collins is a major supplier to the program and is designing, developing, testing and producing the subsystems for navigation and communication. The company is also providing significant systems engineering support, as well as integrated logistics.

JPALS is a Navy-certified, ship-based precision approach and landing system that supports all-weather carrier-based operations day or night across the spectrum from training to combat. JPALS utilizes Global Positioning System (GPS) technology and a secure two-way data link to provide surveillance, ship relative navigation and precision approach landing in and around the carrier controlled airspace.

“The JPALS system provides a new level of safety for carrier-based pilots that will help them accomplish their challenging missions,” said Troy Brunk, vice president and general manager for Communication, Navigation and Electronic Warfare Solutions at Rockwell Collins. “The accuracy provided by the system — supported by our datalink and GPS subsystems — was proven during carrier trials using combat aircraft.”

During flight trials, F/A-18C Hornets from the “Salty Dogs” of Strike Aircraft Test Squadron (VX- 23) successfully made more than 60 touch-and-go landings on the USS Theodore Roosevelt (CVN-71). In all, JPALS guided the Hornets to a “hands-off-the-stick” 3-wire landing to within approximately 20 centimeter accuracy.

“JPALS is clearly a safety and readiness- enhancing, game- changing capability which will extend the life of carrier- based aircraft, as well as allow the Navy to focus training on warfighting, rather than take-offs and landings,” added Brunk.

“JPALS is one of Rockwell Collins' most significant programs supporting the U.S. Navy,” said Phil Jasper, executive vice president and chief operating officer for Government Systems at Rockwell Collins. “For the past eight years, our team has been working to help ensure that Navy aircraft can successfully approach and land on a moving carrier in any environment.”

http://seapowermagazine.org/stories/20180717-jpals.htmlhttps://www.rockwellcollins.com/Data/News/2016-Cal-Yr/GS/FY16GSNR05-JPALS.aspx

USS Abraham Lincoln (CVN 72) Completes First F-35C Carrier Qualification15 Dec 2017 Mass Communication Specialist Second Class Jessica Paulauskas, USS Abraham Lincoln (CVN 72) Public Affairs

https://www.navyrecognition.com/index.php/news/defence-news/2017/december-2017-navy-naval-forces-defense-industry-technology-maritime-security-global-news/5811-uss-abraham-lincoln-cvn-72-completes-first-f-35c-carrier-qualification.html-

“The Nimitz-class aircraft carrier USS Abraham Lincoln (CVN 72) successfullycompleted Fleet Replacement Squadron (FRS) Carrier Qualifications for theF-35C Lightning II program, carrier qualifying the first nine fleet aviators in thenew aircraft, while underway Dec. 7-11.

Along with Abraham Lincoln, the "Rough Raiders" of Strike Fighter Squadron(VFA) 125, the "Grim Reapers" of VFA-101, and VX-9 accomplished many firststeps including... use of the Joint Precision Approach and Landing System (JPALS)

in an operational setting."Thanks to the tireless work from the VFA-125, VFA-101, VX-9, CVN72, and the

Lockheed Team this detachment was able to successfully complete numerousmilestones that will set the foundation for the future 5th generation employmentof the F-35C into the Carrier Air Wing," said Cmdr. Scott Hulett, VFA-125 execut-ive officer....

...Abraham Lincoln operated in inclement weather during portion of the qual-ification process, which gave the squadrons varying condition to test the newlanding system, JPALS. The all-weather system works with the ship's navigationsystem to provide accurate and reliable guidance for the aircraft. Prior to thisunderway, F-35Cs only used JPALS for developmental testing....”

Wasp

https://www.flightglobal.com/news/articles/farnborough-raytheon-jpals-landing-aid-nears-serial-450320/

Jeffrey M Sherman

https://www.flightglobal.com/news/articles/us-navy-awards-raytheon-235m-for-23-jpals-units-458438/

Raytheon Wins $234 Million U.S. Navy Contract for 23 JPALS Landing Systems 19 Jun 2019Seapower Staff https://seapowermagazine.org/raytheon-wins-234-million-u-s-navy-contract-for-23-jpals-landing-systems/-

“PARIS — Raytheon won a four-year $234 million contract from the U.S. Navy to outfit allof its nuclear-powered aircraft carriers and amphibious assault ships with 23 Joint Precis-ion Approach and Landing Systems (JPALS), the company announced in a release.

JPALS is a GPS-based precision landing system that guides aircraft to precision landings in allweather and surface conditions. “The U.S. Navy understands how JPALS contributes to their missionsuccess and safety of its people,” said Matt Gilligan, vice president of Raytheon’s intelligence, infor-mation and services business. “Other military services could also benefit from the system’s ability tosafely land both fixed and rotary-wing aircraft in almost any low-visibility environment.”

Since 2018, U.S. Marine Corps F-35B Lightning II fighter pilots have used JPALS toguide them onto the USS Wasp amphibious assault ship during deployed operationsin what Navy Capt. B. Joseph Hornbuckle III, program manager, Naval Air Traffic Man-agement Systems Program Office, called “the most difficult conditions on Earth.”

Earlier this year, F-35B pilots participated in two demonstrations of anew expeditionary version of the JPALS system that brings the same pre-cision capability from sea to shore. The proof-of-concept events showedhow the GPS-based system could be reconfigured into a mobile versionto support landings in a traditional airport setting.

Expeditionary JPALS fits in five transit cases and could be repackaged for avariety of small transit vehicles transportable by C-130. Once on the ground, thesystem can be fully operational in under 90 minutes.”

https://www.military.com/daily-news/2019/06/21/all-navy-carriers-amphibs-get-f-35-precision-landing-system.html

GAO-19-336SP Weapon Systems Annual Assessment

Joint Precision Approach and Landing System (JPALS) JPALS is a program to develop a Global Positioning System (GPS)-based aircraft landing system that will allow aircraft such as the F-35 Lightning II and the MQ-25 Unmanned Aircraft System to operate from aircraft carriers and amphibious assault ships. With JPALS, the Navy intends to provide a reliable, sea-based precision approach and landing capability that is effective in adverse weather conditions. JPALS functionality is primarily software-based, although it will also feature off-the-shelf hardware such as antennas and racks.

Program Essentials Milestone decision authority: Navy Program office: Lexington Park, MD Prime contractor: Raytheon Contract type: CPIF (development) Software development approach:MixedNext major milestone: Low-rate initial production (March 2019)

Program Performance (fiscal year 2019 dollars in millions)

First full estimate (07/2008)

Latest (06/2018)

Percentage change

Development $886.90 $1,494.70 +68.5%

Procurement $238.80 $415.10 +73.9%

Unit cost $30.63 $58.11 +89.7%

Acquisition cycle time (months)

77 146 +89.6%

Total quantities 37 33 -10.8%Total quantities comprise 10 development quantities and 23 procurement quantities.

Funding and Quantities (fiscal year 2019 dollars in millions)

Attainment of Product Knowledge As of January 2019

Status at Current Status

Resources and requirements match Development

Start

Demonstrate all critical technologies are very close to finalform, fit and function within a relevant environmentDemonstrate all critical technologies in form, fit and function within a realistic environment

Complete a system-level preliminary design review

Product design is stable Design Review

Release at least 90 percent of design drawings

Test a system-level integrated prototype

Manufacturing processes are mature Production Start

Demonstrate Manufacturing Readiness Level of at least 9,or critical processes are in statistical control NA NA

Demonstrate critical processes on a pilot production line NA NA

Test a production-representative prototype in its intendedenvironment NA NA

Knowledge attained, Knowledge not attained, … Information not available, NA Not applicable

JPALS Program

Technology Maturity and Design Stability Both of JPALS’s two critical technologies are approaching maturity, and the program has released 100 percent of its design drawings, which corresponds with a stable design. However, as the program continues to mature its critical technologies through testing, the program may need to revise its design drawings to accommodate these changes, which could compromise design stability.

JPALS originally entered system development in July 2008 and held a critical design review (CDR) in December 2010, but the design later proved unstable. The program proceeded with development and accepted delivery of eight prototypes. As JPALS approached its original production decision in 2013, other military departments and civilian agencies decided to continue using their current landing systems instead of investing their resources in JPALS. As a result, the Navy restructured the JPALS program from seven increments to one.

Because of the restructure, the Navy revised its schedule and milestones and conducted a new system-level preliminary design review in March 2016, a new development start in June 2016, and a new CDR in May 2017. Because the program repeated these three events, our attainment of product knowledge table assesses the program’s knowledge at its original development start and original CDR events, which formed the basis for the program’s original business case. This methodology is consistent with how we have previously assessed JPALS and other programs that have repeated key program events.

In June 2016, Navy leadership authorized the restructured JPALS program to enter the engineering and manufacturing development phase. The program office reported that it awarded a contract in September 2016 to upgrade the eight original prototypes, as well as to procure two additional prototypes for developmental testing. The contractor delivered these prototypes during the second quarter, of fiscal year 2018, according to program officials. Both the new and upgraded prototypes are intended to be production representative. According to program officials, these prototypes will allow the program to demonstrate the JPALS critical technologies in a realistic environment, which the program plans to do prior to entering production.

Production Readiness JPALS does not have any critical manufacturing processes, according to the program, because the hardware is primarily off-the-shelf. In December 2017, the Navy approved the JPALS program to procure the entirety of its 23 production units through low-rate initial production because it anticipates cost savings through

shortening the procurement schedule. As a result, the program updated its baseline in March 2018 to reflect that it would not execute a full-rate production decision. Program officials reported that they completed an operational test readiness review in April 2018 and attained early operational capability with their prototypes in June 2018 to support F-35 Lightning II operational testing. For fiscal year 2018, program officials reported a combined total of 78 aircraft approaches for integrated and operational testing. They also stated the program successfully completed its production readiness review in December 2018 ahead of the planned March 2019 low-rate initial production decision.

Other Program Issues Because JPALS is GPS-based, it will need to be compliant with with any updates to GPS systems, such as the integration of M-code, a new military GPS signal designed to further improve anti-jamming and secure access to GPS signals for military users. JPALS program officials stated they contracted for a trade study to determine future M-code integration and implementation options. Program officials expect the study to be delivered in early 2019.

Program Office Comments We provided a draft of this assessment to the program office for review and comment. The program office stated that JPALS is part of a family of systems that provide capability to naval aviation and its partners. According to the program office, in fiscal year 2018 and early fiscal year 2019, JPALS successfully deployed on the amphibious ships LHD 1 and LHD 2, supporting F-35 operational deployments. The program stated that,in fiscal year 2018, it received approval to compress theJPALS production schedule from five to four lots, whichit anticipated would save costs over the program lifetimeand accelerate deployment. The program also statedthat JPALS entered the production and deploymentphase on March 25, 2019, which it said providesauthority to award a low-rate initial production contractfor 23 JPALS quantities. The program said that itexpects to complete some integrated testing and anoperational assessment in April 2019 in support ofJPALS’s integrated operational test and evaluationphase. Additionally, the program stated thatrestructured and accelerated requirements drovechanges to design drawings during JPALSdevelopment.

https://www.gao.gov/assets/700/698933.pdf

MAY 2019

ANALYSIS: US Navy precisionlanding system to enter production

26 APRIL, 2019 | SOURCE: FLIGHTGLOBAL.COM | BY: GARRETT REIM | LOS ANGELES

Naval Air Systems Command (NAVAIR) on 25 March approvedproduction of the system, which is installed on all three variantsof the Lockheed Martin F-35 Lightning II, and should sign acontract with the Raytheon at the beginning of May. This willlaunch serial production of the technology, says Raytheon andlead to JPALS being installed on 11 nuclear-powered aircraftcarriers and eight amphibious assault ships, with the first unitsexpected to be delivered some time in 2020.

JPALS is a differential, GPS-based precision landing systemthat guides aircraft to land on carrier or assault vessel decks.The navigation equipment is used by the F-35 and will be in-stalled on the in-development Boeing MQ-25A Stingray unman-ned in-flight refuelling vehicle, while other USN aircraft will con-tinue to use the service's existing tactical air navigation system.

"In layman’s terms, it provides a kind of a tunnel [on the heads-up display] for the airplane to fly through to get at the samelanding point every time safely," says Brooks Cleveland, Ray-theon's senior aviation adviser for precision landing systems.

Raytheon promises that the system is 99% reliable, guid-ing an aircraft to a 20x20cm (8x8in) spot on a carrier's deck in almost all weather and up to Sea State 5, an ocean sur-face condition where rough waves are cresting as high as 2.5m (8ft). JPALs uses an encrypted, anti-jam data link to connect to software and receiver hardware built into F-35 fighters and MQ-25A tankers, as well as an array of GPS sensors, mast-mounted antennas & shipboard equipment.

Pilots returning to a carrier for a landing will first engage with JPALS at about 200nm (370km) away, where they start receiving range and bearing information, then at 60nm the jet automatically logs into the JPALS queue, receiving more precise data while beginning two-way data-link com-munication. At 10nm the pilot starts receiving precision data for landing, following visual cues to land on an exact spot.

-traffic

https://www.flightglobal.com/news/articles/analysis-us-navy-precision-landing-system-to-enter-457458/

you,"she says. "A system can be on the ground and a pilot can go allthe way to his landing point without any communicationwhatsoever."

Because the system relies on a direct encrypted data link thelikelihood of interception – a risk with a broadcast, which couldgive away the position of the aircraft or ship – is also lower,says Cleveland.

In July 2018, the USS Wasp amphibious assault ship usedJPALS for the first time to guide a US Marine Corps (USMC) F-

Raytheon says Italy also plans to buy the system for one of its aircraft carriers. And the UK Royal Navy has expressed an interest in buying two systems for its two Queen Elizabeth-class aircraft carriers.

EXPEDITIONARY USEIn January 2019, Raytheon demonstrated a portable version ofJPALS guiding in a USMC F-35B vertical take-off and landingvariant for a touchdown at Yuma Proving Ground in Arizona. Inattendance were personnel from the USN, USMC and US AirForce (USAF), says the company.

Those services are interested in JPALS as a way to rapidly setup and facilitate air traffic control operations at expeditionarybases, which are part of a Pentagon idea to make the position

"Right now the goal is to have [a] multi-runway, multi-aircraft[capability], with the ultimate goal we envision an end spacewhere you can handle up to 50 aircraft with that landingsystem," says Jaynes. "And you could land up to 50 planes ortouch down [at] points within 20nm of that ground station.”

For a nd demonstration of the expeditionary version of JPALSat NAS Patuxent River in Maryland on 8 May, Raytheon invited back all of the US military services, plus internationaldevelopment partners on the Joint Strike Fighter programme."Any country that's buying an F-35 – whether it's

-

Two systems – one aircraft-based and one shipboard – operateindependently, and must provide identical data to the incomingpilot. In a 2003 University of Tennessee master’s thesis asses-sing techniques for certifying that these independent elementsare indeed providing identical information, John Ellis describesthe system as “a vital component of modern naval aircraft re-covery”. Ellis notes that in the John F. Kennedy trials “the bene-fits the system provided to naval aviation were immediatelyrecognised”.

PALS dates, ultimately, to the 1950s. A Textron retirees newsletter article observes that work by Bell – later to become aTextron division – led to the first automatic landing in 1954. Thefirst automatic landing on a carrier deck was in 1957, with aNavy pilot putting a Douglas F-3D down on the USS Antietam.

Production systems were certified for use from 1963, but earlyexamples apparently suffered from reliability problems as theyconsisted of “more than 30 units of electronic equipment, con-sisting of hundreds of vacuum tube operational amplifiers”.

Subsequent digitalisation – and now the advent of GPS – have been welcome improvements.

s

Mission

wo

Major Contractor

Executive Summary

Dwight D.Eisenhower

is

System

Joint Precision Approach and Landing System (JPALS)

F Y 1 9 N A V Y P R O G R A M S

Dwight D.Eisenhower

Assessment

Recommendation

Activity

https://assets.documentcloud.org/documents/6768586/2019DOTEAnnualReport.pdf

SEE LARGERTEXT EXTRACT NEXT PAGES

Joint Precision Approach & Landing System (JPALS)

FY 2019 [Jan 2020] DOT&E

Executive Summary

-

--

-

-

-

--

-

-

--

-

-

-

-

-

autoland

MissionOperational Com-manders will use units equipped with JPALS Block 0 to achieve preci-sion approach and land-ing capability for F-35B aircraft deployed to am-phibious assault ships

conditions at point of departure or landing.

Operational Com-manders will use units equipped with JPALS Block 1 to achieve pre-cision approach and landing capability for F-35B/C and MQ-25A for stand-alone or close-proximity air operations with CVN- and LH-type ships throughout the world….

…Activity

-

-

--

Pilots completed 21 ap-proaches, 14 of which included autonomous JPALS assisted landings.

--

-Fielding of JPALS

Two-Way capability is not expected until F-35 Block 4.3 in FY24.

https://assets.documentcloud.org/documents/6768586/20 19DOTEAnnualReport.pdf

l ifi d DISTRIBUTION STATEMENT D Di t ib ti th i d t th D t t f D f d U S D D C t t l

Ship Location CoverageShip to Air broadcastallows aircraft to find ship under all conditions out to 200 nm

200 nm

Concept of Operations (ConOps)

60 nm

10 nm

www.jpdo.gov/library/20080618AllHands/05_20080618_Brett_Easler.pdf

JointPrecisionApproach

andLandingSystem(JPALS)ProgramOverviewJune 2008

l ifi d DISTRIBUTION STATEMENT D Di t ib ti th i d t th D t t f D f d U S D D C t t l

60 nmTwo-way datalink with ship when within 60 nm. Position reports supplement radar and IFF data in CCA displays. Conceptually enable “text messaging” ,i.e. ’99’ Broadcasts

Marshal

CCA coverage

Provides position data used for collision avoidance and Cockpit Display of TrafficInformation (CDTI). Active at 50 nm

A/C SituationalAwareness20 nm

200 nm

10 nm

l ifi d DISTRIBUTION STATEMENT D Di t ib ti th i d t th D t t f D f d U S D D C t t l

10 nmSupports precision nav (15 cm)within 10 nm, 360 deg aroundthe ship. Downlink to ship provides for CATCC, LSO andPrimary to monitor approach

Marshal

Approachcoverage

CASE II/III, CASE I,bolter and waveoffpatterns supported

Guidanceoff the cat& departure

60 nm 200 nm

l ifi d DISTRIBUTION STATEMENT D Di t ib ti th i d t th D t t f D f d U S D D C t t l

10 nmSupports precision nav (15 cm)within 10 nm, 360 deg aroundthe ship. Downlink to ship provides for CATCC, LSO andPrimary to monitor approach

60 nm

20 nmICAO/ NATO compatibleapproach capability within 30 nm of airfield

Two-way datalink with ship when within 60 nm. Position reports supplement radar and IFF data in CCA displays. Conceptually enable “text messaging” ,i.e. ’99’ Broadcasts

Marshal

Approachcoverage

Ashore

Ship Location CoverageCCA coverageShip to Air broadcastallows aircraft to find ship under all conditionsout to 200 nm

Provides position data used for collision avoidance and Cockpit Display of TrafficInformation (CDTI). Active at 50 nm

A/C SituationalAwareness

200 nm

20 nm

CASE II/III, CASE I,bolter and waveoffpatterns supported

Guidanceoff the cat& departure

Global Precision Approach Capability

(DoD and Civil Interoperability)

JPALS End State

Three SystemComponents:

GPS

Ground Station

AircraftIntegration

1

2

22

3

3

3

Ground StationVariants

• Sea-Based:2-way data link

• Shore-Based:1-way databroadcast(fixed/mobile)

1

2

3

MediumEarthOrbit

Unclassified – DISTRIBUTION STATEMENT D. Distribution au70.25thorized to the Department of Defense and U.S. DoD Contractors only.

Webster hosts UK, Italian sailors for landing system training 06 Mar 2020

NAVAL AIR WARFARE CENTER AIRCRAFT DIVISION, WEBSTEROUTLYING FIELD, Md. -- As the F-35B is set for its debut aboard Italy’s and the United Kingdom’s aircraft carriers, sailors from both navies spent the last month learning how to maintain the ships’ instru-ment carrier landing system (ICLS), graduating Feb. 27 during a small ceremony at Webster Outlying Field.

“The Air Traffic Control and Landing Systems team at NAWCAD WOLF [Naval Air Warfare Center Aircraft Division Webster Outlying Field] are the recognized worldwide experts in developing, installing & maintain-ing shipboard landing systems,” said Capt. Kevin Watkins, Naval Air Traffic Management Systems (PMA-213) program manager. “These training classes allow us to pass that knowledge on to our internation-al partners, strengthening our alliances and ensuring our warfighter & partner coalitions have the best capabilities in the world.”

Watkins joined NAWCAD WOLF leadership at the event to congratulate the group completing the three-week AN/SPN-41B technician training class: two Royal Navy sailors and one Italian navy warrant officer.

Following the graduation, Royal Navy Petty Officer Pete Ross, an aviation facilities maintainer responsible for landing aids such as the AN/SPN-41B, said thanks to the course and his instructor, Bill Brooks, he’s now more than confident to carry out his duties on the ship.

“I haven’t seen the system before so this is all new to me, but I’m quite confident I’ll be able to maintain the system,” he said. “So it shows that the training that’s being delivered here is appropriate.”

The AN/SPN-41B is one of two shipboard instrument landing systems compatible with the F-35B; JPALS is the other, but is not currently installed on either ship. These precision electronic approach & land-ing aids help pilots safely land by displaying the glide path and centerline information to the pilot while approaching the carrier.

The U.K.’s two Queen Elizabeth-class carriers and the Italian carrier ITS Cavour are designed for F-35B operations and will be equipped with the AN/SPN-41B. However, ICLS technician training is not yet available to foreign nationals at the U.S. Navy’s “A” School. To add-ress the need, the program office and NAWCAD WOLF collaborated to develop a customized curriculum in 2016 comprising classroom and hands-on training on how to service and maintain the system. The first two groups to complete the course were Royal Navy sailors assigned to U.K.’s first-in-class HMS Queen Elizabeth in 2017. HMS Queen Elizabeth began flying the F-35B off its deck in late 2018 during devel-opmental testing.

“The U.K. specifically has different options on their SPN-41B than whatwe have, so their training needs are different from what our Sailors re-ceive at Navy “A” School,” said Barrett Straub, Air Traffic Control sys-tems engineering branch head at NAWCAD WOLF. “This techniciantraining shows how to conduct routine maintenance & repair failures.”

The U.K. and Italy operate the F-35B short takeoff and vertical landingvariant, which is the U.S. Marine Corps model scheduled to replacethe AV-8B Harrier. The Pax River F-35 Integrated Test Force is scheduled to carry out developmental testing on ITS Cavour later this year and on HMS Prince of Wales in 2021 with its assigned F-35B flight test aircraft.

https://www.navair.navy.mil/news/Webster-hosts-UK-Italian-sailors-landing-system-training/Fri-03062020-0928

restrictions May 14, 2020

NAVAL AIR SYSTEMS COMMAND, PATUXENT RIVER, Md. --TheNaval Air Traffic Management Systems Program Office (PMA-213) completed precision approach and landing system (PALS) certification on USS Essex (LHD 2) in April and began installation of two landing systems aboard the Italian Navy ship, ITS Cavour, despite restrictions due to the Coronavirus pandemic.

“Thanks to dedicated, knowledgeable personnel who persevered with limited resources, changing ship schedules and the unseen specter of Coronavirus we are all coping with in our daily lives, we’ve successfully completed USS Essex’s PALS certification,” said Cmdr. Jarrod Hair, PMA-213 SHIP Air Traffic Management (ATM) deputy program manager.

After achieving first flight day confirmations for three USS Essex PALS systems: the AN/SPN-35 Precision Approach Landing System (PALS), the AN/SPN-41 Instrument Carrier Landing System (ICLS), and the

teams from Naval Air Warfare Center Webster Outlying Field (NAWCAD WOLF) Atlantic Air Traffic Control and Landing Systems (ATC&LS), Naval Test Wing ATC&LS Test, Air Test and Evaluation Squadron (VX) 23, and Strike Fighter Squadron (VFA) 147 were able to align the systems to support the warfighter.

“Due to the complex nature of the systems, it is a rare occasion when a system does not need adjustment between flights; this time we had rose to the challenge and had all three [PALS systems] ready on the first day,” said Hair. “Their efforts have ensured a U.S. Navy capital ship’s PALS capability is available to support their primary mission as the flagship of an Amphibious Ready Group.”

support service personnel created a first-of-a-its kind Virtual Install Technical Assistance Guide for the andthe AN/SPN-41, which serves as a checklist for both U.S. and ForeignMilitary Sales shipyard installers.

“This critical time calls for a creative solution; therefore, this is the first Virtual Install Technical Assistance of an Aircraft Carrier Landing Systemon a foreign ship,” said Clay Smeal, PMA-213 Landing Systems deputy case manager. “This guide enables all installations to proceed onschedule.”

To ensure a successful install and subsequent PALS certification on ITSCavour, PMA-213 holds daily communications with the ship to monitorprogress and mitigate technical issues.

, ifCOVID-19 travel restrictions remain in place.

https://www.navair.navy.mil/news/Navy-achieves-landing-system-certification-FMS-installs-despite-pandemic-restrictions/Thu

Pax airfield first to receive Navy’s newest instrument landing systemPublished: Feb 6, 2020

NAVAIR AIR SYSTEMS COMMAND, PATUXENT RIVER, Md. -- The Navy’s newest instrument landing system (ILS) is installed at NAS Patuxent River’s Trapnell Airfield, required inspections are underway,

While the new system somewhat removes the “middle man,” it does not mean the 81 military and civilian air traffic controllers at Pax River are no longer necessary.

“You may not need to use PAR as frequently, but you still need someone to clear the airspace and clear the runway,” Palmer noted. “There are other parts to air traffic control, not only that final critical phase of flight; and for any aircraft not capable of using ILS, air traffic control comes back into play with precision approach. There are platforms in the Navy that aren’t going anywhere soon, and because they don’t have room in the cockpit or don’t have the capability to receive the other end of ILS they’d need in the cockpit, we’ll still be providing plenty of precision approaches.”

The system’s installation provided an increased capability at Pax River, and will also save the Navy money.

“It will allow test aircraft at Pax to use the ILS, which will reduce the flight hours required to go to a different location, saving both time and money,” said Jason Zimmerman, the Level II IPTL for Shore Landing Systems at PMA-213, the program office that oversaw the installation. “The cost savings are estimated to be more than $8 million a year.”

“Because of fewer parts with the system, it won’t go down for maintenance as much as the bigger, older systems we have, and having the ILS engineering team down at Webster Outlying Field is a plus,” Palmer added. “If they need to take measurements or want to check on the installation, it makes it so much easier, and the response they can provide if there is a problem is rapid fire. It’s very helpful in that aspect.”

The project was a team effort that required multiple stakeholders working together to get the system in place at Pax River.

“And by having the system as a program of record, it will include the sustainment and training that was not available to the fleet before,” Zimmerman added. “To date, the plan is to have all the current systems installed [Navywide] by 2028.”

https://www.navair.navy.mil/news/Pax-airfield-first-receive-Navys-newest-instrument-landing-system/Thu-02062020-1521