This article appeared in a journal published by Elsevier. The attachedcopy is furnished to the author for internal non-commercial researchand education use, including for instruction at the authors institution

and sharing with colleagues.

Other uses, including reproduction and distribution, or selling orlicensing copies, or posting to personal, institutional or third party

websites are prohibited.

In most cases authors are permitted to post their version of thearticle (e.g. in Word or Tex form) to their personal website orinstitutional repository. Authors requiring further information

regarding Elsevier’s archiving and manuscript policies areencouraged to visit:

http://www.elsevier.com/copyright

Author's personal copy

Short Communication

Molecular functions of chaperonin gene, containing tailless complex polypeptide 1from Macrobrachium rosenbergii

Jesu Arockiaraj a,⁎, Puganeshwaran Vanaraja b, Sarasvathi Easwvaran b, Arun Singh c,Rofina Yasmin Othman b, Subha Bhassu b,⁎⁎a Department of Biotechnology, Faculty of Science and Humanities, SRM University, SRM Nagar, Kattankulathur 603 203, Chennai, Tamil Nadu, Indiab Centre for Biotechnology in Agriculture Research, Division of Genetics & Molecular Biology, Institute of Biological Sciences, Faculty of Science, University of Malaya,50603 Kuala Lumpur, Malaysiac Centre for Aquaculture Research and Extension, St. Xavier's College (Autonomous), Palayamkottai, Tamil Nadu 627002, India

a b s t r a c ta r t i c l e i n f o

Article history:Accepted 30 July 2012Available online 8 August 2012

Keywords:ChaperoninPrawnVirusChaperone activityATPase activity

Chaperonin (MrChap) was identified from a constructed transcriptome dataset of freshwater prawnMacrobrachium rosenbergii. The MrChap peptide contains a long chaperone super family domain between11 and 525. Three chaperone tailless complex polypeptide (TCP-1) signatures are present in the MrChappeptide sequence at 36–48, 57–73 and 85–93. The gene expressions ofMrChap in both healthyM. rosenbergiiand those infected with infectious hypodermal and hematopoietic necrosis virus (IHHNV) were examinedusing qRT-PCR. To understand its biological activity, the recombinant MrChap gene was constructed andexpressed in Escherichia coli BL21 (DE3). The results of ATPase assay showed that the recombinant MrChapprotein exhibited apparent ATPase activity. Chaperone activity assay showed that the recombinant MrChapprotein is an active chaperone. These results suggest that MrChap is potentially involved in the immuneresponses against viral infection in M. rosenbergii. These findings indicate that the recombinant MrChap pro-tein may be used in immunotherapeutic approaches.

© 2012 Elsevier B.V. All rights reserved.

1. Introduction

Chaperonins are a class of proteins which ease the folding andassociation of nascent polypeptide chains in bacteria, fungi, plantsand animals. Folding is an essential step for assembling the polypep-tides and this may avoid dissociation by hydrophobic residue duringits native states (Gupta et al., 2006). Thus chaperonin emphasizesits vital presence in cellular mechanism as it directs the sequesterprotein folding and ensures dynamic equilibrium of the proteinlevel in the system. Chaperonin function was presupposed from thegenetic studies with the Escherichia coli/bacteriophage λ (Friedmanet al., 1984). The identification of these proteins has increased theunderstanding of protein folding in vivo (Gupta et al., 2006). So far,

two chaperonins have been distinguished and were classified asgroups I (GroEL/GroES) and II (thermosome).

The group I chaperonin are tetradecameric complexes composedof one or two kinds of subunits, named after the bacterial genesthat it was identified, chaperonin proteins GroES (homolog in E. coliis GroE small; also known as chaperonin 10) with molecular massof about 10 kDa and GroEL (homolog in E. coli is GroE large; alsoknown as chaperonin 60) with molecular mass of 60 kDa. The forma-tion of this group I chaperonin is accelerated by several external fac-tors including bacteriophage λ infection, heat, ultraviolet light (UV)radiation and chemical reagents. The group II chaperonin is heteroge-neous in nature, mostly available in archaebacteria and eurkaryotecytosol (known as TriC or CCT; TCP1-ring complex or chaperonincontaining TCP1). There are about nine kinds of subunits that residein the eukaryotic cytosolic chaperonin, where its rotational symmetryis up to 8 or 9 fold (Kubota et al., 1995). Both the GroEL and GroESexist in a heptamer structure with each having double and singlering respectively. The middle of the double ring heptamer of GroELis filled with chaperonin and this complex binds to the GroES singleheptamer ring.

In a well understood mechanism of protein folding involvingchaperonin GroEL and GroES, the newly synthesized polypeptidesare arbitrated to folding by GroEL in an ATP dependant reaction(Hartl, 1996). In conjunction with that, the GroEL undergoes structur-al changes to prevent other protein binding to reduce competition for

Gene 508 (2012) 241–249

Abbreviations: MrChap, Macrobrachium rosenbergii chaperonin; TCP-1, tailless com-plex polypeptide; IHHNV, infectious hypodermal and hematopoietic necrosis virus;qRT-PCR, quantitative real time polymerase chain reaction; ATP, adenine tri-phosphate;GroES, homolog in E. coli is GroE small; GroEL, homolog in E. coli is GroE large; CCT,TCP1-ring complex or chaperonin containing TCP1; HSPs, heat shock proteins; IPTG,isopropyl-β-thiogalactopyranoside; MBP, mannose binding protein; ORF, open readingframe; UTR, untranslated region.⁎ Corresponding author. Tel.: +91 44 27452270; fax: +91 44 27453903.

⁎⁎ Corresponding author. Tel.: +60 3 79675829; fax: +60 3 79675908.E-mail addresses: jesuaraj@gmail.com (J. Arockiaraj),

subhabhassu2010@gmail.com (S. Bhassu).

0378-1119/$ – see front matter © 2012 Elsevier B.V. All rights reserved.http://dx.doi.org/10.1016/j.gene.2012.07.050

Contents lists available at SciVerse ScienceDirect

Gene

j ourna l homepage: www.e lsev ie r .com/ locate /gene

Author's personal copy

the active ring site. Besides this, the GroES attachment to GroEL alsoeases the protein folding mechanism.

Molecular chaperonin plays a vital role in the immune response ofvariety of organisms, where they are also termed as heat shock pro-teins (HSPs) as it assists in the formation of protein in stress condi-tion. As in the study of chaperonin in immunity of shrimp, the firstcloning and characterization of heat shock cognate 70 was reportedby Lo et al. (2004) and it was conserved in both vertebrates and in-vertebrates. There has been a few reports available on the findingsof this molecular chaperonin in other species including zhikong scal-lop Chlamys farreri (Gao et al., 2007), bay scallop Argopecten irradiant(Gao et al., 2008), zebra fish Danio rerio (Matsuda and Mishina, 2004)and migratory locust Locusta migratoria (Qin et al., 2003).

Macrobracium rosenbergii, or giant freshwater prawn has a higheconomical value in the aquaculture industry compared to otherfreshwater cultured crustaceans in all over the World. However theshrimp aquaculture industry has been facing a major crisis due to var-ious viral diseases. More than 20 viruses, which include infectious hy-podermal and hematopoietic necrosis virus (IHHNV) have beenidentified in prawns (Arockiaraj et al., 2012a). Thus the research onimmune mechanism of freshwater prawns especially M. rosenbergiihas to be improved in order to sustain the productivity of these eco-nomically important species.

So far, only a limited number of reports have been published onmolecular cloning, characterization and gene expression of chaperoninfrom crustacean, but as per our knowledge, there is no report availableon chaperonin from M. rosenbergii. To gather the knowledge in thecharacterization of M. rosenbergii chaperonin (designated as MrChap)and its role in M. rosenbergii, a full length cDNA of MrChap was identi-fied from the transcriptome of M. rosenbergii unigenes obtained byIllumina's Solexa sequencing technology. The transcriptional differenti-ation of MrChap mRNA has been analyzed using IHHNV challenge.Furthermore, over expression and purification of recombinant MrChapprotein were conducted using E. coli BL21 (DE3) bacterial expressionsystem and analyzed their functional properties.

2. Materials and methods

2.1. Prawns

Healthy prawns (average body weight of 10 g) were obtainedfrom the Bandar Sri Sendayan Aquaculture Farm in Negeri Sembilan,Malaysia. Prawns were maintained in flat-bottomed glass tanks(300 L) with aerated and filtered freshwater at 28±1 °C in the labora-tory. All prawns were acclimatized for 1 week before being challengedto IHHNV. A maximum of 15 prawns per tank were maintained duringthe experiment.

2.2. M. rosenbergii chaperonin

A full length MrChap gene was identified from the M. rosenbergiitranscriptome unigenes obtained by Illumina's Solexa sequencingtechnology. In brief, unigenes obtained from the assembly of theIllumina Solexa short reads of the RNA sequencing of the muscle,gills and hepatopancreas transcriptomes of M. rosenbergii weremined for sequences which had been identified as chaperonin genethrough BLAST homology search against the NCBI database (http://blast.ncbi.nlm.nih.gov/Blast).

2.3. Chaperonin sequence analysis

The full-length MrChap sequence was compared with other se-quences available in NCBI database and the similarities were ana-lyzed. The open reading frame (ORF) and amino acid sequence ofMrChap was obtained by using DNAssist 2.2. Characteristic domainsor motifs were identified using the PROSITE profile database (http://prosite.expasy.org/scanprosite/). The N-terminal transmembrane se-quence was determined by DAS transmembrane prediction program(http://www.sbc.su.se/~miklos/DAS). Signal peptide analysis wasdoneusing the SignalP (http://www.cbs.dtu.dk). Pair-wise andmultiplesequence alignment were analyzed using the ClustalW version 2 pro-gram (http://www.ebi.ac.uk/Tools/msa/clustalw2/). The phylogeneticrelationship of MrChap was determined using the Neighbor-Joining(NJ) method and PHYLIP (3.69). The presumed tertiary structureswere established for MrChap using the SWISS-MODEL prediction algo-rithm (http://swissmodel. expasy.org/).

2.4. Gene expression of MrChap after IHHNV infection

For IHHNV induced gene expression analysis, the prawns wereinjected with IHHNV, as described in our earlier report (Arockiarajet al., 2011). IHHNV infected prawn tail tissue, tested positive bynested PCR was homogenized in sterile 2% NaCl (1:10, w/v) solutionand centrifuged in a tabletop centrifuge at 5000 rpm for 5 min at4 °C. The supernatant was filtered through 0.45 μm filter and usedfor injecting (100 μl per 10 g prawn) the animals. Samples were col-lected before (0 h), and after injection (3, 6, 12, 24 and 48 h) andwere immediately snap-frozen in liquid nitrogen and stored at −80 °Cuntil total RNA was isolated. Using a sterilized syringe, the hemolymph(0.2–0.5 ml per prawn) was collected from the prawn heart and imme-diately centrifuged at 3000×g for 10 min at 4 °C to allow hemocyte col-lection for total RNA extraction. Tissue homogenate prepared fromhealthy tail muscle served as control. All samples were analyzed in

Fig. 1. Multiple sequence alignments of MrChap with six other homologous sequences. Chaperonin 1 from brine shrimp Artemia franciscana (AAL27405), chaperonin 7 fromzebrafish Danio rerio (AAI63876), pipid frog Xenopus tropicalis (AAH89710), chaperonin from yellow fever mosquito Aedes aegypti (EAT48473), castor oil plant Ricinus communis(EEF33578) and human Homo sapiens (AAC96011) are shown. Chaperone tailless complex polypeptide (TCP-1) signature 1 (36–48), 2 (57–73) and 3 (85–93) are highlighted ingreen, pink and blue color, respectively. The potential nonorganellar eukaryotic consensus motif is boxed. Glycine–methionine motif is highlighted in yellow color. Asteriskmarks indicate identical amino acids and numbers to the right indicate the amino acid position of chaperonin in the corresponding species. Conserved substitutions are indicatedby (:) and semi-conserved substitutions are indicated by (.). Deletions are indicated by dashes. GenBank accession numbers for the amino acid sequences are given in theparentheses.

Table 1ScanProsite motif analysis of MrChap amino acid.

Details of domain and motifs (nos.) AA position

Domain:Chaperone super family (1) 11–525Signature motifs:Chaperone tailless complexpolypeptide-1 (TCP-1)

36–38

TCP-2 57–73TCP-3 85–93Non-organellar eukaryoticconsensus motif

310–318

Glycine-methionine motif 527–544Common motifs:N-myristoylation site (5) 11–16, 159–164, 327–332, 362–367

and 533–538Protein kinase C phosphorylationsite (6)

123–125, 139–141, 321–323, 384–386,519–521 and 522–524

Casein kinase II phosphorylationsite (7)

77–80, 152–155, 203–206, 332–335,387–390, 515–518 and 525–528

N-glycosylation site (2) 337–340 and 487–490cAMP and cGMP dependentprotein kinase

phosphorylation site (1) 125–128

242 J. Arockiaraj et al. / Gene 508 (2012) 241–249

Author's personal copy

243J. Arockiaraj et al. / Gene 508 (2012) 241–249

Author's personal copy

}

Fig. 1 (continued).

244 J. Arockiaraj et al. / Gene 508 (2012) 241–249

Author's personal copy

three duplications and the results are expressed as relative fold of onesample as mean±standard deviation.

2.5. Total RNA isolation and first strand cDNA synthesis

Total RNA was isolated from the tissues of each animal using TRIReagent following themanufacturer's protocol (Guangzhou DongshengBiotech, China). Total RNA was treated with RNase free DNAse set(5 Prime GmbH, Hamburg, Germany) to remove the contaminatingDNA. The total RNA concentration was measured spectrophometrically(NanoVue Plus Spectrophotometer, GE Healthcare UK Ltd, England).First-strand cDNA was synthesized from total RNA by M-MLV reversetranscriptase (Promega, USA) following the manufacturer's protocolwith AOLP primer (5′GGCCACGCGTCGACTAGTAC(T)16(A/C/G)3′).

2.6. Quantitative real time PCR analysis

The relative expression of MrChap in the hemocytes, pleopods,walking legs, eye stalks, gills, hepatopancreas, stomach, intestine,brain and muscle were measured by quantitative real time polymerasechain reaction (qRT-PCR). qRT-PCR which was carried out using a ABI7500 Real-time Detection System (Applied Biosystems) in 20 μl reac-tion volume containing 4 μl of cDNA from each tissue, 10 μl of FastSYBR® Green Master Mix, 0.5 μl of each primer (20 pmol/μl) and 5 μldH2O. The qRT-PCR cycle profile was 1 cycle of 95 °C for 10 s, followedby 35 cycles of 95 °C for 5 s, 58 °C for 10 s and 72 °C for 20 s and finally1 cycle of 95 °C for 15 s, 60 °C for 30 s and95 °C for 15 s. The same qRT-PCR cycle profile was used for the internal control gene, β-actin. The in-ternal control primers were designed from the β-actin ofM. rosenbergii(GenBank accession number: AY651918). The primer details of genespecific primer (MrChap) and internal control are as follows:MrChap-F:ATGCTTGTGCTGCAGTTGTGGATG and MrChap-R: ACCTCAGCATCTTGAGACTTGGCA; β-actin-F: ACCACCGAAATTGCTCCATCCTCT and β-actin-R:

ACGGTCACTTGTTCACCATCGGCATT. After the PCR program, data wereanalyzedwith ABI 7500 SDS software. Tomaintain consistency, the base-line was set automatically by the software. The comparative CT method(2-δδCT method) was used to analyze the expression level of MrChap(Livak and Schmittgenm, 2001). All samples were analyzed in three du-plications and the results are expressed as relative fold of one sample asmean±standard deviation.

2.7. Cloning of MrChap coding sequence into the pMAL-c2X expressionvector system

All the cloning experiments were carried out according to Sambrooket al. (1989) with slight modifications (Arockiaraj et al., 2012b). Theprimer set ofMrChap were designed with the corresponding restrictionenzyme sites for EcoRI and HindIII at the N- and C-termini respectively[MrChap ORF amplification primer forward: (GA)3GAATTCGCCACTCAGTACT TTGCAGACAEcoRI and reverse: (GA)3AAGCTTCAAGCTGCTTCTGATGCTGCAGTT HindIII] in order to clone the coding sequence into theexpression vector, pMAL-c2X (New England Biolabs UK Ltd, UnitedKingdom). Using plasmid DNA of MrChap as a template and Taq DNApolymerase (Invitrogen BioServices India Pvt. Ltd, Bangalore, India), PCRwas carried out to amplify the coding sequence. The PCR productwas pu-rified using the QIAquick Gel Extraction Kit (QIAGEN India Pvt. Ltd., NewDelhi, India). Then, both insert and vector were digestedwith the respec-tive restriction enzymes. The ligated product was transformed into XL1blue cells and the correct recombinant product was transformed intocompetent E. coli BL21 (DE3) cells for protein expression.

2.8. Induction of MrChap protein expression in E. coli BL21 (DE3)

Transformed E. coli BL21 (DE3) cells were incubated in ampicillin(100 μg/mL) Luria broth (LB) overnight. This culture was then usedto inoculate 100 mL of LB broth in 0.2% glucose-rich medium with

Fig. 2. A phylogenetic tree of MrChap with 22 other homologous chaperonin amino acid sequences was reconstructed by the Neighbour-Joining Method. The tree is based on analignment corresponding to full-length amino acid sequences, using ClustalW and PHYLIP (3.69). The numbers shown at the branches denote the bootstrap majority consensusvalues of 1000 replicates. The GenBank accession numbers are given in parentheses.

245J. Arockiaraj et al. / Gene 508 (2012) 241–249

Author's personal copy

ampicillin at 37 °C until cell density reached 0.7 at OD600. E. coli BL21(DE3) harboring pMAL-c2x-MrChap was induced for over expressionwith 1 mM isopropyl-β-thiogalactopyranoside (IPTG) and incubatedat 15 °C for 4 h. Cells were harvested by centrifugation (4000 x gfor 20 min at 4 °C). E. coli BL21 (DE3) uninduced culture was usedas a negative control. Then the cells were resuspended in columnbuffer (Tris–HCl, pH 7.4, 200 mM NaCl) and frozen at −20 °C over-night. After thawing on ice, cells were disrupted by sonication. Thecrude MrChap fusion protein fused with maltose binding protein(MBP) was purified using pMAL™ protein fusion and purification sys-tem protocol (New England Biolabs UK Ltd, United Kingdom). Fur-ther, DEAE-Sepharose™ ion exchange chromatography method wasused to purify the recombinant MrChap protein away from MBP andthe protease, and also we stipulated an additional purification stepfor removing trace contaminants according to the manufacturer'sprotocol (New England Biolabs UK Ltd, United Kingdom). Then thepurity of the expressed enzyme was verified by 12% SDS-PAGE andthe molecular weight of target protein was evaluated using proteinmolecular weight standards. Proteins were visualized by stainingwith 0.05% Coomassie blue R-250. The concentrations of purified pro-teins were determined by the method of Bradford (1976) using bo-vine serum albumin (BSA) as the standard. The purified protein waskept at −80 °C until determination of molecular functional activities.

2.9. ATP-hydrolysis assay

ATP-hydrolysis assay of recombinant MrChap protein was deter-mined according to the method of Matambo et al. (2004) and Dang etal. (2010) with slight modification (Arockiaraj et al., 2012c). Briefly,recombinant MrChap protein was mixed at different concentrationswith Buffer I (10 mM Hepes, 10 mM MgCl2, 20 mM KCl, 0.5 mMdithiothreitol, and 1 mM ATP) and incubated at 37 °C for 1 h, followedby adding 15% trichloroacetic acid to stop the reaction. An equal volumeof Buffer II (1% ammoniummolybdate, 6% ascorbic acid, 2% sodium cit-rate, and 2% acetic acid)was added to the assaymixture, followed by in-cubation at 45 °C for 25 min. Absorbance at 660 nmwas then recorded.As a negative control, recombinantMrChap protein inactivated by boil-ing at 100 °C for 10 min was also used in the assay.

2.10. Chaperone activity

Chaperone activity of citrate synthase was monitored in HEPESbuffer (50 mM HEPES, pH 8.0, 25 mM NaCl, 0.5 mM DTT) at 45 °Caccording to the methodology of Huang et al. (2008) with slight mod-ifications (Arockiaraj et al., 2012c). The buffer containing recombi-nant MrChap protein at different concentrations was pre-incubatedfor 10 min at 45 °C before the addition of citrate synthase to a finalconcentration of 20 μg/ml. Reactions were continuously monitoredat 320 nm in a spectrophotometer Specord 200 UV VIS (Coslab,India). The absorbance of citrate synthase alone at 60 min of heatingwas defined as 100% aggregation.

2.11. Statistics

For comparison of relative MrChap mRNA expression, statisticalanalysis was performed using one-way ANOVA and mean compari-sons were performed by Tukey's Multiple Range Test using SPSS11.5 at the 5% significant level.

3. Results

The isolated full length MrChap cDNA was 1977 base pair (bp) longwith an open reading frame (ORF) of 1632 bp and encoding a predictedprotein of 544 amino acids with a calculated molecular mass of 60 kDa.,predicted isoelectic point of 6.2, a 96 bp 5′ untranslated region (UTR)and a 249 bp 3′ UTR. The obtained complete M. rosenbergii chaperonin

was submitted to NCBI GenBank database under the accession numberHQ668094. TheMrChap peptide sequence neither has a transmembraneregion nor a signal peptide region. The ScanProsite results together withProRule-based predicted intra-domain features are presented in Table 1.

The putative amino acid (aa) sequences of the MrChap were alignedwith known sequence of chaperonins and presented in Fig. 1. Multiplesequence alignment shows that the number of aa varied from speciesto species and the longest aa (563 aa) taken for analysis from Ricinuscommunis, even though conserved motifs were observed among the aasequences. The highest sequence similarity was observed in chaperoninfrom Aedes aegypti and Culex quinquefasciatus (89%) and chaperonin-1from Artemia franciscana (89%) among the invertebrate group. All indi-viduals taken for similarity analysis showed no less than 78% similaritywithMrChap.

Fig. 2 shows the phylogenetic relationship of MrChap with that ofother homologous groups including invertebrates, vertebrates andplants. The phylogenetic analyses were conducted using the Neighbor-Joining (NJ) and maximum composite likelihood (ML) methods. Thephylogenetic tree showed thatMrChap is closely related to other crusta-cean chaperonin-1 from A. franciscana, formed a sister group withchaperonin from arthropods including A. aegypti, C. quinquefasciatus,Glossina morsitans morsitans, Tribolium castaneum, Nasonia vitripennisand Acyrthosiphon pisum and finally clustered together with chaperoninfrom an arthropod Ixodes scapularis and a hemichordate acorn wormSaccoglossus kowalevskii. The genetic distance is 0.05.

Fig. 3. The Swiss-Model 3D structure of Macrobrachium rosenbergii chaperonin drawnbased on the template, crystal structure of yeast (Saccharomyces cerevisiae) eukaryoticcytosolic chaperonin. Chaperone tailless complex polypeptide (TCP-1) signature 1(36–48), 2 (57–73) and 3 (85–93) are highlighted in green, pink and blue color, re-spectively. The potential nonorganellar eukaryotic consensus motif is highlighted inyellow color.

246 J. Arockiaraj et al. / Gene 508 (2012) 241–249

Author's personal copy

The three dimensional coordinates of MrChap used in the proteinmodeling studies were constructed based on the template, ‘crystal struc-ture of yeast (Saccharomyces cerevisiae) eukaryotic cytosolic chaperonins’with x-ray resolution of 3.80 Å (Fig. 3). The template's pdb code and thechain are 3p9d and O, respectively. The amino acid residue of MrChap

used to construct this 3D model ranged between 11 and 525, sincethese regions possessed a long chaperone super family domain. Thesimilarity between the target and template is 63.18% and the E-value

Fig. 4. Gene expression patterns of MrChap by qRT-PCR. 4A: Tissue distribution of MrChap in different tissues of M. rosenbergii. Data are expressed as a ratio to MrChap gene ex-pression in intestine. Data with different letters significantly differ (Pb0.05) between tissues. 4B: The time course of MrChap gene expression in hemocyte at 0, 3, 6, 12, 24, and48 h post injection with IHHNV. Data are expressed as a ratio toMrChap gene in sample from control group. Data with different letters significantly differ (Pb0.05) between controland IHHNV challenged groups at various sampling times.

Table 2ATP-hydrolysis assay of recombinant MrChap protein analyzed in a colorimetric assay.Heat-inactivated recombinant MrChap protein used as a control.

Optical density (660 nm)

Conc. of MrChap (μM) MrChap (active) MrChap (inactivated)

0.5 0.44 0.141.0 0.53 0.181.5 0.73 0.222.0 0.85 0.262.5 0.97 0.283.0 1.30 0.293.5 1.33 0.314.0 1.51 0.434.5 1.95 0.495.0 2.21 0.52

Table 3Chaperone activity of recombinant MrChap protein. Thermally induced aggregation ofcitrate synthase alone used as a control and applied to compare the chaperone activitywith different ratios of recombinant MrChap protein:citrate synthase (CS).

Recombinant MrChap protein chaperone activity (%)

Time(min)

CS MrChap:CS(1:1)

MrChap:CS(2:1)

MrChap:CS(4:1)

MrChap:CS(8:1)

0.0 0.0 0.0 0.0 0.0 0.00.5 6.0 5.2 4.9 2.5 1.50.10 10.5 7.5 6.9 3.9 2.60.15 14.0 12.6 10.0 5.2 2.90.20 19.3 21.4 15.0 8.7 3.10.25 29.2 27.1 19.2 9.4 3.80.30 38.0 36.7 26.7 12.5 4.00.35 49.0 41.6 32.0 15.4 4.30.40 58.0 49.0 38.8 19.5 5.10.45 67.5 60.0 41.6 21.6 5.40.50 82.7 69.8 46.9 23.9 5.90.55 93.4 76.5 50.7 24.1 7.31.00 100.0 85.0 56.5 25.5 8.6

247J. Arockiaraj et al. / Gene 508 (2012) 241–249

Author's personal copy

is 0.00e−1. The normalized QMEAN z-score details in respect to theprotein size of MrChap are as follows: z-score QMEAN=−3.64,z-score Cβ interaction=−0.08, z-score all atom interaction=−0.48,z-score solvation=−0.19 and z score torsion=−3.92. The homologymodel of the MrChap has an NH2-terminal lobe and a COOH-terminallobe, which are linked by back bones. The three chaperone taillesscomplex polypeptide (TCP-1) signature ‐1, -2 and ‐3 was availablein the NH2-terminal lobe. According to RasMol Molecular RenderAnalysis MrChap 3D structure contains 774H-bonds, 41 α-helix, 49β-strands and 87 turns.

To investigate the tissue distribution of MrChap transcripts, totalRNA extraction was followed by cDNA conversion from variousM. rosenbergii tissues and subjected to quantitative real time PCRanalysis. Fig. 4A shows that the MrChap transcript was expressed inall the tissues analyzed. Significantly (Pb0.05) highest expressionwas noticed in hemocyte and significantly (Pb0.05) lowest expres-sion at intestine. Based on the results of tissue distribution analysis,MrChap mRNA expression in M. rosenbergii was induced in hemocytefollowed by IHHNV challenge. MrChap mRNA expression at 3, 6, 12and 24 h in hemocyte was significantly greater (Pb0.05) than thecontrol, peaking up to 25 times above the control after 24 h post in-fection (Fig. 4B). Control groups yielded no significant increase in ex-pression levels.

The putative mature MrChap molecule was expressed in E. colicells after cloning the cDNA into the EcoRI and HindIII restrictionsites of pMAL-c2x-MrChap expression vector. IPTG driven expressionof MrChap was done in E. coli BL 21 (DE3) cells. The recombinantMrChap protein was purified from the supernatant of induced cells.The result of SDS-PAGE of the recombinant MrChap protein alongwith fusion protein, the recombinant protein gave a major singleband with molecular mass around 102.5 k Da (42.5 k Da for MBPand 60 k Da for MrChap). Further, the recombinant MrChap proteinhas been purified from the MBP fusion protein using DEAE-Sepharoseion exchange chromatography method, and finally the recombinantMrChap protein showed a single band with molecular weight about60 k Da.

The purified recombinant MrChap protein was used for ATP-hydrolysis assay. The ATPase activity of recombinant MrChap proteinwas determined by measuring the release of inorganic phosphate. Theresults showed that recombinant MrChap protein exhibited apparentATPase activity which increased with the concentration of the protein(Table 2). In contrast, heat-inactivated recombinant MrChap proteinexhibited no detectable ATPase activity at low concentrations andonly very weak ATPase activity at high concentrations.

The purified recombinant MrChap protein was used for chaperoneactivity assay. Table 3 explains that the recombinant MrChap proteinwas active in a standard chaperone assay, which measures theheat-induced aggregation of citrate synthase. At a recombinantMrChapprotein-citrate synthase ratio of 1:1 (w/w), chaperonin protein offersprotection to the extent of 15%. The extent of protection increases asthe concentration of recombinant MrChap protein increased, at a ratioof 2:1, 4:1 and 8:1 (recombinantMrChap protein-citrate synthase) ap-proximately 44%, 72% and 91% protection is observed respectively.Thus, recombinantMrChap protein is an active chaperone in this assay.

4. Discussion

Chaperonins are a ubiquitous group of protein subsets and it isknown as molecular chaperones (Hartl, 1996). These are importantproteins and are available in almost all prokaryotic and eukaryotic or-ganisms. It assists in the exact folding of many proteins in the cellunder both normal and stressed states. Chaperonins belong to HSPfamilies and it has been used as essential antigens in the immune sys-tem to a wide variety of infections. Recognition of these antigens mayinvolve protective immunity, but, in some conditions, may also havepathological autoimmune consequences. Furthermore, the recognition

of chaperonins may be an innate factor of the immune system. Younget al. (1993) suggested that themain function of chaperonins in antigenprocessing may be a parameter which contributes to their immunoge-nicity. In this study, the cDNA encoding chapernonin was identifiedfrom the M. rosenbergii transcriptome unigenes obtained by Illumina'sSolexa sequencing technology. The 1977 bp full-length cDNA containeda 1632 bp ORF encoding an MrChap protein of 544 amino acids. Untilnow, only a few chaperonins have been reported in aquatic organismsincluding Penaeus monodon (Lo et al., 2004), Chlamys farreri (Gao etal., 2007), Argopecten irradiant (Gao et al., 2008) and Danio rerio(Matsuda and Mishina, 2004). In this study, for the first time we havereported chaperonin from a freshwater crustacean M. rosenbergii.Based on the predicted amino acid sequence of MrChap, the protein iscomposed of a long chaperone super family domain along with athree chaperone TCP-1 signatures. The C-terminal region of MrChapcontains a glycine–methionine motif (GMM), which is mostly foundin group I chaperonins, and is not found in other archaeal chaperonins.The role of the GMM is still unknown, and its deletion in GroEL does notaffect its in vivo or in vitro assay (Burnett et al., 1994). Additionally,MrChap possessed a nonorganellar eukaryotic consensus motif, whichaffects binding of certain cofactors of theMrChap. This motif is respon-sible for the localization of MrChap in the cell cytosol and cytoplasmsuch asHSP 70 (Demand et al., 1998). Based on the results ofmotif anal-yses of MrChap, MrChap may be a member of the eukaryotic cytosolicchaperonin (chaperonin containing TCP-1, CCT) (Demand et al., 1998;Vayssier et al., 1999).

Search for sequence similarities revealed that the deduced aminoacid sequence of MrChap shared high identity and similarity withother known chaperonins (more than 78% similarity in all thematches),especially chaperonin from A. aegypti and C. quinquefasciatus (89%) andchaperonin-1 from A. franciscana (89%) of the invertebrates. MrChapclustered with the other homologous chaperonin amino acid sequencesof invertebrate groups, vertebrates and plant. Phylogenetically,MrChapis most closely related to chaperonin-1 from A. franciscana, becauseboth belong to arthropod family and members of the eukaryotic cyto-solic chaperonin and also they share 89% sequence similarity. Further,MrChap formed sister branch with chaperonin from other arthropodgroups and finally clustered together with chaperonin from anotherarthropod I. scapularis and a hemichordate worm S. kowalevskii. Themultisequence alignment, homology analysis and phylogenetic analysissuggest that MrChap was a member of the group I chaperonin family.Based on the presence of three TCP-1 signature motifs on its N terminalregion and GMM in the C terminal region,MrChapwas concluded to bea cytosolic chaperonin homolog. The predicted tertiary structure ofMrChap has specific axial symmetry i.e., GroEL structure (2 rings of 7units arranged back-to-back) and GroES structure (1 ring of 7 units).Usually these molecular chaperonin proteins assist protein foldingsupported by ATP, thereby controlling them from degradation(Motojima et al., 2004). The results of MrChap protein 3D structureshows the chaperonin as a back-to-back linked double-ring complexas described by Banach et al. (2009). The seven fold symmetric ringsof GroEL interact with GroES (co-chaperonin). The mechanism of ATPbinding and its collaboration with internal structure reveal the functionof protein folding mechanism.

The tissue distribution has been investigated in a variety of organ-isms, but results were not always similar. For example, the heat shockcognate mRNA transcripts were strongly expressed in hemocytes ofP. monodon (Lo et al., 2004), C. farreri (Gao et al., 2007), Pacific oysterCrassostrea gigas (Gourdon et al., 2000), liver of common carp Cyprinuscarpio (Hermesz et al., 2001), human peripheral blood monocytes(Jacquier-Sarlin et al., 1995), human lymphocytes (Hansen et al.,1991) and human HeLa cells (O'Malley et al., 1985). In this study, thegene expression of MrChap was detectable in all examined tissues,including hepatopancreas, hemocytes, pleopods, walking legs, eyestalks, gills, stomach, intestine, brain and muscle with the highestlevel in hemocytes. The significantly (Pb0.05) highest expression level

248 J. Arockiaraj et al. / Gene 508 (2012) 241–249

Author's personal copy

ofMrChap gene expression in hemocytes might imply the participationof hemocytes in immune responses (Lo et al., 2004). Based on the re-sults of this study and those from other studies (Lo et al., 2004),prawn hemocytes, which are similar to immune cells, provide vital cel-lular protection against stress includingheat, cold,wound andmicrobialinfection. The temporal profile of MrChap on IHHNV post-stimulationgene expressionwas constructive to understand its roles in the immunemechanisms. In this study, MrChap gene expression was up-regulatedand reached a peak at 24 h after IHHNV challenge. The up-regulationof MrChap gene expression in response to different stimulations wasreported in P. monodon (Lo et al., 2004), C. farreri (Gao et al., 2007), C.gigas (Gourdon et al., 2000), which was in agreement with our findings.The fluctuation of mRNA expression revealed in the present study im-plied that the MrChap stepwise participated in the immune responseagainst the invading microbe in a complicated mechanism.

ThisMrChap sequence was validated by the pMAL-c2x-MrChap ex-pression vector and expressed in E. coli as fusion protein. RecombinantMrChap protein was purified to homogeneity using pMAL™ protein fu-sion and purification system. The molecular mass of protein was about60 k Da on 12% SDS-PAGE gel, similar to the earlier reports (Wu et al.,2000). The purified recombinant MrChap protein exhibited apparentATP-hydrolysis activity. The result of the present study is in accordancewith the earlier findings of Han and Christen (2003), Jiang et al. (2005)and Mayer and Bukau (2005). According to the literature (Han andChristen, 2003; Jiang et al., 2005; Mayer and Bukau, 2005) molecularchaperones in the ATP-bound form has a low affinity for substrate; inthis state, the carboxy-terminal “lid” is open and allows the access ofsubstrate peptide to substrate binding domain (SBD). Substrate bindingat SBD induces a conformational change at SBD, which is transmitted tonucleotide binding domain (NBD) and stimulates the ATP-hydrolysisactivity of NBD. In addition to being activated by substrate binding,the ATP-hydrolysis activity of NBD can also be modulated by a groupof cofactors known as J-domain co-chaperones,whichpromote the con-version of ATP-bound chaperonin to ADP-bound chaperonin. In theADP-bound form of chaperonin, the carboxy-terminal “lid” is closedupon SBD, thus trapping the bound substrate inside the binding pocketof SBD. The ADP-bound chaperonin is subsequently reverted to ATP-bound form with the assistance of nucleotide exchange factors whichfacilitate the exchange of nucleoside diphosphates for fresh nucleosidetriphosphates.

The results of chaperone activity assay suggest thatMrChap is like-ly to be a functional chaperone and participate in the protein homeo-stasis of M. rosenbergii (Dang et al., 2010). The results of chaperoneactivity assay revealed thatMrChap was indeed with chaperone activ-ity. Besides, while comparing its chaperone activity withMrChap, at aratio 1:1, the protection was 50% in Litopenaeus vannamei (Huang etal., 2011) and 60% in MrChap. These data suggest that the MrChap isan effective chaperone. The results of the chaperone activity appearto play central roles in defense ability against pathogen infectionand response to stress in addition to normal cells.

Acknowledgments

The authors would like to thank the funding agencies ABI(53-02-03-1030) and FP 055/2010B for supporting this research.

References

Arockiaraj, J., Puganeshwaran, V., Sarasvathi, E., Arun, S., Rofina, Y.O., Subha, B., 2011.Bioinformatic characterization and gene expression pattern of apoptosis inhibitorfrom Macrobrachium rosenbergii challenged with infectious hypodermal and he-matopoietic necrosis virus. Fish Shellfish Immunol. 31, 1259–1267.

Arockiaraj, J., Sarasvathi, E., Puganeshwaran, V., Arun, S., Rofina, Y.O., Subha, B., 2012a. First re-port on interferon related developmental regulator-1 from Macrobrachium rosenbergii:bioinformatic analysis and gene expression. Fish Shellfish Immunol. 32, 929–933.

Arockiaraj, J., Sarasvathi, E., Puganeshwaran, V., Arun, S., Rofina, Y.O., Subha, B., 2012b. Mo-lecular cloning, characterization and gene expression of an antioxidant enzyme cata-lase (MrCat) from Macrobrachium rosenbergii. Fish Shellfish Immunol. 32, 670–682.

Arockiaraj, J., Sarasvathi, E., Puganeshwaran, V., Arun, S., Rofina, Y.O., Subha, B., 2012c.Prophenoloxidase activating enzyme-III from giant freshwater prawnMacrobrachiumrosenbergii: characterization, expression and specific enzyme activity. Mol. Biol. Rep.39, 1377–1386.

Banach, M., Stąpor, K., Roterman, I., 2009. Chaperonin structure—the large multi-subunit protein complex. Int. J. Mol. Sci. 10, 844–861.

Bradford, M.M., 1976. A rapid and sensitive method for the quantification of microgramquantities of protein utilizing the principle of proteinedye binding. Anal. Biochem.72, 248–254.

Burnett, B.P., Horwich, A.L., Low, K.B., 1994. A carboxy-terminal deletion impairs theassembly of GroEL and confers a pleiotropic phenotype in Escherichia coli K-12.J. Bacteriol. 176, 6980–6985.

Dang, W., Hu, Y., Zhang, M., Sun, L., 2010. Identification and molecular analysis of a stress-inducible Hsp70 from Sciaenops ocellatus. Fish Shellfish Immunol. 29, 600–607.

Demand, J., Luders, J., Hohfeld, J., 1998. The carboxy-terminal domain of Hsc70 providesbinding sites for a distinct set of chaperone cofactors. Mol. Cell. Biol. 18, 2023–2028.

Friedman, D.I., Olson, E.R., Tilly, K., Georgopoulos, C., Herskowitz, I., Banuett, F., 1984.Interactions of bacteriophage λ and host macromolecules in the growth of bacteri-ophage λ. Microbiol. Rev. 48, 299–325.

Gao, Q., Song, L., Ni, D., Wu, L., Zhang, H., Chang, Y., 2007. cDNA cloning and mRNAexpression of heat shock protein 90 gene in the haemocytes of Zhikong scallopChlamys farreri. Comp. Biochem. Physiol. B 147, 704–715.

Gao, Q., et al., 2008. Molecular cloning, characterization and expression of heat shockprotein 90 gene in the haemocytes of bay scallop Argopecten irradians. Fish ShellfishImmunol. 24, 379–385.

Gourdon, I., Gricourt, L., Kellner, K., Roch, P., Escoubas, J.M., 2000. Characterization of acDNA encoding a 72 kDa heat shock cognate protein (Hsc72) from the Pacificoyster, Crassostrea gigas. DNA Seq. 11, 265–270.

Gupta, P., Aggarwal, N., Batra, P., Mishra, S., Chaudhuri, T.K., 2006. Co-expression ofchaperonin GroEL/GroES enhances in vivo folding of yeast mitochondrial aconitaseand alters the growth characteristics of Escherichia coli. Int. J. Biochem. Cell Biol. 38,1975–1985.

Han, W., Christen, P., 2003. Interdomain communication in the molecular chaperoneDnaK. Biochem. J. 369, 627–634.

Hansen, L.K., Houchins, J.P., O'Leary, J.J., 1991. Differential regulation of HSC70, HSP70,HSP90 alpha, and HSP90 beta mRNA expression by mitogen activation and heatshock in human lymphocytes. Exp. Cell Res. 192, 587–596.

Hartl, F.U., 1996. Molecular chaperones in cellular protein folding. Nature 381, 571–580.Hermesz, E., Abraham, M., Nemcsok, J., 2001. Identification of two hsp90 genes in carp.

Comp. Biochem. Physiol. C 129, 397–407.Huang, P.Y., et al., 2008. Identification of the small heat shock protein, HSP21, of shrimp

Penaeus monodon and the gene expression of HSP21 is inactivated after white spotsyndrome virus (WSSV) infection. Fish Shellfish Immunol. 25, 250–257.

Huang, W.J., Leu, J.H., Tsau, M.T., Chen, J.C., Chen, L.L., 2011. Differential expression ofLvHSP60 in shrimp in response to environmental stress. Fish Shellfish Immunol.30, 576–582.

Jacquier-Sarlin, M.R., Jornot, L., Polla, B.S., 1995. Differential expression and regulationof hsp70 and hsp90 by phorbol esters and heat shock. J. Biol. Chem. 270,14094–14099.

Jiang, J., Prasad, K., Lafer, E.M., Sousa, R., 2005. Structural basis of interdomain commu-nication in the HSP70 chaperonee. Mol. Cell 20, 513–524.

Kubota, H., Hynes, G., Willison, K., 1995. The chaperonin containing t-complex poly-peptide 1 (TCP-1): multisubunit machinery assisting in protein folding and assem-bly in the eukaryotic cytosol. Eur. J. Biochem. 230, 3–16.

Livak, K.J., Schmittgenm, T.D., 2001. Analysis of relative gene expression data using real-timequantitative PCR and the 2(−Delta Delta C(T)) method. Methods 25, 402–408.

Lo, W.Y., Liu, K.F., Liao, C., Song, Y.L., 2004. Cloning and molecular characterization of heatshock cognate 70 from tiger shrimp (Penaeus monodon). Cell Stress Chaperones 9,332–343.

Matambo, T.S., Odunuga, O.O., Boshoff, A., Blatch, G.L., 2004. Over-production, purificationand characterization of the Plasmodium falciparum heat shock protein 70. ProteinExpr. Purif. 33, 214–222.

Matsuda, N., Mishina, M., 2004. Identification of chaperonin CCTg subunit as a determi-nant of retinotectal development by whole-genome subtraction cloning fromzebrafish no tectal neuron mutant. Development 131, 1913–1925.

Mayer, M.P., Bukau, B., 2005. HSP70 chaperonees: cellular functions and molecularmechanisms. Cell. Mol. Life Sci. 62, 670–684.

Motojima, F., Chaudhry, C., Fenton, W.A., Farr, G.W., Horwich, A.L., 2004. Substratepolypeptide presents a load on the apical domains of the chaperonin GroEL.PNAS USA 101, 15005–15012.

O'Malley, K., Mauron, A., Barchas, J.D., Kedes, L., 1985. Constitutively expressed rat mRNAencoding a 70-kilodalton heat shock-like protein. Mol. Cell. Biol. 5, 3476–3483.

Qin, W., Tyshenko, M.G., Wu, B.S., Walker, V.K., Robertson, R.M., 2003. Cloning andcharacterization of a member of the hsp70 gene family from Locusta migratoria, ahighly thermotolerant insect. Cell Stress Chaperones 8, 144–152.

Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual, 2ndedition. Cold SpringHarbor Laboratory, Cold SpringHarbor Laboratory Press, NewYork.

Vayssier, M., Le-Guerhier, F., Fabien, J.F., Philippe, H., Vallet, C., Ortega-Pierres, G., Soule,C., Perret, C., Liu, M., Vega-Lopez, M., Boireau, P., 1999. Cloning and analysis of aTrichinella britovi gene encoding a cytoplasmic heat shock protein of 72 kDa. Par-asitology 119, 81–93.

Wu, Y., Egerton, G., Ball, A., Tanguay, R.M., Bianco, A.E., 2000. Characterization of the heat-shock protein 60 chaperonin from Onchocerca volvulus. Mol. Biochem. Parasitol. 107,155–168.

Young, D., Roman, E., Moreno, C., O'Brien, R., Born, W., 1993. Molecular chaperones andthe immune response. Philos. Trans. R. Soc. Lond. 339, 363–368.

249J. Arockiaraj et al. / Gene 508 (2012) 241–249