microbial life associated with low-temperature alteration of ultramafic rocks in the leka ophiolite...

Microbial life associated with low-temperature alteration ofultramafic rocks in the Leka ophiolite complexF. L . DAAE,1 I . ØKLAND,2 H. DAHLE,1 S . L . JØRGENSEN,1 I . H. THORSETH2 AND

R. B. PEDERSEN2

1Department of Biology, Centre for Geobiology, Bergen, Norway2Department of Earth Science, Centre for Geobiology, Bergen, Norway

ABSTRACT

Water–rock interactions in ultramafic lithosphere generate reduced chemical species such as hydrogen that

can fuel subsurface microbial communities. Sampling of this environment is expensive and technically

demanding. However, highly accessible, uplifted oceanic lithospheres emplaced onto continental margins

(ophiolites) are potential model systems for studies of the subsurface biosphere in ultramafic rocks. Here,

we describe a microbiological investigation of partially serpentinized dunite from the Leka ophiolite (Nor-

way). We analysed samples of mineral coatings on subsurface fracture surfaces from different depths

(10–160 cm) and groundwater from a 50-m-deep borehole that penetrates several major fracture zones in

the rock. The samples are suggested to represent subsurface habitats ranging from highly anaerobic to aer-

obic conditions. Water from a surface pond was analysed for comparison. To explore the microbial diversity

and to make assessments about potential metabolisms, the samples were analysed by microscopy, con-

struction of small subunit ribosomal RNA gene clone libraries, culturing and quantitative-PCR. Different

microbial communities were observed in the groundwater, the fracture-coating material and the surface

water, indicating that distinct microbial ecosystems exist in the rock. Close relatives of hydrogen-oxidizing

Hydrogenophaga dominated (30% of the bacterial clones) in the oxic groundwater, indicating that micro-

bial communities in ultramafic rocks at Leka could partially be driven by H2 produced by low-temperature

water–rock reactions. Heterotrophic organisms, including close relatives of hydrocarbon degraders possibly

feeding on products from Fischer–Tropsch-type reactions, dominated in the fracture-coating material. Puta-

tive hydrogen-, ammonia-, manganese- and iron-oxidizers were also detected in fracture coatings and the

groundwater. The microbial communities reflect the existence of different subsurface redox conditions

generated by differences in fracture size and distribution, and mixing of fluids. The particularly dense micro-

bial communities in the shallow fracture coatings seem to be fuelled by both photosynthesis and oxidation

of reduced chemical species produced by water–rock reactions.

Received 14 December 2012; accepted 15 March 2013

Corresponding author: F. L. Daae. Tel.: +47 55582663; fax: +47 5558 3707; e-mail: [email protected]

INTRODUCTION

Hydrothermal alteration (serpentinization) of ultramafic

rocks (olivine-rich rocks such as peridotite and dunite) is

known to produce hydrogen (H2) and short-chain hydro-

carbons (Holm & Charlou, 2001; Palandri & Reed, 2004;

Sleep et al., 2004; McCollom & Bach, 2009). Hydrogen

and hydrocarbons are important energy sources for micro-

bial life, and the formation of such compounds through

water–rock interactions may have the potential to sustain a

deep subsurface biosphere in the Earth’s lithosphere, and

possibly also life on other planets (e.g. Sleep et al., 2004;

Schulte et al., 2006; Blank et al., 2009).

During formation of serpentinite (a mixture of serpen-

tine minerals, magnetite and brucite) in the water–rock

reaction, the oxidation of divalent iron that is dissolved

during breakdown of the primary minerals olivine and

pyroxene results in the reduction and splitting of water to

H2. The serpentinization reactions also typically result in

the development of fluids with high pH (e.g. Barnes

et al., 1967; Moody, 1976; Janecky & Seyfried, 1986;

Bach et al., 2006).

318 © 2013 John Wiley & Sons Ltd

Geobiology (2013), 11, 318–339 DOI: 10.1111/gbi.12035

In the deep-sea, seepage and venting of high-pH fluids

that are rich in H2 and methane (CH4) have been reported

from serpentinite seamounts in the for-arc region of Western

Pacific arcs (Haggerty, 1991) and from the Lost City vent

field at the flank of the Mid-Atlantic Ridge (Kelley et al.,

2001, 2005). At the Lost City vent field, high-pH (9–11)

vent fluids emanate from carbonate chimneys that are built

on a basement of peridotite representing mantle that has

been exhumed to the surface by kilometres of fault displace-

ment. The presence of hydrocarbons in the Lost City fluids,

in fluids seeping from serpentine seamounts, as well as in

high-temperature, black-smoker fluids at peridotite-hosted

vent fields, has been attributed to hydrocarbon-synthesizing

water–rock reactions known as Fischer–Tropsch-type (FTT)

reactions (e.g. Charlou et al., 1998, 2002; Holm &

Charlou, 2001; Proskurowski et al., 2008). These catalytic

reactions are commonly used industrially to produce alkanes

from H2 and CO in the presence of transition metals. In

ultramafic rocks, FeNi alloys and Cr-bearing minerals are

potential catalysts for FTT reactions (Horita & Berndt,

1999; Foustoukos & Seyfried, 2004).

The H2 and CH4 concentrations of the Lost City vent

fluids reach 14 and 2 mmol kg�1, respectively (Proskurow-

ski et al., 2006), and the vent fluids support methane and

sulphur-metabolizing microbial communities within in the

carbonate chimneys (Brazelton et al., 2006). Observations

supporting the presence of an extensive subsurface, litho-

autotrophic biosphere in the oceanic volcanic crust have

accumulated over the last two decades (Stevens & Mckin-

ley, 1995; Nealson et al., 2005; Heberling et al., 2010).

IODP-drilling has documented the presence of subsurface

lithoautotrophic microbial communities in the shallow

volcanic layers of the oceanic crust (Lysnes et al., 2004),

and recent drilling at the Atlantis massif to the north of

Lost City has shown that a microbial community domi-

nated by close relatives of hydrocarbon oxidizers is present

1.4 km subsurface in lower crustal lithologies (Mason et al.,

2010). Such microbial communities may be powered by H2

formed by water–peridotite reactions (Brazelton et al.,

2012). Additional evidence for microbial life in the deeper

parts of the oceanic lithosphere is the detection of organic

accumulations with characteristics similar to biopolymers

within fully serpentinized peridotites recovered further

south of the Mid-Atlantic ridge (Menez et al., 2012).

On-land, springs of high-pH waters that are rich in H2

have been reported from several ophiolite complexes (Neal

& Stanger, 1983; Abrajano et al., 1990; Brazelton et al.,

2012; Szponar et al., 2012). Ophiolite complexes are frag-

ments of oceanic crust and upper mantle that have been

emplaced onto continental margins during the closure of

ocean basins and the construction of mountain belts. Man-

tle peridotite, similar to those exposed at Lost City, are

important components of ophiolite complexes, and the

subsurface geomicrobiology of such complexes is a source

of information about peridotite-hosted microbial commu-

nities. In this study, we investigated the peridotite-hosted

microbial communities that were recovered from the sub-

surface environment by drill-sampling an ophiolite complex

located on the Norwegian coast. We analysed samples of

mineral coatings from 10- to 160-cm-deep subsurface frac-

tures and groundwater from a 50-m-deep borehole located

at the same site. Results from a parallel geochemical study

suggest that these samples represent subsurface habitats

ranging from highly anaerobic to aerobic conditions

(Okland et al., 2012). In the present study, we document

how these variable environmental conditions are reflected

in the microbial communities and that the reduced water–

rock-dominated habitats support different microbial metab-

olisms than habitats that are more strongly influenced by

atmospheric conditions.

MATERIALS AND METHODS

Geology of the Leka ophiolite complex and the sampling

site

The drill site is located at the island of Leka at the mid-

Norwegian coast (Fig. 1A). The ancient ocean crust and

mantle now exposed at Leka formed by seafloor spreading

in the ancient Iapetus Ocean around 490 million years ago.

The Leka ophiolite complex is one of several fragments of

oceanic lithosphere that became accreted to continental

margins during formation of the Caledonian-Appalachian

mountain belt that stretches from northern Norway to east-

ern North America (Furnes et al., 1988). The peridotites at

Leka include mantle peridotites, present as serpentinized

harzburgites, as well as a layered sequence of dunite and

wehrlite that represent the ancient mantle–crust transition.

The drill sampling took place in 2005 within a hundred-

metre-thick layer of dunite (>90% olivine) at the foot of a

50-m-high cliff face, where extremely slow groundwater

seepage along a network of fractures has resulted in white

mineral precipitate of mostly hydromagnesite at the surface

(Fig. 1B,C). The drilling was done with a motorized,

mobile drill rig carrying a diamond coring system that

yielded a 3.5 cm core diameter. The drill sampling

occurred in two ways: (i) To minimize contamination, a

shallow hole was first drilled with only compressed air as a

coolant. This cooling method was insufficient to prevent

overheating of the drill bit, and the penetration depth was

therefore limited to 2 m. (ii) A 50-m-deep hole was drilled

into the cliff wall using water from the local drinking-water

supply to cool the drill bit. This borehole penetrated a

major aquifer in the inner part and has produced ground-

water since the drilling. The borehole was plugged with a

packer to allow for easy sampling of the groundwater.

Our studies of the site and the deep drill core suggest

that the hydrogeological system at this cliff consists in

© 2013 John Wiley & Sons Ltd

Microbial life in ultramafic rocks 319

principle of four parts (Fig. 2A; Okland et al., 2012): (i)

an infiltration zone in the high-grounds above the cliff

where the drill sampling occurred, (ii) three steep-dipping

fracture zones that represent aquifers and where the inner-

most zone has the highest flow rate, (iii) a network of frac-

tures – and since 2005 a borehole – that connects these

aquifers to the cliff surface, and (iv) the cliff surface where

water under artesian pressure is slowly seeping from the

fracture network. The rock varies from almost completely

serpentinized dunite in the three heavily fractured zones to

nearly unaltered dunite with abundant olivine and only

small amounts of serpentine in other parts. The groundwa-

ter is characterized by high pH (up to 9.6), low concentra-

tion of dissolved substances with sodium, magnesium,

silicon, chloride and inorganic carbon being most abun-

dant. Similar Na/Cl ratios of rain and groundwater suggest

that seawater is the main source for these elements. Minor

amounts of dissolved iron (5.8 lM), manganese (0.18 lM),ammonium (0.5 lM), nitrate (19 lM), phosphate (0.5 lM)and organic carbon (1.1 lM) are also detected in the

groundwater. For comparison, surface water from the infil-

tration area above the borehole is lower in pH (7.9), iron

B

C

studysite

A

Fig. 1 (A) Simplified geological map of Leka showing the sampling site. (B) Photograph of the dunite cliff face at the sampling site. (C) Close-up photograph

of the cliff surface showing typical white mineral precipitate along fractures with slow groundwater seepages that is partially covered by red-coloured lichens.

10203040 050 m

W50 m

A

B

W0 m

2 013 m

F160 cm

F155 cm

F15 cm

Fig. 2 (A) Schematic cross section of the

dunite cliff showing the location of the

50-m-long borehole transecting three highly

fractured zones. The depth of the

groundwater sample from the borehole

(W50 m), the location of the surface water

sample (W0 m) and the 2-m-deep drill core

within the outermost fracture zone (square)

are indicated. (B) Schematic cross section of

the outermost fracture zone and the

2-m-deep core where the sampled fracture

coatings from depths of 155 and 160 cm, and

10–20 cm (F15 cm) are indicated.


320 F. L. DAAE et al.

(0.99 lM), manganese (0.05 lM) and nitrate (1.8 lM),similar in ammonium and higher in organic carbon

(14 lM). Detection of similar levels of O2 in groundwater

and surface water indicates a relative short residence time

for the majority of the groundwater in the borehole. How-

ever, detection of H2 (up to 585 nM) and traces of meth-

ane (not quantified) in this oxic groundwater suggests that

these compounds are generated in narrow, anoxic fractures

with low water/rock ratios, before they migrate into the

oxic borehole. For a more detailed description of this sys-

tem, see Okland et al. (2012).

Sampling

Samples of fracture-coating material, groundwater and sur-

face water for microbiological analyses were collected from

different locations at the drill site as shown in Fig. 2. White

powdery to solid mineral coatings (mostly hydromagnesite)

from several shallow fractures (10–20 cm depth) were sam-

pled from the seepage area of the cliff surface. Access to

these shallow fractures was obtained by removing weakly

attached rock fragments, which were transported in sterile

plastic bags to the laboratory for further sampling. The rela-

tively thick (up to 1 cm) fracture-coating material was then

removed from 12 fragments with sterile scalpel. Initial

molecular fingerprinting analyses by denaturing gradient gel

electrophoresis (DGGE) indicated that these fractures were

inhabited by highly similar communities (Daae, 2006).

They were therefore mixed and further analysed as one sam-

ple (F15 cm). To investigate the microbial communities

present in the deeper subsurface, two samples of much thin-

ner fracture-coating material from the 2-m-deep core that

was drilled in 2005 were collected (samples F155 cm and

F160 cm, numbers refers to depth behind cliff surface). To

prevent contamination of the core after drilling, it was

wrapped in sterile aluminium foil at the drill site and trans-

ported to a temporary field laboratory for further sampling

the same day using sterile scalpels. The F155 cm sample

appeared as white to light grey powdery coating (approxi-

mately 50 lL) and the F160 cm sample as patchy dark

brown to black coating (approximately 50 lL). All samples

were frozen on site at �20 °C.Groundwater from the 50-m-long borehole was not

sampled for microbiological studies before 2008 (W50 m)

to avoid contamination from cooling water used during

drilling. After drilling, the borehole was left open for sev-

eral months to flush out drilling fluid and particles before

it was plugged by a packer and a water tap. The tap was

opened several times the following 2 years to let out

groundwater of a similar volume as the total borehole

(81 L). Before the sampling in 2008, the borehole was

again tapped two times for this volume of water. In 2008,

also a surface pond that is present in the infiltration area

above the borehole was sampled (sample W0 m).

For DNA extraction, 500 mL of each water sample was

pre-filtered through 5-lm polycarbonate membrane filter

(ø = 4.7 cm) and subsequently through a 0.2-lm polycar-

bonate membrane filter. All filters were frozen at �20 °Cuntil analysing. Water samples for fluorescence microscopy

were fixed in 2% formaldehyde overnight and collected on

0.2-lm polycarbonate filters as described by Glockner

et al. (1996).

Carbon analyses and electron microscopy of mineral

coatings

Mineral coatings from several shallow fractures (10–20 cm)

and one deeper fracture (80 cm) were analysed for total

organic and inorganic carbon (TOC and TIC) using an

Analytikjena multi EA 4000 analyzer (Matriks AS, Oslo,

Norway). To investigate the morphology of micro-organ-

isms and their relationship to minerals, air-dried fracture-

coating material and surface precipitates were carbon-

coated and studied using a Zeiss Supra 55VP field emission

scanning electron microscope (FE-SEM; Carl Zeiss, Stock-

holm, Sweden) equipped with a Thermo Noran System

SIX energy dispersive spectrometer (EDS) system (Carl

Zeiss AS, Oslo, Norway).

Total number of cells and fluorescent in situhybridization

Total number of cells (TNC) was performed for the water

samples (W0 m and W50 m) with the fluorescent DNA-

binding dye 4′,6-diamidino-2-phenylindole (DAPI; Morik-

awa & Yanagida, 1981). Fluorescent in situ hybridization

(FISH) was performed for the same samples on filters with

fluorescently labelled oligonucleotides (Glockner et al.,

1996). Alexa-488-labelled EUB338 I–III (Daims et al.,

1999) were used to target Bacteria, and NON338 as nega-

tive control (Wallner et al., 1993). For Archaea, the Cy-3

double-labelled (Stoecker et al., 2010) ARC917 (Loy

et al., 2002) was used. Hybridizations were performed at

35% formamide for both probes. Stained slides were

immersed in Immersol 518F (Zeiss) and evaluated in Zeiss

Axio Imager Z1 microscope (Carl Zeiss AS, Oslo,

Norway), equipped with illumination system HXP-120 and

filters for DAPI, Cy3 and GFP. A minimum of 10 fields of

0.015 mm2 were counted from two parallels per sample.

TNC and FISH counts could not be obtained from the

fracture-coating material because of strong background flu-

orescence from the minerals.

DNA extraction, PCR amplification of 16S and 18S rRNA

genes and cloning

DNA was extracted from the samples using the FastDNA�

SPIN Kit for Soil according to manufacturer’s instructions



(Q-BIOgene, Alere AS, Oslo, Norway). One-half of the fil-

ters from the water samples were cut into smaller pieces in a

sterile petri dish and then transferred to the ‘Lysing Matrix

E tube’ in the extraction kit. From F15 cm sample, 0.25 g

of the material was used, and from the deeper fractures, all

the collected materials, approximately 50 lL, were used for

DNA extractions. Extracted DNA concentrations were esti-

mated by visual inspection in 1% agarose gel and by spectro-

photometry (Cary -400 UV). The extracted DNA was used

as template in PCR to amplify the small subunit of the ribo-

somal RNA (SSU rRNA) genes from Eukarya, Bacteria

and Archaea: for Eukarya, with the primers Euk82F

(GAADCTGYGAAYGGCTC) (Dawson & Pace, 2002) and

Un1392r (ACGGGCGGTGTGTRC) (Lane et al., 1985),

for Bacteria with B8f (AGAGTTTGATCCTGGCTCAG)

(Edwards et al., 1989) and Un1392r, and for Archaea with

the primers A20f (TTCCGGTTGATCCYGCCRG) (Mas-

sana et al., 1997) and A958r (YCCGGCGTTGAMTCCA-

ATT) (DeLong, 1992). The PCR mixture (20 lL)consisted of 0.02 U of DreamTaq polymerase (Fermentas,

Fisher Scientific, Oslo, Norway) in 1X DreamTaq buffer,

0.2 mM dNTPs (Fermentas), 0.5 lM primers (Sigma,

Sigma-Aldrich, Norway AS, Oslo, Norway) and 0.05% BSA

(Fermentas), and template concentrations of 0.1–

1 ng lL�1. Amplifications were run in a Veriti 96-well ther-

mal cycler (Applied Biosystems, Life Technologies, Oslo,

Norway) at following settings: initial step of 5 min at

94 °C, 30 cycles for eukaryal and bacterial primers, 35

cycles for archaeal primers with 94 °C 30 s, annealing for

30 s and extension at 72 °C for 1 min and 30 s. After the

cycles followed 7-min extension at 72 °C, and then a final

stage of 4 °C. Annealing temperature with eukaryal primers

was 58 °C for bacterial and archaeal primers 55 °C. In all

PCRs, positive and negative controls were used. For bacte-

rial PCR, DNA from the archaeal strain Archaeoglobus fulgi-

dus was used as negative controls and DNA from

Escherichia coli was used as positive control. In the archaeal

PCR, DNA from these strains was used as positive and neg-

ative controls, respectively. For eukaryal PCR, DNA from a

fungi isolate was used as positive control, and DNA from

A. fulgidus and E. coli served as negative controls. Clone

libraries were constructed from the water samples (W0 m

and W50 m) and the fracture coatings (F15 cm, F155 cm

and F160 cm) using TOPO-TA cloning (StrataClone PCR

Cloning Kit Catalogue # 240205, Bionordika AS, Lysaker,

Norway). An additional clone library was made for Eukarya

from the shallow fractures. Inserts in the clones were ampli-

fied with M13f- and M13r-primers, and amplicons with cor-

rect length were purified by dilution 1/20 in water before

sequencing with the forward domain-specific primer. The

samples were sequenced using Big Dye vs3.1 (Applied Bio-

systems, Life Technologies, Oslo, Norway) with 3.2 pmol

primer per reaction and run for 35 cycles according to man-

ufacturer’s instructions. Sequencing was performed with

Applied Biosystems 3730/3730xl DNA Analyzer at the

Sequence laboratory at University of Bergen.

Real-time quantitative PCR (qPCR)

Real-time PCR was performed to enumerate the cells in

the fracture-coating material (F15 cm), because these sam-

ples gave too strong background fluorescence signals for

TNC and FISH. The water samples (W0 m and W50 m)

served as a control to compare with the FISH counts. We

have no real-time qPCR data from the deeper fracture-

coating materials (F155 cm and F160 cm) as all extracted

DNA was used for clone library construction.

Archaeal 16S rRNA genes were quantified using modified

version of the 515F (5′CAGCMGCCGCGGTAA3′) (De-

Long, 1992) and 907R (5′CCCGCCAATTCCTT

TAAGTT3′) (Jurgens et al., 1997). Quantification stan-

dards, PCR conditions and set-up were as described else-

where (Jorgensen et al., 2012). In short, each reaction

(25 lL) contained 19 QuantiTech SybrTM Green� PCR

master mixture (Qiagen, Qiagen Norge, Olslo, Norway),

0.8 lM of each primer and 1 lL template DNA. Thermal

cycling program was as follows: 15 min at 95 °C, then 40

cycles of 95 °C/30 s, 60 °C/30 s, 72 °C/45 s. Quantifica-

tion standard consisted of a dilution series of a known

amount of linearized fosmid 54d9 (Treusch et al., 2005),

Genomic DNA from E. coli was used as negative control.

R2 value for the standard curve was 0.99 and slope value

�3.26, giving an estimated amplification efficiency of 102%.

Bacterial 16S rRNA genes were quantified using primers

338F (Amann et al., 1995) and 519R (Muyzer et al.,

1993) and following the protocol described by Einen et al.

(2008). Quantification standard consisted of a dilution ser-

ies (between 1.38 9 10 and 1.38 9 107 16S rDNA copies

per lL) of a known amount of purified PCR product

obtained using the 16S rDNA-specific primers 8F

(Edwards et al., 1989) and 1392R (Lane et al., 1985).

Genomic DNA from Sulfolobus sulfataricus was used as

negative control. The R2 value for the standard curve was

0.999 and slope value �3.403, giving an estimated amplifi-

cation efficiency of 97%. All qPCR experiments were con-

ducted in a Step-OnePlus Real-Time qPCR system

(Applied Biosystems) with Power SYBR�Green PCR Mas-

ter Mix (#P/N4367659). To confirm product specificity,

melting curve analyses were performed after each run for

all experiments and each qPCR set-up contained samples,

standard series, negative control and blank all in duplicates.

Analyses of 16S and 18S rRNA gene sequences

The sequences obtained from cloning were edited in Vec-

tor NTI vs 11 (Invitrogen) and analysed for chimeras with

Bellerophon (Huber & Hugenholtz, 2004). Putative chi-

meras were discarded after a manual check. Grouping of



sequences into operational taxonomic units (OTUs), using

a threshold value of 2% sequence identity (Stackebrandt &

Ebers, 2006), and rarefaction analyses were performed in

Mothur (Schloss et al., 2009). Sequences were aligned

using the Silva Web aligner (Pruesse et al., 2007), and the

ARB software version 5.0 (Ludwig et al., 2004) was used in

constructing phylogenetic trees by the maximum likelihood

method (PhyML; Guindon & Gascuel, 2003) using

sequence-associated information (SAI) filters for Archaea

(799 valid columns), Bacteria (833 valid columns) and

Eukarya (1345 valid columns). Short sequences were

added to trees by the quick add option in ARB. Selected

representative sequences of each OTU were compared with

the NCBI database using BLASTN (Altschul et al., 1997).

Bray–Curtis dissimilarities between clone libraries were

based on OTU abundances and were calculated using the

‘VEGAN’ R package (Oksanen et al., 2011).

Nucleotide sequence accession numbers

The sequences are deposited in GenBank with accession

numbers JN002436–JN003204.

Enrichments of fungi

Enrichments for fungi were set up based on the observa-

tion of filamentous morphologies using SEM (Fig. 3C).

Material (approximately 10–20 lL) from shallow fractures

(F15 cm) was suspended in sterile water, and 100 lL of

the suspension was spread on Malt Extract Agar (Oxoid

CM0059, Fisher Scientific, Oslo, Norway) plates and incu-

bated at 20 °C for 6 days. Enrichments were transferred to

new plates for isolation until mono-cultures were obtained.

Enrichments of aerobic methanotrophs

From the 2-m-deep drill core, material (approximately

10–20 lL) from several fractures including the deep frac-

tures (F155 cm and F160 cm) was added on site to 5 mL

NMS-medium (DSMZ 1179 with addition of trace

element solution in medium DSMZ 632) in 15-mL glass

tubes (Rundbunnglass, ApodanNordic A/S, Copenhagen,

Denmark), capsulated with rubber stoppers and incubated

on a rotor at 10 °C with 20% (v/v) methane in air for

3 weeks. Methylococcus capsulatus was cultured as a positive

control.

RESULTS

Cell counts, biomass and electron microscopy

Cell numbers were measured using DAPI, FISH and real-

time qPCR (Table 1). The groundwater (W50 m) had

consistently lower cell counts than the surface water

(W0 m) with 6.24 9 105 and 1.78 9 106 cells mL�1,

respectively. For the mineral coatings in the shallow frac-

tures (F15 cm), as much as 3.3 9 109 cells g�1 were

revealed by real-time qPCR. DAPI and FISH counts could

not be obtained for this material because of strong back-

ground fluorescence from the minerals. However, abun-

dant colonies of rod-shaped cells attached to the

hydromagnesite crystals, as well as coccoid cells and

hyphae-like filaments, were observed using SEM (Fig. 3).

Bacteria dominated over Archaea both in the water

samples and in the shallow fracture coatings (Table 1).

According to the FISH counts, the abundance of Archaea

was higher in the groundwater (14.6%) than in the surface

water (5.4%). Lower Archaea numbers from real-time

qPCR than from FISH counts may indicate primer biases.

We have no real-time qPCR data for mineral coatings from

the deep fractures (F155 cm and F160 cm) as all extracted

DNA was used for clone library construction. However, no

cells were observed in these samples by inspection with

SEM, and the amount of DNA was below the detection

limit from spectroscopy, suggesting low cell numbers. The

average organic carbon content of the fracture-coating

material was 0.7 weight% in the shallow fractures and 0.1

weight% in the deep fractures.

Taxonomy, phylogeny and diversity

Clone libraries of the 16S rRNA genes were constructed

from all the samples using archaeal- and bacterial-specific

primers. Phylogenetic analyses showed that most phylo-

2 μM 2 μM

A

1 μM

B C

Fig. 3 Scanning electron microscope (SEM) images of mineral coatings from shallow fractures showing (A) rod-shaped microbial cells on hydromagnesite

crystals, (B) coccoid cells and (C) microbial filaments resembling mycelia.



types were relatively distantly related to cultured micro-

organisms (Figs 4 and 5). Furthermore, several unique

phylotypes were observed in each sample, except for the

Archaea from the shallow fractures, indicating the presence

of distinct microbial communities (Table 2). Rarefaction

curves (Fig. 6A) indicate that the bacterial diversity was

much lower in the surface water than in any of the subsur-

face samples, where the highest bacterial diversity was

observed for the mineral coatings from the deepest frac-

tures. Among the Archaea, the diversity in the fracture-

coating material was lower than in the groundwater and

the surface water (Fig. 6B). The archaeal diversity was also

generally lower than the bacterial diversity (Fig. 6B). The

Bray–Curtis dissimilarity between the archaeal libraries

from the two deep fracture samples was 0.45. Dissimilari-

ties between any other pairs of libraries were above 0.89.

The bacterial libraries from the surface water and the

groundwater were dominated by Betaproteobacteria,

whereas the mineral coatings from the shallow and deep

fractures were dominated by Actinobacteria (Fig. 7A). Sev-

eral taxa, including Planctomycetes and Candidate division

OP-11, were observed in the groundwater, but not in the

surface water. On the other hand, Bacteroidetes, the second

most abundant phyla in the surface water, was not detected

in the groundwater. The mineral coatings from the two

deepest fractures had highly similar taxonomic composi-

tions on the phylum level and could be distinguished from

the shallow fractures by a high abundance of Firmicutes,

the absence of the Deinococcus-Thermus clade and much

lower abundance of Bacteroidetes. In the archaeal libraries,

we found a dominance of the Soil Crenarchaeotic group

(group 1.1b) belonging to Thaumarchaeota in all fracture

coatings (Fig. 7B), while the surface water and the

groundwater were both dominated by Marine Group II

within the Euryarchaeota. Enrichments for aerobic methan-

otrophs were all negative after 3 weeks of incubation.

PCR amplification of eukaryal 18S rRNA sequences was

negative for the groundwater and the deep fracture-coating

material and positive for the surface water (not further

analysed) and the mineral coatings from shallow fractures.

A clone library of 43 clones was constructed from the shal-

low fracture sample, and the clones were assigned to Chlo-

rophyta (71%) and Ascomycota (29%). Among the fungal

clones (Fig. 8), 85% were assigned to the lichenized fungi

Lecania cytella (Reese Næsborg et al., 2007) with 98.5%

similarity, and 87.5% of the algal clones had 99.8% similar-

ity to the lichenized algae Trebouxia usnae (Ahmadjian,

1988). From the enrichments of fungi, eight different

species within Ascomycota were isolated (Fig. 8). Only one

of the isolated species, affiliating with Eupenicillium javan-

icum, was represented in the clone library.

Similarity to cultured organisms

Some of the detected organisms were close relatives of

cultured organisms with known phenotypic traits, where

most are described as strictly or facultative aerobes

(Table 3, Fig. 5). An exception is two clones from one of

the deep fracture coatings with 96% sequence identity to

the obligate anaerobic and fermentative Clostridium thio-

sulfatireducens in the Firmicutes phylum (Fig. 5C).

A large fraction of bacterial sequences obtained from the

groundwater (30%) were close relatives (98.4–99.0%

sequence identity) to Hydrogenophaga pseudoflava in the

Betaproteobacteria class (Fig. 5A), whereas 52% of the

clones from the surface water were related to the betapro-

teobacterium Curvibacter delicatus (>97% sequence iden-

tity), which has been reported to dominate in activated

sludge (Thomsen et al., 2004; Nielsen et al., 2009).

Hydrogenophaga pseudoflava grows aerobically with hydro-

gen or organic compounds as electron donor and is also

reported to be able to grow anaerobically with nitrate as

electron acceptor (Willems et al., 1989). Other close

relatives of known hydrogen oxidizers were detected in

the deep fracture coatings, including Acidivorax facilis

and Aquaspirillum arcticum in the Betaproteobacteria

(Fig. 5A), the alphaproteobacterium Bradyrhizobium

japonicum (Fig. 5A) and the actinobacterium Mycobacte-

rium insubricum (Fig. 5D; Schwartz et al., 2006). Taken

together, at least 6% of the sequences in the bacterial

clone libraries from the deep fractures were close relatives

of aerobic hydrogen oxidizers.

Several bacterial clones from both groundwater and the

deep fracture coatings were closely related to hydrocarbon-

utilizing species. In the groundwater library, we detected

relatives of the aerobic alphaproteobacterium Sphingobium

xenophagum (Fig. 5A; Li et al., 2010), and of the betapro-

Table 1 Microbial counts in water (mL�1) and shallow fracture mineral coatings (g�1). Microscopy: Total number of cells (TNC) obtained by DAPI, bacterial

and archaeal numbers by fluorescent in situ hybridization. Real-time qPCR: Cell numbers calculated from measured copy numbers of the 16S rDNA gene

Microscopy Real time PCR

TNC Bacteria Archaea Bacteria* Archaea†

Surface water (W0 m) 1.8 (�0.1) 9 106 9.6 (�1.2) 9 105 5.4 (�0.3) 9 104 9.4 (�1.3) 9 105 6.7 (�0.6) 9 103

Groundwater (W50 m) 6.2 (�0.6) 9 105 4.4 (�0.5) 9 105 7.5 (�1.1) 9 104 3.1 (�0.04) 9 104 1.0 (�0.2) 9 103

Fracture coatings (F15 cm) NA NA NA 3.2 (�0.6) 9 109 6.6 (�3.0) 9 105

NA, not analysed.*Cell number of Bacteria calculated as average 4.17 16S rDNA copies pr cell.†Cell number of Archaea calculated as average 1.71 16S rDNA

copies pr cell (Klappenbach et al., 2001; Lee et al., 2009).



Fig. 4 Phylogenetic analysis of Archaea. The sequences are grouped in OTUs within 2% distance, and the numbers of sequences in the OTUs are indicated

after the accession number if more than one sequence is represented.



A

Fig. 5 Phylogenetic analysis of Bacteria divided into subtrees: (A) Proteobacteria, (B) Phyla from Bacteroidetes to Gemmatimonadetes, (C) Phyla from Planc-

tomycetes to Acidobacteria and (D) Actinobacteria. The sequences are grouped in OTUs with 2% distance, and the numbers of sequences in the OTUs are

indicated after the accession number if more than one sequence is represented.



B

Fig. 5 (continued)



C

Fig. 5 (continued)



D

Fig. 5 (continued)



teobacterium Oxalobacteriaceae bacterium HTCC302, iso-

lated from a trichlorethene-contaminated groundwater

(Fig. 5A; Connon et al., 2005). In one of the deep fractures

(F160 cm), we found close relatives of the methylotrophic

alphaproteobacterium Hyphomicrobium methylovorum

(Fig. 5A; Tanaka et al., 1997) and the betaproteobacterium

Methyloversalis universalis (Fig. 5A; Kalyuzhnaya et al.,

2006). Furthermore, the actinobacterium M. insubricum

(Fig. 5D) is known to oxidize C2-compounds like ethane

(Davis et al., 1956). Close relatives of M. insubricum were

detected in the deep fractures.

We also observed close relatives of organisms involved in

the cycling of nitrogen, iron and manganese. Several

sequences from the deep fractures were related to the

nitrite-oxidizing alphaproteobacterium Nitrobacter alkali-

cus (Fig. 5A) and one to Nitrospira moscoviensis (Fig. 5C),

which is an obligate chemolithoautotrophic nitrite oxidizer

(Ehrich et al., 1995). From the deep fractures, we found

close relatives of the Betaproteobacteria, Ferrovum myxofac-

iens and A. facilis (Fig. 5A). Strains within the genus

Acidovorax are reported to do nitrate-dependent iron-oxi-

dation (Hedrich et al., 2011). The groundwater library

had one clone with closest similarity to the iron-oxidizing

gammaproteobacterium Acidothiobacillus ferrooxidans

(Fig. 5A; Karavaiko et al., 2006). Clones from the ground-

water were related to the alphaproteobacterium genus

Pedomicrobium (Fig. 5A), which includes strains with the

ability to oxidize manganese (Larsen et al., 1999). One

clone from the deep fractures had high similarity to the

actinobacterium genus Arthrobacter, and one to the actino-

bacterium genus Pseudonocardia (Fig. 5D). Strains from

both of these genera are reported to oxidize manganese

(Van Veen, 1973; Cahyani et al., 2009). Isolates of the

fungi Acremonium and Cladosporium from the shallow

fracture coatings had 97.2–98.1% and 98.5–99.9% identity,

respectively, to reported manganese-oxidizing strains of

these species (Cahyani et al., 2009).

Similarity to environmental sequences

In the shallow fractures, 42% of the bacterial sequences

(mostly Actinobacteria) had high identity to sequences from

hydrocarbon-rich environments such as natural asphalts of

the Rancho La Brea Tar Pits (Kim & Crowley, 2007) and

hydrocarbon-rich sediments from the Gulf of Mexico

(Orcutt et al., 2010; Table 4). Large fractions of the bacte-

rial sequences from the deep fractures (27%) and the

groundwater (19%) had high identity to sequences obtained

from hydrocarbon-degrading communities in soil contami-

nated by aliphatic hydrocarbons and petroleum (Kasai et al.,

2005; Osaka et al., 2008; Yagi et al., 2009; Militon et al.,

2010). Among the Archaea detected in the shallow frac-

tures, 5% had high identity to sequences obtained from

hydrocarbon-rich sediments (Orcutt et al., 2010).

Many of the detected Archaea were closely related to

organisms from ammonium-oxidizing environments

(Table 4). This included 32% of the archaeal sequences

from the groundwater, which had high similarity to

sequences obtained from acidic red soil (Ying et al., 2010),

and a rhizospheric Archaea dominating an ammonium-oxi-

Table 2 OTUs calculated at 2% distance

Sample Description Library

No.

seq.

No.

OTUs

No. unique

OTUs

No.

singletons

W0 m Surface

water

B 94 22 22 14

W50 m Groundwater B 94 46 45 34

F15 cm Shallow

fracture

B 89 52 52 38

F155 cm Deep

fracture

B 76 63 55 51

F160 cm Deep

fracture

B 94 81 73 70

W0 m Surface

water

A 43 26 21 18

W50 m Groundwater A 47 28 25 16

F15 cm Shallow

fracture

A 75 2 0 0

F155 cm Deep

fracture

A 46 12 5 7

F160 cm Deep

fracture

A 48 19 11 10

No., number of; B, bacteria; A, Archaea.

A B

Fig. 6 Rarefaction curves for (A) Bacteriaand (B) Archaea.



dizing community (Herrmann et al., 2008). In the archa-

eal library from the deep fractures, we found that 45% were

highly similar to sequences from the above-

mentioned ammonium-oxidizing community (Herrmann

et al., 2008) and 16% of the archaeal sequences obtained

from the shallow fractures were highly similar to sequences

obtained from an ammonium-oxidizing community in

compost (Yamamoto et al., 2011).

Of the archaeal sequences, 35% from the shallow frac-

tures and 22% from the deep fractures affiliated (>99%)with clones from iron- and manganese-rich environments

(Stein et al., 2002).

DISCUSSION

The subsurface microbial communities reported in this

study are hosted by a network of fractures that provide

channel-ways for fluid flow through the dunite. The

groundwater sampled from the borehole represents water

that has passed through this network of fractures.

Although the dissolved O2 level indicates that the resi-

dence time is short, the relatively high pH (up to 9.6) of

this water documents that water–rock reactions are taking

place as the water flows through these rocks. Furthermore,

the occurrence of O2 together with H2 strongly suggests

subsurface mixing of fluids that evolve in fractures with

highly different water/rock ratios and redox conditions

(Okland et al., 2012).

The large differences between the microbial communities

detected in the surface water, groundwater and the deep

and shallow fracture-coating materials are likely the result of

the different conditions. The surface water and shallow frac-

ture coatings were inhabited by eukaryotes and dominated

by prokaryotic organisms different from the organisms in

the groundwater and the deep fracture coatings, indicating

that the deep habitats harbour microbial communities spe-

cifically adapted to the subsurface environments.

Geochemistry, energy and carbon sources for subsurface

life

Hydrogen oxidation

Interestingly, close relatives of micro-organisms known to

utilize hydrogen as energy source were present in the

B

A 0 % 10 % 20 % 30 % 40 % 50 % 60 % 70 % 80 % 90 % 100 %

0 % 10 % 20 % 30 % 40 % 50 % 60 % 70 % 80 % 90 % 100 %

W0 m (94)

W50 m (94)

F15 cm (89)

F155 cm (76)

F160 cm (94)

W0 m (43)

W50 m (47)

F15 cm (75)

F155 cm (46)

F160 cm (48)

Euryarchaeota: Marine Gr II

Thaumarchaeota: SoilCrenGroup (SCG)

Crenarchaeota: Miscelanneous CrenGroup

Alphaproteobacteria Gammaproteobacteria Betaproteobacteria

Deltaproteobacteria Candidate division OP11 Bacteroidetes

Firmicutes Actinobacteria Candidate division TM7

Planctomycetes Nitrospirae Verrucomicrobia

Gemmatimonadetes MVP-21 WCHB1-60

Fusobacteria Deinococcus-Thermus SM2F11

Candidate division OP3 Candidate division OP10 BHI80-139

Chloroflexi Acidobacteria Elusimicrobia

Fig. 7 Distribution of phyla and subclasses in

(A) Bacteria and phyla in (B) Archaea. The

number of clones in each library is given in

parentheses.



Euk3_JN003162,Euk37_JN003184Euk21_JN003173Euk36_JN003183Euk45_JN003189Euk43_JN003188Euk31_JN003181Euk40_JN003186Euk13_JN003168Euk25_JN003176Euk33_JN003182

Lecania cyrtella, Af091589Eupenicillium javanicum, EF413620Euk2_JN003161FL19_SL13.1_JN003153FL17_SL10.2_JN003151FL9_SL2.3_JN003145FL21_SL13.3_JN003155FL20_SL13.2_JN003154FL22_SL13.4_JN003156FL15_SL9.1_JN003150Cladosporium cladosporioides, AY251093

FL13_SL5.1_JN003149Capnobotryella sp. MA3612, AM746202

FL135_FL136_SL2.1_JN003143Sclerotinia sclerotiorum, L37541

FL10_SL2.4_JN003146FL130_SL2.2_JN003144Alternaria alternata, FJ717693

FL12_SL4.1_JN003148FL18_SL10.3_JN003152

FL24_SL14.2_JN003158Acremonium alternatum, Ay083232FL11_SL3.1_JN003147FL23_SL14.1_JN003157

FL6_SL1.1_JN003142Stilbella fimetaria, FJ430712FL139_141_SLH.1_JN003159

Euk14_JN003169Tritirachium sp. IAM 14522, AB003951

EukL777_JN003193EukL733_JN003191

EukL811_JN003200EukL790_JN003196EukL805_JN003199EukL730_JN003190EukL817_JN003202EukL815_JN003201EukL819_JN003203EukL797_JN003198EukL791_JN003197EukL779_JN003194EukL772_JN003192Euk15_JN003170Euk30_JN003180Euk39_JN003185Euk7_JN003163Euk9_JN003164Euk29_JN003179Euk10_JN003165Euk19_JN003171Euk27_JN003177Euk41_JN003187Euk11_JN003166EukL789_JN003195Euk22_JN003174Euk23_JN003175Trebouxia usneae, Z68702Myrmecia astigmatica, Z47208EukL821_JN003204

Pirula salina, Af124337Euk20_JN003172Euk28_JN003178Euk1_JN003160Euk12_JN003167

Metazoa_Planocera et. rel.2

0.10

Ascomycota

Chlorophyta

Fig. 8 Phylogenetic tree of eukaryal clones and isolates in the shallow fractures (F15 cm). Isolates are marked in red.



Table 3 Comparison with cultured organisms. Identity was calculated from Phylip Distance in Arb using SAI-filters

Clones Cultured organism Phylum Identity% Feature or isolation source References

Groundwater (W50 m) 28 Hydrogenophaga pseudoflava Betaproteobacteria 98.4–99.0 Aerobic Hydrogen

oxidation

1

3 Sphingobium xenophagum Alphaproteobacteria 98 Hydrocarbon degrading 2

4 Oxalobacteriaceae bacterium

HTCC302

Betaproteobacteria 99 TCE contaminated

ground water

3

1 Acidothiobacillus ferroxidans Gammaproteobacteria 95 Acidophilic iron

oxidation.

4

3 Pedomicrobium spp. Alphaproteobacteria >97 Manganese oxidation 5

Deep fracture (F155 cm) 2 Clostridium thiosulfatireducens Firmicutes 96 Obligate anaerobic

1 Ferrovum myxofaciens Betaproteobacteria 92 Iron oxidation,

Acidophilic

6

2 Acidovorax facilis Betaproteobacteria 99.5 Aerobic Hydrogen

oxidation

1

Nitrate dependent

iron oxidation

7

1 Aquaspirillum arcticum Betaproteobacteria 94.6 Aerobic Hydrogen

oxidation

1

2 Bradhyrizobium japonicumNitrobacter

alkalicus

Alphaproteobacteria 97.7–98.8

.899

Aerobic Hydrogen

oxidationNitrite

oxidation

1

Deep fracture (F160 cm) 2 Bradhyrizobium japonicumNitrobacter

alkalicus

Alphaproteobacteria 97.8 Aerobic Hydrogen

oxidationNitrite oxidation

1

1 Aquaspirillum arcticum Betaproteobacteria 95.9% Aerobic Hydrogen

oxidation

1

1 Fusobacterium nucleatum Fusobacteria 99.3 Anaerobic

1 Leptotrichia wadei Fusobacteria 98.4 Anaerobic

2 Hyphomicrobium methylovorum Alphaproteobacteria 98.8 Methylotrophic 8

1 Methyloversalis universalis Betaproteobacteria 95 Methylotrophic 9

2 Mycobacterium insubricum Actinobacteria 96.1–97.8 Aerobic Hydrogen

oxidation

1

Oxidize C-2 compounds 10

1 Nitrospira moscoviensis Nitrospira 97.6 Nitrite oxidation 11

1 Ferrovum myxofaciens Betaproteobacteria 92 Iron oxidation, Acidophilic 6

1 Arthrobacter spp. Actinobacteria 99.4 Manganese

oxidationAerobe

hydrogenoxidation

12

1 Pseudonocardia spp. Actinobacteria 98.5 Manganese oxidation 13

References: (1) Schwartz et al. (2006); (2) Li et al. (2010); (3) Connon et al. (2005); (4) Karavaiko et al. (2006); (5) Larsen et al. (1999); (6) Heinzel et al.

(2009); (7) Hedrich et al. (2011); (8) Tanaka et al. (1997); (9) Kalyuzhnaya et al. (2006); (10) Davis et al. (1956); (11) Ehrich et al. (1995); (12) Van Veen

(1973); (13) Cahyani et al. (2009).

Table 4 Sequence similarity to environmental sequences; results from BLAST searches in GenBank

Domain Seq (%) Sim (%) Environment References

Groundwater (W50 m) B 19 95–99 Hydrocarbon-contaminated soil 1,2,3,4

Shallow fractures (F15 cm) B 42 93.7–99.5 Natural asphalts. Rancho la Brea Tar Pits 5

Natural asphalts. Rancho la Brea Tar

PitsHydrocarbon-rich sediments, Gulf of Mexico

6

Deep fractures (F155 cm,

F160 cm)

B 27 95–99 Hydrocarbon contaminated soil 1,2,3,4

Groundwater (W50 m) A 32 93–99.5 Ammonium-oxidizing – acidic red soil 6

Rhizosphere, ammonium-oxidizing community 7

Shallow fractures (F15 cm) A 5 >99 Hydrocarbon-rich sediments 8

16 >99 Compost, ammonium-oxidizing community 9

Deep fractures (F155 cm,

F160 cm)

A 45 >98 Rhizosphere, ammonium-oxidizing community 7

B, Bacteria; A, Archaea; Seq, sequences; Sim, similarity.References: (1) Kasai et al. (2005); (2) Osaka et al. (2008); (3) Yagi et al. (2009); (4) Militon et al.

(2010); (5) Kim & Crowley (2007); (6) Ying et al. (2010); (7) Herrmann et al. (2008); (8) Orcutt et al. (2010); (9) Yamamoto et al. (2011).



groundwater and in the deep fracture-coating material. Bac-

teria dominated over Archaea in all samples (Table 1), and

the finding that as much as 30% of the Bacteria in the

groundwater were relatives of H. pseudoflava strongly indi-

cates that hydrogen is fuelling the community. This is in

agreement with a recent metagenomic study of peridotite-

hosted communities where genes for hydrogen oxidation

belonging to Hydrogenophaga spp were detected (Brazelton

et al., 2012). Detection of other putative hydrogen-

oxidizing bacteria (6%) in the deep fracture coatings

suggests that hydrogen is a source of energy also in this hab-

itat, although not as extensive as in the groundwater in the

borehole. This apparent presence of aerobic hydrogen

oxidizers is consistent with the occurrence of dissolved H2

in oxygenated water. Hydrogen production through split-

ting of water during Fe(II)-oxidation and development of

highly reducing condition is most likely to occur in very thin

fractures with little water relative to the reacting rock sur-

face. It has not been possible to sample the fluids from the

thin fractures directly, and the H2 content of these fluids is

therefore unknown. However, the H2 content of the water

in the main aquifer, which is sampled from the borehole, is

up to 585 nM. As this water also is oxygen-rich, it is likely

that H2 produced in surrounding anoxic micro-fractures

migrates into wider fractures and to the borehole (Okland

et al., 2012). This is supported by the detection of two

clones in the deep fractures affiliated with Clostridium, and

two clones affiliated with Fusobacteria, which both represent

anaerobic organisms. The hydrogeological system that hosts

these subsurface microbial ecosystems seems accordingly to

include both channel-ways for oxic water, as well as highly

reduced micro-environments where hydrogen production

takes place. Both oxic and hydrogen-rich anoxic habitats, as

well as interfaces with steep redox gradients between such

habitats where hydrogen oxidizers may thrive, are thus likely

to be present. This may explain the differences between the

microbial communities in the groundwater and the deep

fractures, and the presence of other putative hydrogen-

oxidizing bacteria in these fractures.

Hydrocarbon degradation

Hydrogen produced by the serpentinization reactions may

further react with dissolved carbon dioxide to produce

methane or higher alkanes (Holm & Charlou, 2001).

Although this mainly has been described as high-tempera-

ture reactions, production of hydrocarbons at low tempera-

tures was recently also reported (Neubeck et al., 2011).

Thus, traces of methane detected in the Leka groundwater

could have a similar origin.

Organic carbon present in the surface water may be

transported through the fracture zones and initially serve as

an energy source for heterotrophic organisms in the shallow

subsurface environment. However, this carbon is not likely

to reach the deep fractures, because only a very low amount

of organic carbon was detected in the oxic groundwater

that is channelled relative rapidly through the innermost

highly fractured zone (Fig. 2). Consistent with this, rela-

tives of heterotrophic Bacteroidetes (Kirchman, 2002) were

abundant in the surface water, but absent in groundwater.

Three clones from the 160-cm-deep fracture had high simi-

larity to known methylotrophs and two clones to known

ethane oxidizers. Also, a large proportion of organisms

detected in the groundwater and in the deep fracture coat-

ings were most closely related to clones from hydrocarbon-

rich environments, indicating that organisms with the

potential of oxidizing hydrocarbons are present in the sub-

surface. None of the known aerobic methane-

oxidizing Proteobacteria was detected either by enrichments

or by molecular methods. However, sequences from the

groundwater (three sequences) and the deep fractures (four

sequences) belonged to Verrumicrobia, a phylum that has

recently been shown to include species with methane-

oxidizing capability (Dunfield et al., 2007; Islam et al.,

2008). Moreover, no methanogenic Archaea were detected

in this study, indicating that the possible methane forma-

tion is not biogenic. These observations support the

hypothesis that hydrogen and hydrocarbons are formed by

water–rock interactions in this low-temperature environ-

ment. Thus, abiotic synthesis of organic compounds could

be catalysed by the transition metals present in the rock.

Alternatively, organic compounds could be present as inclu-

sions in the rock or be absorbed to mineral surfaces and

released when the rock dissolves (McCollom & Seewald,

2001; Menez et al., 2012). Also, autotrophy could provide

organic compounds for heterotrophs. However, the abun-

dance of autotrophs seems to be low in the fractures, and

thus, autotrophy is not likely a source of carbon there.

Consequently, our results point to the possibility that the

subsurface water–rock interactions sustain microbial com-

munities with lithoautotrophic hydrogen or hydrocarbon

oxidizers as primary producers. Detection of both H2 and

CH4 from low-temperature water–rock experiments with

dunite from Leka (Okland, I., Huang, S., Thorseth, I.H.

and Pedersen, R.B., unpubl. data) supports this possibility.

Other metabolic processes

Oxidation of ammonia, iron and manganese are other

energy-yielding metabolic pathways for micro-organisms,

and a high number of the archaeal sequences from the

groundwater and the fracture coatings belonged to the soil

crenarchaeotic group (1.1b), which is constituted by puta-

tive ammonium oxidizers (Prosser & Nicol, 2008). In

addition, many sequences from the fracture coatings were

most closely related to clones from environments rich in

iron and manganese. The detected ammonia concentration

in the groundwater is low (0.5 lM). The ammonia could

possibly come from degradation of organic material or be

leached from the rock in the narrow fractures surrounding



the borehole (Philippot et al., 2007; Holm & Neubeck,

2009). Furthermore, it is not clear whether the source of

the relatively high nitrate concentration in the groundwater

compared with the surface water is of abiotic or biotic ori-

gin. Low-temperature alteration experiments with rock

from the same location suggest, however, that both NH4

and NO3 are leached from the rock and that additionally

NH4 are produced through reduction in NO3 (unpubl.

data). We have indication of putative ammonium-oxidizing

communities that produce nitrite both in the groundwater

and in the deep fractures, and sequences with high identity

to known nitrite oxidizers were detected in the deep frac-

ture coatings. Fixation of nitrogen is an ability assigned

different phyla detected in this study, but phylogenetic

affiliation to such organisms, based on 16S rDNA

sequences, is not enough evidence for inferring this process

(Zehr et al., 2003).

Interestingly, clones affiliated with the acidophilic iron-

oxidation species Acidothiobacillus ferroxidans (groundwa-

ter) and F. myxofaciens (deep fractures) were detected in

this high-pH environment. In addition, a possible nitrate-

dependent iron-oxidation by Acidovorax sp. may occur in

the deep fractures. This indicates that there are more

reducing conditions in the narrow fractures than in the

groundwater in the borehole. Manganese oxidation is also

likely to be an energy source for the microbial communi-

ties in the groundwater and the fracture coatings, and dif-

ferent putative manganese-oxidizing species seem to

inhabit the different subsurface environments.

The shallow fractures had the highest density of cells

(Table 1) and could clearly be distinguished from the dee-

per fractures by the detection of eukaryotes like lichens,

algae and fungi. In addition, a high number of bacteria

affiliated with the Deinococcus-Thermus group (Fig. 6A)

and the order Rubrobacterales, within the Actinobacteria

phylum (Fig. 8D), were detected only in the shallow frac-

tures. These bacteria often inhabit extreme environments

with high radiation and temperatures (Stackebrandt et al.,

2006). The presence of lichens and algae indicates that

these fractures are influenced by the surface communities

including photosynthetic primary producers. Thus, these

organisms may provide organic carbon to the community

in the shallow fractures, which could explain the domi-

nance of heterotrophic organisms detected here. Another

possible explanation for the high prokaryotic biomass in

these fractures is that favourable geochemical gradients

have developed at the interface between the reduced sub-

surface environment and the O2- and CO2- containing

atmosphere at the surface.

Comparison with other ultramafic systems

The Lost City Hydrothermal Field was the first recognized

peridotite-hosted microbial system (Kelley et al., 2001).

This is an active serpentinization system at the seafloor,

which is characterized by high calcium carbonate towers

building up when calcium-rich warm fluids reach cold sea-

water. The high concentrations of methane and hydrogen

in the fluids support methanotrophic organisms as well as

methanogenic micro-organisms. A recent metagenomic

study comparing both the marine system at the Lost City

hydrothermal field and two continental serpentinite-hosted,

high-pH seeps at the Tablelands Ophiolite, Newfoundland,

concludes that the most active hydrogen oxidizers in fluids

from these environments probably are the knallgas bacteria

Hydrogenophaga spp (Brazelton et al., 2012), which is

consistent with our findings. The absence of methane- and

sulphur-metabolizing communities at Leka, which are

observed to dominate the marine Lost City hydrothermal

field (Brazelton et al., 2006), is likely the result of the low

reaction temperature and thus low methane production,

and the meteoric fluid composition where only traces of

sulphate are present (Okland et al., 2012).

In another study, samples of the gabbroic layer of the

oceanic crust were found to be dominated by bacteria pre-

viously detected in hydrocarbon-rich environments (Mason

et al., 2010). Genes for hydrocarbon degradation were also

detected in some of these samples. However, no evidence

for the presence of hydrogen oxidizers was detected in the

gabbroic rock. This environment could possibly be influ-

enced by gas seeps from deeper layers in the oceanic litho-

sphere (Mason et al., 2010).

A few studies have been performed on serpentinite soil

(DeGrood et al., 2005; Oline, 2006) and ultramafic soil

(Lenczewski et al., 2009). The serpentinite soils are highly

altered and inhabit very different microbial communities

than those in the seafloor systems having more resem-

blance to soil and other alkaline, non-saline environments.

DeGrood et al. (2005) showed that the serpentinite soil

has a higher proportion of Actinomycetes than non-serpen-

tine soil. This is consistent with the high abundance of

Actinobacteria that we detected in all the fracture-coating

materials. Studies on groundwater have been performed at

Cabec�o de Vide in Portugal (Tiago et al., 2004) and of a

spring system within the Del Puerto Ophiolite (Blank

et al., 2009). Tiago et al. (2004) cultivated heterotrophic

strains from a non-saline high-pH groundwater (pH 11.4).

Sequences similar to the representative isolated strains are

also found in the groundwater and the deep fracture coat-

ings at Leka, but the Betaproteobacteria are not represented

in their cultures. In the Del Puerto Ophiolite spring sys-

tem, the influence of sunlight produces microbial mats of

Cyanobacteria, which results in a very different microbial

community compared with the water analysed in this study

where no Cyanobacteria were detected. Ultramafic rocks

are abundant in the oceanic lithosphere, not only in the

deeper parts of the crust and upper mantle but also close

to the seafloor (e.g. Cannat et al., 1995), and seawater



with elevated H2 and CH4 concentrations has been

observed over such outcrops (Charlou et al., 1998, 2002).

Thus, the low-temperature geochemical processes that are

active in such systems might support diverse microbial

communities with metabolic functions similar to the com-

munities observed in the subsurface system at Leka.

CONCLUSIONS

In this study, we have described microbial communities in

groundwater and fracture-coating material from different

depths of a serpentinized dunite body. Based on our

results, we hypothesize that hydrogen is an important

source of energy for microbial growth in the oxic ground-

water, especially for H. pseudoflava. In the deep fractures,

the microbial groups are very different from those in the

groundwater, and the putative hydrogen oxidizers are

distinct from those dominating in the groundwater, and

also less frequent. However, the majority of the sequences

are similar to heterotrophic prokaryotes where some are

related to known hydrocarbon degraders or clones

detected in hydrocarbon-rich environments. Thus, hydro-

carbons may be an important energy and carbon source in

this ultramafic environment.

The fuel for the extensive growth of micro-organisms

observed in the surface-near fractures is not clear. Appar-

ently this zone is where the seeping groundwater contain-

ing reduced species meets the atmosphere and thereby

generates highly energetic favourable gradients supporting

a high biomass production. In addition, there is an impact

from phototrophic organisms growing on the surface.

ACKNOWLEDGMENTS

This study was financial supported by the Research Council

of Norway through the EuroMARC project “H2DEEP”

and the Centre for Geobiology, University of Bergen. We

want to thank Jostein Hiller for valuable assistance during

field work, and Lise Ovreas for constructive discussions in

the initial phase of the study. [Correction added on 4 April

2013, after first online publication: Acknowledgements

section has been added.]

REFERENCES

Abrajano TA, Sturchio NC, Kennedy BM, Lyon GL,

Muehlenbachs K, Bohlke JK (1990) Geochemistry of reduced

gas related to serpentinization of the Zambales ophiolite,Philippines. Applied Geochemistry 5, 625–630.

Ahmadjian V (1988) The lichen alga Trebouxia: does it occur free-living? Plant Systematics and Evolution 158, 243–247.

Altschul S, Madden T, Schaffer A, Zhang J, Zhang Z, Miller W,Lipman D (1997) Gapped BLAST and PSI-BLAST: a new

generation of protein database search programs. Nucleic AcidsResearch 25, 3389–3402.

Amann RI, Ludwig W, Schleifer KH (1995) Phylogenetic

identification and in situ detection of individual microbial cells

without cultivation. Microbiological Reviews 59, 143–169.Bach W, Paulick H, Garrido CJ, Ildefonse B, Meurer WP,Humphris SE (2006) Unraveling the sequence of

serpentinization reactions: petrography, mineral chemistry, and

petrophysics of serpentinites from MAR 15ºN (ODP Leg 209,

Site 1274). Geophysical Research Letters 33, L13306.Barnes I, La March�e VR Jr, Himmelberg G (1967) Geochemical

evidence of present-day serpentinization. Science 156, 830–832.Blank JG, Green SJ, Blake D, Valley JW, Kita NT, Treiman A,Dobson PF (2009) An alkaline spring system within the Del

Puerto Ophiolite (California, USA): a Mars analog site.

Planetary and Space Science 57, 533–540.Brazelton WJ, Schrenk MO, Kelley DS, Baross JA (2006)Methane- and sulfur-metabolizing microbial communities

dominate the lost city hydrothermal field ecosystem. Appliedand Environment Microbiology 72, 6257–6270.

Brazelton WJ, Nelson B, Schrenk MO (2012) Metagenomicevidence for H2 oxidation and H2 production by serpentinite-

hosted subsurface microbial communities. Frontiers inMicrobiology 2, 268.

Cahyani V, Murase J, Ishibashi E, Asakawa S, Kimura M (2009)Phylogenetic positions of Mn2+-oxidizing bacteria and fungi

isolated from Mn nodules in rice field subsoils. Biology andFertility of Soils 45, 337–346.

Cannat M, Mevel C, Maia M, Deplus C, Durand C, Gente P,

Agrinier P, Belarouchi A, Dubuisson G, Humler E, Reynolds

J (1995) Thin crust, ultramafic exposures, and rugged faulting

patterns at Mid-Atlantic Ridge (22°–24°N). Geology 23,49–52.

Charlou JL, Fouquet Y, Bougault H, Donval JP, Etoubleau J,

Jean-Baptiste P, Dapoigny A, Appriou P, Rona PA (1998)

Intense CH4 plumes generated by serpentinization of ultramaficrocks at the intersection of the 15º 20’ N fracture zone and the

Mid-Atlantic Ridge. Geochimica et Cosmochimica Acta 62,2323–2333.

Charlou JL, Donval JP, Fouquet Y, Jean-Baptiste P, Holm N

(2002) Geochemistry of high H2 and CH4 vent fluids issuing

from ultramafic rocks at the Rainbow hydrothermal field (36°14′N, MAR). Chemical Geology 191, 345–359.

Connon SA, Tovanabootr A, Dolan M, Vergin K, Giovannoni SJ,

Semprini L (2005) Bacterial community composition

determined by culture-independent and -dependent methods

during propane-stimulated bioremediation in trichloroethene-contaminated groundwater. Environmental Microbiology 7,165–178.

Daae FL (2006) Mikrobielt Liv Assosiert Med Forvitring avUltramafiske Bergarter. Master thesis, University of Bergen,

Norway.

Daims HBA, Amann R, Schleifer Kh, Wagner M (1999) The

domain-specific probe EUB338 is insufficient for the detectionof all Bacteria: development and evaluation of a more

comprehensive probe set. Systematic and Applied Microbiology22, 434–444.

Davis JB, Chase HH, Raymond RL (1956) Mycobacteriumparaffinicum n. sp., a bacterium isolated from soil. AppliedMicrobiology 4, 310–315.

Dawson SC, Pace NR (2002) Novel kingdom-level eukaryotic

diversity in anoxic environments. Proceedings of the NationalAcademy of Sciences of the USA 99, 8324–8329.

DeGrood SH, Claassen VP, Scow KM (2005) Microbial

community composition on native and drastically disturbedserpentine soils. Soil Biology and Biochemistry 37, 1427–1435.



DeLong E (1992) Archaea in coastal marine environments. PNAS89, 5685–5689.

Dunfield PF, Yuryev A, Senin P, Smirnova AV, Stott MB, Hou S,

Ly B, Saw JH, Zhou Z, Ren Y, Wang J, Mountain BW, CroweMA, Weatherby TM, Bodelier PLE, Liesack W, Feng L, Wang

L, Alam M (2007) Methane oxidation by an extremely

acidophilic bacterium of the phylum Verrucomicrobia. Nature450, 879–882.

Edwards U, Rogall T, Blocker H, Emde M, Bottger EC (1989)

Isolation and direct complete nucleotide determination of entire

genes – characterization of a gene coding for 16S-ribosomalRNA. Nucleic Acids Research 17, 7843–7853.

Ehrich S, Behrens D, Lebedeva E, Ludwig W, Bock E (1995)

A new obligately chemolithoautotrophic, nitrite-oxidizing

bacterium, Nitrospira moscoviensis sp. nov. and its phylogeneticrelationship. Archives of Microbiology 164, 16–23.

Einen J, Thorseth IH, Øvre�as L (2008) Enumeration of Archaea

and Bacteria in seafloor basalt using real-time quantitative PCR

and fluorescence microscopy. FEMS Microbiology Letters 282,182–187.

Foustoukos DI, Seyfried WE (2004) Hydrocarbons in

hydrothermal vent fluids: the role of chromium-bearing

catalysts. Science 304, 1002–1005.Furnes H, Pedersen RB, Stillman CJ (1988) The Leka Opholite

Complex, central Norwegian Caledonides: field characteristics

and geotectonic significance. Journal of the Geological Society145, 401–412.

Glockner FO, Amann R, Alfreider A, Pernthaler J, Psenner R,

Trebesius K, Schleifer KH (1996) An in situ hybridization

protocol for detection and identification of planktonic bacteria.Systematic and Applied Microbiology 19, 403–406.

Guindon S, Gascuel O (2003) A simple, fast, and accurate

algorithm to estimate large phylogenies by maximum likelihood.

Systematic Biology 52, 696–704.Haggerty JA (1991) Evidence from fluid seeps atop serpentine

seamounts in the Mariana Forearc: clues for emplacement of the

seamounts and their relationships to forearcs tectonics. MarineGeology 102, 293–309.

Heberling C, Lowell RP, Liu L, Fisk MR (2010) Extent of the

microbial biosphere in the oceanic crust. Geochemistry,Geophysics, Geosystems 11, Q08003.

Hedrich S, Schl€omann M, Johnson DB (2011) The iron-oxidizing

proteobacteria. Microbiology 157, 1551–1564.Heinzel E, Janneck E, Glombitza F, Schl€omann M, Seifert J

(2009) Population dynamics of iron-oxidizing communities inpilot plants for the treatment of acid mine waters.

Environmental Science and Technology 43, 6138–6144.Herrmann M, Saunders AM, Schramm A (2008) Archaeadominate the ammonia-oxidizing community in the rhizosphere

of the freshwater macrophyte Littorella uniflora. Applied andEnvironment Microbiology 74, 3279–3283.

Holm NG, Charlou JL (2001) Initial indications of abioticformation of hydrocarbons in the Rainbow ultramafic

hydrothermal system, Mid-Atlantic Ridge. Earth and PlanetaryScience Letters 191, 1–8.

Holm N, Neubeck A (2009) Reduction of nitrogen compounds inoceanic basement and its implications for HCN formation and

abiotic organic synthesis. Geochemical Transactions 10, 9.Horita J, Berndt ME (1999) Abiogenic methane formation and

isotopic fractionation under hydrothermal conditions. Science285, 1055–1057.

Huber TFG, Hugenholtz P (2004) Bellerophon: a program to

detect chimeric sequences in multiple sequence alignments.Bioinformatics 20, 2317–2319.

Islam T, Jensen S, Reigstad LJ, Larsen Ø, Birkeland N-K (2008)

Methane oxidation at 55°C and pH 2 by a thermoacidophilic

bacterium belonging to the Verrucomicrobia phylum.

Proceedings of the National Academy of Sciences of the USA 105,300–304.

Janecky DR, Seyfried WE (1986) Hydrothermal serpentinization

of peridotite within the oceanic crust: experimental

investigations of mineralogy and major element chemistry.Geochimica et Cosmochimica Acta 50, 1357–1378.

Jorgensen SL, Hannisdal B, Lanzen A, Baumberger T, Flesland K,

Fonseca R, Ovreas L, Steen IH, Thorseth IH, Pedersen RB,Schleper C (2012) Correlating microbial community profiles

with geochemical data in highly stratified sediments from the

Arctic Mid-Ocean Ridge. Proceedings of the National Academy ofSciences of the USA 109, E2846–E2855.

Jurgens G, Lindstrom K, Saano A (1997) Novel group within the

kingdom Crenarchaeota from boreal forest soil. Applied andEnvironment Microbiology 63, 803–805.

Kalyuzhnaya MG, De Marco P, Bowerman S, Pacheco CC, LaraJC, Lidstrom ME, Chistoserdova L (2006) Methyloversatilisuniversalis gen. nov., sp. nov., a novel taxon within the

Betaproteobacteria represented by three methylotrophic isolates.

International Journal of Systematic and EvolutionaryMicrobiology 56, 2517–2522.

Karavaiko G, Dubinina G, Kondrat’eva T (2006) Lithotrophic

microorganisms of the oxidative cycles of sulfur and iron.Microbiology 75, 512–545.

Kasai Y, Takahata Y, Hoaki T, Watanabe K (2005) Physiological

and molecular characterization of a microbial community

established in unsaturated, petroleum contaminated soil.Environmental Microbiology 7, 806–818.

Kelley DS, Karson JA, Blackman DK, Fruh-Green GL, Butterfield

DA, Lilley MD, Olson EJ, Schrenk MO, Roe KK, Lebon GT,

Rivizzigno P (2001) An off-axis hydrothermal vent field nearthe Mid-Atlantic Ridge at 30 degrees N. Nature 412, 145–149.

Kelley DS, Karson JA, Fruh-Green GL, Yoerger DR, Shank TM,

Butterfield DA, Hayes JM, Schrenk MO, Olson EJ,Proskurowski G, Jakuba M, Bradley A, Larson B, Ludwig K,

Glickson D, Buckman K, Bradley AS, Brazelton WJ, Roe K,

Elend MJ, Delacour A, Bernasconi SM, Lilley MD, Baross JA,

Summons RT, Sylva SP (2005) A serpentinite-hosted ecosystem:the lost city hydrothermal field. Science 307, 1428–1434.

Kim J, Crowley DE (2007) Microbial diversity in natural asphallts

of the Rancho La Brea Tar Pits. Applied and EnvironmentMicrobiology 78, 4579–4591.

Kirchman DL (2002) The ecology of Cytophaga–Flavobacteria in

aquatic environments. FEMS Microbiology Ecology 39, 91–100.Klappenbach JA, Saxman PR, Cole JR, Schmidt TM (2001)rrndb: the ribosomal RNA operon copy number database.

Nucleic Acids Research 29, 181–184.Lane DJ, Pace B, Olsen GJ, Stahl DA, Sogin ML, Pace NR

(1985) Rapid determination of 16S ribosomal RNA sequencesfor phylogenetic analyses. PNAS 82, 6955–6959.

Larsen EI, Sly LI, Mcewan AG (1999) Manganese(II) adsorption

and oxidation by whole cells and a membrane fraction of

Pedomicrobium sp. ACM 3067. Archives of Microbiology 171,257–264.

Lee ZM-P, Bussema C, Schmidt TM (2009) rrnDB: documenting

the number of rRNA and tRNA genes in bacteria and archaea.

Nucleic Acids Research 37, D489–D493.Lenczewski M, Rigg L, Enright N, Jaffre T, Kelly H (2009)

Microbial communities of ultramafic soils in maquis and

rainforest at Mont Do, New Caledonia. Austral Ecology 34,567–576.



Li Y, Montgomery-Brown J, Reinhard M (2010)

Biotransformation of halogenated nonylphenols with

Sphingobium xenophagum bayram and a nonylphenol-degrading

soil-enrichment culture. Archives of EnvironmentalContamination and Toxicology 60, 1–8.

Loy A, Lehner A, Lee N, Adamczyk J, Meier H, Ernst J, Schleifer

K-H, Wagner M (2002) Oligonucleotide microarray for 16S

rRNA Gene-based detection of all recognized lineages ofsulfate-reducing prokaryotes in the environment. Applied andEnvironment Microbiology 68, 5064–5081.

Ludwig W, Strunk O, Westram R, Richter L, Meier H, Yadhu K,Buchner A, Lai T, Steppi S, Jobb G, Forster W, Brettske I,

Gerber S, Ginhart AW, Gross O, Grumann S, Hermann S, Jost

R, Konig A, Liss T, Lussmann R, May M, Nonhoff B, Reichel

B, Strehlow R, Stamatakis A, Stuckmann N, Vilbig A, Lenke M,Ludwig T, Bode A, Schleifer K-H (2004) ARB: a software

environment for sequence data. Nucleic Acids Research 32,1363–1371.

Lysnes K, Thorseth IH, Steinsbu BO, Øvre�as L, Torsvik T,Pedersen RB (2004) Microbial community diversity in seafloor

basalt from the Arctic spreading ridges. FEMS MicrobiologyEcology 50, 213–230.

Mason OU, Nakagawa T, Rosner M, Van Nostrand JD, Zhou J,Maruyama A, Fisk MR, Giovannoni SJ (2010) First

investigation of the microbiology of the deepest layer of ocean

crust. PLoS ONE 5, e15399.Massana R, Murray AE, Preston CM, Delong EF (1997) Vertical

distribution and phylogenetic characterization of marine

planktonic Archaea in the Santa Barbara Channel. Applied andEnvironmental Microbiology 63, 50–56.

McCollom TM, Bach W (2009) Thermodynamic constraints on

hydrogen generation during serpentinization of ultramafic rocks.

Geochimica et Cosmochimica Acta 73, 856–875.McCollom TM, Seewald JS (2001) A reassessment of the potentialfor reduction of dissolved CO2 to hydrocarbons during

serpentinization of olivine. Geochimica et Cosmochimica Acta65, 3769–3778.

Menez B, Pasini V, Brunelli D (2012) Life in the hydrated

suboceanic mantle. Nature Geoscience 5, 133–137.Militon C, Boucher D, Vachelard C, Perchet G, Barra V, Troquet

J, Peyretaillade E, Peyret P (2010) Bacterial community changesduring bioremediation of aliphatic hydrocarbon contaminated

soil. FEMS Microbiology Ecology 74, 669–681.Moody JB (1976) An experimental study of the serpentinization

of iron-bearing olivines. Canadian Mineralogist 14, 462–478.Morikawa K, Yanagida M (1981) Visualization of individual DNA

molecules in solution by light microscopy: DAPI staining

method. Journal of Biochemistry 89, 693–696.Muyzer G, Dewaal EC, Uitterlinden AG (1993) Profiling of

complex microbial-populations by denaturing gradient gel-

electrophoresis analysis of polymerase chain reaction-amplified

genes-coding for 16S ribosomal-RNA. Applied andEnvironmental Microbiology 59, 695–700.

Neal C, Stanger G (1983) Hydrogen generation from mantle

source rocks in Oman. Earth and Planetary Science Letters 66,315–320.

Nealson KH, Inagaki F, Takai K (2005) Hydrogen-driven

subsurface lithoautotrophic microbial ecosystems (SLiMEs): do

they exist and why should we care? Trends in Microbiology 13,405–410.

Neubeck A, Duc N, Bastviken D, Crill P, Holm N (2011)

Formation of H2 and CH4 by weathering of olivine at

temperatures between 30 and 70 degrees C. GeochemicalTransactions 12, 6.

Nielsen PH, Kragelund C, Seviour RJ, Nielsen JL (2009) Identity

and ecophysiology of filamentous bacteria in activated sludge.

FEMS Microbiology Reviews 33, 969–998.Okland I, Huang S, Dahle H, Thorseth IH, Pedersen RB(2012) Low temperature alteration of serpentinized ultramafic

rock and implications for microbial life. Chemical Geology318, 75–87.

Oksanen J, Blanchet FG, Kindt R, Legendre P, O’Hara RB,Simpson GL, Solymos P, Stevens MHH, Wagner H (2011).

Vegan: Community Ecology Package. R package version 1.17-6.

http://vegan.r-forge.r-project.org/Oline DK (2006) Phylogenetic comparisons of bacterial

communities from serpentine and nonserpentine soils. Appliedand Environment Microbiology 72, 6965–6971.

Orcutt BN, Joye SB, Kleindienst S, Knittel K, Ramette A, Reitz A,Samarkin V, Treude T, Boetius A (2010) Impact of natural oil

and higher hydrocarbons on microbial diversity, distribution and

activity in Gulf of Mexico cold-seep sediments. Deep SeaResearch Part II: Topical Study in Oceanograpy 57, 2008–2021.

Osaka T, Ebie Y, Tsuneda S, Inamori Y (2008) Identification of

the bacterial community involved in methane-dependent

denitrification in activated sludge using DNA stable-isotope

probing. FEMS Microbiology Ecology 64, 494–506.Palandri JL, Reed MH (2004) Geochemical models of

metasomatism in ultramafic systems: serpentinization,

rodingitization, and sea floor carbonate chimney precipitation.Geochimica Et Cosmochimica Acta 68, 1115–1133.

Philippot P, Busigny V, Scambelluri M, Cartigny P (2007)

Oxygen and nitrogen isotopes as tracers of fluid activities in

serpentinites and metasediments during subduction. Mineralogyand Petrology 91, 11–24.

Proskurowski G, Lilley MD, Kelley DS, Olson EJ (2006) Low

temperature volatile production at the Lost City Hydrothermal

Field, evidence from a hydrogen stable isotope geothermometer.Chemical Geology 229, 331–343.

Proskurowski G, Lilley MD, Seewald JS, Fruh-Green GL, Olson

EJ, Lupton JE, Sylva SP, Kelley DS (2008) Abiogenichydrocarbon production at Lost City hydrothermal field. Science319, 604–607.

Prosser JI, Nicol GW (2008) Relative contributions of archaea and

bacteria to aerobic ammonia oxidation in the environment.Environmental Microbiology 10, 2931–2941.

Pruesse E, Quast C, Knittel K, Fuchs BM, Ludwig W, Peplies

J, Gl€ockner FO (2007) SILVA: a comprehensive online

resource for quality checked and aligned ribosomal RNAsequence data compatible with ARB. Nucleic Acids Research35, 7188–7196.

Reese Næsborg R, Ekman S, Tibell L (2007) Molecular phylogenyof the genus Lecania (Ramalinaceae, lichenized Ascomycota).

Mycological Research 111, 581–591.Schloss PD, Westcott SL, Ryabin T, Hall JR, Hartmann M,

Hollister EB, Lesniewski RA, Oakley BB, Parks DH, RobinsonCJ, Sahl JW, Stres B, Thallinger GG, Van Horn DJ, Weber CF

(2009) Introducing mothur: open-source, platform-

independent, community-supported software for describing and

comparing microbial communities. Applied and EnvironmentMicrobiology 75, 7537–7541.

Schulte MBD, Hoehler T, McCollom T (2006) Serpentinization

and its implications for life on the early Earth and Mars.

Astrobiology 6, 364–376.Schwartz E, Friedrich B, Dworkin M, Falkow S, Rosenberg E,

Schleifer K-H, Stackebrandt E (2006) The H2-MetabolizingProkaryotes. The Prokaryotes, Springer, New York, NY, pp.496–563.



Sleep NH, Meibom A, Fridriksson T, Coleman RG, Bird DK

(2004) H2-rich fluids from serpentinization: geochemical and

biotic implications. Proceedings of the National Academy ofSciences of the USA 101, 12818–12823.

Stackebrandt E, Ebers J (2006) Taxonomic parameters revisited:

tarnished gold standards. Microbiology Today 33, 152–155.Stackebrandt E, Schumann P, Dworkin M, Falkow S, Rosenberg

E, Schleifer K-H (2006) Introduction to the Taxonomy ofActinobacteria the Prokaryotes, Springer, New York, NY, pp.

297–321.Stein LY, Jones G, Alexander B, Elmund K, Wright-Jones C,Nealson KH (2002) Intriguing microbial diversity associated

with metal-rich particles from a freshwater reservoir. FEMSMicrobiology Ecology 42, 431–440.

Stevens TO, Mckinley JP (1995) Lithoautotrophic microbialecosystems in deep basalt aquifers. Science 270, 450–455.

Stoecker K, Dorninger C, Daims H, Wagner M (2010) Double

labeling of oligonucleotide probes for fluorescence in situ

hybridization (DOPE-FISH) improves signal intensity andincreases rRNA accessibility. Applied and EnvironmentMicrobiology 76, 922–926.

Szponar N, Brazelton WJ, Schrenk MO, Bower DM, Steele A,

Morrill PL (2012). Geochemistry of a continental site ofserpentinization, the Tablelands Ophiolite, Gros Morne

National Park: a Mars analogue. Icarus, in press. http://dx.doi.

org/10.1016/j.icarus.2012.07.004.Tanaka Y, Yoshida T, Watanabe K, Izumi Y, Mitsunaga T (1997)

Cloning and analysis of methanol oxidation genes in the

methylotroph Hyphomicrobium methylovorum GM2. FEMSMicrobiology Letters 154, 397–401.

Thomsen TR, Nielsen JL, Ramsing NB, Nielsen PH (2004)

Micromanipulation and further identification of FISH-labelled

microcolonies of a dominant denitrifying bacterium in activated

sludge. Environmental Microbiology 6, 470–479.Tiago I, Chung AP, Verissimo A (2004) Bacterial diversity in a

nonsaline alkaline environment: heterotrophic aerobic

populations. Applied and Environment Microbiology 70,7378–7387.

Treusch AH, Leininger S, Kletzin A, Schuster SC, Klenk HP,

Schleper C (2005) Novel genes for nitrite reductase and Amo-

related proteins indicate a role of uncultivated mesophilic

crenarchaeota in nitrogen cycling. Environmental Microbiology7, 1985–1995.

Van Veen W (1973) Biological oxidation of manganese in soils.

Antonie van Leeuwenhoek 39, 657–662.Wallner G, Amann R, Beisker W (1993) Optimizing fluorescent insitu-hybridization with rRNA-targeted oligonucleotide probes

for flow cytometric identification of microorganisms. Cytometry14, 136–143.

Willems A, Busse J, Goor M, Pot B, Falsen E, Jantzen E, Hoste B,

Gillis M, Kersters K, Auling G, De Ley J (1989) Hydrogenophaga,a new genus of hydrogen-oxidizing bacteria that includes

Hydrogenophaga flava comb. nov. (Formerly Pseudomonas flava),Hydrogenophaga palleronii (Formerly Pseudomonas palleronii),Hydrogenophaga pseudoflava (Formerly Pseudomonas pseudoflavaand “Pseudomonas carboxydoflava”), and Hydrogenophagataeniospiralis (Formerly Pseudomonas taeniospiralis).International Journal of Systematic Bacteriology 39, 319–333.

Yagi JM, Neuhauser EF, Ripp JA, Mauro DM, Madsen EL (2009)

Subsurface ecosystem 11 resilience: long-term attenuation of

subsurface contaminants supports a dynamic 12 microbialcommunity. ISME Journal 4, 131–143.

Yamamoto N, Asano R, Yoshii H, Kenichi O, Nakai Y (2011)

Archaeal community dynamics and detection of ammonia-oxidizing archaea during composting of cattle manure using

culture-independent DNA analysis. Applied Microbiology andBiotechnology 90, 1501–1510.

Ying JY, Zhang LM, He JZ (2010) Putative ammonia-oxidizingbacteria and archaea in an acidic red soil with different land

utilization patterns. Environmental Microbiology Reports 2,304–312.

Zehr JP, Jenkins BD, Short SM, Steward GF (2003) Nitrogenasegene diversity and microbial community structure: a cross-

system comparison. Environmental Microbiology 5, 539–554.



microbial life associated with low-temperature alteration of ultramafic rocks in the leka ophiolite...

Documents