j. rodor, e. jobet, j. bizarro, f. vignols, c.c. carles, t. suzuki, k. nakamura, m. echeverria...

AtNUFIP, an essential protein for plant development,reveals the impact of snoRNA gene organisationon the assembly of snoRNPs and rRNA methylationin Arabidopsis thaliana

Julie Rodor1, Edouard Jobet1, Jonathan Bizarro1,†, Florence Vignols1, Cristel Carles1, Takamasa Suzuki2, Kenzo Nakamura3

and Manuel Echeverrıa1,*

1Laboratoire Genome et Developpement des Plantes, UMR 5096 Universite de Perpignan via Domitia – Centre National

de la Recherche Scientifique – Institut de Recherche pour le Developpement, Perpignan, France,2Laboratory of Plant Molecular Genetics, Graduate School of BioAgriculture, Nagoya University, Nagoya, Japan, and3Laboratory of Biochemistry, Graduate School of BioAgriculture, Nagoya University, Nagoya, Japan

Received 3 September 2010; revised 6 December 2010; accepted 18 December 2010.*For correspondence (fax +330 468668499; e-mail [email protected]).†Present address: Institut de Genetique Moleculaire de Montpellier, CNRS-UMR 5535, 1919 Route de Mende, 34293 Montpellier-Cedex 5, France.

SUMMARY

In all eukaryotes, C/D small nucleolar ribonucleoproteins (C/D snoRNPs) are essential for methylation and

processingof ribosomalRNAs.Theyconsistof aboxC/Dsmall nucleolarRNA(C/DsnoRNA)associatedwith four

highly conserved nucleolar proteins. Recent data in HeLa cells and yeast have revealed that assembly of these

snoRNPsisdirectedbyNUFIPproteinandotherauxiliaryfactors.Nevertheless,theprecisefunctionandbiological

importance of NUFIP and the other assembly factors remains unknown. In plants, few studies have focused on

RNA methylation and snoRNP biogenesis. Here, we identify and characterise the AtNUFIP gene that directs

assemblyofC/DsnoRNP.ToelucidatethefunctionofAtNUFIP inplanta,wecharacterizedatnufipmutants.These

mutants are viable but have severedevelopmental phenotypes.Northernblot analysis of snoRNAaccumulation

inatnufipmutantsrevealedaspecificdegradationofC/DsnoRNAsandthissituationiscorrelatedwithareduction

inrRNAmethylation.Remarkably,theimpactofAtNUFIPdependsonthestructureofsnoRNAgenes: it isessential

fortheaccumulationofthoseC/DsnoRNAsencodedbypolycistronicgenes,butnotbymonocistronicortsnoRNA

genes. We propose that AtNUFIP controls the kinetics of C/D snoRNP assembly on nascent precursors to

overcome snoRNA degradation of aberrant RNPs. Finally, we show that AtNUFIP has broader RNP targets,

controlling the accumulation of scaRNAs that directmethylation of spliceosomal snRNA in Cajal bodies.

Keywords: AtNUFIP, snoRNP assembly, atnuf mutants, development, rRNA methylation.

INTRODUCTION

Small nucleolar RNAs (snoRNAs) represent an abundant

class of guide RNAs that direct modifications of approxi-

mately 200 residues on rRNAs in eukaryotes. Most snoRNAs

fall into two families: (i) the box C/D snoRNAs, with con-

served C and D motifs, which direct 2¢-O-ribose methyla-

tions; and (ii) the box H/ACA snoRNAs, with conserved

H/ACA motifs, which direct pseudouridylation. In addition, a

subset of C/D and H/ACA snoRNAs is implicated in specific

cleavage of rRNA precursors (pre-rRNA) (Bachellerie et al.,

2002; Matera et al., 2007).

In vivo, each snoRNA associates with a set of core

proteins, forming hundreds of nucleolar ribonucleoproteins

(snoRNPs). The C/D snoRNAs associate with fibrillarin

(Nop1p in yeast), which is the RNA methylase, NOP58,

NOP56 and 15.5K (Snu13p in yeast). The H/ACA snoRNAs

associate with dyskerin/NAP57 (Cbf5p in yeast), which is the

pseudouridine synthase, NHP2, GAR1 and NOP10 (Brown

et al., 2003a; Matera et al., 2007).

Another related class of guide RNAs are the small Cajal

bodies RNAs (scaRNAs) that direct modifications of splice-

osomal snRNAs in Cajal bodies (Darzacq et al., 2002). The

scaRNAs contain C/D or H/ACA conserved elements but can

also have hybrid C/D and H/ACA structure (Jady and Kiss,

2001). In vivo, scaRNAs associate with the same set of

ª 2011 The Authors 1The Plant Journal ª 2011 Blackwell Publishing Ltd

The Plant Journal (2011) doi: 10.1111/j.1365-313X.2010.04468.x

proteins as snoRNAs and form the corresponding

scaRNPs.

In contrast with the conservation of snoRNP components,

the plant snoRNA genes exhibit specific modes of genomic

organization and expression (Brown et al., 2003a; Rodor

et al., 2010). In animals, most snoRNAs are encoded within

introns of protein coding genes and are produced by

processing of the intron lariat. In plants, most snoRNAs

are encoded by polycistronic clusters independently tran-

scribed from their own promoter. They produce a polycis-

tronic precursor that is processed by endonucleolytic and

exonucleolytic trimming to release the individual snoRNAs.

In plants there are also intronic snoRNAs, but most of them

are in clusters. Plants also have a unique family of tRNA-

snoRNA genes. These are transcribed by Pol III from the

tRNA promoter producing a dicistronic precursor that is

processed into a tRNA and a C/D snoRNA (Kruszka et al.,

2003; Barbezier et al., 2009). Independent monocistronic

snoRNA genes which are the majority in yeast are very

rare in plants. The only clear examples are U3, which is

transcribed by Pol III (Kiss et al., 1991), and U13, transcribed

by Pol II (Kim et al., 2010). Notably, both U3 and U13 are

implicated in pre-rRNA processing in mammals (Maxwell

and Fournier, 1995; Cavaille et al., 1996).

All snoRNAs are produced by processing of a precursor

(pre-snoRNA). Several studies in animals, yeast and plants

have revealed a tight link between transcription, processing

and assembly of the snoRNP on the nascent pre-snoRNA

(Darzacq et al., 2006; Hirose et al., 2006; Barbezier et al.,

2009). The initial processing steps are distinct on the

monocistronic, intronic or polycistronic pre-snoRNAs.

Nevertheless, the final steps of processing are similar and

implicate 5¢ and 3¢ exonucleolytic trimming of flanking

sequences to produce the mature snoRNA ends (Allmang

et al., 1999; Van Hoof et al., 2000; Lee et al., 2003). Assembly

of the snoRNP is essential to control exonucleolytic degra-

dation and stabilize the mature snoRNA.

Assembly of C/D snoRNPs is initiated by the binding

of 15.5K to the k-turn RNA motif formed by C/D elements

(Watkins et al., 2000). Binding of 15.5K to the snoRNAs

nucleates the recruitment of the three other core proteins

forming the C/D snoRNP. Recent studies in yeast and human

cells have revealed auxiliary factors that transiently interact

with the core proteins and direct assembly of the snoRNP

(McKeegan et al., 2007, 2009; Boulon et al., 2008).

A central factor directing assembly of C/D snoRNPs is

NUFIP identified in HeLa cells. NUFIP directly interacts with

the 15.5K protein, which binds to C/D snoRNA and facilitates

the recruitment of the three other core proteins (McKeegan

et al., 2007; Boulon et al., 2008).

In plants, snoRNP assembly factors have not been studied

and their impact on snoRNA metabolism and development

is not known. To address these questions, here we focus on

the identification and characterization of the AtNUFIP gene

in Arabidopsis thaliana and characterize two distinct atnufip

mutant lines. Analysis of mutants shows that AtNUFIP is

required for plant development and is essential for C/D

snoRNA stability. Remarkably this effect depends on the

genomic organization of snoRNAs and AtNUFIP is only

essential for the accumulation of snoRNAs derived from

polycistronic precursors. Finally, we show that AtNUFIP has

an additional function and controls the biogenesis of C/D

scaRNPs predicted to direct methylation of spliceosomal

snRNAs.

RESULTS

Identification of potential NUFIP homologs in plants

The human NUFIP and its homolog in yeast Rsa1p are

divergent but share a short conserved motif PEP that directs

the interaction with the 15.5K (Snu13p in yeast) core C/D

snoRNP protein (Boulon et al., 2008). A TBLASTN search

(Altschul et al., 1997) with the human PEP motif on the

Arabidopsis thaliana and rice genomes identified a single

gene encoding a protein with a PEP motif in each species

(Figure 1a). Using the discovery motif MEME/MAST (Bailey

and Elkan, 1994), we identified a second conserved motif

in the C terminal extremity of plant putative NUFIP, human

NUFIP and yeast Rsa1p (Figure 1a). This motif contains the

CRM1-dependent nuclear export signal (NES) described in

human NUFIP (Bardoni et al., 2003).

To further characterize the eukaryotic NUFIP family, we

extended the previous analysis to several species, including

protist and green unicellular algae (Figure 1b). In addition to

PEP, the NES motif is conserved in most species, except in

a few lower eukaryotes (Figure 1b). Alignment of this motif

shows high conservation of hydrophobic residues that are

important for nuclear export (Dong et al., 2009). In addition,

the plant NUFIP proteins contain a third motif of unknown

function, called motif P (Figure 1a,c), which is not found in

any other protein. Finally, the zinc finger domain of NUFIP,

which is related to a transcriptional function of the protein

(Cabart et al., 2004), is specific to animal NUFIP.

This analysis shows that the central PEP motif associated

with the C-terminal NES motif define the NUFIP family. In

Arabidopsis thaliana, the predicted NUFIP homolog is

encoded by gene At5g18440, hereafter called AtNUFIP.

Expression of AtNUFIP in Arabidopsis thaliana

The coding sequenceofAtNUFIPgenewas based on a partial

cDNA. To eliminate any ambiguity, we mapped the 5¢ and 3¢

endsofAtNUFIPmRNAbyRLMRACE.Thismappingrevealed

two types of transcripts that differedby a 96nucleotide intron

retained on the 5¢UTR (Figure 2a). Otherwise both transcripts

haveidenticalORFsand3¢UTRs.Semi-quantitativeRT-PCRon

total RNA fromwild type seedlings with primers flanking the

retained intron (Figure 2a) confirmedthatboth transcriptsare

expressed at similar levels (Figure 2b).

2 Julie Rodor et al.

ª 2011 The AuthorsThe Plant Journal ª 2011 Blackwell Publishing Ltd, The Plant Journal, (2011), doi: 10.1111/j.1365-313X.2010.04468.x

We checked the expression of the AtNUFIP gene in

different plant tissues by semi-quantitative RT-PCR. Primers

were designed on the ORF extremities to amplify the two

types ofAtNUFIPmRNAs. These primers encompass several

introns to distinguish PCR amplification from genomic DNA

(Figure 2a). As a control we assessed expression of eEF1-a

constitutive gene. AtNUFIP mRNA was specifically detected

on all tissues (Figure 2c). Thus AtNUFIP is expressed con-

stitutively but at a low level because a high number of PCR

cycles was required to detect it as compared with eEF1-a

mRNA.

AtNUFIP interacts directly with At15.5K

The PEP motif of AtNUFIP should direct its interaction with

At15.5K. In Arabidopsis, At15.5K is encoded by three genes

producing nearly identical proteins conserved with their

human and yeast orthologues (Figure S1A). Considering

that all three At15.5K genes are constitutively expressed

(Figure S1B), we randomly chose At15.5K-3 (At4g22380) to

test its interaction with AtNUFIP.

We first tested their interaction by yeast two-hybrid

analysis. The AtNUFIP and At15.5K ORFs were cloned by

fusion with the binding (BD) and activating (AD) domains of

GAL4. As a negative control, we used the GAL4 AD or BD

empty vector. Cells co-transformed with different combina-

tions of these constructs were grown in the presence or

absence of histidine selectable marker. Clearly, yeast

cells co-transformed with AD-AtNUFIP and BD-At15.5K (or

BD-AtNUFIP and AD-At15.5K) could grow in the absence

of histidine, revealing an interaction between these two

proteins (Figure 3a).

To confirm a direct interaction between AtNUFIP and

At15.5K, we fixed a glutathione S-transferase (GST)-At15.5K

recombinant protein to glutathione-sepharose beads to trap

in vitro translated [35S]-Met-AtNUFIP. Bound and unbound

products were analyzed by SDS-PAGE and revealed by

autoradiography. [35S]-Met-AtNUFIP is highly susceptible to

proteolysis and gives three major bands of approximately

50 kDa (Figure 3b). These bands were significantly enriched

in the GST-At15.5K bound fraction and were not retained on

control glutathione-GST beads (Figure 3b).

These results confirm that AtNUFIP directly interacts with

At15.5K and could be implicated in C/D snoRNP assembly

as human NUFIP.

AtNUFIP partially colocalizes with At15.5K at the

nucleolar periphery

To determine the subcellular localization of AtNUFIP and

At15.5K in vivo, we produced transgenic plants co-express-

ing GFP–AtNUFIP and At15.5K-RFP under the control of the

constitutive 35S CaMV promoter. Several transgenic lines

were produced expressing At15.5K-RFP in all tissues. The

fluorescence was concentrated in the nucleolus, with major

labeling in the center of this compartment, and in small foci

associated to the nucleolus (Figure 4a). These foci corre-

spond to Cajal bodies revealed by co-localization with

Homo sapiens

Saccharomyces cerevisiae

Arabidopsis thaliana

Oryza sativa

NESPEP

(a)

(b) PEP motif NES motif

P

P

495 aa

533 aa

381 aa

470 aa

Zn finger

No homology

(c) P motif

No homology

Plants

Algae

unicel.

Animals

Fungi

ProtistsNo homology

Figure 1. The NUFIP family.

(a) Structure of NUFIP proteins from human,

Saccharomyces cerevisiae, Arabidopsis thali-

ana andOryza sativa. The conservedmotifs are

indicated by boxes.

(b) Alignment of conserved PEP and NES

motifs of different eukaryotes.

(c) Alignment of plant specific P motif.

AtNUFIP: snoRNP assembly and plant development 3


U2B¢¢-GFP (Figure 4a), a specificmarker of this compartment

in plants (Collier et al., 2006).

Very few lines expressing GFP–AtNUFIP could be

obtained. Moreover, in these lines, the GFP fluorescence

was weak and restricted to root cells. GFP–AtNUFIP was

localized in the nucleus with a diffused fluorescence in the

nucleoplasm and a high concentration in the perinucleolar

region (Figure 4b). In meristematic cells from root tips, the

fluorescence was concentrated in the external layer of the

nucleolus. In elongating root cells, the fluorescence concen-

trated in perinucleolar foci (Figure 4b). GFP–AtNUFIP was

observed neither in the central region of the nucleolus nor in

Cajal bodies (Figure 4b). The yellow signal in merged

images shows that GFP–AtNUFIP partially co-localized with

At15.5K-RFP in the external nucleolar layer and the perinu-

cleolar foci (Figure 4b).

These results show partial co-localization of AtNUFIP

with At15.5K in the nucleolar periphery and are in agree-

ment with an interaction between AtNUFIP and At15.5K

in vivo.

Characterization of T-DNA insertional mutant lines

in the AtNUFIP gene

To study the function of AtNUFIP in vivo, we identified two

T-DNA insertional mutant lines, the SALK 134962 and the

GABI 680F01 lines, hereafter called atnuf-1 and atnuf-2

respectively. PCR genotyping confirmed that the insertions

in atnuf-1 and atnuf-2 mutants are in the last exon and sixth

intron respectively (Figure 2a). We obtained homozygous

plants for atnuf-1 and atnuf-2 in the F2 generation by self

crossing F1 heterozygous lines.

The atnuf-1 homozygous plants presented severe pheno-

types but were fertile and could be maintained as homozy-

gous line. A segregation test to confirm a single T-DNA

insertion in the atnuf-1 mutant was not possible due to loss

of the kanamycin resistance gene due to rearrangement of

the T-DNA insertion. Complementation of atnuf-1 mutants

with an AtNUFIP-FLAG-HA tagged gene fully rescued all

phenotypes (Figure S2).

In atnuf-2mutants, the GABI T-DNA insertion retained the

sulfadiazine resistance gene, allowing confirmation of a

single T-DNA insertion by a segregation test (result not

shown). This was confirmed by full complementation of

atnuf-2 mutants with the AtNUFIP-FLAG-HA tagged gene

(Figure S2). The atnuf-2 mutants are sterile and are main-

tained in heterozygous state.

H 2O

WT

atnuf-1

atnuf-2

5′ 3′

atnuf-2 atnuf-1

F RR1R25F

F and R

F and R1

5F and R2

eEF1-α

AtNUFIP

1.5 kb

1 kb

650 bp

200 bp

AtNUFIP

eEF1-α

gDNA

Seedlings

Flower

bud

s

Flower

s

Silique

s

Stem

Leav

es

Roo

ts

H 2O

35 cycles

25 cycles

1 kb

3 kb

100 bp

(a)

(c)

(b)

0.1 kbPEP NES

M

M

Figure 2. AtNUFIP gene and expression profile in wild type plants and atnuf

mutants.

(a) Structure of the AtNUFIP gene. Dark and clear boxes indicate coding and

UTR regions respectively. The stripped box indicates an alternatively spliced

intron. The position of atnuf-1 and atnuf-2 T-DNA insertions (dark triangles),

the PEP and NES motifs as well as primers (arrows) are indicated.

(b) Analysis of AtNUFIP transcripts in atnufmutants. RT-PCR was made using

total RNA from wild type, atnuf-1 or atnuf-2 seedlings as indicated using the

pairs of primers shown in (a).

(c) Expression profile of AtNUFIP mRNA detected by semi-quantitative

RT-PCR. Total RNAs from indicated tissues were used as substrate using

primers R and F to detect AtNUFIP mRNA. The eEF1-a mRNA was used as

control. The number of PCR cycles is indicated. H2O, control without DNA;

gDNA, genomic DNA used as substrate; M, size marker.

GST

GST-

At1

5.5K

-3

Input

B BUB UB

[35S]-AtNUFIP 50 kDa

(a)

(b)

AD.At15.5K/- BD

AD/BD.At15.5K

AD.AtNUFIP/- BD

AD/BD.AtNUFIP

AD.At15.5K/BD.AtNUFIP

AD.AtNUFIP/BD.At15.5K

Control - his

OD600 5.10–2 5.10–3 5.10–4 5.10–2 5.10–45.10–3

Figure 3. AtNUFIP interaction with At15.5K.

(a) Yeast two-hybrid assay. Yeast cells were co-transformedwith AtNUFIP and

At15.5K cloned either as baits (AD constructs) or targets (BD constructs) in

Gal4-based yeast two-hybrid vectors. Cells were plated as serial dilutions on a

control plate containing all auxotrophic requirements (left panel) and on a test

plate without histidine (right panel).

(b) GST-At15.5K pull down analysis. The GST-At15.5K fixed to glutathion-

sepharose beads was incubated with in vitro translated [35S]-AtNUFIP (see

Experimental procedures). The bound (B) and unbound (UB) fractions were

analysed by SDS PAGE and visualised on a phosphoimager. Input represents

10% of the sample before loading. GST fixed to glutathione-sepharose beads

was used as control.



Full-length AtNUFIP mRNA detected by RT-PCR was not

produced in both atnuf-1 and atnuf-2 lines (Figure 2b).

Nevertheless, using primers upstream from the insertions

(Figure 2a) ‘truncated’ mRNAs were detected in both

mutants (Figure 2b). In both mutants the couple of primers

5F/R2 detected two mRNA forms distinguished by retention

of the first intron (Figure 2b). Interestingly, in atnuf-2 a third

major transcript was detected which corresponds to an

unspliced product retaining both the first and second introns

(Figure 2b). This indicates that splicing ofAtNUFIP truncated

transcript is affected in atnuf-2.

These data show that only truncated RNAs are expressed

from atnuf-1 and atnuf-2 locus. If translated thesewould give

truncated proteins (Figure 2a).

atnuf-1 and atnuf-2 have severe developmental phenotypes

Homozygous atnuf-1 and atnuf-2 mutants were affected in

their development. Overall, both mutants had similar phe-

notypes but defects were enhanced in atnuf-2. Both mutants

showed significant growth delay as comparedwithwild type

plants (Figure 5a). Also, many atnuf-2 seedlings had pre-

mature growth arrest and did not reach the adult state. The

atnuf-1 and atnuf-2 seedlings and adult plants were smaller

and presented leaf morphological defects compared to wild

type (Figure 5a). This situation was most evident in young

seedlings that had a pointed leaf phenotype that is typical of

ribosomal protein mutants (Van Lijsebettens et al., 1994).

Both mutants had phyllotaxy defects revealed, for example,

by some seedlings with three cotyledons or plants with two

cauline leaves on the same node (Figure 5b). The atnuf-1

mutants had important floral defects and, in the case of

atnuf-2, only few plants could develop flowers and in a

limited number. In both mutants, flowers had lost organ

symmetry, had altered number and morphology of petals

and had shorter stamens (Figure 5c). Histological analysis of

atnuf-1 mutants revealed a size reduction of the inflores-

cence meristem that presents a domed profile and leads to a

premature termination (Figure 5d). Analysis of atnuf-1 pistil

section showed a total disorganization and a reduced num-

ber of embryos (Figure 5e). Consequently fertility in atnuf-1

was highly reduced, with smaller siliques and few seeds,

while atnuf-2 produced no seeds and was sterile (Figure 5f).

To unambiguously confirm that the phenotypes of atnuf-1

and atnuf-2 were due to the AtNUFIP gene insertion, we

complemented the mutant lines with a tagged AtNUFIP–HA-

FLAG gene containing all introns and driven from its own

promoter. The complemented mutant plants showed com-

plete rescue of the phenotypes (Figure S2).

Accumulation of C/D snoRNAs from polycistronic genes

are reduced in atnuf mutants

Accumulation of snoRNAs in atnuf-1 and atnuf-2 mutants

was analysed by Northern blots using radiolabelled oligo-

nucleotide probes and total RNAs from wild type and atnuf

seedlings (Figure 6). As a loading control, we measured

tRNAval.

We first tested the accumulation of U14 and other C/D

snoRNAs derived from independent polycistronic clusters.

The U14 probe should detect the four U14 isoforms of the

cluster which are nearly identical. A reduction of 70–80%was

observed for U14 in atnuf-1 and atnuf-2 compared with wild

type plants (Figure 6). Accumulation of snoR22, snoR37 and

snoR23 encoded by two duplicated clusters (Barneche et al.,

2001) were also drastically reduced in atnuf-1 and atnuf-2

(Figure 6). A similar reduction in bothmutants was observed

for dicistronic C/D snoRNAs R16 and U43 (Figure 6) and

C/D snoRNAs U34a, R19, U36.3, R68 and R40 from six other

polycistronic clusters (Figure S3). Complementation of atnuf

mutants with AtNUFIP-FLAG-HA gene completely restored

normal levels of snoRNAs, confirming that their reduction

was specifically due to AtNUFIP gene disruption (Figure S2).

Remarkably, accumulation of snoR80, an H/ACA snoRNA

derived from the same cluster encoding C/D snoR37, snoR22

and snoR23 showed a 1.7–2.2-fold increase. This finding

(a)

(b)

GFP-AtNUFIP At15.5K-RFP Phase contrast OverlayOverlay

GFP-U2B’’ At15.5K-RFP Phase contrast OverlayFigure 4. Confocal microscope analysis of

GFP:AtNUFIP and At15.5K:RFP expressed in

Arabidopsis roots.

(a) Co-expression of At15.5K:RFP and GFP:U2B,

a specific marker of Cajal bodies in plants

(Collier et al., 2006). The large plain arrow and

small dashed arrow indicate the nucleolus and

Cajal bodies respectively.

(b) Co-expression of At15.5K:RFP and GFP:At-

NUFIP in meristematic root tip cells (lower part)

and elongating root cells (upper part). The plain

arrow and white dashed circle indicate the

nucleolus. The dashed small arrow indicates

potential Cajal bodies. White bar, 5 lm.



indicates that the reduction in C/D snoRNA was not due to

reduced accumulation or a maturation defect of the poly-

cistronic precursor in the mutants. This fact was confirmed

by semi-quantitative RT-PCR that showed no difference

in the snoRNA polycistronic precursor level in the mutants

compared with wild type plants (Figure S4).

Few H/ACA snoRNA polycistronic clusters have been

identified in Arabidopsis thaliana. One of these clusters

corresponds to the dicistronic cluster encoding H/ACA

snoR141 and snoR77 (Chen and Wu, 2009). Northern

blot analysis showed that these snoRNAs presented

an approximately two-fold increase in atnuf mutants

(Figure 6).

We then analysed the accumulation of intronic C/D

snoRNAs nested in protein coding genes. The snoR24

(Figure 6) and snoR40 (Figure S4) encoded by two different

intronic cluster showed both a 90% reduction in atnuf

mutants compared with wild type seedlings. A different

situation was observed for the single intronic snoR60

(Barneche et al., 2000) which was not affected in the

mutants (Figure 6).

We also analysed expression of the monocistronic C/D

snoRNAs U3 and U13. Accumulation of both snoRNAs

increased slightly in atnuf-1 and atnuf-2 (Figure 6).

Finally, we tested the accumulation of C/D snoR43.1,

which is processed from a tRNAGly–snoR43 precursor

(Kruszka et al., 2003). Northern blots showed a three- to

four-fold enhancement of snoR43.1 in both atnuf mutants

(Figure 6).

These results show that atnuf mutants present a strong

reduction of C/D snoRNAs derived from polycistronic

precursors which represent the majority of C/D snoRNAs

in plants. The C/D snoRNAs derived from monocistronic,

single intronic or tRNA-snoRNA precursors as well as the

H/ACA snoRNAs show increased accumulation in the

mutants.

(a)

No

silique

No

seed

(b)

(c)

(f)

WT atnuf-1 atnuf-2

WT atnuf-1 atnuf-2

WT atnuf-1 atnuf-2

WT atnuf

(e)

(d)

WT

atnuf-1

WT

atnuf-1

s1

s1

s2

s2

s3

s3

im

im

fm

fm

Figure 5. Phenotypic analysis of atnuf-1 and

atnuf-2 homozygous lines. (a) Growth and leaf

phenotypes. Black arrows highlight pointed

leaves. (b) Phyllotaxy defects. (c) Flower mor-

phology defects. Black arrows point at stamens.

(d) Inflorescence phenotypes of atnuf-1. Inflo-

rescence tips and serial longitudinal sections

(s1–s3) through inflorescence meristems (indi-

cated by a white bar) of wild type (top lanes) and

atnuf-1 (bottom lanes). im corresponds to inflo-

rescence meristem and fm to floral meristem.

Scale dark bar: 30 lm. (e) Longitudinal sections

through pistils of wild-type Col 0 and atnuf-1

plants. Scale bar: 100 lm. (f) Siliques and seeds

production.



Reduction of C/D snoRNAs correlates with rRNA

down-methylation in atnuf mutants

Reduction of methylation guide C/D snoRNAs in atnuf

mutants should impair 2¢-O-ribose methylation of their tar-

get residues. To confirm this finding we analysed the level of

methylation of rRNA residues using primer extension assay

with limiting dNTP substrate (Barneche et al., 2001). Upon

limiting dNTP, the reverse transcriptase becomes sensitive

to the 2¢-O-ribose methylation and generates a premature

stop signal. As a positive control, we assessed the methyl-

ation of 25S:Gm2114 directed by snoR60, which is not

affected in atnufmutants. Under limiting dNTP, a premature

stop signal appeared at the target rRNA residue in wild type

plants (Figure 7a). A similar premature stop signal was

detected on rRNA from atnuf-1 and atnuf-2 showing that

methylation of this residue was not affected in the mutants

(Figure 7a).

We then assessed methylation of 25S:Am2826 directed

by snoR24 that is drastically reduced in mutants. Methyla-

tion of this residue was clearly detected in wild type plants

(Figure 7a). Nevertheless the strong arrest signal under

limiting dNTPs was not observed with atnuf-1 or atnuf-2

rRNAs indicating a drastic reduction of methylation of this

residue (Figure 7a).

We tested methylation of 25S:Gm1260 and 25S:Gm1275

targeted both by C/D snoR22 with has two guide sequences

(Brown et al., 2003b). Methylation of its two targets was

revealed by two strong premature stop signals in wild type

plants (Figure 7a). The snoR22 levels are reduced in the

mutants and there are no premature stops on atnuf-1 and

atnuf-2 rRNAs, revealing a drastic reduction of their meth-

ylation (Figure 7a).

In atnuf mutants U14 was strongly reduced. Considering

that U14 is a conserved C/D snoRNA implicated in pre-rRNA

cleavage in animals (Enright et al., 1996) and yeast (Li et al.,

atnuf-

1

atnuf-

2

R37

U43

R60

R43

U3

tRNA

R23.1

R22

U14

R80

R24

R16

U13

R141

Pol IIR37.2 R22.3a R22.3b R23.2 R80.2

R37.1 R22.1 R23.1 R80.3Pol II

R16 U43

Pol II

R141 R77

Pol II

R77

R24.1 R24.2Pol II

R24.3 R24.4

exon 3 exon 4

R60

Pol II

exon 5 exon 6

U3

Pol III

U13

Pol II

tRNA Val

tRNA R43

Pol III

WT

Pol IIU14.1 U14.2 U14.3 U14.4

1 0.3 0.2

1 0. 1 0.2

1 0.1 0.1

1

1 1.7 2.2

1

1 0.1 0.1

1 2.4 2.6

1 0.1 0.1

1 1.1 1.1

1 1.6 1.8

1 2.1 2.7

1 3.6 4.1

1 1 1

1 11

1 1.7 2.2

At4g29410

At5g52470

Figure 6. Analysis of snoRNA accumulation in

atnuf mutants by Northern blot. Numbers are

the ratio of signal relative to wild type. tRNAval

was used as a loading control. The genomic

organisation of the distinct snoRNAs is shown.

The transcription initiation site is indicated by

angled arrow labelled Pol II or Pol III. Grey and

black arrows correspond to C/D snoRNAs and

H/ACA snoRNAs respectively.



1990), we analysed the accumulation of pre-rRNAs as well as

rRNAs by real time-qRT-PCR in the mutants (Figure 7b).

Specific pair of primers complementary to pre-rRNA spacer

sequences (5¢ETS and ITS1) were designed (Figure 7b). The

analysis showed a 1.5- to two-fold increase for pre-rRNA

precursors inatnufmutants thatprobablyreflects impairment

in pre-rRNA processing due to reduction of U14 (Figure 7b).

Nevertheless, no impact on steady-state levels of mature

rRNA18Sand25Swasobserved inatnufmutants (Figure 7b).

Overall, these results show a significant reduction of the

2¢-O-ribose methylation of rRNA residues targeted by C/D

snoRNAs encoded by polycistronic clusters in atnufmutants,

with no significant effect on total rRNA accumulation.

Accumulation of C/D scaRNAs is reduced in atnuf mutants

The C/D scaRNPs, which direct modification of snRNAs in

Cajal bodies, are related to C/D snoRNPs and contain the

15.5K protein which interacts with NUFIP (Jady and Kiss,

2001; Darzacq et al., 2002). In plants, few scaRNAs have been

identified but their genomic organisation has not been

clearly defined. We tested whether AtNUFIP is also required

for their accumulation.

C/D scaR101, predicted to target methylation of U2

(Marker et al., 2002), is encoded by the opposite strand of

At1g20690, a predicted gene with no protein-coding capac-

ity. Clearly scaR101 is expressed in wild type plants and is

strongly reduced in atnuf-1 and atnuf-2 mutants (Figure 8a).

C/D scaR102 is predicted to target methylation of U5

(Marker et al., 2002) andwas confirmed to be located in plant

Cajal bodies (Kim et al., 2010). It was originally described as

a monocistronic scaRNA. Nevertheless analysis of flanking

genomic sequences reveals a potential C/D scaRX just

upstream of scaR102 and a cDNA (AY045928) of 385

nucleotides encompassing both sequences is reported in

databanks (Figure 8b). A Northern blot with a scaR102 probe

revealed an approximately 160 nucleotide RNA and a longer

transcript of approximately 370 nucleotides (Figure 8b).

Hybridisation with a probe specific to the scaRX sequence

detected only the longer RNA (Figure 8b) revealing that the

potential scaRX is not produced in vivo. These data indicate

that the 370 nucleotides RNA is a stable transcript that

accumulates in vivo and is also a precursor for scaR102 but

not for potential scaRX. This finding is reminiscent of some

scaRNAs described in animals produced from longer tran-

scripts that also accumulate in vivo (Tycowski et al., 2004).

Notably, accumulation of both the scaR102 and the longer

transcript was affected in both atnuf-1 and atnuf-2 (Fig-

ure 8b). This situation confirms the implication of AtNUFIP

G A C U [dNTP]

WT atnuf-1 atnuf-2

G

G

G

A

A

A

U

C

G

U

G

U

C

C

A

A

AAGGGGAATC

UUCCCCUUAGG

AGAC

5′

3′

25S

25S

R60

AGCCAAGCGU

UUCGGUUCGA

AGUC

5′

3′

R24

GAAAUCCGCUGCUUUAGGCGA

AGUC

3′

R2225S

GUGUGUAAACAAGCACACAUUUGUU

AGUC

3′

R2225S

5′

5′

2114

2826

1260

1275

(b)(a)

3′5′ 18S 5.8S 25S

P ITS1 ITS2

12

318S 25S

0

0.5

1

1.5

2

2.5

3

3.5

4

Pair 1 Pair 2 Pair 3 18S 25S

WT

5′ETS 3′ETS

Re

lative

ra

tio

Figure 7. Effect of atnuf mutation on rRNA biogenesis.

(a) Analysis of 2¢-O-ribosemethylation. Reverse transcription was done on total RNA fromwild type and atnufmutants in the presence of decreasing concentrations

of dNTPs. Arrows indicate concentration-dependent premature pauses of reverse transcriptase induced bymethylation. GACU indicates rDNA sequence ladder. The

snoRNA-rRNA duplexes and the targeted residue are shown. Methylated residues are numbered according to the 5¢ ends of the Arabidopsis 25S rRNA (GenBank

accession no. X52322).

(b) Analysis of rRNA accumulation by real time-qRT-PCR. The scheme illustrates the pre-rRNA primary transcript with the coding sequences, flanking spacer

sequences and the positions of primers pairs used. Primer pairs 1, 2 and 3 are designed to specifically amplify pre-rRNA intermediate precursors. P indicates first

cleavage site in the 5¢ETS. Each value represents an average of three biological replicates. Signal values for each PCR product were normalized against two control

mRNAs, actin and GAPA, which are constitutively expressed in Arabidopsis. Results were expressed as relative ratio compared to wild type RNA accumulation

(arbitrary set to 1).



in C/D scaR102 assembly and in the stabilisation of the

longer transcript.

We assessed whether AtNUFIP is required for accumula-

tion of intronic H/ACA scaR103 predicted to target pseudo-

uridylation of U5 (Chen and Wu, 2009; Kim et al., 2010). No

effect was observed in its accumulation in atnuf-1 and atnuf-

2 mutants (Figure 8a).

The 15.5K protein is also a core component of U4 snRNP

and it was proposed that NUFIP could be implicated in its

assembly (Boulon et al., 2008). We tested the accumulation

of U4 in the mutants but no effect was observed (Figure 8c).

Reduction of C/D scaRNAs should lead to down-methyl-

ation of their target snRNAs.We could not test this hypothesis

because the assay requires a large amount of RNA, which

could not be obtained from atnuf mutants. Nevertheless

Northern blot shows that the accumulation of snRNAs is not

affected in atnuf mutants (Figure 8c). This finding suggests

that the predicted reduction of snRNA methylation in atnuf

mutants does not affect snRNA stability.

DISCUSSION

We have identified the AtNUFIP gene in Arabidopsis and

characterized two distinct atnufip mutant lines, revealing

that this gene is essential for plant development. AtNUFIP

directly interacts with At15.5K and is probably implicated in

C/D snoRNP assembly, as revealed by destabilisation of C/D

snoRNAs in atnufip mutants. Most remarkably this study

reveals that the requirement of AtNUFIP for C/D snoRNP

assembly depends on the genomic organisation of C/D

snoRNAs. In addition AtNUFIP is also required for the bio-

genesis of C/D scaRNPs directing methylation of spliceoso-

mal snRNA. These results raise several questions.

AtNUFIP is required for the assembly of snoRNPs and

scaRNPs

AtNUFIP has the conserved PEP motif and interacts with

At15.5K core C/D snoRNP protein in vitro (Figure 3). This

suggests that, similar to NUFIP (McKeegan et al., 2007;

Boulon et al., 2008), AtNUFIP has a chaperone function

facilitating the assembly of C/D snoRNP. The strong reduc-

tion of C/D snoRNAs in atnuf mutants probably results from

defective assembly triggering snoRNA degradation (Fig-

ure 6). Likewise, the reduction of C/D scaRNAs in atnuf

mutants (Figure 8a) is due to impaired scaRNP assembly.

Depletion of NUFIP in HeLa cells leads to an approximate

20% reduction of an H/ACA snoRNA and it was proposed

that it also controls assembly of H/ACA snoRNPs (Boulon

et al., 2008). In plants the direct implication of AtNUFIP in

H/ACA snoRNP assembly seems unlikely considering the

moderate increase of all H/ACA snoRNAs in atnufipmutants

(discussed below).

The lack of effect of atnuf mutants on U4 is intriguing

because the 15.5K protein, which directly interacts with

NUFIP, is a core component of the U4 snRNP in eukaryotes.

R103exon 1 exon 2

R102

At5g57870

eIF4f

RX

R102 probeRX probe

R102WT

atn

uf-1

atn

uf-2

WT

atn

uf-1

atn

uf-2

At1g20690

R101

R101

R103

U1

U2

U4

U5

U6

WT

atnuf-1

atnuf-2

tRNA Val

WT

atnuf-1

atnuf-2

1 0.3 0.4

1 1.1 1.2

1 1 1

1 1.2 1

1 0.9 1.2

1 0.9 1.2

1 0.9 0.9

1 0.9 0.8

(a) (b)

(c)

Probes

R102 gene

RX

~ 160 nt

~370 nt

385 ntcDNA AY045928

Figure 8. Effect of atnuf mutations in scaRNA

and snRNA accumulation.

(a) Genomic organisation and Northern blot

analysis of C/D scaR101 and H/ACA scaR103.

The genomic organisation of the distinct snoR-

NAs is shown. Clear boxes indicate exons from

annotated genes. Grey and black arrows respec-

tively indicate C/D and H/ACA scaRNAs and their

orientation relative to annotated genes.

(b) Genomic organisation and Northern blot of

C/D scaR102. The genomic locus encoding

scaR102 and potential C/D scaRX are indicated

by the arrows.

(c) Northern blot analysis of snRNAs. tRNAval

was used as a control.



However, a similar result was observed for human or

yeast cells depleted of NUFIP or Rsa1 (Boulon et al.,

2008).

AtNUFIP and its role in polycistronic C/D snoRNA

assembly: a kinetic model

An important observation is that AtNUFIP is not essential for

the biogenesis of some C/D snoRNPs. In fact, AtNUFIP

becomes critical only for the accumulation of C/D snoRNAs

processed from polycistronic precursors, either from inde-

pendent or intronic clusters, which represent the vast

majority of plant snoRNAs.

One simple explanation is that AtNUFIP is required to

maintain the normal rate of C/D snoRNP assembly. It has

been proposed that any factor affecting the kinetics of RNP

assembly triggers the degradation of defective RNA (Doma

and Parker, 2007). The specific effect on polycistronic

snoRNAs in atnuf mutants would, therefore, be the result

of a lower assembly rate ofmultiple C/D snoRNPs on a single

pre-snoRNA, leading to incomplete assembly and rapid

degradation of the snoRNA. In this kinetic model, an

important factor is the availability of core proteins and other

auxiliary factors. Assembly is known to occur on the nascent

pre-snoRNAs and is tightly linked to transcription and

processing (Ballarino et al., 2005; Darzacq et al., 2006; Hirose

et al., 2006). This factor defines a ‘physical and temporal

pre-snoRNA nascent space’ in which the assembly and core

factors could become limiting on a polycistronic precursor

because several complexes have to be assembled con-

comitantly.

Probably, AtNUFIP also facilitates the assembly on

‘monocistronic’ snoRNAs in vivo but its implication is

masked in atnuf mutants. Indeed the monocistronic U3

and U13 snoRNA as well as snoR43 derived from dicis-

tronic tRNA-snoRNA are increased in atnuf mutants

(Figure 6). One explanation is that, as snoRNPs derived

from polycistronic precursors are not longer assembled,

C/D core component or other auxiliary factors would be

more available for assembly of the C/D snoRNP on

monocistronic units. An alternative explanation is that

the massive degradation of polycistronic snoRNAs in atnuf

mutants diverts the RNA degradation machinery and this

situation would result in a stabilisation of monocistronic

C/D snoRNAs. Similar explanations could be invoked for

the increase of H/ACA snoRNAs observed in the mutants

considering the possibility that common factors could be

implicated in the biogenesis of C/D and H/ACA snoRNAs

(Rodor et al., 2010).

AtNUFIP sub-cellular localisation and the assembly

of snoRNPs in plants

Where does assembly of snoRNP occur? In plants, pre-

snoRNA polycistronic precursors have been detected by

in situ hybridisation in the Cajal bodies and in the nucleolus

(Shaw et al., 1998). Thus, some assembly steps that are

linked to pre-snoRNAprocessing could occur in any, or both,

of these compartments in plants. Localisation of the GFP–

AtNUFIP fusion in transgenic plants shows diffuse fluores-

cence in the nucleoplasm, with bright foci in the nucleolar

periphery (Figure 4b). This peripheral region could corre-

spond to the granular component of the nucleolus where the

last steps of rRNA processing and assembly of ribosomes

occurs. The distribution of At15.5K-RFP is different: it is

concentrated in the centre of the nucleolus and in Cajal

bodies (Figure 4a). GFP–AtNUFIP partially colocalizes with

At15.5K-RFP in the nucleolar periphery, suggesting that

some steps of snoRNP biogenesis could occur at the

nucleolar periphery and even inside the nucleolus in plants.

In animals, the Cajal bodies are assembly factories for

both snRNPs and snoRNPs (Narayanan et al., 1999; Verheg-

gen et al., 2002; Qiu et al., 2008). Surprisingly, we never

detected AtNUFIP in Cajal bodies in areas where At15.5K-

RFP (Figure 4b) and scaRNAs (Kim et al., 2010) are found.

This fact is probably due to the very low level of expression

of GFP–AtNUFIP in transgenic plants.

AtNUFIP and development

The atnuf mutants are affected at different steps of plant

development. The phenotypes are roughly similar in both

mutant lines but are much more severe in atnuf-2. Consid-

ering that truncated mRNAs are produced in the mutants,

this fact could be explained by the expression of a truncated

AtNUFIP protein in atnuf-1 (Figure 2). In atnuf-1, the pre-

dicted truncated protein would be nearly full length and

contain an intact PEP motif, while in atnuf-2 it would be

totally ‘disrupted’ and probably degraded.

Developmental defects in atnufmutants could result from

defective ribosomes. The pointed leaf phenotype observed

in young atnuf seedlings (Figure 5) is typical of ribosomal

protein plant mutants (Van Lijsebettens et al., 1994; Weijers

et al., 2001; Degenhardt and Bonham-Smith, 2008).

It is unlikely that defective ribosomes are linked to pre-

rRNA processing defects as steady state levels of mature

rRNAs are not affected in atnuf mutants (Figure 7b). A

similar situation has been reported for the Arabidopsis

Atnuc-l1, Atrtl2 and xrn2 mutants, which are affected in pre-

RNA processing but have no effect on steady-state levels of

mature rRNAs (Kojima et al., 2007; Comella et al., 2008;

Zakrzewska-Placzek et al., 2010).

More probably defective ribosomes in atnuf mutants

could be due to down-methylation of rRNAs. In Arabidopsis,

most C/D snoRNAs are encoded by polycistronic C/D snoR-

NA genes and their reduction in atnuf mutants correlates

with concomitant reduction of themethylation of their target

rRNA residues. Thus, atnuf mutants should present an

important reduction in the global level of rRNA methylation

and this could reduce the translational capacity of the

ribosomes (Esguerra et al., 2008).



Developmental defects of atnufmutants could also be due

to deficient splicing. The atnuf mutants show a drastic

reduction of C/D scaR101 and scaR102. They target respec-

tively methylation of U2:Cm29, which is specific to plants

and drosophila (Huang et al., 2005), and U5:Gm41, con-

served in many species (Massenet et al., 1998). In Xenopus

oocytes and human cells, depletion of U2 modifications

affects the formation of spliceosomes and has an impact on

splicing (Yu et al., 1998; Donmez et al., 2004; Zhao and Yu,

2004). Interestingly, splicing of AtNUFIP truncated mRNA is

affected in the atnuf mutants (Figure 2c). At present, except

for the example of U2, little is known on the effect of snRNA

modification on splicing. The atnufmutants now provide the

opportunity to address this question using a transcriptomic/

sequencing approach.

Future prospectives in AtNUFIP function

Ribosome and splicing defects probably both contribute to

mutant phenotypes, but cannot completely explain the

strong developmental defects of atnuf mutants. Indeed,

whereas the level of reduction of C/D snoRNA and scaRNAs

are comparable in both mutant lines, the developmental

phenotypes are much more severe in atnuf-2. We suspect

that AtNUFIP has additional unidentified RNA substrates

and functions. These should direct the study of AtNUFIP in

the future.

EXPERIMENTAL PROCEDURES

Plant materials and histology studies

Arabidopsis are from the Columbia 0 ecotype. Mutant atnuf-1

(SALK-134962) and atnuf-2 (GABI-680F01) lines were obtained from

the European Arabidopsis Stock Centre (http://arabidopsis.info) and

Gabi-Kat (http://www.gabi-kat.de) respectively. Plant cultures were

done on MS medium under continuous light for in vitro culture and

in soil under a 16:8 h light/dark cycle.

Longitudinal sections of inflorescencemeristems and pistils were

performed as described previously (Carles et al., 2010).

RNA extraction, RT-PCR, qPCR and RLM RACE

Total RNAs were extracted from tissues by the guanidine hydro-

chloride method (Logeman et al., 1987). For RNA extraction from

siliques, the Invisorb spin plant RNA mini kit (Invitek, http://

www.invitek.eu) was used. RNA samples were then treated with

RQ1 RNase-free DNase (Promega, http://www.promega.com). For

PCR substrates, cDNA was produced using the StrataScript First

Strand Synthesis System (Stratagene, http://www.genomics.agilent.

com). RLM RACE to map AtNUFIP mRNA extremities used the

FirstChoice RLM RACE kit (Ambion, http://www.ambion.com), with

total RNA from 15-day-old seedlings.

For real-time PCR, cDNAs were obtained from RNAs extracted

from 14 to 18-day-old seedlings using random primers. Real-time

PCR was performed using Light Cycler 480 SYBR Green I Master

(Roche, http://www.roche.com) using the following parameters:

start cycle: 95�C for 10 min; amplification: 45 cycles of

95�C · 10 sec, 65�C · 10 sec, 72�C · 20 sec; cycle for melting

curve: 95�C · 5 min, 65�C · 1 min, increase to 97�C with a slope

of 0.11 sec; cooling at 40�C for 30 sec, then stop. Amplification was

performed in triplicate for three independent biological samples.

Actin and GAPA genes were used as an internal standardisation

controls.

Northern blot

Total RNAs from 14 to 18-day-old seedlings were separated on a 7%

acrylamide–8.3M urea gel, transferred to membrane (Hybond N+;

Amersham, http://www.gelifesciences.com) and UV light cross-

linked. Membranes were incubated overnight with [32P]-5¢end-

labelled oligonucleotide probe at 37�C in 6· SSC, 5· DENHARDT’S,

1% SDS, 100 lg ml)1 salmon sperm DNA. Membranes were

washed 15 min at 37�C and 15 min at 42�C in 6· SSC, 1% SDS then

twice at 42�C in 1· SSC and 1% SDS. After exposure, membranes

were scanned with a STORM 860 (Molecular Dynamics, http://

www.moleculardynamics.com) and signals quantified in compari-

son to tRNAVal.

Plasmids

AtNUFIP coding sequence was amplified from the pENTRY221-

At5g18440 clone (ABRC) and At15.5K-3 (At4g22380) from a seedling

cDNA library. The GFP::AtNUFIP and At15–5K::RFP were obtained

using the Gateway system (Invitrogen, http://www.invitrogen.com).

For complementation of mutants, the AtNUFIP genomic sequence

from 1 kb upstream of the transcription initiation site to the end of

the coding sequence were cloned in frame into a 2·FLAG::2·HA-

pCAMBIA 1300 vector.

Creation of transgenic lines expressing fluorescent

proteins and localization

Stable transgenic plants expressing the AtNUFIP and At15.5K fluo-

rescence fusions were produced by Agrobacterium-mediated

transformation using the floral dip method (Walkerpeach and

Velten, 1994). Plants expressing U2B¢¢-GFP (Collier et al., 2006) were

provided by Dr P. Shaw (John Innes Institute, Norwich).

Complementation of atnufmutants with AtNUFIP-FLAG-HA

Atnuf-1 and atnuf-2 heterozygous mutants were transformed

with promAtNUFIP::AtNUFIP-FLAG-HA construct using Agrobacte-

rium-mediated floral dip method. The stable insertion of the

AtNUFIP-FLAG-HA transgene was confirmed by PCR genotyping.

Accumulation of AtNUFIP-FLAG–HA protein was confirmed by

Western blot using anti-HA-HRP antibody (Sigma, http://www.

sigmaaldrich.com).

Yeast two-hybrid assay

AtNUFIP and At15.5K-3 (At4g22380) ORFs were cloned in framewith

the activator or binding Gal4 domains in pGAD.T7 and pGBK.T7

vectors (Clontech, http://www.clontech.com). The Saccharomyces

cerevisiae strain YRG2 (Stratagene), carrying a Gal4-based yeast

two-hybrid reporter system, was transformed by lithium chloride

treatment (Gietz et al., 1992). Yeast cells were plated on minimal

YNB medium with required amino acids with (control) or without

(Y2H assay) histidine and grown at 30�C for 6 days.

GST pull down assay

GST-At15.5K-3 and GST proteins were produced in Escherichia coli

BL21 and purified using the BULK GST Purification Modules kit (GE

Healthcare, http://www.gehealthcare.com). [35S] Met-AtNUFIP was

synthesized with the PROMEGA TNT Coupled Reticulocyte Lysate

System. Binding was performed with 10 lg of GST-At15.5K-3 or

GST in 50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 5 mM MgCl2, 0.1 mM

EDTA, 0.1% NP-40, 2 mM DTT, 1 mM PMSF, 2 mM benzamidine,



1 lg ml)1 leupeptin, 1 lg ml)1 pepstatine and 10% glycerol. After

three washes using the same buffer, bound proteins were eluted

in Laemmli buffer and separated by SDS-PAGE. Labelled proteins

were visualized by a Storm 860 (Molecular Dynamics).

Mapping 2¢-O-ribose methylation on rRNAs

To map 2¢-O-ribose methylation, primer extension was performed

on 1.5 lg of total RNA with 5¢end-labeled oligonucleotides and two

concentrations of dNTPs (1 mM or 0.004 mM). The sequencing

ladder was performed with the same primer on the corresponding

DNA sequence as template.

List of oligonucleotides

All primer and oligonucleotide probes are given in Table S1.

ACKNOWLEDGEMENTS

We would like to thank Dr E. Bertrand and Dr. J. Saez-Vasquez for

helpful discussions, Dr R. Cooke for correcting the English, Dr Peter

Shaw for providing us the 35S:U2B¢¢–GFP Arabidopsis seeds and

Dr D. Pontier for the gift of the FLAG-HA pCAMBIA 1300 vector. We

are also grateful to Dr H. Murakami and the Global COE program

from Nagoya University for supporting J.R. stage in Japan. This

work was supported by a grant to J.R. from the Ministere de

l’Enseignement et de la Recherche and the Project CNRS-JSPS

2008–2009, no. PRC449.

SUPPORTING INFORMATION

Additional Supporting Information may be found in the online

version of this article:

Figure S1. (A) Alignment of At15.5K proteins. (B) RT-PCR analysis of

expression of At15.5K genes.

Figure S2. Complementation of atnuf-1 and atnuf-2 mutants with

tagged AtNUFIP-FLAG–HA.

Figure S3. Northern blot analysis of additional polycistronic snoR-

NAs in atnuf mutants.

Figure S4. Semi-quantitative RT-PCR analysis of polycistronic

snoRNA precursor in atnuf mutants.

Table S1. Primers used for the RT-PCR and RLM-RACE analysis and

oligonucleotides used for Northern blot hybridization.

Please note: As a service to our authors and readers, this journal

provides supporting information supplied by the authors. Such

materials are peer-reviewed and may be re-organized for online

delivery, but are not copy-edited or typeset. Technical support

issues arising from supporting information (other than missing

files) should be addressed to the authors.

REFERENCES

Allmang, C., Kufel, J., Chanfreau, G., Mitchell, P., Petfalski, E. and Tollervey,

D. (1999) Functions of the exosome in rRNA, snoRNA and snRNA synthesis.

EMBO J. 18, 5399–5410.

Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W.

and Lipman, D.J. (1997) Gapped BLAST and PSI-BLAST: a new generation

of protein database search programs. Nucleic Acids Res. 25, 3389–3402.

Bachellerie, J.P., Cavaille, J. and Huttenhofer, A. (2002) The expanding

snoRNA world. Biochimie, 84, 775–790.

Bailey, T.L. and Elkan, C. (1994) Fitting a mixture model by expectation

maximization to discovermotifs in biopolymers. Proc. Int. Conf. Intell. Syst.

Mol. Biol. 2, 28–36.

Ballarino, M., Moranto, M., Pagano, F., Fatica, A. and Bozzoni, I. (2005) The

cotranscriptional assembly of snoRNPs controls the biosynthesis of H/ACA

snoRNAs in Saccharomyces cerevisiae. Mol. Cell. Biol. 25, 5396–5403.

Barbezier, N., Canino, G., Rodor, J., Jobet, E., Saez-Vasquez, J., Marchfelder,

A. and Echeverrıa, M. (2009) Processing of a dicistronic trna-snorna pre-

cursor: combined analysis in vitro and in vivo reveals alternate pathways

and coupling to assembly of snoRNP. Plant Physiol. 150, 1598–1610.

Bardoni, B., Willemsen, R., Weiler, I.J., Schenck, A., Severijnen, L., Hindelang,

C., Lalli, E. and Mandel, J. (2003) NUFIP1 (nuclear FMRP interacting protein

1) is a nucleocytoplasmic shuttling protein associated with active syna-

ptoneurosomes. Exp. Cell Res. 289, 95–107.

Barneche, F., Steinmetz, F. and Echeverrıa, M. (2000) Fibrillarin genes encode

both a conserved nucleolar protein and a novel small nucleolar RNA

involved in ribosomal RNA methylation in Arabidopsis thaliana. J. Biol.

Chem. 275, 27212–27220.

Barneche, F., Gaspin, C., Guyot, R. and Echeverrıa, M. (2001) Identification of

66 box C/D snoRNAs in Arabidopsis thaliana: extensive gene duplications

generated multiple isoforms predicting new ribosomal RNA 2¢-O-methyl-

ation sites. J. Mol. Biol. 311, 57–73.

Boulon, S., Marmier-Gourrier, N., Pradet-Balade, B. et al. (2008) The Hsp90

chaperone controls the biogenesis of L7Ae RNPs through conserved

machinery. J. Cell Biol. 180, 579–595.

Brown, J.W.S., Echeverria, M. and Qu, L.H. (2003a) Plant snoRNAs: functional

evolution and new modes of gene expression. Trends Plant Sci. 8, 42–49.

Brown, J.W.S., Echeverria, M., Qu, L., Lowe, T.M., Bachellerie, J., Huttenho-

fer, A., Kastenmayer, J.P., Green, P.J., Shaw, P. and Marshall, D.F. (2003b)

Plant snoRNA database. Nucleic Acids Res. 31, 432–435.

Cabart, P., Chew, H.K. and Murphy, S. (2004) BRCA1 cooperates with NUFIP

and P-TEFb to activate transcription by RNA polymerase II. Oncogene, 23,

5316–5329.

Carles, C., Ha, C., Jun, J., Fiume, E. and Fletcher, J. (2010) Analyzing shoot

apical meristem development. Methods Mol. Biol. 655, 105–129.

Cavaille, J., Hadjiolov, A.A. and Bachellerie, J.P. (1996) Processing of mam-

malian rRNA precursors at the 3¢ end of 18S rRNA. Identification of cis-

acting signals suggests the involvement of U13 small nucleolar RNA. Eur.

J. Biochem. 242, 206–213.

Chen, H. and Wu, S. (2009) Mining small RNA sequencing data: a new

approach to identify small nucleolar RNAs in Arabidopsis. Nucleic Acids

Res. 37, e69.

Collier, S., Pendle, A., Boudonck, K., van Rij, T., Dolan, L. and Shaw, P. (2006)

A distant coilin homologue is required for the formation of cajal bodies in

Arabidopsis. Mol. Biol. Cell, 17, 2942–2951.

Comella, P., Pontvianne, F., Lahmy, S., Vignols, F., Barbezier, N., Debures, A.,

Jobet, E., Brugidou, E., Echeverria, M. and Saez-Vasquez, J. (2008)

Characterization of a ribonuclease III-like protein required for cleavage

of the pre-rRNA in the 3’ETS in Arabidopsis. Nucleic Acids Res. 36, 1163–

1175.

Darzacq, X., Jady, B.E., Verheggen, C., Kiss, A.M., Bertrand, E. and Kiss, T.

(2002) Cajal body-specific small nuclear RNAs: a novel class of 2¢-O-

methylation and pseudouridylation guide RNAs. EMBO J. 21, 2746–2756.

Darzacq, X., Kittur, N., Roy, S., Shav-Tal, Y., Singer, R.H. and Meier, U.T.

(2006) Stepwise RNP assembly at the site of H/ACA RNA transcription in

human cells. J. Cell Biol. 173, 207–218.

Degenhardt, R.F. and Bonham-Smith, P.C. (2008) Arabidopsis ribosomal

proteins RPL23aA and RPL23aB are differentially targeted to the nucleolus

and are desperately required for normal development. Plant Physiol. 147,

128–142.

Doma, M.K. and Parker, R. (2007) RNA quality control in eukaryotes. Cell, 131,

660–668.

Dong, X., Biswas, A., Suel, K.E., Jackson, L.K., Martinez, R., Gu, H. and Chook,

Y.M. (2009) Structural basis for leucine-rich nuclear export signal recog-

nition by CRM1. Nature, 458, 1136–1141.

Donmez, G., Hartmuth, K. and Luhrmann, R. (2004) Modified nucleotides

at the 5¢ end of human U2 snRNA are required for spliceosomal E-complex

formation. RNA, 10, 1925–1933.

Enright, C.A., Maxwell, E.S., Eliceiri, G.L. and Sollner-Webb, B. (1996) 5’ETS

rRNA processing facilitated by four small RNAs: U14, E3, U17, and U3.

RNA, 2, 1094–1099.

Esguerra, J., Warringer, J. and Blomberg, A. (2008) Functional importance of

individual rRNA 2¢-O-ribose methylations revealed by high-resolution

phenotyping. RNA, 14, 649–656.

Gietz, D., St Jean, A., Woods, R.A. and Schiestl, R.H. (1992) Improvedmethod

for high efficiency transformation of intact yeast cells. Nucleic Acids Res.

20, 1425.

Hirose, T., Ideue, T., Nagai, M., Hagiwara, M., Shu, M. and Steitz, J.A. (2006) A

spliceosomal intron binding protein, IBP160, links position-dependent



assembly of intron-encoded box C/D snoRNP to pre-mRNA splicing. Mol.

Cell, 23, 673–684.

Huang, Z., Zhou, H. and Qu, L. (2005) Maintaining a conserved methylation in

plant and insect U2 snRNA through compensatory mutation by nucleotide

insertion. IUBMB Life, 57, 693–699.

Jady, B.E. and Kiss, T. (2001) A small nucleolar guide RNA functions both in

2¢-O-ribose methylation and pseudouridylation of the U5 spliceosomal

RNA. EMBO J. 20, 541–551.

Kim, S.H., Spensley, M., Choi, S.K., Calixto, C.P.G., Pendle, A.F., Koroleva, O.,

Shaw, P.J. and Brown, J.W.S. (2010) Plant U13 orthologues and orphan

snoRNAs identified by RNomics of RNA from Arabidopsis nucleoli.Nucleic

Acids Res. 38, 3054–3067.

Kiss, T., Marshallsay, C. and Filipowicz, W. (1991) Alteration of the RNA

polymerase specificity of U3 snRNA genes during evolution and in vitro.

Cell, 65, 517–526.

Kojima, H., Suzuki, T., Kato, T. et al. (2007) Sugar-inducible expression of the

nucleolin-1 gene of Arabidopsis thaliana and its role in ribosome synthesis,

growth and development. Plant J. 49, 1053–1063.

Kruszka, K., Barneche, F., Guyot, R., Ailhas, J., Meneau, I., Schiffer, S.,

Marchfelder, A. and Echeverrıa, M. (2003) Plant dicistronic tRNA-snoRNA

genes: a new mode of expression of the small nucleolar RNAs processed

by RNase Z. EMBO J. 22, 621–632.

Lee, C.Y., Lee, A. and Chanfreau, G. (2003) The roles of endonucleolytic

cleavage and exonucleolytic digestion in the 5¢-end processing of S. cere-

visiae box C/D snoRNAs. RNA, 9, 1362–1370.

Li, H.D., Zagorski, J. and Fournier, M.J. (1990) Depletion of U14 small nuclear

RNA (snR128) disrupts production of 18S rRNA in Saccharomyces cerevi-

siae. Mol. Cell. Biol. 10, 1145–1152.

Logeman, J., Shell, J. and Willmitzer, L. (1987) Improved method for the

isolation of RNA from plant tissues. Anal. Biochem. 163, 16–20.

Marker, C., Zemann, A., Terhorst, T., Kiefmann, M., Kastenmayer, J.P., Green,

P., Bachellerie, J., Brosius, J. and Huttenhofer, A. (2002) Experimental

RNomics: identification of 140 candidates for small non-messenger RNAs

in the plant Arabidopsis thaliana. Curr. Biol. 12, 2002–2013.

Massenet, S., Mougin, A. and Branlant, C. (1998) Posttranscriptional

modifications in the U small nuclear RNAs. In Modification and Editing of

RNA (Grosjean, H. and Benne, R., eds). Washington DC: ASM Press, pp.

201–228.

Matera, A.G., Terns, R.M. and Terns, M.P. (2007) Non-coding RNAs: lessons

from the small nuclear and small nucleolar RNAs. Nat. Rev. Mol. Cell Biol.

8, 209–220.

Maxwell, E.S. and Fournier, M.J. (1995) The small nucleolar RNAs. Annu. Rev.

Biochem. 64, 897–934.

McKeegan, K.S., Debieux, C.M., Boulon, S., Bertrand, E. and Watkins, N.J.

(2007) A dynamic scaffold of pre-snoRNP factors facilitates human box C/D

snoRNP assembly. Mol. Cell. Biol. 27, 6782–6793.

McKeegan, K.S., Debieux, C.M. and Watkins, N.J. (2009) Evidence that the

AAA+ proteins TIP48 and TIP49 bridge interactions between 15.5K and the

related NOP56 and NOP58 proteins during box C/D snoRNP biogenesis.

Mol. Cell. Biol. 29, 4971–4981.

Narayanan, A., Speckmann, W., Terns, R. and Terns, M.P. (1999) Role of the

box C/D motif in localization of small nucleolar RNAs to coiled bodies and

nucleoli. Mol. Biol. Cell, 10, 2131–2147.

Qiu, H., Eifert, J., Wacheul, L. et al. (2008) Identification of genes that function

in the biogenesis and localization of small nucleolar RNAs in Saccharo-

myces cerevisiae. Mol. Cell. Biol. 28, 3686–3699.

Rodor, J., Letelier, I., Holuigue, L. and Echeverria, M. (2010) Nucleolar RNPs:

from genes to functional snoRNAs in plants. Biochem. Soc. Trans. 38, 672–

676.

Shaw, P.J., Beven, A.F., Leader, D.J. and Brown, J.W. (1998) Localization and

processing from a polycistronic precursor of novel snoRNAs in maize.

J. Cell Sci. 111, 2121–2128.

Tycowski, K.T., Aab, A. and Steitz, J.A. (2004) Guide RNAs with 5¢caps and

novel box C/D snoRNA-like domains for modification of snRNAs in meta-

zoan. Curr. Biol. 23, 1985–1995.

Van Hoof, A., Lennertz, P. and Parker, R. (2000) Yeast exosome mutants

accumulate 3’-extended polyadenylated forms of U4 small nuclear RNA

and small nucleolar RNAs. Mol. Cell. Biol. 20, 441–452.

Van Lijsebettens, M., Vanderhaeghen, R., De Block, M., Bauw, G., Villarroel,

R. and Van Montagu, M. (1994) An S18 ribosomal protein gene copy at the

Arabidopsis PFL locus affects plant development by its specific expression

in meristems. EMBO J. 13, 3378–3388.

Verheggen, C., Lafontaine, D.L.J., Samarsky, D., Mouaikel, J., Blanchard, J.,

Bordonne, R. and Bertrand, E. (2002) Mammalian and yeast U3 snoRNPs

are matured in specific and related nuclear compartments. EMBO J. 21,

2736–2745.

Walkerpeach, C. and Velten, J. (1994) Agrobacterium-mediated gene transfer

to plant cells: cointegrate and binary vector systems. Plant Mol. Biol. Man.

1, 1–19.

Watkins, N.J., Segault, V., Charpentier, B., Nottrott, S., Fabrizio, P., Bachi, A.,

Wilm, M., Rosbash, M., Branlant, C. and Luhrmann, R. (2000) A common

core RNP structure shared between the small nucleoar box C/D RNPs and

the spliceosomal U4 snRNP. Cell, 103, 457–466.

Weijers, D., Franke-van Dijk, M., Vencken, R.J., Quint, A., Hooykaas, P. and

Offringa, R. (2001) An Arabidopsis minute-like phenotype caused by a

semi-dominant mutation in a RIBOSOMAL PROTEIN S5 gene. Develop-

ment, 128, 4289–4299.

Yu, Y.T., Shu, M.D. and Steitz, J.A. (1998) Modifications of U2 snRNA are

required for snRNP assembly and pre-mRNA splicing. EMBO J. 17, 5783–

5795.

Zakrzewska-Placzek, M., Souret, F.F., Sobczyk, G.J., Green, P.J. and Kufel, J.

(2010) Arabidopsis thaliana XRN2 is required for primary cleavage in the

pre-ribosomal RNA. Nucleic Acids Res. 38, 4487–4502.

Zhao, X. and Yu, Y. (2004) Pseudouridines in and near the branch site

recognition region of U2 snRNA are required for snRNP biogenesis and

pre-mRNA splicing in Xenopus oocytes. RNA, 10, 681–690.



j. rodor, e. jobet, j. bizarro, f. vignols, c.c. carles, t. suzuki, k. nakamura, m. echeverria...

Documents