expression and localization of hepcidin in macrophages: a role in host defense against tuberculosis

Expression and localization of hepcidin in macrophages:a role in host defense against tuberculosis

Fatoumata B. Sow,*,† William C. Florence,*,† Abhay R. Satoskar,*,† Larry S. Schlesinger,†,‡,§

Bruce S. Zwilling,*,† and William P. Lafuse†,‡,1

Departments of *Microbiology, ‡Molecular Virology, Immunology and Medical Genetics, and §Internal Medicine,Division of Infectious Diseases, and †Center for Microbial Interface Biology, The Ohio State University, Columbus,Ohio, USA

Abstract: Hepcidin is an antimicrobial peptideproduced by the liver in response to inflammatorystimuli and iron overload. Hepcidin regulates ironhomeostasis by mediating the degradation of theiron export protein ferroportin 1, thereby inhibit-ing iron absorption from the small intestine andrelease of iron from macrophages. Here, we exam-ined the expression of hepcidin in macrophagesinfected with the intracellular pathogens Mycobac-terium avium and Mycobacterium tuberculosis.Stimulation of the mouse RAW264.7 macrophagecell line and mouse bone marrow-derived macro-phages with mycobacteria and IFN-� synergisti-cally induced high levels of hepcidin mRNA andprotein. Similar results were obtained using thehuman THP-1 monocytic cell line. Stimulation ofmacrophages with the inflammatory cytokines IL-6and IL-� did not induce hepcidin mRNA expres-sion. Iron loading inhibited hepcidin mRNA ex-pression induced by IFN-� and M. avium, and ironchelation increased hepcidin mRNA expression.Intracellular protein levels and secretion of hepci-din were determined by a competitive chemilumi-nescence ELISA. Stimulation of RAW264.7 cellswith IFN-� and M. tuberculosis induced intracellu-lar expression and secretion of hepcidin. Further-more, confocal microscopy analyses showed thathepcidin localized to the mycobacteria-containingphagosomes. As hepcidin has been shown to pos-sess direct antimicrobial activity, we investigatedits activity against M. tuberculosis. We found thathepcidin inhibited M. tuberculosis growth in vitroand caused structural damage to the mycobacteria.In summary, our data show for the first time thathepcidin localizes to the phagosome of infected,IFN-�-activated cells and has antimycobacterialactivity. J. Leukoc. Biol. 82: 934–945; 2007.

Key Words: innate immunity � cytokines � antimicrobial peptides

INTRODUCTION

Mycobacteria are engulfed by macrophages through phagocy-tosis and reside within the phagosomes of these cells [1, 2].

Antimycobacterial activity is mediated primarily by CD4� andCD8� T cells through the secretion of cytokines, which in-crease the antimicrobial activity of macrophages [3, 4]. IFN-�is the major regulator of the immune response to mycobacteria[5, 6]. Activation of macrophages by IFN-� in mice induces theexpression of NO synthase 2 (NOS2), resulting in the produc-tion of NO, which leads to killing of the intracellular myco-bacteria [7]. IFN-� also promotes the fusion of the mycobac-teria-containing phagosome with late endosomal vesicles andlysosomal vesicles [8, 9], resulting in the delivery of lysosomalenzymes to the phagosome and the acidification of the phago-some.

Iron is essential for the growth and survival of mycobacteria,but it is also involved in host macrophage defense by catalyzingthe production of toxic hydroxyl radicals via the Haber-Weiss/Fenton reactions [10, 11]. During infection, a competition foriron occurs between the host macrophage and the pathogen.The macrophage attempts to suppress pathogen proliferation bycomplex, iron-withholding mechanisms. Activation of macro-phages by IFN-� results in a decrease in macrophage ironcontent, ferritin levels, and expression of the transferrin recep-tor [12–15]. In response, Mycobacterium tuberculosis, presentin activated macrophages, increases the expression of theiron-binding siderophores, mycobactin and carboxymycobac-tin, which are involved in binding and transporting iron [16–19].

The effectors of innate immunity also include antimicrobialpeptides [20], which are found in prokaryotes, plants, andanimals and have broad activities against bacteria and fungi.Hepcidin, originally identified as a 25-amino acid antimicro-bial peptide present in serum and urine [21, 22], is producedfrom a propeptide precursor by liver hepatocytes during theacute-phase response. Recent studies have shown that hepci-din also acts as a negative regulator of iron absorption by theduodenum [23, 24] and inhibits release of recycled iron bymacrophages [25]. Studies by Nemeth et al. [26] have shownthat hepcidin binds to ferroportin 1, which is the sole ironexport protein in mammalian cells, and mediates its internal-

1 Correspondence: Department of Molecular Virology, Immunology andMedical Genetics, The Ohio State University, 333 W. 10th Ave., Columbus,OH 43210, USA. E-mail: [email protected]

Received April 10, 2007; revised June 6, 2007; accepted June 7, 2007.doi: 10.1189/jlb.0407216

934 Journal of Leukocyte Biology Volume 82, October 2007 0741-5400/07/0082-934 © Society for Leukocyte Biology

ization and degradation, resulting in a decrease in iron release.Thus, knockout of hepcidin gene expression in mice resulted iniron overload resembling hemochromatosis [27], and overex-pression of hepcidin in transgenic mice resulted in severe irondeficiency anemia and death at birth [28].

Expression of hepcidin mRNA is induced in human hepa-tocytes by IL-6 and LPS [29, 30] and in mouse hepatocytes, byIL-1 and IL-6 [31]. In vivo, liver hepcidin mRNA is up-regulated following injection of mice with LPS, turpentine, andCFA [32–34]. Liver hepcidin mRNA expression is also in-creased by iron overload [34] and decreased by anemia in-duced by bleeding or hemolysis [33]. A recent study [35]reported that infection of mouse bone marrow-derived macro-phages (BMDM) with the extracellular pathogens Pseudomonasaeruginosa and group A Streptococcus induced hepcidin mRNAexpression in macrophages. However, no similar studies havebeen done with intracellular pathogens of macrophages. Theprevious study also did not determine if macrophage activationby IFN-� regulates hepcidin expression or the localization ofhepcidin within the macrophage. We investigated the expres-sion of hepcidin mRNA and protein in Mycobacterium avium-and M. tuberculosis-infected macrophages. We demonstratethat mycobacteria infection and IFN-� stimulation synergisti-cally induce high levels of hepcidin mRNA and protein in themacrophage. We also show that hepcidin is present in the M.tuberculosis-containing phagosomes and that at least in vitro,hepcidin can inhibit M. tuberculosis growth. Thus, these stud-ies indicate that hepcidin production by infected macrophagesis an IFN-�-induced host defense mechanism against infectionwith mycobacteria.

MATERIALS AND METHODS

Mycobacteria

M. avium strain Mac101 [American Type Culture Collection (ATCC) 70998]and M. tuberculosis H37Rv strain (ATCC 27294) were obtained from ATCC(Manassas, VA, USA). M. avium was cultured in Middlebrook 7H9 mediasupplemented with oleic acid-albumin-dextrose-catalase (OADC; Difco, De-troit, MI, USA) and stored in 1 ml aliquots in 10% glycerol at –70°C until used.Lyophilized M. tuberculosis H37Rv was reconstituted in pyogen-free water(Sigma Chemical Co., St. Louis, MO, USA), plated on 7H11 agar plates, andincubated at 37°C in 5% CO2 for 14 days, and bacterial suspensions weregenerated as described [36]. �-Irradiated M. tuberculosis (Colorado StateUniversity, Fort Collins, CO, USA; National Institutes of Health ContractNIAID-N01-AI-40091) was resuspended in PBS, briefly sonicated, and cen-trifuged at 800 rpm for 10 min to eliminate clumped bacteria. The proteinconcentration in the supernatant was determined by the Bradford protein assay(Bio-Rad, Hercules, CA, USA).

Cell cultures

The RAW264.7 mouse macrophage cell line (TIB-71) was plated at 5 � 106

cells per well in six-well culture plates containing DMEM supplemented with10% FBS (Atlanta Biologicals, Lawrenceville, GA, USA) and penicillin-streptomycin. The macrophages were allowed to adhere for 4 h at 37°C in 5%CO2 in air. The nonadherent cells were washed away with DMEM withoutantibiotics, and the macrophage monolayers were infected with M. avium strainMac101 or with live M. tuberculosis H37RV at a ratio of 10:1, bacterium:macrophage. Macrophage monolayers were also stimulated with 200 U/mlmouse IFN-� (Roche, Indianapolis, IN, USA), with and without mycobacteriainfection. RAW264.7 cells were also stimulated with IFN-� in combinationwith 100 �g/ml �-irradiated M. tuberculosis H37Rv. In other experiments,

RAW264.7 cells were also stimulated with the proinflammatory cytokines IL-6,IL-1�, and TNF-� at 10 ng/ml (Alpha Diagnostic, San Antonio, TX, USA) incombination with M. avium infection. For iron-loading experiments,RAW264.7 cells were pretreated for 1 h with Fe-nitrilotriacetate (FeNTA;molar ratio 1:4), prepared from FeCl3 and sodium NTA (Sigma Chemical Co.)before stimulation with IFN-� and �-irradiated M. tuberculosis. For ironchelation experiments, the RAW264.7 cells were pretreated with the ironchelator desferrioxamine (Sigma Chemical Co.) for 1 h prior to stimulation.

A RAW264.7 cell line, constitutively expressing Flag-tagged hepcidinunder control of the CMV promoter, was created by cloning full-length hep-cidin cDNA into the pCMV-3Tag 8 expression vector (Stratagene, La Jolla, CA,USA). The sequence of the hepcidin cDNA was confirmed by DNA sequencing.RAW264.7 cells were transfected with the plasmid using Lipofectamine (In-vitrogen, Carlsbad, CA, USA). Stable clones were obtained by hygromycinselection and limiting dilution cloning. High expressing clones were identifiedby confocal microscopy as described below using the M2 anti-Flag mAb (SigmaChemical Co.) and Alexa 488-coupled F(ab�)2 goat anti-mouse IgG antibody(Invitrogen) as the secondary antibody.

The human THP-1 monocytic cell line (ATCC TIB-202) was plated at 5 �106 cells per well in six-well culture plates containing RPMI 1640, supple-mented with 10% heat-inactivated FBS and penicillin-streptomycin at 37°C in5% CO2 for 2 h. The cells were then infected with live M. tuberculosis H37Rvat a ratio of 20:1, bacterium:macrophage, and stimulated with 200 units/mlhuman IFN-� (Roche).

BMDM

Cells were isolated from the marrow of femurs and tibias of C57/BL6J mice.The cells were plated in complete DMEM, supplemented with 10 ng/mlGM-CSF (Peprotech, Rocky Hill, NJ, USA). After 3 and 5 days of culture, 50%and 75% of the medium was removed and replaced with fresh medium,supplemented with GM-CSF, respectively. Mature, adherent BMDM wereharvested after 7 days of culture and subjected to stimulation with M. avium,IFN-�, or a combination of IFN-� and M. avium for 24 h.

RNA isolation

RAW264.7 macrophages were lysed using Qiagen lysis buffer and 2-ME andhomogenized by passing the cell lysates through QiaShredders (Qiagen, Va-lencia, CA, USA). The RNA was then isolated using the RNeasy mini kit. RNAwas isolated from THP-1 and BMDM using the High Pure RNA isolation kit(Roche). Residual DNA was removed during RNA purification by on-columnDNase digestion in both procedures.

Quantitative RT-PCR

Total RNA (1 �g) was reverse-transcribed using 100 �M dNTPs, 15 unitsavian myloblastosis virus reverse transcriptase, and 0.5 �g oligo(dT)15 primerin RT buffer for 1 h at 42°C (Promega, Madison, WI, USA). The expression ofmouse hepcidin 1 and GAPDH mRNA was analyzed by real-time RT-PCR inthe Roto-gene 2000 real-time cycler (Phenix Research Products, Candler, NC,USA) using FastStart DNA SYBR Green I reaction mix (Roche). The primersequences are mouse GAPDH: GTGTGAACGGATTTGGCCGTATTGGGCG(sense) and TCGCTCCTGGAAGATGGTGATGGGC (antisense); mouse �-ac-tin: TACAGCTTCACCACCACAGC (sense) and AAGGAAGGCTGGAAAA-GAGC (antisense); mouse hepcidin 1: GCAGAAGAGAAGGAAGAGAGA-CACC (sense) and TGTAGAGAGGTCAGGATGTGGCTC (antisense); humanGAPDH: GAAGGTGAAGGTCGGAGTC (sense) and GAAGATGGTGATGG-GATTTC (antisense); human hepcidin: GCACTGAGCTCCCAGATCTG (sense)and CTACGTCTTGCAGCACATCC (antisense). The primers were designed usingMacVector primer software (Accelrys, San Diego, CA, USA). Specificity of primerswas confirmed by GenBank Blast searches. Mice express two duplicated hepcidingenes, hepc1 and hepc2 [34]. hepc2 has only 58% identity with hepc1 and does notappear to be involved in regulating iron metabolism. Primers were designed toamplify hepcidin 1 cDNA and not hepcidin 2 cDNA. The amplification conditionswere 95°C for 10 min followed by 40 cycles of 95°C for 15 s, 60°C for 5 s, and72°C for 20 s. The relative expression of each sample was calculated using mouseGAPDH as a reference and the �Ct method as described previously [37]. GAPDHmRNA levels were used as the reference mRNA in all experiments, except forexperiments in which RAW264.7 cells were loaded with iron and treated with theiron chelator desferrioxamine. �-Actin was used as the reference mRNA in these

Sow et al. Hepcidin expression in mycobacteria-infected macrophages 935

experiments. Preliminary experiments showed that GAPDH mRNA levels in-creased when macrophages were treated with desferrioxamine. �-Actin mRNAlevels were not changed by iron-loading or iron chelation.

Hepcidin-competitive chemiluminescence ELISA

RAW264.7 cells in six-well culture plates were stimulated for 24 h with IFN-�(200 units/ml), 100 �g/ml �-irradiated M. tuberculosis, and the combination ofIFN-� and �-irradiated M. tuberculosis in serum-free DMEM. Hepcidin se-creted into the culture media and intracellular hepcidin were measured by acompetitive chemiluminescence ELISA with biotinylated mouse hepcidin (Al-pha Diagnostic). To measure cellular hepcidin expression, the RAW264.7cells were harvested by scraping and then pelleted by centrifugation. The cellswere lysed on ice for 10 min with 1% Triton X-100 in PBS with proteaseinhibitor cocktail tablets (Roche), and the cell debris was removed by centrif-ugation for 10 min at 14,000 rpm. Protein concentration of the lysate wasdetermined using the Bradford method (Bio-Rad). The ELISA was performedby coating white ELISA plates overnight at 4°C with 100 �l per well 1 �g/mlaffinity-purified rabbit anti-mouse hepcidin IgG (Alpha Diagnostic) in coatingbuffer (Alpha Diagnostic). The plates were washed three times with washingbuffer (PBS, 0.050% Tween-20) and incubated with blocking solution, I-Block(Applied Biosystems, Foster City, CA, USA), in PBS, 0.050% Tween-20, for1 h at room temperature. Blocking solution was removed, and 50 �l per wellsamples and standards (0–10 pg/ml hepcidin) diluted in blocking buffer wasadded to the plate. After 1 h incubation at room temperature, 50 �l 5 ng/mlbiotinylated mouse hepcidin (Alpha Diagnostic) in blocking buffer was addedto each well, and the plate was incubated for an additional hour at roomtemperature. The plate was washed three times with washing buffer. To detectthe bound, biotinylated hepcidin, 100 �l avidin/biotin-AP solution (ABCReagent, Vector Laboratories, Burlingame, CA, USA) was added to each welland plate, incubated for 1 h at room temperature. The plate was washed fourtimes in washing buffer and once in 1� assay buffer. The substrate (CDP-Starwith Sapphire II enhancer, Applied Biosytems), 50 �l/well, was added to theplate and incubated for 10 min at room temperature. The plate was then readusing a microplate luminometer (Packard, Meriden, CT, USA). The concen-tration of hepcidin in the samples was determined by regression analysis of thestandard curve.

Confocal microscopy

RAW264.7 cells were plated on coverslips in 24-well plates at 5.0 � 105

cells/well and stimulated with IFN-� and M. tuberculosis at 2:1, bacteria:macrophage. The cells were fixed in 4% paraformaldehyde in PBS for 20min, washed twice with PBS, and then permeabilized with 0.1% TritonX-100 in PBS for 10 min and washed twice with PBS. Monolayers wereincubated in blocking solution (1% BSA, 10% heat-inactivated goat serum,in PBS) for 3 h at room temperature. To detect hepcidin, affinity-purifiedrabbit anti-mouse hepcidin (20 –25 hepc; Alpha Diagnostic), raised againstthe C terminus of the mature, 25 amino acid hepcidin, was used. ResidualM. tuberculosis-reactive antibodies were removed by two rounds of absorp-tion with �-irradiated M. tuberculosis for 1 h at 4°C prior to use. Antibodieswere added at 1:200 in blocking solution for 3 h at room temperature,followed by extensive washing with 0.5% BSA in PBS and detection withAlexa 488-coupled F(ab�)2 goat anti-rabbit IgG antibody (Invitrogen). Todetect mycobacteria in infected RAW264.7 cells, coverslips were stainedwith auramine-rhodamine (Difco), counterstained with 5% potassium per-manganate as described by Ferguson et al. [38], and followed by detectionof hepcidin by immunofluorescence as described above. The exclusion ofprimary antibody was used as a negative control. A second negative controlconsisted of the hepcidin antibody preabsorbed with the mature, 25-aminoacid peptide. Coverslips were removed from 24-well plates and mounted onslides with Prolong mounting medium (Invitrogen). Fluorescence was vi-sualized by cross-sectional confocal microscopy using a Zeiss LSM 510confocal microcscope. The percentage of phagosomes positive for hepcidinwas determined by counting 25–50 phagosomes. Intensity of the greenimmunofluorescence was measured from images using Sigma ScanProimage analysis software (SPSS Science, Chicago, IL, USA).

To determine the localization of hepcidin to the phagosome in RAW264.7cells constitutively expressing hepcidin, the RAW-264.7-hepcidin-Flag cellline was plated onto coverslips and infected with live M. tuberculosis for 2 h.The coverslips were then processed for confocal microscopy as described

above. M. tuberculosis was detected by auramine-rhodamine staining andFlag-tagged hepcidin with the M2 anti-Flag mAb (1:500; Sigma Chemical Co.)and Alexa 488-coupled F(ab�)2 goat anti-mouse IgG antibody (Invitrogen) asthe secondary antibody.

Antimicrobial assay for hepcidin

The 25-amino acid form of hepcidin (Alpha Diagnostics) was tested forantimicrobial activity against M. tuberculosis by incubating various concentra-tions of this peptide (20, 50, 100, and 200 �g/ml) with 1 � 104 M. tuberculosisH37Rv at 37°C in 100 �l 7H9 broth. At 6 and 72 h, viable bacteria wereassessed by culturing serial dilutions onto Middle-brook 7H11 agar plates(Becton Dickinson, San Jose, CA, USA), supplemented with OADC (BectonDickinson). Colonies were counted after 21 days at 37°C.

Transmission electron microscopy (TEM)

M. tuberculosis H37Rv bacteria were plated at 1 � 108 in 100 �l 7H9 broth,with or without hepcidin (200 �g/ml), in 24-well culture plates. After 24 h, thecell suspensions were centrifuged at 10,000 g for 15 min, washed with PBS,and resuspended in fixative (3% glutaraldehyde and 4% paraformaldehyde in0.1 M cacodylate buffer at pH 7.2) overnight at 4°C. The next day, the cellswere washed three times in sodium cacodylate buffer, postfixed in 1% osmiumtetroxide, and en bloc-stained in 1% uranyl acetate for 90 min. The cells werethen dehydrated in gradient ethanol (45 min at 50%, 45 min at 70%, 50 minat 80%, 1 h at 95%, and 90 min with three changes at 100%), followed bytreatment with propylene oxide and covering with polybed and propylene oxide(2:1) overnight. The samples were then embedded in polybed resin for 20 h at60°C, followed by thin sectioning at 70 nm using a Leica EM UC6 ultramic-rotome and staining in 2% uranyl acetate and Reynold’s lead citrate. Thesamples were then observed and photographed in a FEI Technai Spirit TEM at80 kV.

Statistics

Results were analyzed by one-way ANOVA with Tukey’s test and t-test usingSigmaSTAT (SPSS Science).

RESULTS

Induction of macrophage hepcidin mRNAexpression by mycobacteria and IFN-�

We examined the mRNA expression of hepcidin in macro-phages infected with M. avium and M. tuberculosis. Figure 1shows that IFN-� and M. avium strain Mac101 synergisticallyinduced production of hepcidin mRNA in RAW264.7 macro-phages (Fig. 1A). The increase in hepcidin mRNA expressionwas apparent at 12 h after stimulation with IFN-� and M.avium. A 100-fold increase in hepcidin mRNA was observed at24 h. Infection with M. avium alone induced low levels ofhepcidin mRNA (threefold increase at 24 h), and treatmentwith IFN-� alone did not induce any significant changes in theexpression of hepcidin mRNA. The synergistic effect observedwas dependent on the IFN-� concentration and the M. aviumdose used. Maximal effect was reached at a dose of 200units/ml (Fig. 1B) and a M. avium ratio of 20:1 (Fig. 1C).Heat-killed M. avium was as effective as live bacteria ininducing hepcidin mRNA expression, and phagocytosis of la-tex beads had no effect (data not shown).

The results in Figure 1D show that IFN-� and M. avium alsosynergistically produced hepcidin mRNA in mouse BMDM.The combination of IFN-� and M. avium induced a 40-foldincrease in hepcidin mRNA.

936 Journal of Leukocyte Biology Volume 82, October 2007 http://www.jleukbio.org

Live M. tuberculosis H37Rv and IFN-� also synergisticallyinduced hepcidin mRNA expression in RAW264.7 macro-phages (Fig. 2 A and B). The results in Figure 2A show thelevel of hepcidin mRNA expression after 24 h, and those inFigure 2B show the effect of increasing doses of M. tuberculo-sis. Overall, M. tuberculosis induced high levels of hepcidinmRNA expression. M. tuberculosis alone induced a hepcidinmRNA level, which was 25–50 times higher than control cells.The combination of IFN-� and M. tuberculosis increased thelevels to 250–500 times greater than control cells. Synergy wasalso observed in RAW264.7 cells stimulated with IFN-� and�-irradiated M. tuberculosis (Fig. 2, C and D). We alsoobserved similar synergy in the induction of hepcidin by�-irradiated M. tuberculosis and IFN-� using the mousemacrophage cell line J774A.1 and mouse BMDM (notshown). To determine if M. tuberculosis and IFN-� inducehepcidin mRNA in human cells, we examined the expres-sion of hepcidin mRNA in the human monocytic cell lineTHP1. As shown in Figure 2E, live M. tuberculosis andIFN-� induced hepcidin mRNA in THP1 cells.

Hepcidin mRNA in macrophages is not inducedby proinflammatory cytokines or iron overload

As hepcidin mRNA expression is induced in human hepatocytesby IL-6 and LPS [29, 30] and in mouse hepatocytes by IL-1 andIL-6 [31], we determined if these proinflammatory cytokines in-duce hepcidin mRNA in mouse macrophages. The results inFigure 3 show that IL-1� and IL-6 do not induce hepcidinmRNA in RAW264.7 macrophages. Hepcidin mRNA was alsonot induced by TNF-�. IL-1� and IL-6 did significantly increasehepcidin mRNA induced by M. avium. However, the effect ofthese cytokines on hepcidin mRNA in M. avium-infected macro-phages was much less than observed with IFN-� (Fig. 1).

We observed that the addition of iron in RAW264.7 macrophagesinhibited the induction of hepcidin mRNA by M. tuberculosis �IFN-�, and iron chelation increased hepcidin mRNA expression(Fig. 4). These effects of iron and iron chelation occurred only in M.tuberculosis � IFN-�-treated RAW264.7 cells. Addition of iron aloneor the iron chelator desferrioxamine alone to RAW264.7 cells had noeffect on hepcidin mRNA expression (not shown).

Fig. 1. IFN-� and M. avium synergistically induce hepcidin mRNA expression. (A) Time-course experiment in which RAW264.7 macrophages were stimulated withIFN-� (200 U/ml), M. avium infection (10:1 ratio), and IFN-� � M. avium. (B) IFN-� dose-response experiment. RAW264.7 macrophages were stimulated with M. avium(10:1) and the indicated doses of IFN-� for 24 h. (C) M. avium dose experiment. RAW264.7 macrophages were stimulated with IFN-� and M. avium for 24 h. (D) BMDMwere isolated from C57BL/6J mice as described in Materials and Methods and stimulated with IFN-� (200 U/ml), M. avium infection (30:1 ratio), and IFN-� � M. avium(M.a). Total RNA was extracted, and hepcidin mRNA was detected by real-time RT-PCR. The hepcidin mRNA expression levels were normalized to GAPDH mRNA levelsand expressed as fold induction relative to untreated RAW264.7 cells. The data represent the mean SD of three separate experiments.


Detection of hepcidin protein in activatedmacrophages by a competitive ELISA

We determined if IFN-� and mycobacteria induced the ap-pearance of hepcidin protein in macrophages using a compet-

itive chemiluminescence ELISA. The antibody used to detecthepcidin is an affinity-purified rabbit anti-mouse hepcidinproduced by immunization with a 13-amino acid peptide lo-cated in the C terminus of the mature, 25-amino acid form ofmouse hepcidin. In the competitive ELISA, the antibody wascoated onto the wells of a 96-well plate, and hepcidin levelswere determined by competition of standards and samples withbiotinylated hepcidin; hepcidin protein expression was in-creased in cell lysates of RAW264.7 cells stimulated with�-irradiated M. tuberculosis (Fig. 5A). The highest level ofhepcidin protein expression (160 pg hepcidin/mg protein)was observed in RAW264.7 cells stimulated with �-irradiatedM. tuberculosis and IFN-�. Stimulation with �-irradiated M.tuberculosis and IFN-� also resulted in the secretion of up to 50pg/ml hepcidin by the macrophage (Fig. 5B).

Hepcidin is present in mycobacteria-containingphagosomes

The expression of hepcidin was examined in RAW264.7 cellsinfected with M. tuberculosis by cross-sectional, confocal mi-croscopy (Fig. 6). As CFA was used in the production of theantihepcidin rabbit antibody (Alpha Diagnostic, personal com-munication), the antibody was absorbed with �-irradiated M.tuberculosis to remove any M. tuberculosis-reactive antibodies,which may have remained after affinity purification. The ab-sorbed antibody was negative against M. tuberculosis by West-ern blot analysis with M. tuberculosis SDS lysates and negativeby immunofluorescence of M. tuberculosis adhered to cover-slips (data not shown). Hepcidin was not detected in untreated

Fig. 2. IFN-� and M. tuberculosis synergistically in-duce hepcidin mRNA expression. (A) RAW264.7 mac-rophages were infected with M. tuberculosis (M.tb; 10:1)and stimulated with IFN-� (200 U/ml) for 24 h. (B) M.tuberculosis dose response. RAW264.7 macrophageswere infected with M. tuberculosis and stimulated withIFN-� for 24 h. (C) Time-course experiment using�-irradiated M. tuberculosis. RAW264.7 macrophageswere stimulated with �-irradiated (irra.) M. tuberculosis(100 �g protein/ml) and IFN-� (200 U/ml). (D) Doseresponse using �-irradiated M. tuberculosis at the indi-cated protein concentrations. RAW264.7 macrophageswere stimulated with �-irradiated M. tuberculosis and

IFN-� for 24 h. (E) Induction of hepcidin mRNA in human THP1 cells, which were infected with M. tuberculosis (20:1) and 200 units/ml human IFN-� for 24 h.(A–D) Total RNA was extracted, and hepcidin mRNA was detected by real-time RT-PCR using primers specific for mouse hepcidin and GAPDH. Mean SD ofthree separate experiments. (E) Primers specific for human hepcidin and GAPDH were used. The hepcidin mRNA expression levels were normalized to GAPDHmRNA levels and expressed as fold induction relative to untreated cells.

Fig. 3. Induction of hepcidin in macrophages by cytokines. RAW264.7macrophages were stimulated with 10 ng/ml IL-1�, IL-6, TNF-�, and M. aviuminfection (10:1 ratio) and a combination of cytokines and M. avium for 24 h.Total RNA was extracted, and hepcidin mRNA was detected by real-timeRT-PCR. The hepcidin mRNA expression levels were normalized to GAPDHmRNA levels and expressed as fold-induction relative to untreated RAW264.7cells. The data represent the mean SD of three separate experiments. *,IL-1� and IL-6 significantly increased hepcidin mRNA levels induced by M.avium; P � 0.05 by ANOVA when compared with M. avium.


cells (Fig. 6A) or in cells treated with IFN-� alone (Fig. 6B).Figure 6C shows the results when macrophages were stimu-lated with live M. tuberculosis alone. In Figure 6D, the mac-rophages were stimulated with M. tuberculosis and IFN-�. M.tuberculosis was detected by staining the coverslips with aura-mine-rhodamine [38] prior to detection of hepcidin by immu-nofluorescence. Hepcidin was highly localized to the phago-some. In the RAW264.7 cells stimulated with M. tuberculosisand IFN-�, punctate staining was also observed outside of thephagosome (Fig. 6D). The intensity of green immunofluores-cence in the phagosome was significantly higher in cells stim-ulated with M. tuberculosis and IFN-� (Fig. 6D) compared withcells stimulated with M. tuberculosis alone (Fig. 6C). Thefluorescence intensity of phagosomes in macrophages stimu-lated with M. tuberculosis � IFN-� was 3.47 0.33 � 104

green fluorescence intensity units/phagosome compared with1.44 0.12 � 104 green fluorescence intensity units/phago-some for phagosomes in macrophages infected with M. tuber-culosis alone (P�0.001). Pretreatment of the hepcidin antibodywith the 25-amino acid hepcidin peptide blocked the fluores-cence detection of hepcidin (Fig. 6E). There was also no greenfluorescence detected in control experiments in whichRAW264.7 cells treated with M. tuberculosis � IFN-� wereincubated with the secondary antibody only (not shown).

Localization of hepcidin to M. tuberculosis phagosomes wasalso examined in time-course experiments. RAW264.7 wereinfected with M. tuberculosis and IFN-� for 0, 4, 8, 16, and24 h, and hepcidin expression was examined by confocalmicroscopy (Fig. 7A). Hepcidin begins to localize to thephagosome by 4 h (Fig. 7B). Approximately 80% of the phago-somes were positive for hepcidin by 8 h after infection. Hep-cidin expression was quantified by measuring the green immu-nofluorescence intensity of hepcidin-positive phagosomes (Fig.7C). The intensity increased with infection. Peak levels were

obtained at 16 and 24 h, consistent with the increase inhepcidin mRNA levels at these time-points.

To establish further that hepcidin localizes to the phagosomefollowing infection with M. tuberculosis, hepcidin epitopetagged with Flag at the C terminus was stably expressed inRAW264.7 cells. Expression of the hepcidin in the transfectedcells was examined by confocal microscopy using mouse anti-Flag mAb. The cells constitutively express high levels ofhepcidin-Flag in intracellular vesicles (Fig. 8A). After infec-tion with M. tuberculosis, the hepcidin-Flag localized to thephagosome (Fig. 8B). Thus, our studies indicate that hepcidinredistributes to the phagosome during infection.

Hepcidin has direct, antibacterial activity againstM. tuberculosis

As hepcidin has antibacterial activity against a number ofmicroorganisms [21, 22], we determined if hepcidin has anti-

Fig. 4. Addition of iron to IFN-� � M. tuberculosis-stimulated macrophagesinhibits hepcidin mRNA expression, and iron chelation increases expression.RAW264.7 macrophages were incubated with FeNTA and the iron chelatordesferrioxamine for 1 h prior to stimulation with IFN-� (200 U/ml) and�-irradiated M. tuberculosis (100 �g/ml) for 24 h. Total RNA was extracted,and hepcidin mRNA was detected by real-time RT-PCR. The hepcidin mRNAexpression levels were normalized to �-actin mRNA levels and expressed asfold induction relative to untreated RAW264.7 cells. The data represent themean SD of three separate experiments. Addition of iron decreased hepcidinmRNA expression significantly; P � 0.001 by ANOVA. Iron chelation in-creased hepcidin mRNA expression significantly; P � 0.001 by ANOVA.

Fig. 5. Effect of M. tuberculosis and IFN-� on hepcidin protein expression byRAW264.7 cells, which in serum-free media, were stimulated for 24 h withIFN-� (200 units/ml) and �-irradiated M. tuberculosis (100 �g/ml). Hepcidinwas detected in cell lysates (A) and culture media (B) by a competitivechemiluminescent ELISA. Results are the mean SD of two experiments.Hepcidin levels in cell lysates were increased significantly in RAW264.7 cellsstimulated with M. tuberculosis (*, P�0.001, t-test) and the combination of M.tuberculosis and IFN-� (*, P�0.001, t-test) compared with control cells.Hepcidin, secreted into the culture media, was increased significantly bytreatment with M. tuberculosis and IFN-� (*, P�0.05, t-test) compared withcontrol cells.


bacterial against M. tuberculosis in vitro. The 25-amino acidhepcidin peptide was incubated with M. tuberculosis in 7H9broth. At 6 and 72 h, the effect of hepcidin on M. tuberculosisviability was determined by CFU. As shown in Table 1,

treatment of M. tuberculosis with hepcidin for 6 h reducedCFUs, and CFUs of M. tuberculosis were reduced by 50%compared with control, untreated M. tuberculosis at the highestconcentration of hepcidin used. The effect of hepcidin on M.

Fig. 6. Localization of hepcidin to the M. tuberculosis phagosome. RAW264.7 cells were infected with M. tuberculosis and stimulated with 200 units/ml IFN-�for 24 h. Representative confocal microscopy images of control, untreated RAW264.7 cells (A), RAW264.7 cells stimulated with IFN-� alone (B), RAW264.7 cellsinfected with M. tuberculosis alone (C), and RAW264.7 cells infected with M. tuberculosis and stimulated with IFN-� (D). Hepcidin was detected in permeablizedcells with rabbit anti-mouse hepcidin antibody. M. tuberculosis was detected by staining with auramine-rhodamine prior to immunofluorescence detection. Thesecondary antibody was Alexa 488-conjugated F(ab�)2 goat anti-rabbit IgG. (E) Control experiment in which the rabbit anti-mouse hepcidin was absorbed with themature, 25-amino acid hepcidin peptide prior to fluorescence microscopy. Results are representative of three experiments.


tuberculosis was also observed after 72 h. M. tuberculosis CFUsat 72 h of the hepcidin treatment were comparable with CFUsat 6 h. In contrast, CFUs of the control cultures of M. tuber-culosis at 72 h increased by 30% compared with the number ofCFUs at 6 h. To determine if hepcidin also damaged themycobacteria structurally, we examined M. tuberculosis byTEM. We examined 481 control M. tuberculosis bacteria incu-bated in media only and 416 M. tuberculosis bacteria incubatedwith hepcidin for 24 h. In the hepcidin-treated M. tuberculosis,39% of the mycobacteria visualized had lost their normalarchitecture (disruption of membrane and loss of cytosol) com-pared with only 7.9% in the control. Representative TEMphotographs are shown in Figure 9.

DISCUSSION

Hepcidin acts as a hormone to maintain iron homeostasis byinhibiting intestinal iron absorption [22, 33] and the macro-

phage release of iron [25, 39]. Hepcidin is produced rapidly bythe liver in mice in response to inflammatory stimuli, LPS,Freund adjuvant, and turpentine [29, 32, 33, 40]. Hepcidin isalso produced by the liver following in vivo iron loading, andanemia and hypoxia lead to a decrease in production [30, 33].Bacterial induction of hepcidin expression in mouse macro-phages and neutrophils following infection with P. aeruginosaand group A Streptococcus has been reported recently by Pey-ssonnaux et al. [35]. Other studies showed that LPS inducedhepcidin mRNA in mouse macrophages [41, 42]. However,these studies focused on extracellular pathogens of macro-phages and LPS and did not examine effects of IFN-� onhepcidin production induced by bacterial infection. Here, wereport that hepcidin is also produced in mouse macrophagesinfected with intracellular mycobacteria. Furthermore, wefound that high levels of hepcidin mRNA and protein areinduced in the RAW264.7 mouse macrophage cell line andBMDM infected with M. avium or M. tuberculosis and stimu-lated with IFN-�. Mycobacteria and IFN-� acted synergisti-

Fig. 7. Time course of the localization of hepcidin to the M. tuberculosis phagosome. RAW264.7 cells were infected with M. tuberculosis and stimulated with 200units/ml IFN-� for 0, 4, 8, 16, and 24 h. (A) Representative confocal images. Hepcidin was detected with rabbit anti-mouse hepcidin antibody and Alexa488-conjugated F(ab�)2 goat anti-rabbit IgG secondary antibody. M. tuberculosis was detected by staining with auramine-rhodamine prior to immunofluorescencedetection. (B) Quantitative analysis of the percentage of M. tuberculosis phagosomes containing hepcidin. Results are the pooled data from two independentexperiments. (C) Quantitative analysis of the green fluorescence intensity of hepcidin localized to the M. tuberculosis phagosome. The increase in fluorescenceintensity with time was statistically significant by one-way ANOVA; P � 0.01.


cally to induce hepcidin mRNA expression. We also observedthat M. tuberculosis and IFN-� synergistically induced hepci-din mRNA expression in the human monocytic THP1 cell line,indicating that hepcidin mRNA can also be induced in humancells. Heat-killed M. avium and �-irradiated M. tuberculosiswere as effective as live mycobacteria in inducing expression.However, phagocytosis of latex beads in combination withIFN-� did not induce expression of hepcidin mRNA. Thus, ourdata suggest that a component(s) of mycobacteria, rather thanjust phagocytosis itself, induces hepcidin mRNA.

Hepcidin production in mouse hepatocytes is induced byIL-1� and IL-6 [31]. However, we found that IL-1� and IL-6had no effect on hepcidin mRNA expression in RAW264.7macrophages. We did observe an increase in hepcidin mRNAwhen IL-1� or IL-6 was added to RAW264.7 cells with M.avium infection. However, the effect of IL-1� and IL-6 wasmuch less than that observed with IFN-�. Conditioned mediafrom macrophages stimulated with LPS have been shown toinduce hepcidin expression in hepatocytes [29, 30]. However,we have found that conditioned media from RAW264.7 mac-rophages treated with M. avium and IFN-� did not inducehepcidin mRNA in fresh RAW264.7 cells (data not shown).This suggests that cytokines released from the activated mac-rophages are not responsible for induction of hepcidin mRNAexpression in mouse macrophages. These results also suggestthat expression of hepcidin mRNA is differentially regulated inmacrophages and hepatocytes.

Expression of hepcidin mRNA is also differentially regu-lated following iron loading. Previous studies have shown thatliver hepcidin mRNA is increased by iron loading [34]. How-ever, we have found that iron has an opposite effect on mac-rophage hepcidin mRNA expression. Incubation of RAW264.7cells with iron decreased hepcidin mRNA expression induced

Fig. 8. Hepcidin localizes to the M. tuberculosis phagosome in RAW264.7 cells, constitutively expressing high levels of Flag epitope-tagged hepcidin.RAW-hepcidin-Flag cells were infected with live M. tuberculosis for 2 h. Hepcidin-Flag was detected with anti-Flag mAb and Alexa 488-conjugated F(ab�)2 goatanti-mouse IgG secondary antibody. M. tuberculosis was detected by staining with auramine-rhodamine prior to immunofluorescence detection. (A) Representativeconfocal images of hepcidin-Flag expression in unstimulated cells. (B) Representative images of hepcidin-Flag in M. tuberculosis-infected cells. Results arerepresentative of two experiments.

TABLE 1. Hepcidin Antimicrobial Assaya

Hepcidinconcentrations (�g/ml)

CFU/ml

6 h 72 h

0 95.5 1.5 132.6 19.120 62.3 10.1b 86.0 0.0b

50 NT 84.0 1.41b

100 72.6 1.5b 66.3 9.9b

200 57.0 4.6b 62.3 3.1b

a Values are CFU � 103 SD pooled from three independent experiments.b P � 0.002 compared with control. NT, Not tested.


by IFN-� and M. tuberculosis, and iron chelation increasedhepcidin mRNA expression. A similar effect of iron on mousemacrophage inducible NOS promoter activity has been re-ported [43]. Thus, the effects of iron on hepcidin expression inmacrophages and hepatocytes may reflect differences in pro-moter activity. The increased hepcidin mRNA in response toiron chelation in macrophages is consistent with studies, whichshow iron chelation inhibits M. tuberculosis growth [44].

The ELISA and immunofluorescence studies show that hep-cidin protein is also induced by IFN-� and mycobacterialinfection. Intracellular hepcidin was detected by ELISA inRAW264.7 cells treated with irradiated M. tuberculosis. Thehighest levels of hepcidin protein were detected in RAW264.7cells, which were also stimulated with IFN-�. Hepcidin is also

secreted by RAW264.7 cells stimulated with M. tuberculosisand IFN-�. Hepcidin protein was also observed in RAW264.7cells infected with live M. tuberculosis alone and in RAW264.7cells treated with M. tuberculosis and IFN-�; the latter condi-tion demonstrated greater fluorescence intensity. In these ex-periments, we found hepcidin to highly localize to the phago-some. Hepcidin was present in the phagosome beginning at 4 hafter infection. Fluorescence intensity increased with time afterinfection and stimulation with IFN-�. This increase in hepci-din protein paralleled the increase in hepcidin mRNA expres-sion. To our knowledge, this is the first report that indicatesthat hepcidin trafficks to the phagosome.

Hepcidin is synthesized as a propeptide precursor, which isthen processed into the 25-amino acid, mature form [22, 45].The hepcidin antibody used in these studies was raised with apeptide from the C terminus of the mature form of hepcidin.Absorption with the 25 amino acid hepcidin peptide removedthe immunofluorescence activity of the antibody, indicating theantibody is reactive with the mature hepcidin peptide. How-ever, the antibody could also potentially react with the propep-tide precursor. Our immunofluorescence microscopy studiesshow a low level of punctate staining throughout the cell,consistent with hepcidin being present in intracellular vesi-cles. Thus, our studies suggest that hepcidin has two pathwaysof trafficking within macrophages: fusion of intracellular vesi-cles with phagosomes, resulting in localization of hepcidinwithin the phagosome, and trafficking to the cell surface,resulting in secretion. At present, we do not know at what stepin the trafficking the hepcidin propeptide precursor is pro-cessed into the mature form.

In macrophages, mycobacteria acquire iron from extracellu-lar sources, including iron bound to transferrin, lactoferrin, andlow molecular weight chelates, and from the intracellular labileiron pool [46, 47]. IFN-� is critical in restricting the growth ofmycobacteria [5, 6]. One of the antimicrobial mechanisms ofIFN-� is its ability to decrease macrophage iron levels. De-creased macrophage iron is thought to result from decreasedtransferrin receptor and ferritin expression induced by IFN-�[12–15, 46]. Our observations, that IFN-� regulates expressionof hepcidin, raise the question of whether this protein has arole in the antimicrobial activity of the IFN-�-activated mac-rophage. Hepcidin was identified, first as an antimicrobialpeptide [21, 22]. To determine if hepcidin has antibacterialactivity against M. tuberculosis, in this study, we incubated M.tuberculosis with hepcidin in vitro. We observed growth inhi-bition of M. tuberculosis at 6 and 72 h. Examination of M.tuberculosis by electron microscopy showed that hepcidincaused lysis of M. tuberculosis, suggesting that hepcidin acts bycausing loss of membrane integrity. This could occur by open-ing pores in the cell membrane of M. tuberculosis through theinsertion of hepcidin into the cell membrane or by hepcidininteracting with transport proteins present in the cell mem-brane. The maximal growth inhibition hepcidin observed atearlier times-points was no greater than 50%. This observationsuggests that M. tuberculosis can repair some of the damagecaused by hepcidin or is able to partially degrade or inactivatehepcidin. The concentration of hepcidin required to maximallyinhibit M. tuberculsosis growth in the in vitro assay is also high(100–200 �g/ml). Whether this concentration is reached in the

Fig. 9. Hepcidin causes lysis of M. tuberculosis, which was incubated for 24 hin 7H9 broth (Control M. tuberculosis) or 7H9 broth with 200 �g/ml hepcidin(Hepcidin treated M. tuberculosis). (A) Representative TEM photograph ofintact M. tuberculosis from the control culture. (B) Representative TEM pho-tograph of M. tuberculosis from the hepcidin-treated culture. Present in B areintact M. tuberculosis and M. tuberculosis, which have lost normal architectureas a result of disruption of membrane and loss of cytosol.


phagosome is unknown. However, in the macrophage, hepcidinmay act in concert with other IFN-�-induced antimicrobialmechanisms and thus, may be more effective at lower concen-trations. Also, the conditions in the phagosome are likely to bemore optimal for killing M. tuberculosis than the in vitroconditions.

During infection, hepcidin is released into the blood by liverhepatocytes and is believed to be responsible for the anemiaassociated with chronic disease and inflammation [48, 49].Tuberculosis is a chronic disease, and anemia is a commoncomplication of pulmonary tuberculosis [50]. Dietary iron over-load has been shown to support the growth of M. tuberculosisand is a risk factor for active tuberculosis [51, 52]. Thesestudies would suggest that hepcidin production is likely to bea factor in the anemia associated with tuberculosis. How muchhepcidin secreted by mycobacteria-infected macrophages con-tributes to levels of hepcidin in the blood is not known. It ismore likely that the effect of hepcidin production by infectedmacrophages would be local, mediating antimicrobial activityand inhibiting iron recycling from dead cells by surroundingmacrophages.

ACKNOWLEDGMENTS

This work was supported by grant RO1DK-57667 from theNational Institutes of Health. We thank Dr. Georg Pongratz,Dr. Travis McCarthy, Gail Alvarez, and Steve Oghumu fortechnical help, Dr.Virginia Sanders for equipment use, andJane Dudek from Roche Applied Science for help with real-time RT-PCR assays.

REFERENCES

1. Schlesinger, L. S. (2004) Phagocytosis and Toll-like receptors in tuber-culosis. In Tuberculosis, 2nd edition (W. M. Rom, S. M. Garay, eds.),Philadelphia, PA, USA, Lippincott, Williams, and Wilkins, 203–204.

2. Fenton, M. J., Riley, L. W., Schlesinger, L. S. (2004) Receptor-mediatedrecognition of Mycobacterium tuberculosis by host cells. In Tuberculosisand Tubercle Bacillus (S. T. Cole, K. D. Eisenach, D. N. McMurray, W R.Jacobs, eds.), Herndon, VA, USA, American Society for Microbiology,405–426.

3. Flynn, J. L., Chan, J. (2001) Immunology of tuberculosis. Annu. Rev.Immunol. 19, 93–119.

4. Collins, H. L., Kaufmann, S. H. E. (2001) The many faces of host responseto tuberculosis. Immunology 103, 1–9.

5. Flynn, J. L., Chan, J., Triebold, K. J., Dalton, D. K., Stewart, T. A., Bloom,B. R. (1993) An essential role for interferon � in resistance in Mycobac-terium tuberculosis infection. J. Exp. Med. 178, 2249–2254.

6. Cooper, A. M., Dalton, D. K., Stewart, T. A., Griffin, J. P., Russell, D. G.,Orme, I. M. (1993) Disseminated tuberculosis in interferon � disruptedmice. J. Exp. Med. 178, 2243–2247.

7. MacMicking, J., Xie, Q-W., Nathan, C. (1997) Nitric oxide and macro-phage function. Annu. Rev. Immunol. 15, 323–350.

8. Schaible, U. E., Strugill-Koszycki, S., Schlesinger, P. H., Russell, D. G.(1998) Cytokine activation leads to acidification and increases maturationof Mycobacterim avium-containing phagosomes in murine macrophages.J. Immunol. 160, 1290–1296.

9. Via, L. E., Fratti, R. A., McFalone, M., Pagen-Ramos, E., Deretic, D.,Deretic, V. (1998) Effects of cytokines on mycobacterial phagosomematuration. J. Cell Sci. 111, 897–905.

10. Crichton, R. R., Wilmet, S., Legssyer, R., Ward, R. J. (2002) Molecularand cellular mechanisms of iron homeostasis and toxicity in mammaliancells. J. Inorg. Biochem. 91, 9–18.

11. Kuhn, D. E., Baker, B. D., Lafuse, W. P., Zwilling, B. S. (1999) Differ-ential iron transport into phagosomes isolated from the RAW264.7 mac-rophage cell lines transfected with Nramp1Gly169 or Nramp1Asp169. J. Leu-koc. Biol. 66, 113–119.

12. Taetle, R., Honeysett, J. M. (1988) �-Interferon modulates human mono-cyte/macrophage transferrin receptor expression. Blood 71, 1590–1595.

13. Byrd, T. F., Horwitz, M. A. (1993) Regulation of transferrin receptorexpression and ferritin content in human mononuclear phagocytes. Coor-dinate upregulation by iron transferrin and downregulation by inter-feron-�. J. Clin. Invest. 91, 969–976.

14. Mulero, V., Block, J. H. (1999) Regulation of iron metabolism in murineJ774 macrophages: role of nitric oxide-dependent and -independent path-ways following activation with � interferon and lipopolysaccharide. Blood94, 2383–2389.

15. Zhong, W., Lafuse, W. P., Zwilling, B. S. (2001) Infection with Mycobac-terium avium differentially regulates the expression of iron transportprotein mRNA in murine peritoneal macrophages. Infect. Immun. 69,6618–6624.

16. Gold, B., Rodriguez, G. M., Marras, M. P., Pentecost, M., Smith, I. (2001)The Mycobacterium tuberculosis IdeR is a dual functional regulator andcontrols transcription of genes involved in iron acquisition, iron storage,and survival in macrophages. Mol. Microbiol. 42, 851–865.

17. De Voss, J. J., Rutter, K., Schroeder, B. G., Barry III, C. E. (1999) Ironacquisition and metabolism by mycobacteria. J. Bacteriol. 181, 4443–4451.

18. Schnappinger, D., Ehrt, S., Voskuil, M. I., Liu, Y., Mangan, J. A.,Monahan, I. M., Dolganov, G., Efron, B., Butcher, P. D., Nathan, C.,Schoolnik, G. K. (2003) Transcriptional adaptation of Mycobacteriumtuberculosis within macrophages: insights into the phagosomal environ-ment. J. Exp. Med. 198, 693–704.

19. Timm, J., Post, F. A., Bekker, L. G., Walther, G. B., Wainwright, C. H.,Manganelli, R., Chan, W. T., Tsenova, L., Gold, B., Smith, I., Kaplan, G.,McKinney, J. D. (2003) Differential expression of iron-, carbon-, andoxygen-responsive mycobacterial genes in the lungs of chronicle infectedmice and tuberculosis patients. Proc. Natl. Acad. Sci. USA 100, 14321–14326.

20. Hancock, R. E., Diamond, G. (2000) The role of cationic antimicrobialpeptides in innate host defences. Trends Microbiol. 8, 402–410.

21. Krause, A., Neitz, S., Magert, H. J., Schulz, A., Forssmann, W. G.,Schulz-Knappe, P., Adermann, K. (2000) LEAP-1, a novel highly disul-fide-bonded human peptide, exhibits antimicrobial activity. FEBS Lett.480, 147–150.

22. Park, C. H., Valore, E. V., Waring, A. J., Ganz, T. (2001) Hepcidin: aurinary antimicrobial peptide synthesized in the liver. J. Biol. Chem. 276,7806–7810.

23. Laftah, A. H., Ramesh, B., Simpson, R. J., Solanky, N., Bahram, S.,Schumann, K., Debnam, E. S., Srai, S. K. S. (2004) Effect of hepcidin onintestinal iron absorption in mice. Blood 103, 3940–3944.

24. Yamaji, S., Sharp, P., Ramesh, B., Srai, S. K. S. (2004) Inhibition of irontransport across human intestinal epithelial cells by hepcidin. Blood 104,2178–2180.

25. Knutson, M. D., Oukka, M., Koss, L. M., Aydemir, F., Wessling-Resnick,M. (2005) Iron release from macrophages after erythrophagocytosis isup-regulated by ferroportin 1 overexpression and down-regulated by hep-cidin. Proc. Natl. Acad. Sci. USA 102, 1324–1328.

26. Nemeth, E., Tuttle, M. S., Powelson, J., Vaughn, M. B., Donovan, A.,McVey Ward, D., Gantz, T., Kaplan, J. (2004) Hepcidin regulates cellulariron efflux by binding to ferroportin and inducing its internalization.Science 306, 2090–2093.

27. Nicolas, G., Bennoun, M., Devaux, I., Beaumont, C., Grandchamp, B.,Kahn, A., Vaulont, S. (2001) Lack of hepcidin gene expression and severetissue iron overload in upstream stimulatory factor 2 (USF2) knockoutmice. Proc. Natl. Acad. Sci. USA 98, 8780–8785.

28. Nicolas, G., Bennoun, M., Porteu, A., Mativet, S., Beaumont, C., Grand-champ, B., Sirito, M., Sawadogo, M., Kahn, A., Vaulont, S. (2002) Severeiron deficiency anemia in transgenic mice expressing liver hepcidin. Proc.Natl. Acad. Sci. USA 99, 4596–4601.

29. Nemeth, E., Rivera, S., Gabayan, V., Keller, C., Taudorf, S., Pedersen,B. K., Ganz, T. (2004) IL-6 mediates hypoferremia of inflammation byinducing the synthesis of the iron regulatory hormone hepcidin. J. Clin.Invest. 113, 1271–1276.

30. Nemeth, E., Valore, E. V., Territo, M., Schiller, G., Lichtenstein, A., Ganz,T. (2003) Hepcidin, a putative mediator of anemia of inflammation, is atype II acute-phase protein. Blood 101, 2461–2463.

31. Lee, P., Peng, H., Gelbart, T., Wang, L., Beutler, E. (2005) Regulation ofhepcidin transcription by interleukin-1 and interleukin-6. Proc. Natl.Acad. Sci. USA 102, 1906–1910.


32. Anderson, G. J., Frazer, D. M., Wilkins, S. J., Becker, E. M., Millard,K. N., Murphy, T. L., McKie, A. T., Vulpe, C. D. (2002) Relationshipbetween intestinal iron-transporter expression, hepatic hepcidin levelsand the control of iron absorption. Biochem. Soc. Trans. 30, 724–726.

33. Nicolas, G., Ghauvet, C., Viatte, L., Danan, J. L., Biggard, X., Devaux, I.,Beaumont, C., Kahn, A., Vaulont, S. (2002) The gene that codes forhepcidin, an iron regulatory hormone, is regulated by anemia, hypoxia,and inflammation. J. Clin. Invest. 110, 1037–1044.

34. Pigeon, C., Ilyin, G., Courselaud, B., Leroyer, P., Turlin, B., Brissot, P.,Loreal, O. (2001) A new mouse liver-specific gene, encoding a proteinhomologous to human antimicrobial peptide hepcidin, is overexpressedduring iron overload. J. Biol. Chem. 276, 7811–7819.

35. Peyssonnaux, C., Zinkernagel, A. S., Datta, V., Lauth, X., Johnson, R. S.,Nizet, V. (2006) TLR-4 dependent hepcidin expression by myeloid cells inresponse to bacterial pathogens. Blood 107, 3727–3732.

36. Schlesinger, L. S. (1993) Macrophage phagocytosis of virulent but notattenuated strains is mediated by mannose receptors in addition to com-plement receptors. J. Immunol. 150, 2920–2930.

37. Livak, K. J., Schmittgen, D. T. (2001) Analysis of relative gene expressiondata using real-time quantitative PCR and the 2–��Ct method. Methods25, 402–408.

38. Ferguson, J. S., Voelker, D. R., Ufnar, J. A., Dawson, A. J., Schlesinger,L. S. (2002) Surfactant protein D inhibition of human macrophage uptakeof Mycobacterium tuberculosis is independent of bacterial agglutination.J. Immunol. 168, 1309–1314.

39. Fleming, R. E., Sly, W. S. (2001) Hepcidin: a putative iron regulatoryhormone relative to hereditary hemochromatosis and the anemia of chronicdisease. Proc. Natl. Acad. Sci. USA 98, 8160–8162.

40. Roy, C. N., Custodio, A. O., deGraaf, J., Schneider, S., Akpan, I., Mon-tross, L. K., Sanchez, M., Gaudino, A., Hentze, M. W., Andrews, N. C.,Muckenthaler, M. U. (2004) An Hfe-dependent pathway mediates hypo-sidermia in response to lipopolysaccharide-induced inflammation in mice.Nat. Genet. 36, 481–485.

41. Liu, X. B., Nguyen, N. H., Marquess, K. D., Yang, F., Haile, D. J. (2005)Regulation of hepcidin and ferroportin expression by lipopolysaccharidein splenic macrophages. Blood Cells Mol. Dis. 35, 47–56.

42. Nguyen, N-B., Callaghan, K. D., Ghio, A. J., Haile, D. J., Yang, F. (2006)Hepcidin expression and iron transport in alveolar macrophages. Am. J.Physiol. Lung Cell. Mol. Physiol. 291, L417–L425.

43. Dlaska, M., Weiss, G. (1999) Central role of transcription factor NF-IL6for cytokines and iron-mediated regulation of murine inducible nitricoxide synthase expression. J. Immunol. 162, 6171–6177.

44. Boelaert, J. R., Vandecasteele, S. J., Appelberg, R., Gordeuk, V. R. (2007)The effect of the host’s iron status on tuberculosis. J. Infect. Dis. 195,1745–1753.

45. Nicolas, G., Viatte, L., Bennoun, M., Beaumont, C., Kahn, A., Vaulont, S.(2002) Hepcidin, a new iron regulatory peptide. Blood Cells Mol. Dis. 29,327–335.

46. Olakanmi, O., Schlesinger, L. S., Ahmed, A., Britigan, B. E. (2002)Intraphagosomal Mycobacterium tuberculosis acquires iron from both ex-tracellular transferrin and intracellular iron pools. Impact of interferon-�and hemochromatosis. J. Biol. Chem. 277, 49727–49734.

47. Olakanmi, O., Schlesinger, L. S., Ahmed, A., Britigan, B. E. (2004) Thenature of extracellular iron influences iron acquisition by Mycobacteriumtuberculosis. Infect. Immun. 72, 2022–2028.

48. Ganz, T. (2003) Hepcidin, a key regulator of iron metabolism and mediatorof anemia of inflammation. Blood 102, 783–788.

49. Weinstein, D. A., Roy, C. N., Fleming, M. D., Loda, M. F., Wolfsdorf, J. I.,Andrews, N. C. (2002) Inappropriate expression of hepcidin is associatedwith iron refractory anemia: implications for the anemia of chronic dis-ease. Blood 100, 3776–3781.

50. Goldenberg, A. S. (1996) Haematological abnormalities and mycobacterialinfections. In Tuberculosis (W. N. Rome, S. Garay, eds,), Boston, MA,USA, Little Brown and Company, 645–652.

51. Gangaidzo, I. T., Moyo, V. M., Mvundura, E., Aggrey, G., Murphree, N. L.,Khumalo, H., Saungweme, T., Kasvosve, I., Gomo, Z. A. R., Rouault, T.,Boelaert, J. R., Gordeuk, V. R. (2001) Association of pulmonary tuber-culosis with increased dietary iron. J. Infect. Dis. 184, 936–939.

52. Lounis, N., Truffot-Pernot, C., Grosset, J., Grodeuk, V. R., Boelaert, J. R.(2001) Iron and Mycobacterium tuberculosis infection. J. Clin. Virol. 20,123–126.


expression and localization of hepcidin in macrophages: a role in host defense against tuberculosis

Documents