early electrical remodeling in rabbit pulmonary vein results from trafficking of intracellular sk2...

75 (2007) 758–769www.elsevier.com/locate/cardiores

Cardiovascular Research

Early electrical remodeling in rabbit pulmonary vein results fromtrafficking of intracellular SK2 channels to membrane sites

Nazira Özgen a,b,1, Wen Dun b,1, Eugene A. Sosunov a,b, Evgeny P. Anyukhovsky a,b,Masanori Hirose b, Heather S. Duffy b, Penelope A. Boyden b, Michael R. Rosen a,b,c,⁎

a Center for Molecular Therapeutics, College of Physicians and Surgeons of Columbia University, New York, New York, United Statesb Department of Pharmacology, College of Physicians and Surgeons of Columbia University, New York, New York, United States

c Department of Pediatrics, College of Physicians and Surgeons of Columbia University, New York, New York, United States

Received 30 January 2007; received in revised form 1 May 2007; accepted 2 May 2007

Time for primary review 19 daysAvailable online 10 May 2007

by guest on June 20, 2016D

ownloaded from

Abstract

Objective: Atrial fibrillation is often initiated by bursts of ectopic activity arising in the pulmonary veins. We have previously shown that a 3-h intermittent burst pacing protocol (BPP), mimicking ectopic pulmonary vein foci, shortens action potential duration (APD) locally at thepulmonary vein–atrial interface (PV) while having no effect elsewhere in rabbit atrium. This shortening is Ca2+ dependent and is preventedby apamin, which blocks small conductance Ca2+-activated K+ channels (SKCa). The present study investigates the ionic and molecularmechanisms whereby two apamin-sensitive SKCa channels, SK2 and SK3, might contribute to the regional APD changes.Methods: Microelectrode and patch clamp techniques were used to record APDs and apamin-sensitive currents in isolated rabbit left atriaand cells dispersed from PV and Bachmann's bundle (BB) regions. SK2 and SK3 mRNA and protein levels were quantified, andimmunofluorescence was used to observe channel protein distribution.Results: There was a direct relationship between APD shortening and apamin-sensitive current in burst-paced but not sham-paced PV.Moreover, apamin-sensitive current density increased in PV but not BB after BPP. SK2 mRNA, protein, and current were increased in PVafter BPP, while SK2 immunostaining shifted from a perinuclear pattern in sham atria to predominance at sites near or at the PV membrane.Conclusions: BPP-induced acceleration of repolarization in PV results from SK2 channel trafficking to the membrane, leading to increasedapamin-sensitive outward current. This is the first indication of involvement of Ca2+-activated K+ currents in atrial remodeling and provides apossible basis for evolution of an arrhythmogenic substrate.© 2007 European Society of Cardiology. Published by Elsevier B.V. All rights reserved.

Keywords: Arrhythmias; Ion channels; K channels

1. Introduction

Pulmonary vein–atrial junctions are important sites ofectopy that induces atrial fibrillation (AF) [1,2]. The paroxysmsof AF alter atrial electrical properties in a manner that promoteAF initiation and maintenance— a process called electrophys-

⁎ Corresponding author. College of Physicians and Surgeons of ColumbiaUniversity, Department of Pharmacology, 630 West 168 Street, PH 7West-321,NewYork,NY10032,United States. Tel.: +1 212 305 8754; fax: +1 212 305 8351.

E-mail address: [email protected] (M.R. Rosen).1 Contributed equally to this study.

0008-6363/$ - see front matter © 2007 European Society of Cardiology. Publishdoi:10.1016/j.cardiores.2007.05.008

iologic remodeling [3]. The major electrophysiologic char-acteristics of this remodeling are a reduction in the atrialeffective refractory period and loss of its adaptation to ratechanges [3–5]. In animal models, remodeling is produced bycontinuous high rate pacing through electrodes located atarbitrary atrial sites. Yetwe previously reported that early stagesof the remodeling process (within hours) depend critically notonly on rate but on site and pattern of ectopic activity [6]. In thisstudy of isolated rabbit atria, we noted that a 3 h intermittentburst pacing protocol mimicking ectopic foci in pulmonaryveins alters the atrial repolarization gradient by shorteningaction potential duration (APD) locally at the pulmonary vein–

ed by Elsevier B.V. All rights reserved.

mailto:[email protected]

http://dx.doi.org/10.1016/j.cardiores.2007.05.008

759N. Özgen et al. / Cardiovascular Research 75 (2007) 758–769


ownloaded from

atrial interface while having no effect elsewhere in the atrium[6]. When the site of burst rapid pacing was shifted frompulmonary vein to Bachmann's bundle region, no repolariza-tion changes were seen [6]. We found the burst pacing-inducedAPD shortening in pulmonary vein region to be calcium-dependent and prevented by nifedipine, ryanodine and apamin[6]. The latter venom blocks small conductance Ca2+-activatedK+ channels (SKCa) [7]. These data suggested that SKCa sub-units are responsible for APD shortening of pulmonary veininduced by the burst pacing protocol.

Recent studies have confirmed the presence of SKCa

channels in human and mouse cardiac myocytes with moreabundant channels in the atria compared with the ventricles[8,9]. Each subtype of SKCa channel family, SK1, SK2 andSK3, has a different sensitivity to apamin: SK2 channels are themost sensitive and SK1 channels, the least [10,11]. However nostudy has revealed how or if these currents are involved in earlyatrial remodeling. In the present study we hypothesized thatSK2 and/or SK3 channels are involved in burst pacing-inducedAPD shortening in the pulmonary vein region. We askedwhether there are changes in apamin-sensitive current andwhether any changes of SK2 and/or SK3 that occur are tran-scriptional and/or posttranslational. As shall be demonstratedfor the first time, SK2 channels are present in rabbit atrium andbrief periods of pulmonary vein ectopic activity are sufficient totraffic the channel proteins to membrane sites, resulting inincreased apamin-sensitive current, electrophysiologic remo-deling and the evolution of an arrhythmogenic substrate.

2. Methods

All experiments were performed according to protocolsapproved by the Columbia University Institutional Animal Careand Use Committee and conform to the Guide for the Care andUse of Laboratory Animals published by the US NationalInstitutes ofHealth (NIHPublicationNO. 85–23, revised 1996).

2.1. Electrophysiological studies

Male New Zealand White rabbits (3 months old, 2–2.5 kg)were anesthetized with sodium pentobarbital (30 mg/kg i.v.),heparinized and the left atria removed, opened, and pinned in atissue bath, endocardial surface up. The atria were superfusedwith Tyrode's solution containing (mmol/L): NaCl 131,NaHCO3 18, KCl 4, CaCl2 0.9, MgCl2 0.5, NaH2PO4 1.8and dextrose 5.5 (T=37 °C, pH 7.35±0.05). Bipolarstimulating electrodes were placed near Bachmann's bundle(BB) and within the pulmonary vein ostium (Fig. 1A).

Conventional microelectrode techniques were used to recordatrial action potentials from pulmonary vein and Bachmann'sbundle regions. Recording sites were located 3–4 mm fromstimulating electrodes. After 1 h equilibration in controlTyrode's solution while pacing from Bachmann's bundle atcycle length (CL)=0.4 s, an intermittent burst pacing protocolwas applied. The protocol was developed to mimic anintermittently bursting focus in sleeves of pulmonary vein. For

each 5 min period preparations were driven for 4.5 min fromBachmann's bundle region at CL=0.4 s (S1, normal spread ofexcitation) followed by 30 s of stimulation from pulmonary veinat CL=0.2 s (S2, ectopic focus) (Fig. 1B). This pattern of pacingwas applied for 3 h and its effectwas evaluated at the end of eachhour. All records were made at the end of 4.5 min of pacing atCL=0.4 s (steady-state). To study the effects of the SK2 channelblocker apamin on the burst pacing-induced changes in repo-larization, the compound was added to the solution 30 minbefore starting the pacing protocol and was present thereafter(Fig. 1C). Sham-paced atria were prepared by continuouspacing at CL=0.4 s from Bachmann's bundle region for 4 h.After the end of each pacing protocol, preparations incorporat-ing pulmonary vein and Bachmann's bundle regions wereisolated and used for biophysical, molecular or immunofluo-rescence studies. For all molecular and immunofluorescencestudies, pulmonary vein or Bachmann's bundle tissues werequick frozen in liquid nitrogen immediately after the end of theexperiment.

2.2. Biophysical studies of single myocytes

Pulmonary vein and Bachmann's bundle regions weredissected free of the atria and placed in a 60-mm plastic petridish containing 5 ml of enzyme solution containing KCl 5.4,KH2PO4 0.4, MgSO4 16.6, NaCl 137, NaHCO3 4.3, Na2HPO4

0.47, glucose 5.6, phenol red 0.056 (mM), MEM amino acidand vitamin (GIBCO) pH 6.7. Collagenase (Worthington typeII) was added to a final concentration of 1200 U/ml. The tissuewas rotated at 37 °C and agitated at a rate 1–2 cycles/s for35min. The tissue was then placed in a tube containing 3–4 mlof HEPES-buffered salt solution with 145 mM potassiumglutamate 5.7 mMMgCl2 at pH 6.72 and agitated for 10 min at37 °C. The softened tissue piece was broken up by gentlepipetting with a Pasteur pipette (20 titrations, removal of super-natant and repeated 3 times). The dispersed cells werecentrifuged and resuspended in MEM (pH 7.3). Resuspensionsolution was changed every 15 min for solution containingincreasing concentrations of Ca2+ (0 to 0.5 mM). The entirepreparation procedure required about 2 h. The cells weremaintained in this solution at room temperature until needed forpatch-clamping. For patching, an aliquot of cells wastransferred onto a poly-lysine coated glass coverslip placed atthe bottom of a 0.5 mL tissue chamber mounted on the stage ofa Nikon inverted microscope (Nikon Diaphot, Tokyo, Japan).Cells were continuously superfused (2–3 ml/min) with normalTyrode's solution containing (inmM): NaCl, 137;NaHCO3 24,NaH2PO4 1.8, MgCl2 0.5, CaCl2 2.0, KCl 4.0 and dextrose 5.5(pH=7.4). The solution was bubbled with 5% CO2/95% O2.

To measure Ca2+ activated K+ currents, patch pipette withresistances 2–3 MΩ was filled with the internal solution (inmM): KCl 140, MgCl2 1.0, EGTA 3, HEPES 10, Mg–ATP5, Na2–creatine phosphate 5, pH 7.2. Cells were superfusedwith a Na+-free solution (mM): N-methyl-D-glucamine Cl144, HEPES 10, KCl 5.4, CaCl2 5, MgCl2 1.0, pH 7.4,temperature: 30 °C. A voltage clamp protocol including 4

Fig. 1. Schematic of left atrial preparation (A) and burst pacing protocol performed in control Tyrode's solution (B) or in the presence of apamin (C). S1 and S2,stimulation sites; R1 and R2, recording sites; App, appendage; BB, Bachmann's bundle; LIPV, left inferior pulmonary vein; RIPV+LSPV, ostia of right inferiorand left superior pulmonary veins. See Methods for description of pacing protocol.

760 N. Özgen et al. / Cardiovascular Research 75 (2007) 758–769


ownloaded from

preconditioning depolarizing clamp steps (−70 mV to +20 mV, duration of the pulse=200 ms, repetition rate=1.2 s)was used to load Ca2+ and thus to study currents undersimilar SR loads. Apamin-sensitive peak currents wereassessed using 210-ms voltage step from Vts +30 to +60 mVin 10 mV increments from a holding potential of −70 mV at0.1 Hz after the preconditioning steps in the absence (con-trol) and presence of apamin (100 nM). As in our studies ofCai dependent chloride currents in canine cells [12], weselected internal and external solutions that would minimizeinternal Ca buffering. However, as in our earlier ventricularstudies, we found that 5 mM and 10 mM EGTA wereexcessive and buffered almost all Cai. Under these condi-tions we were unable to reliably see any Cai dependentcurrents. Thus we used 3 mM EGTA in all cell types. Underthese conditions we were able to see a difference in the peakcurrent blocked by apamin (apamin-sensitive currents). Fi-nally, we did not measure Ca2+ under the conditions of our

patch experiments but did note that the cells were relaxedand could withstand a seal and voltage clamp protocol.

2.3. Real-time PCR

Total RNA was extracted using the RNeasy midi-kit(Qiagen). First-strand cDNA was generated from 0.2 μg oftotal RNA using SuperScript First-Standard Synthesis System(Invitrogen). Real-time polymerase chain reaction (PCR) wasperformed using a LightCycler (Roche) with a reactionmixture composed of 2 μL of the cDNA mixture, 2 μL ofLightCycler— Faststart DNAmaster SYBRGreen I (Roche),4 mmol/L Mg2+, and 0.5 μmol/L of each primer in a finalvolume of 20 μL. Primer pairs were:

SK2: GCTCGGTCTCGATGAC (forward),GCAAGAAGAAGAACCAGAACA(reverse),

Table 1Effects of 3 h burst pacing protocol and of apamin 100 nmol/L ontransmembrane potentials recorded from atrial endocardium in pulmonaryveins and Bachmann's bundle

N MDP Vmax APA APD30, APD90

mV V/s mV ms ms

Bachmann's bundleControl 12 −79±1 129±7 108±2 26±3 91±33 h BPP 12 −80±1 123±10 109±3 25±2 89±3Control 6 −78±1 135±11 105±3 22±4 78±4Apamin 6 −80±2 132±12 107±4 24±3 80±5Apamin+ 3 h BPP 6 −81±2 127±13 106±4 25±4 81±5

Pulmonary veinsControl 12 −81±1 109±8 102±1 37±2 102±43 h BPP 12 −82±1 105±9 101±1 29±2# 83±3#

Control 6 −82±1 104±10 101±2 39±3 96±6Apamin 6 −81±2 102±11 103±3 48±4# 115±5#

Apamin+ 3 h BPP 6 −83±2 107±13 103±2 47±4# 116±7#

#pb0.05 vs. control; MDP: maximum diastolic potential; Vmax: maximumupstroke velocity; APA: action potential amplitude; APD30 and APD90:action potential duration to 30 and 90% repolarization, respectively.Pacing cycle length=400 ms.



ownloaded from

SK3: TTGCCCAACTCCAGAGC (forward),CAAGCAAGTGGTCATTGAGATTTA(reverse),

Cyclophyllin A: CCAACACAAACGGCTC (forward),GCAGACACGGAACCAA (reverse).

After an initial denaturation at 95 °C for 10 min for ampli-fication was carried out under different conditions for differentprimers: SK2 — 45 cycles of denaturation at 95 °C for 10 s,annealing at 60 °C for 7 s, extension at 72 °C for 8 s, SK3 —47 cycles of denaturation at 95 °C for 10 s, annealing at 60 °C for7 s, extension at 72 °C for 5 s, cyclophilin A — 35 cycles ofdenaturation at 95 °C for 10 s, annealing at 63 °C for 10 s,extension at 72 °C for 11 s. Fluorescence (arbitrary units) wasmeasured at the end of each extension step and the quantitativecomparison of mRNA was done based on a standard curvegenerated from a 10 times serially diluted cDNA. Data werenormalized to the data on cyclophilin A from the samepreparation (n=7). Product sequences were verified by theirsequencing at the DNA facility of Columbia University, NY.

2.4. Western blot

Tissues were chopped and sonicated in two 30 s bursts inlysate buffer (mmol/L) tris–HCl 20 (pH 7.4), EDTA 10,sodium orthovanadate 0.04, benzamidine 3.2, phenylmethyl-sulfonyl fluoride 0.1, 1% Triton X-100 and completeproteinase inhibitor (Roche) and incubated on ice for 2 h.After centrifugation at 14,000 rcf for 10 min, supernatantswere collected and protein concentration was measured usingBio-Rad DC protein assay. Twenty μg of the whole cell lysatewere separated on a 4% to 20% tris-glycine gradient gel(Invitrogen) and transferred to PVDF membranes (BioRad).Membranes were blocked overnight in 5% milk in phosphatebuffered saline containing 0.1% Tween 20 (PBST) thenincubated with anti-SK2 or SK3 rabbit polyclonal antibody(Alomone, 1:1500) in 5% milk/PBST at RT for 2 h. Themembranes were washed in PBST 5×5 min anti-rabbitTrueBlot system (eBioscience) secondary antibody was usedto eliminate interference of heavy chain and light chain ofendogenous IgG. Membranes were washed for 5×5 min inPBST and immunodetection was performed with an en-hanced chemiluminescence method (Amersham PharmaciaBiotech) and developed using X-ray film (AmershamPharmacia Biotech). Data were normalized to a non-specificbackground band at 10 kDa as a loading control. This bandwas unaltered by the SK2 blocking peptide (data not shown).A preadsorption control experiment done using controlantigen per the manufacturer's indication demonstrated thatthe band above 50 kDa was antigen specific (data not shown).

2.5. Immunohistochemistry for SK2 alone or together withSERCA2

Pulmonary vein or Bachmann's bundle tissues wereimbedded in O.C.T. (embedding medium, Tissue-Tek) for

immunofluorescence studies. Cryostat sections (12 μM) werefixed in 4% paraformaldehyde for 30 min, and then incubatedovernight at 4 °C with SK2 antibody (1:200) alone or togetherwith SERCA2 antibody (1:100, Abcam), as a endoplasmicreticulummarker, in PBSwith 0.50%Triton-X and 1% normalgoat serum. After incubation sections were rinsed 5×5 min,then incubated with secondary antibodies (Alexa Fluor 488goat anti-rabbit IgG, 1:300, and Alexa Fluor 594 goat anti-mouse IgG, 1:500, Molecular Probes) 90 min, sections weremounted with anti-fade mounting medium which includesDAPI (4′, 6 diamidino-2-phenylindole, VectorLaboratories,Inc.) a counter stain for DNA to visualize nuclei.

2.6. Immunocytochemistry for SK2 in rabbit pulmonary veincells

Dissociated pulmonary vein cells were fixed in 4%paraformaldehyde for 30 min, and then blocked in 2% avidinand 2% biotin for 15 min, respectively. After incubation withanti-SK2 antibody (Alomone, 1:100 in 5% goat serum0.75% Triton X-100 in PBS) overnight at 4 °C, immuno-fluorescence labeling was done by incubation with biotiny-lated secondary antibody (1:300) for 90 min followed bytreatment with avidin D fluorescein (1:300) for 90 min.Finally, the slides were mounted with anti-fade mountingmedium which includes DAPI.

2.7. Microscopy

For both immunohistochemistry and immunocytochem-istry, images were viewed using a Zeiss LSM 510 NLOMultiphoton Confocal Microscope. SK2 (green), SERCA2(red) immunoreactivity and DAPI (blue) were visualized via488, 543 and 780 nm excitation, respectively. Three


dimensional reconstructions of sections were analyzed usingImage J programming to calculate the pixel intensity overbackground in each section in cytosolic vs. membrane com-partments of the reconstructed cells (NIH freeware).

2.8. Statistical analysis

All results are expressed as mean +/−S.E.M. Comparisonbetween group means was done by one-way ANOVA. Forapamin-sensitive peak current comparison was done usingstudent's t-test. p≤0.05 was considered statistically significant.

3. Results

3.1. Electrophysiological study

Consistent with our previous results [6], transmembranepotential recordings showed that burst pacing progressively and

Fig. 2. Panel A: AP recordings from untreated (Tyrode) and apamin-treated (Tyrode+protocol. Note that in the presence of apamin there is no effect of the burst pacing proAPD50 in pulmonary vein and Bachmann's bundle for control and at 3 h of burst pacAPD50 at pulmonary vein and Bachmann's bundle for control, apamin and apamin pladministration; +Ap+BPP indicates apamin administration plus burst pacing; ⁎, pb0.0

significantly shortened APD within the atrial sleeves inpulmonary vein extending to 1–2 mm beyond the orifice, butnot in Bachmann's bundle (Table 1, Fig. 2A and B) and thisshortening was completely blocked by administration ofapamin (0.1 μM) (Table 1, Fig. 2A and C). In contrast, nosignificant APD changes were seen in pulmonary vein orBachmann's bundle from sham-paced atria (data not shown).Moreover, apamin administration during adaptation had noeffect on APD at Bachmann's bundle but significantly pro-longed it at pulmonary vein, suggesting the presence of moreapamin-sensitive current in pulmonary vein than in Bach-mann's bundle (Table 1, Fig. 2A, C).

To test whether the shortened repolarization in pulmonaryvein was the result of increased apamin-sensitive currents,patch clamp studies were performed. A representative exper-iment in one pulmonary vein cell is shown in Fig. 3A and afamily of apamin-sensitive currents is shown in Fig. 3B. Onlya few cells were probed using a full IV clamp protocol and

Apamin, 100 nM) preparations before (Control) and after the 3 h burst pacingtocol on pulmonary vein APD shortening. Panel B shows the summary data foring (n=12 preparations, and 12 animals). Panel C shows the summary data forus 3 h of burst pacing (n=6 preparations, and 6 animals). +Ap indicates apamin5 vs. control. #, pb0.05 vs. +Ap and +Ap+BPP.


ownloaded from

Fig. 3. Apamin-sensitive currents. Panel A, Representative apamin-sensitive current recorded in a pulmonary vein cell after the burst pacing protocol. Currenttracings before (Con), in the presence of Apamin (100 nM) and the difference current (Ap-sensitive current) are shown. Note that Apamin does completely inhibitthis current. Panel B, Family of tracings of Apamin-sensitive currents during clamp protocol exploring the full range of voltages. See text. Panel C, Complete IVof currents (filled circles) and Apamin-sensitive (unfilled circles) currents in a Sham pulmonary vein cell (left) and a burst-paced pulmonary vein cell (right). Seetext for description. Panel D. Average peak density of transient outward currents in the absence (CON) of apamin and of currents sensitive to apamin, 100 nM,(Ap-sensitive) in pulmonary vein and Bachmann's bundle cells from both Sham and burst-paced preparations. Asterisk indicates pulmonary vein burst-paced issignificantly greater than Sham-paced (pb .05). n=7 pulmonary vein myocytes from 4 sham animals and 8 pulmonary vein myocytes from 5 paced animals.



ownloaded from

Fig. 3C shows representative complete IV curves of total cur-rent and apamin-sensitive currents in one Sham and one burst-paced pulmonary vein cell. Note the larger current density and alarger apamin-sensitive current in the burst-paced pulmonaryvein cell as compared to the Sham. Voltage dependence ap-peared similar in both settings.

Data for all experiments are summarized in Fig. 3D whichdemonstrates the average peak apamin-sensitive currents in thedifferent cell groups (n=7 pulmonary vein myocytes obtainedfrom 4 sham animals and 8 pulmonary vein myocytes from 5

paced animals). Of central importance is that burst pacingresults in a greater increase in apamin-sensitive current in pul-monary vein than in Bachmann's bundle (Fig. 3D). There wasno difference in the kinetics of decay of the peak apamin-sensitive current in pacedpulmonaryvein cells (17.2+/−4.1ms,n=6 cells from 5 animals) versus those of Sham cells (9.8+/−1.1 ms, n=4 cells from 3 animals).

Fig. 4 demonstrates the relationship between apamin-sensitive currents and changes in APD50 produced with burstpacing. Note that following burst pacing in pulmonary vein

Fig. 4. Regression of changes in pulmonary vein APD50 (control-3 h pacing) as a function of apamin-sensitive currents (mean value of the apamin-sensitivecurrent in individual cells from same preparation) in cells from Sham-paced (Panel A) and burst-paced (Panel B) pulmonary vein. As sham preparations are pacedthere is no relationship between current magnitude and the change in APD (R=0.23, pN0.05). In contrast, there is a significant relationship between increases incurrent and the decrease in APD50 produced with burst pacing (R=0.97, pb0.05). The significant relationship between actual APD50 as a function of apamin-sensitive currents in cells from burst-paced pulmonary vein is shown in Panel C (R=0.81, pb0.05).



ownloaded from

preparations, larger apamin-sensitive currents are reflected in agreater change in APD50 in cells from the same preparations.(Panel B). There is no such relationship with Sham pacing(Panel A). There is also significant relationship between actualAPD50 as a function of apamin-sensitive currents in cells fromburst-paced pulmonary vein (Panel C).

3.2. mRNA and protein level

To test whether the burst pacing protocol induced changesin SK2 and SK3 transcription levels, we performed quan-titative real-time PCR and western blot studies. The burst pa-cing protocol led to a significant increase in SK2mRNA levelsin pulmonary vein but not in Bachmann's bundle (Fig. 5A).SK3 mRNA levels did not change significantly after the burstpacing protocol in both pulmonary vein and Bachmann'sbundle (Fig. 5A).

In parallel with the mRNA level change, western blottingshowed a significant increase of SK2 protein in pulmonary veinbut not Bachmann's bundle after the burst pacing protocol(Fig. 5B and C). No change in SK3 protein level was inducedby the burst pacing protocol in either pulmonary vein orBachmann's bundle (Fig. 5B and C).

3.3. Immunohistochemical and immunocytochemical studiesof SK2 channels

To visualize the distribution of SK2 channels, we performedimmunofluorescence staining of left atrium, pulmonary veinand Bachmann's bundle frozen sections as well as disaggre-

gated pulmonary vein cells from atria subjected to either theburst pacing protocol or Sham-pacing. Fig. 6A shows the resultof co-immunostaining of SK2 channels with SERCA2 protein,as an endoplasmic reticulum marker in sham rabbit left atrium.These data indicate that SK2 protein colocalizes with SERCA2protein in the endoplasmic reticulum. Fig. 6B and C showrepresentative images of sections and single cells immunos-tained for SK2 and analyzed by confocal microscopy. Notablyin sham-paced pulmonary vein, the SK2 antibody stainedintensely in perinuclear regions but minimally in the cytosol orat the plasma membranes (Fig. 6B and C). After the burstpacing protocol, SK2 channel staining significantly increased atsites near or at the membrane as well as in the cytosol inpulmonary vein but not Bachmann's bundle. Results of quan-titative analysis showed that the burst pacing protocol induced asignificant increase in staining of SK2 both in the cytosol andmembrane in pulmonary vein but not in Bachmann's bundle(bar graphs in Fig. 6B and C). Since Bachmann's bundle mightbe considered a specialized tissue, we also asked whether burstpacing might induce changes in SK2 distribution in left atrialfree wall. Immunostaining of SK2 channels in Sham and burst-paced left atria showed no difference in channel distribution inthese two groups: most of the SK2 channels were locatedperinuclearly and there was minimal staining in cytosol andmembrane (data not shown).

4. Discussion

Atrial fibrillation tends to be a progressive arrhythmia,evolving from paroxysmal to persistent to chronic forms

Fig. 5. Panel A: Summary data of real–time PCR for SK2 and SK3 in all groups. There is a significant increase in transcription for SK2 in pulmonary vein and nochange in Bachmann's bundle after burst pacing (⁎, pb0.05 vs. Sham, n=7). There is no significant change in SK3 transcription in pulmonary vein andBachmann's bundle after burst pacing protocol (n=7). Panel B: Summary data of western blots in burst pacing protocol and Sham show that SK2 protein issignificantly increased after burst pacing protocol in pulmonary vein but not Bachmann's bundle (⁎, pb0.05 vs. Sham, n=3). There is no significant change inSK3 protein level in both burst pacing protocol and Sham at both sites (n=3). Panel C: Representative western blots and loading controls of SK2 and SK3 (above50 kDa) in pulmonary vein and Bachmann's bundle.



ownloaded from

[12,13]. AF progression results in part from its effect toinduce atrial electrical remodeling, thus creating an arrhyth-mogenic substrate for its own maintenance [3,13,14]. Initialparoxysms of AF can be triggered by ectopic foci located inthe muscle sleeves of pulmonary veins [1,2]. The subsequentadvancement of AF to persistence suggests that remodelingof repolarization and refractoriness in the tissues into whichthe triggered pulmonary venous impulses propagate com-mences rapidly after the onset of triggered activity.

Although recent studies have shown that SK channels areimportant in the repolarization of atrial action potentials inmice and humans [8,9], this is the first study focused on thepotential association of these channels to the initiation ofatrial remodeling. Specifically, we have determined thatapamin-sensitive SKCa channels are involved in the repolar-ization change induced by rapid burst pacing, and have

identified SK2 and not SK3 as the culprit channel. Mech-anistically, we have determined that the accelerated repolar-ization results from trafficking of SK2 channel sub-units andthat there are the beginnings of transcriptional changes as well.

The data for this early stage of atrial remodeling wereobtained from amodified, yet well-characterized in vitro model(isolated rabbit atria) of atrial fibrillation mechanisms [15,16].The burst pacing protocol usedmimics the firing of ectopic fociin pulmonary veins [6]. Conceptually the background for thisresearch evolved from the hypothesis of “sensitivity to the rare”initially developed in neural cell cultures [17,18] which weadapted to the heart [19]. In brief, the concept states that rapidactivity originating from sites of intermittent (so-called, “rare”)impulse initiation will more readily take over the activationpatterns of sheets of cells than will comparable activityoriginating from sites of dominant impulse initiation [17–19].

Fig. 6. Panel A, Co-immunostaining of SK2 protein (green), SERCA2 (red), as an endoplasmic reticulum marker, and nuclei (DAPI, blue) in sham left atrialsections. Note the colocalization of SK2 and SERCA2 protein in the overlay. Panel B: Representative experiments on SK2 immunofluorescence staining (green)for Sham and burst-paced Bachmann's bundle and pulmonary vein sections. SK2 antibody stained intensely in the perinuclear region of Sham–pulmonary veinsections, and minimally in the cytosol and membrane. In contrast, SK2 antibody stained near or at the membrane as well as in the cytosol in burst pacingprotocol–pulmonary vein. In both burst pacing and Sham protocols, Bachmann's bundle SK2 stained mainly in the perinuclear region. Summary data (bargraphs) show a significant increase in both cytosolic and membrane immunofluorescence intensity after burst pacing protocol of pulmonary vein only (⁎, pb0.05vs. Sham, n=10). Panel C: SK2 immunofluorescence staining (green) in disaggregated pulmonary vein cells from Sham or burst-paced atria. SK2 antibodystains intensely in the perinuclear region of the Sham pulmonary vein cell, and minimally in the cytosol and membrane. In contrast, SK2 antibody stains near or atthe membrane as well as in the cytosol after burst pacing the pulmonary vein cell. Summary data (bar graphs) show a significant increase of immunofluorescenceintensity in membrane and in cytosol after burst pacing (n=3) as compared to Sham (n=6) in pulmonary vein (⁎, pb0.05 vs. Sham).



ownloaded from

A goal of the present study was to understand the cellular andmolecular mechanisms that might facilitate such behavior inotherwise normal atria which undergo a lifetime of activationvia normal sinus rhythm but then can remodel rapidly and oftenirreversibly when an ectopic focus gains access to the substrate.

The burst pacing protocol (the site- and pattern-specificpacing) we have used in this and previous studies [6,20] inducessignificant shortening of repolarization in the region of rapid

pacing, the pulmonary vein, but not the distant site, Bachmann'sbundle within 3 h. Importantly, this does not mean that 3 h ofburst pacing are performed. Rather, (see Fig. 1) because thebursting activity is delivered for only 30 s of each 5 min periodof “sinus rhythm,” only 18 min of rapid burst pacing occurduring the 180 min of the pacing protocol. The resultant,regionally-delimited shortening of repolarization seen inpulmonary vein but not in Bachmann's bundle, markedly alters



ownloaded from

dispersion of repolarization between the two sites [6]. It shouldbe emphasized that while a gradient in repolarization could helpto promote reentry between the PV/atria and could help tosustain AF, it would likely not lead directly to initiation of AF.

While it might have been interesting to chart the temporalaspects of change in message, protein and current, subdividingthe 18 min time course of pacing would not only have beendifficult with regard to quantifyingmagnitude, but would likelynot have been very informative. More important is tounderstand the transition that occurs between the rapid eventsthat we describe here and the more long-term aspects ofremodeling that occur over hours–months–years of repetitivebursting activity. It should be noted that changes in repo-larization secondary to trafficking of SK2 channels are notviewed by us as the trigger for an arrhythmic event, but rather asthe response to a period of burst pacing (which itself is thetrigger) that then facilitates the further expression of thearrhythmia.

The changes that occur appear to be calcium-dependent asthey are prevented by nifedipine and ryanodine [6]. Since SK1current is not apamin-sensitive, this result is consistent with arole for the calcium- and apamin-sensitive SK2 and/or SK3channels in the evolution of action potential shortening. How-ever, the observation that rapid burst pacing affects the pulmo-nary vein site more than the Bachmann's bundle site not onlyimplies that SK2 and/or SK3 channels are involved in thisprocess, but that there is a regional dispersion of their presenceand/or that of the factors that activate them.

SK channels are present inmany excitable and non-excitablecells including brain, peripheral nervous system, and smooth,skeletal and cardiac muscle [21–26]. Calmodulin constitutivelybinds to SK channels and functions as aCa2+ sensor: in responseto Ca2+ binding to calmodulin, channel opening occurs withtime constants of activation of 5–15ms [27]. SK channels showa steep dependence on intracellular Ca2+ concentration and canbe activated by submicromolar concentrations of intracellularCa2+ in a voltage-independent manner [28]. Hence, even subtlechanges in intracellular Ca2+ concentration might haveprofound physiological consequences. Although the structureand the nature of Ca2+ gating of the three SK channels aresimilar, the sensitivities of the channel isoforms to apamin aredifferent, with SK2NSK3NSK1 [10,22,29]. SK channels havebeen implicated in many physiological processes includingregulation of secretion, smooth muscle tone, firing pattern inneuron excitable cells, the repolarization phase of cardiac actionpotentials and in afterhyperpolarization induction followingaction potentials in neurons [8,9,11,30,31].

Electrophysiological data from our single cell studiesdemonstrated significantly greater apamin-sensitive current inpulmonary vein than Bachmann's bundle cells. It should benoted that the SK2 currents we record are transient andoutward. This differs from the results of others [8,9] who havereported steady-state apamin-sensitive currents in a setting ofCai chelation. Our studies were designed to minimally perturbthe sarcoplasmic reticulum Ca2+ release that occurs withvoltage clamp steps so that Ca-dependent, apamin-sensitive

currents could be reported during the dynamic change in Cai.Thus the apamin-sensitive current we report here is a transientoutward current presumably reflecting the transient global Ca2+

release of atrial cells.Our voltage clamp results are consistent with our

microelectrode studies in which apamin significantly pro-longed APD in pulmonary vein but not Bachmann's bundlecells. A significant relationship between the change in actionpotential duration and the size of the apamin-sensitive currentis seen in the pulmonary vein region, and there was a greaterincrease in apamin-sensitive current in burst-paced pulmo-nary vein than in either sham pulmonary vein or inBachmann's bundle. Even allowing for the potential impactof the cell disaggregation protocol on the currents subse-quently recorded, it is clear that an apamin-sensitive current ispresent and is functional in the pulmonary vein more than inBachmann's bundle.

Our molecular studies also support a role for SK2 channelsin the pulmonary vein andnot Bachmann's bundle in the settingof burst pacing-induced acceleration of repolarization. Quan-titative PCR showed that burst pacing-induced a significantincrease of SK2 transcription in the pulmonary vein, but notBachmann's bundle. Consistent with the mRNA results, burstpacing also induced a significant increase in the SK2 proteinlevel in pulmonary vein alone. In contrast to the SK2 results,neither SK3message nor protein changed during the protocol ineither region. These results suggest a prominent role for theSK2 channel in pulmonary vein APD shortening induced byburst pacing.

Whereas the changes in mRNA and protein levels wouldsuggest longer-term alterations in apamin-sensitive current,they do not necessarily explain the steady progression of APDshortening during the 3 h burst pacing protocol. In immuno-fluorescence studies of tissue preparations (Fig. 6B) migrationof positively stainingmaterial occurred fromperinuclear sites toa more general cytoplasmic distribution in pulmonary veinonly. In addition, the single myocyte experiments (Fig. 6C)show that the distribution achieved with rapid burst pacing wasprimarily at the membrane and/or the immediate sub-mem-branous region. We could not perform western blots usingmembrane preparations to test the presence of altered SK2channel protein after burst pacing because the preparations aretoo small (each one about 3 mm2) for adequate membranepreparation. That the SK2 channel protein was likely inserted inthe membrane is suggested by the increase in current and thedecrease in action potential duration, both of which are de-pendent on localization of channel protein in themembrane andits resultant functionality.

Although there is an alternative interpretation for thecytosolic staining might be a slower recycling of the mem-brane channels due to slower degradation by proteosomes, allour results are strongly suggestive of altered proteintrafficking. Supporting this suggestion is the presence of twopotential endoplasmic reticulum retention domains at the SK2carboxyl terminal: one is the KKXX motif at position 436–439; the other site is the RXR site at 552–554. Although, there



ownloaded from

are also potential endoplasmic retentionmotifs, RXRmotifs, atSK3 sequences these are located close to the amino terminal.Licata et al. observed that when SK2 channels are over-expressed in yeast, SK2 protein does not reach the plasmamembrane, its normal destination; rather, it remains largely inthe endoplasmic reticulum. Adding a putative translocationsequence alters the intracellular distribution significantly withenhanced trafficking out of the endoplasmic reticulum [32].Using SK2 channels expressed in COSm6 cells, Lee et al.suggested that calmodulin, a putative SK channel beta sub-unit, is required for cell-surface expression of the SK2 channel[33]. Another study found that surface expression of SK2 ismodulated through direct phosphorylation of SK2 by proteinkinase A in SK2 overexpressed COS7 cells [34]. Lu et al.demonstrated that both SK2 channels and L-type Ca2+

channels colocalize in T tubules in the sarcolemma via inter-actions with alpha-actinin 2 in cardiac myocytes, and thefunction of SK2 channels in atrial myocytes is critically de-pendent on the normal expression of Cav1.3 channel [35]. Allthese studies suggest a complex series of steps contributing toSK2 channel expression at cell membranes.

In conclusion, the 3 h protocol mimicking an intermit-tently bursting focus in pulmonary vein accelerates repolar-ization in the region of rapid pacing but not distally. APDshortening at the pulmonary vein region results from SK2channel trafficking to the membrane leading to upregulationof apamin-sensitive outward current. The downstream resultof the action potential shortening would be facilitation ofpropagation of triggered impulses arising in the pulmonaryveins to the bulk left atrial myocardium, facilitating stillfurther evolution of atrial remodeling. Within this frame-work, we can speculate that SK2 channels maintained atintracellular sites are available for rapid deployment to thecell membrane. When a stress (such as triggered activity orpacing) occurs, beta sub-units, and/or chaperone proteins orphosphate residues might bind to the SK2 channel andtransport it to the membrane. This is conceived as a “fastresponse” system that would not require time for synthesis ofnew protein when the environment changes.

Our data also suggest that ionic and molecular mechanismsresponsible for the initial steps of atrial remodeling inducedby site- and pattern specific pacing may be different from thosefound in the models with short-term [28,29] and long-term[30–32] continuous rapid pacing from a single atrial site.The latter involve transcriptional and translational changesand are consistent with the alteration of SK2 transcriptionalactivity that is seen in addition to trafficking during the 3 hprotocol. Importantly, the sequence of processes from traf-ficking to transcription sets up a means whereby a rapidresponse element can segue into a sustained response of thesame target protein (in this case, the SK2 channel).Knowledge of the ionic and molecular mechanisms of theearly phases of remodeling in settings such as these shouldhelp to create strategies for preventing the occurrence of AFby counteracting the development of a substrate that facil-itates evolution of the arrhythmia.

Acknowledgements

This work was supported by NIH grants HL67131,HL28958 and HL66140. We thank Laureen Pagan for hercareful attention to the preparation of the manuscript and SebilaKratovac for her technical assistance with western blottingstudies.

References

[1] Haissaguerre M, Jais P, Shah DC, Takahashi A, Hocini M, Quiniou G,et al. Spontaneous initiation of atrial fibrillation by ectopic beatsoriginating in the pulmonary veins. N Engl J Med 1998;339:659–66.

[2] Oral H, Ozaydin M, Tada H, Chugh A, Scharf C, Hassan S, et al.Mechanistic significance of intermittent pulmonary vein tachycardia inpatients with atrial fibrillation. J Cardiovasc Electrophysiol 2002;13:645–50.

[3] Wijffels MC, Kirchhof CJ, Dorland R, Allessie MA. Atrial fibrillationbegets atrial fibrillation. A study in awake chronically instrumented goats.Circulation 1995;92:1954–68.

[4] Morillo CA, Klein GJ, Jones DL, Guiraudon CM. Chronic rapid atrialpacing. Structural, functional, and electrophysiological characteristicsof a new model of sustained atrial fibrillation. Circulation 1995;91:1588–95.

[5] Gaspo R, Bosch RF, Talajic M, Nattel S. Functional mechanismsunderlying tachycardia-induced sustained atrial fibrillation in a chronicdog model. Circulation 1997;96:4027–35.

[6] SosunovEA,AnyukhovskyEP,Hefer D, Rosen TS,Danilo Jr P, JanseMJ,et al. Region-specific, pacing-induced changes in repolarization in rabbitatrium: an example of sensitivity to the rare. Cardiovasc Res 2005;67:274–82.

[7] Hugues M, Romey G, Duval D, Vincent JP, Lazdunski M. Apaminas a selective blocker of the calcium-dependent potassium channelin neuroblastoma cells: voltage-clamp and biochemical character-ization of the toxin receptor. Proc Natl Acad Sci U S A 1982;79:1308–12.

[8] Xu Y, Tuteja D, Zhang Z, Xu D, Zhang Y, Rodriguez J, et al. Molecularidentification and functional roles of a Ca(2+)-activated K+ channel inhuman and mouse hearts. J Biol Chem 2003;278:49085–94.

[9] Tuteja D, XuD, TimofeyevV, LuL, SharmaD, Zhang Z, et al. Differentialexpression of small-conductance Ca2+-activated K+ channels SK1, SK2,and SK3 in mouse atrial and ventricular myocytes. Am J Physiol HeartCirc Physiol 2005;289:H2714–23.

[10] Ishii TM, Maylie J, Adelman JP. Determinants of apamin and d-tubocurarine block in SK potassium channels. J Biol Chem 1997;272:23195–200.

[11] Pedarzani P, Kulik A, Muller M, Ballanyi K, Stocker M. Moleculardeterminants of Ca2+-dependent K+ channel function in rat dorsal vagalneurones. J Physiol 2000;527(Pt 2):283–90.

[12] Aggarwal R, Pu J, Boyden PA. Ca(2+)-dependent outward currents inmyocytes from epicardial border zone of 5-day infarcted canine heart. AmJ Physiol 1997;273:H1386–94.

[13] Allessie MA, Boyden PA, Camm AJ, Kleber AG, Lab MJ, Legato MJ,et al. Pathophysiology and prevention of atrial fibrillation. Circulation2001;103:769–77.

[14] Kannel WB, Wolf PA, Benjamin EJ, Levy D. Prevalence, incidence,prognosis, and predisposing conditions for atrial fibrillation: population-based estimates. Am J Cardiol 1998;82:2N–9N.

[15] Allessie MA, Bonke FI, Schopman FJ. Circus movement in rabbitatrial muscle as a mechanism of tachycardia. Circ Res 1973;33:54–62.

[16] Allessie MA, Bonke FI, Schopman FJ. Circus movement in rabbitatrial muscle as a mechanism of tachycardia. III. The “leadingcircle” concept: a new model of circus movement in cardiac tissuewithout the involvement of an anatomical obstacle. Circ Res1977;41:9–18.


Dow

nlo

[17] Marom S, Shahaf G. Development, learning and memory in large randomnetworks of cortical neurons: lessons beyond anatomy. Q Rev Biophys2002;35:63–87.

[18] Shahaf G, Marom S. Learning in networks of cortical neurons. J Neurosci2001;21:8782–8.

[19] Rosen MR, Binah O, Marom S. Cardiac memory and cortical memory:do learning patterns in neural networks impact on cardiac arrhythmias?Circulation 2003;108:1784–9.

[20] DunW, Özgen N, Hirose M, Sosunov EA, Anyukhovsky EP, Rosen MR,Boyden PA. Ionic mechanisms underlying region-specific remodeling ofrabbit atrial action potentials caused by intermittent burst stimulation.Heart Rhythm 2007;4:499–507.

[21] Keating DJ, Rychkov GY, Roberts ML. Oxygen sensitivity in the sheepadrenal medulla: role of SK channels. Am J Physiol Cell Physiol 2001;281:C1434–41.

[22] Kohler M, Hirschberg B, Bond CT, Kinzie JM, Marrion NV, Maylie J,et al. Small-conductance, calcium-activated potassium channels frommammalian brain. Science 1996;273:1709–14.

[23] Lingle CJ, Solaro CR, Prakriya M, Ding JP. Calcium-activated potassiumchannels in adrenal chromaffin cells. Ion Channels 1996;4: 261–301.

[24] Ro S, Hatton WJ, Koh SD, Horowitz B. Molecular properties of small-conductance Ca2+-activated K+ channels expressed in murine colonicsmooth muscle. Am J Physiol Gastrointest Liver Physiol 2001;281:G964–73.

[25] TamarinaNA,WangY,MariottoL,KuznetsovA,BondC,Adelman J, et al.Small-conductance calcium-activated K+ channels are expressed inpancreatic islets and regulate glucose responses.Diabetes 2003;52: 2000–6.

[26] Taylor MS, Bonev AD, Gross TP, Eckman DM, Brayden JE, Bond CT,et al. Altered expression of small-conductance Ca2+-activated K+ (SK3)

channels modulates arterial tone and blood pressure. Circ Res 2003;93:124–31.

[27] Xia XM, Fakler B, Rivard A, Wayman G, Johnson-Pais T, Keen JE, et al.Mechanism of calcium gating in small-conductance calcium-activatedpotassium channels. Nature 1998;395:503–7.

[28] Hirschberg B, Maylie J, Adelman JP, Marrion NV. Gating ofrecombinant small-conductance Ca-activated K+ channels by calcium.J Gen Physiol 1998;111:565–81.

[29] Castle NA. Recent advances in the biology of small conductance calcium-activated potassium channels. Perspect Drug Discov Des 1999;15:131–54.

[30] Vergara C, Latorre R, Marrion NV, Adelman JP. Calcium-activatedpotassium channels. Curr Opin Neurobiol 1998;8:321–9.

[31] Marty A, Horn R, Tan YP, Zimmerberg J. Delay of the Ca mobilizationresponse tomuscarinic stimulation. SocGen Physiol Ser 1989;44:97–110.

[32] Licata L, Haase W, Eckhardt-Strelau L, Parcej DN. Over-expression of amammalian small conductance calcium-activated K+ channel in Pichiapastoris: effects of trafficking signals and subunit fusions. Protein ExprPurif 2006;47:171–8.

[33] Lee WS, Ngo-Anh TJ, Bruening-Wright A, Maylie J, Adelman JP.Small conductance Ca2+-activated K+ channels and calmodulin: cellsurface expression and gating. J Biol Chem 2003;278:25940–6.

[34] Ren Y, Barnwell LF, Alexander JC, Lubin FD, Adelman JP, Pfaffinger PJ,et al. Regulation of surface localization of the small conductance Ca2+-activated potassium channel, Sk2, through direct phosphorylation bycAMP-dependent protein kinase. J Biol Chem 2006;281:11769–79.

[35] Lu L, Zhang Q, Timofeyev V, Zhang Z, Young JN, Shin HS, et al.Molecular Coupling of a Ca2+-Activated K+ Channel to L-type Ca2+

Channels via alpha-Actinin2. Circ Res 2007;100:112–20.

ade
by guest on June 20, 2016
d from

early electrical remodeling in rabbit pulmonary vein results from trafficking of intracellular sk2...

Documents