DNA Binding Exerted by a Bacterial Gene Regulator with anExtensive Coiled-coil Domain*

(Received for publication, February 9, 1996, and in revised form, March 6, 1996)

Reini Hurme‡§, Kurt D. Berndt§, Ellen Namork¶, and Mikael Rhen‡

From the ‡Microbiology and Tumor Biology Center, the §Department of Medical Biochemistry and Biophysics,Karolinska Institute, 17177 Stockholm, Sweden and ¶Electron Microscopy Unit, National Institute of Public Health,Torshov, N-0403 Oslo, Norway

Although quite common in the eukaryotic cell, bacte-rial proteins with an extensive coiled-coil domain arestill relatively rare. One of the few thus far documentedexamples, TlpA from Salmonella typhimurium, is char-acterized by a remarkably long (250 amino acids) a-hel-ical coiled-coil domain. Herein, we demonstrate thatTlpA is a novel, sequence-specific DNA-binding protein.Several tlpA deletion mutants have been constructed,and their corresponding protein products were purifiedand tested for DNA binding. Two of the mutant proteinswere shown to be deficient in DNA binding. Both mu-tants were analyzed by circular dichroism and electronmicroscopy, supporting the notion that mutant proteinswere largely intact despite lacking the amino acid resi-dues necessary for DNA binding. In vivo studies withtranscriptional tlpA-lacZ fusions demonstrated thatTlpA acts as a repressor. Using the repressor phenotypeas a readout, the chain exchange previously describedin vitro could also be confirmed in vivo. We believe thecoiled-coil domain acts not only as a dimerization inter-face but could also serve a role as a flexible modulator ofthe protein-DNA interaction.

The a-helical coiled-coil motif has been widely described (1,2). Heptad amino acid repeats (a-b-c-d-e-f-g) are the hallmarkof this structure which is driven by apolar residues buried in ainterface formed by two (or more) a-helical chains in the coiled-coil structure (3, 4). Positions a and d of the heptad form thecharacteristic 3–4 hydrophobic repeat, which has been identi-fied in the primary sequence of more than 200 proteins (5).Coiled-coils are also found as components of eukaryotic tran-

scription factors (6). In the eukaryotic bZip family of proteins,a coiled-coil motif of 3–4 heptads in length enables dimeriza-tion and positioning of the two polypeptide chains into a DNAbinding unit (7, 8). The involvement of the leucine zippercoiled-coil is also a centerpiece of the basic region helix-loop-helix-zipper and the basic region helix-loop-helix structures (6).It is now evident that the coiled-coil motif is not unique to thebZip proteins, but can also be found in transcription factorswith homeodomain or zinc finger DNA-binding motifs (9, 10).Gene regulators that utilize the coiled-coil motif appear to be

less abundant in bacteria, and distinct families have yet to berecognized. To date, there are only a few documented examples

of bacterial proteins per se, where the coiled-coil is a majorstructural feature (11–15). Recently, several bacterial DNA-binding proteins with the common helix-turn-helix elementhave been proposed to contain a leucine zipper-like dimeriza-tion motif (16–19). Most of these bacterial examples however,lack biophysical evidence supporting the presence of a coiled-coil. Nevertheless, one cannot exclude the possibility that theleucine repeats, in these so-called zipper regions of the bacte-rial regulators, could mediate dimerization, if not by coiled-coil-like interaction, by way of another novel conformation. Indeed,the x-ray crystal structures of two other bacterial gene regula-tors, catabolite gene activator protein and the lac repressor,show that they contain short coiled-coil motifs enabling subunitinteraction (20, 21).The TlpA protein encoded by the Salmonella typhimurium

virulence plasmid forms an elongated homodimer coiled-coil(15, 22). Here we show that TlpA has an ability to autoregulateits own gene by sequence-specific binding to its promoter DNA,an intriguing finding when one considers the sparse occurrenceof extensive coiled-coils in bacterial proteins. As a first steptoward dissecting the role of the coiled-coil domain in TlpA, weconstructed a panel of mutant proteins lacking various portionsof the reading frame. Purified mutant proteins were subjectedto DNA binding and transcription assays. Based on these re-sults we could localize the DNA-binding region, at the N ter-minus adjacent to the predicted coiled-coil. Evidence for in vivochain exchange also points to TlpA’s flexibility as a generegulator.

EXPERIMENTAL PROCEDURES

Plasmid Construction—Methods for DNA manipulation and trans-formation have been previously described (23). All enzymes were usedas suggested by the manufacturers (Boehringer Mannheim; New Eng-land Biolabs).Plasmids pMR11, p3062, and p3062d1, inclusive of tlpA or deleted

fragments thereof, were available from previous work (15, 22). In thep3062 series, tlpA is under the control of the tac promoter of pKK223-2(Pharmacia Biotech, Inc.), whereas in the pMR series tlpA is containedin pUC19 (New England Biolabs) and expressed from its nativepromoter.pMR12 and p3062d5 were manufactured by replacing in tlpA the

region of codons 31 to 371 with a PCR1-generated fragment encodingresidues 43–371. The oligonucleotides used for PCR were AGATATGG-GACGAATACCAG and ACGTAAGCTTCAGGGCGTCTGAATTGTCA.p3062d3 was produced by deleting the SalI-XhoI fragment in tlpA ofp3062. p3062d2 and p3062d4 were produced by deleting, respectively,the 465- and 234-bp PvuII fragments of tlpA in p3062.The pOF tlpA-lacZ transcription fusion constructs were based on the

pACYC184 vector (New England Biolabs) containing a lacZ cartridge inthe BamHI-SalI sites (pKTH3090) (24). To insert intact tlpA before lacZtlpA was transferred as a SmaI fragment into Bluescript SK1 (Strat-agene), and subsequently as a HindIII-BamHI fragment into

* This work was supported by Swedish National Science ResearchCouncil, the Academy of Finland, and NorFA (to R. H.) The costs ofpublication of this article were defrayed in part by the payment of pagecharges. This article must therefore be hereby marked “advertisement”in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.§ To who correspondence should be addressed: Microbiology and Tu-

mor Biology Center, Karolinska Institute, Box 280, 17177 Stockholm,Sweden. Tel.: 46-8-728-7173; Fax: 46-8-331547; E-mail: reini.hurme@mtc.ki.se.

1 The abbreviations used are: PCR, polymerase chain reaction; bp,base pair(s).

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 271, No. 21, Issue of May 24, pp. 12626–12631, 1996© 1996 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A.

12626

at Karolinska institutet library on February 24, 2015

http://ww

w.jbc.org/

Dow

nloaded from

at Karolinska institutet library on February 24, 2015

http://ww

w.jbc.org/

Dow

nloaded from

at Karolinska institutet library on February 24, 2015

http://ww

w.jbc.org/

Dow

nloaded from

pKTH3090 to generate pOF14. The truncated tlpA region that regu-lates lacZ expression in pOF6 was generated by PCR using S. typhi-murium pEX102 virulence plasmid DNA as a template. OligonucleotideCCTGGCAAGGAGAGTGGCGTGCAT was used for pOF6, and as asecond primer, CAGGTCGTCGACTGTCTGCGC. Next, the resultingPCR fragment was cloned into Bluescript SK1. From the resultantplasmids the inserts were cut out as BamHI-HindIII fragments beforeligation into the corresponding cloning sites of pKTH3090. Finally, alllacZ fusion constructs were supplemented with chloramphenicolacetyltransferase gene block (Pharmacia) inserted into the HindIII infront of the tlpA promoter in an opposite orientation to preventreadthrough from the plasmid.Sequence Analysis—COILS2 program based on a previous coils pro-

gram (5, 11) was used with a 28 residue window, MDITK sequenceprofile, and a weighting of a and d with a factor of 2.5.Proteins—Plasmids producing the recombinant proteins TlpA

(p3062) and dTlp1–5 (p3062d1-d5) were harbored in Escherichia coliTG1 (Amersham Corp.). Overnight cell cultures were harvested for thepurification and processed as described previously (22). All mutantTlpAs were purified according to the procedure previously described(22), except for TlpA, dTlp1, and dTlp5, which were further purified onhigh performance liquid chromatography anion exchange chromatogra-phy followed by size exclusion chromatography with resulting speciesbeing more than 95% pure. As a control for the other protein isolates, aTG1 strain transformed with the vector pKK223 (Pharmacia) was in-duced and subjected in parallel to our previous purification procedure(22). The resultant fraction exhibited no DNA binding activity evenwhen tested at high concentration in gel mobility shift assay (data notshown).Gel Mobility Shift Assays and DNase I Footprinting—DNA frag-

ments for footprinting or the mobility shift assays were end-labeledfollowing calf intestinal phosphatase (Promega) dephosphorylation(when necessary) with [g-32P]ATP (Amersham) using polynucleotidekinase (Boehringer Mannheim) following published protocols (23). A223-bp fragment containing the target sequence was PCR-amplifiedwith oligonucleotides CTCCGGACATGCTGTGCCAGCAATTC andGTCCTTCAGCCTGCAGGGCCAGCC. A 249-bp control fragment wasamplified with oligonucleotides CTCTGTATACCGGTGGTGGCGGAAand AAAGACGTGCAGGGTAGCGAAAAAGG. PCR products were phe-nol-chloroform-extracted and precipitated with ethanol. DNA pelletswere dissolved in water and quantitated spectrophotometrically. Forgel mobility shift assays (25) proteins in gel filtration buffer (50 mM

phosphate-0.15 M NaCl pH 7.0) were mixed with target DNA in abinding buffer (2 mM MgCl2, 5 mM NaCl, 6.5% glycerol, 5 mM dithio-threitol in 4 mM Tris, pH 8.0) in a final volume of 10 ml. NaCl wasadjusted to 150 mM. Proteins were used at a final concentration of 3 mM

(dimer), and DNA at 0.5 ng/reaction, while competitor DNA was used atat least a 600-fold higher concentration. Protein-DNA mixes were in-cubated for 20 min at room temperature (competition was carried outwith a preincubation step of 20 min before the addition of the labeledprobe) after which time sample buffer was added, and mixes wereloaded on a 4% polyacrylamide (29:1 acrylamide:bisacrylamide) gel castin 1 3 TBE (89 mM Tris, 89 mM borate, 2 mM NaEDTA, pH 8.3). Gelswere prerun in 1 3 TBE for at least 3 h until the current remainedconstant, 10–12 mA. Gels were dried and analyzed using a Phos-phorImager (Molecular Dynamics Inc.).DNase I footprinting was accomplished following manufacturers in-

structions utilizing the Sure Track footprinting kit (Pharmacia) withthe following modification. RQ1 DNase (Promega) was used at 2 unitsper reaction. Each binding reaction contained about 15,000 cpm labeledfragments in gel mobility shift binding buffer at final NaCl concentra-tion of 150 mM. The DNA used for footprinting was the 223-bp fragmentproduced by PCR with either one of the two oligonucleotides carryingthe radioactive label. A Maxam and Gilbert G 1 A sequencing reactionwas run for both strands. Footprinting gels were dried and eitherautoradiographed or analyzed by PhosphorImager (Molecular Dynam-ics Inc.)Transcription Fusions—Control plasmid in transcription assays is a

pUC19 with a EcoRI-HindIII fragment encompassing partly the spvAgene from the S. typhimurium virulence plasmid (24). Transcriptionfusion plasmids were propagated in E. coli TG1 grown overnight. Allmeasurements were from the stationary phase and were repeated onnumerous occasions (at least six) and often with freshly transformedcells. b-Galactosidase activity was quantitated and calculated as de-scribed elsewhere (26).Circular Dichroism (CD) Spectroscopy—CD spectra were recorded

using an Aviv 62 DS spectropolarimeter. CD spectra of wild-type andmutant TlpA proteins were recorded from 260 to 187 nm at 25 °C in 50

mM phosphate buffer, pH 7.5, containing 150 mM NaCl. Protein concen-trations used in these experiments ranged from 20 to 35 mM. As anestimate of helical content, we use the value of De222 5 212.56 M21 cm21

(u222 5 241,423 degrees cm2 dmol21) taken from the spectra of poly-L-glutamic acid supplied with the program VARSLC12 as the referencefor 100% a-helix. Protein concentrations were determined by aminoacid analysis (27) of known aliquots of protein solutions.Electron Microscopy—TlpA, dTlp1, and dTlp5 in phosphate buffer

were diluted in distilled water to a protein concentration of about 0.03mg/ml. 5-ml droplets were applied to carbon filmed grids previouslyglow discharged in air. The specimens were left on the grid for 1 min,washed with distilled water for another minute, and finally stainedwith 0.5% uranyl acetate (pH 5.0) for 1 min. The specimens wereexamined in a Jeol 1010 microscope operated at 100 keV.

RESULTS

TlpA Protein Interacts with the 59 End of tlpA Gene—Dele-tions in tlpA lead to increased levels of expression (22), whichsuggests an autoregulatory control of transcription. Seeking toestablish a functional role for TlpA it was therefore obvious totest whether this protein would have DNA-binding capabilities.First, the DNA segment comprising the tlpA gene was cut,separately, by either of two different restriction enzymes toproduce two sets, each consisting of two fragments the XhoImixture or the SnaBI mixture (Fig. 1A). Both fragment mixeswere subjected to gel mobility shift assay with purified protein.TlpA produced a disappearance of only the band which con-tained the 59 end of the SmaI fragment carrying the tlpA gene(Fig. 2, lanes 2 and 4). Thus, in each fragment mix the remain-ing portions served as internal controls for specificity. The factthat the other fragment within a pair remained unaffectedindicates that there is no nuclease activity in the protein prep-aration and also points to a specific binding reaction.Region Outside the Coiled-coil Abolishes DNA Binding—En-

couraged by the finding that purified TlpA bound DNA (Fig. 2),we constructed and purified various TlpA mutant proteins (Fig.3A) for more detailed study of the DNA-protein interaction.Mutant proteins were designed such that the deleted residuesspanned overlapping segments covering most of the proteinsequence and the predicted coiled-coil sequence (Fig. 3B). Us-ing a prediction algorithm COILS2 (11) we can distinguishareas of high coiled-coil forming probability which is shown tocover about two thirds of the protein (Fig. 3B). Since the bind-ing was directed to the 59 end of the SmaI DNA fragment (Fig.1A), we thus selected a 223-bp fragment spanning this regionfor PCR amplification and used it in screening the mutantprotein panel. In addition, a 249-bp control fragment compris-

2 M. Parthasarathy, A. Toumadje, and W. C. Johnson, personalcommunication.

FIG. 1. A, schematic representations of the tlpA gene. The tlpA generepresented by a thin box was cloned from S. typhimurium virulenceplasmid pEX102. The SmaI fragment was cut with either SnaBI orXhoI for gel mobility shift assays to generate, respectively, the SnaBIand the XhoI mixtures (see Fig. 2). B and C, promoterless lacZ car-tridge, represented by the large boxed symbol, was fused to suitablesites of tlpA to generate transcriptional lacZ fusion constructs pOF6and pOF14. Abbreviations: ATG, initiation codon of tlpA; P, tlpA pro-moter; Sma, SmaI; Sna, SnaBI; Sal, SalI; Xho, XhoI; lacZ, b-galacto-sidase promoterless gene

Bacterial Coiled-coil Regulator 12627

at Karolinska institutet library on February 24, 2015

http://ww

w.jbc.org/

Dow

nloaded from

ing upstream DNA (on the virulence plasmid) was also pro-duced to further establish sequence specificity of the binding.The control DNA fragment mixed only with the binding buffer(Fig. 4, lane 1) or TlpA (Fig. 4, lane 2), looked identical, i.e. nobinding was evident. The DNA containing the target shows adistinct binding by TlpA (Fig. 4, lane 4) as compared to a lanewhere no protein was added (Fig. 4, lane 3). This binding wasalso competed with more than a 600-fold excess of the controlfragment (Fig. 4, lane 5) or target DNA (Fig. 4, lane 6). Only theformer was able to impair the binding. A mutant which lackedsome amino acids in the N-terminal portion, dTlp1, showed adramatic loss of DNA binding (Fig. 4, lane 7). dTlp4 seemed toact analogous to TlpA (Fig. 4, lane 10), whereas dTlp2 anddTlp3 produced larger complexes barely entering the gel (Fig.4, lanes 8 and 9).TlpA Binds to the Promoter Region of tlpA—Footprinting was

carried out with wild-type TlpA and dTlp1. The 223-bp frag-ment shown to interact with TlpA in the gel mobility shiftassays was used as a target DNA also in the Dnase I protectionassay. The mutant protein dTlp1 produced a pattern indistin-guishable from a lane containing only DNA, verifying the factthat it does not interact with the nucleic acid (Fig. 5A, lanes 4and 8), whereas TlpA protected a broad region on both strands(Fig. 5A, lanes 3 and 7). The protected area, matching on bothstrands, encompasses a putative promoter region, namely aconsensus 210 element (TATAAT) based on the transcription

start point delineated previously (22) and a 235 element (TT-TATT) where only three out six consensus residues are present(Fig. 5B). Also a striking GT-rich stretch is evident in thefootprint (Fig. 5B).Mutant Protein Lacking 13 Amino Acids Shows Loss of Func-

tion—Satisfied with the fact that dTlp1 showed no intent tointeract with DNA in gel mobility shift assays or footprinting,we created a new mutant, dTlp5. dTlp5, analogous to dTlp1 butwith a smaller deleted region, was constructed in order toidentify the residues responsible for the protein-DNA interac-tion more closely. The new mutant protein, dTlp5, lacking 13amino acids (31–43; Fig. 3A) showed no evidence of bindingcompared to wild-type TlpA in mobility shift assay (Fig. 6,lanes 2 and 4). Lanes containing no protein or dTlp1 or dTlp5looked indistinguishable (Fig. 6, lanes 1, 3, and 4)Nonbinding Mutants Are as Helical as the Wild Type—The

structural integrity of the mutant proteins, as compared toTlpA, was monitored using circular dichroism spectroscopy, torule out massive perturbation of the folding as a cause for lossof biological activity. The CD spectra of dTlp1 (82% a-helical)and dTlp5 (82% a-helical) mutants are nearly indistinguish-able from the wild-type TlpA (85% a-helical; Fig. 7), indicatingthat their a-helicity and most probably their coiled-coil formingpotential remains intact despite the deleted segments.dTlp1 and dTlp5 Form Oligomers in Electron Microsco-

py—To assess whether the binding differences should dependon oligomer state and to see any differences in the morphologyof higher order structure, the solutions of mutant proteins wereexamined for their capacity to form higher protein-protein or-ganization in electron microscopy. TlpA as shown before (15)produced all levels of assembly where stacks of small fibers(data not shown) could be seen culminating in the filamentnetwork (Fig. 8A). dTlp1 also showed a similar propensity (Fig.8B). Surprisingly we could not find filament networks of samemorphology in the dTlp5 preparation, although it also was ableto assemble into smaller filament stacks (Fig. 8C).Transcription Assays Show Repressor Mechanism of TlpA

Action—In order to ascertain the activity of TlpA on itspromoter in vivo, transcriptional lacZ (b-galactosidase) fu-sions to the tlpA gene were constructed (Fig. 1, B and C).Since footprinting had shown that TlpA binds to promoterelements, we expected this to have an effect on transcriptionas well. Basal transcription levels of the fusions were meas-ured in strains co-transformed with an isogenic plasmid con-struct containing no tlpA (Table I). The fusion constructpOF6 (Fig. 1B) contained only a portion of the tlpA readingframe, so that promoter activity could be measured withoutinterference from TlpA. Construct pOF6 had a basal activityof 1170 Miller units (Table I), indicating that the fragment

FIG. 2. Gel mobility shift assay with the tlpA gene fragments.Fragments derived from differentially digested tlpA SmaI block, witheither XhoI or SnaBI, were radiolabeled and mixed with TlpA or onlythe binding buffer. TlpA addition leads to a disappearance of the 59 endfragment in tlpA. Abbreviations: X, no protein added; T, TlpA; Xh, XhoI;Sn, SnaBI

FIG. 3. A, schematic representation of deleted regions in TlpA aminoacid sequence. Internal (dTlp1-dTlp5) deletion derivatives of TlpA areshown underneath with the line symbol indicating residues present ineach protein. All deletions are in frame, i.e. the proteins are translatedin their entirety but lacking the residues indicated. B, plot of theprobability of coiled-coil formation. Probability P(S) is shown as afunction of amino acid residue number in TlpA protein. Figure wascalculated and produced with the COILS2 program (5, 11).

FIG. 4. Gel mobility shift assays. A, specificity controls for TlpAbinding. TlpA was mixed with either the putative target or noncognateDNA and subjected to a mobility shift assay. Same DNA fragmentswere used at more than 600-fold excess to compete the binding. B,binding of TlpA mutant proteins to target DNA competed with noncog-nate DNA. Abbreviations: T, TlpA; T1, dTlp1; T2, dTlp2; T3, dTlp3; T4,dTlp4; C, control DNA fragment; F, DNA fragment which includes thetarget.

Bacterial Coiled-coil Regulator12628

at Karolinska institutet library on February 24, 2015

http://ww

w.jbc.org/

Dow

nloaded from

preceding lacZ, indeed contains an active promoter. FusionpOF14 capable of expressing TlpA, had a 6-fold reduced basalactivity, of 155 Miller units (Table I) as compared to pOF6,indicating that full-length TlpA exerted a significant repres-sor activity on the tlpA promoter. As a further confirmation,TlpA effects were measured in trans with strains carrying atranscription fusion co-transformed with a plasmid express-ing TlpA from its own promoter or a synthetic promoter(Table I). Fusion pOF6 showed a reduced activity when TlpAwas present in trans of 245 units and at higher level TlpAproduction upon induction of the synthetic promoter of 50units (Table I). dTlp5 on the other hand was not able torepress pOF6, supporting our in vitro data which showed alack of interaction region in that protein (Fig. 6). The relativeamounts of TlpA produced from a wild-type promoter or asynthetic tac promoter is roughly illustrated by whole celllysates of E. coli harboring appropriate constructs. TlpA pro-duced from tlpA promoter cannot be distinguished in Coo-massie Blue-stained SDS-polyacrylamide gel electrophoresisgels, whereas tac-directed TlpA expression shows massiveproduction as indicated by the appearance of an intense TlpAband in the gel (15). The reason for using both sources of TlpAproduction was to exclude the possibility of interference of

normal cellular function upon massive overproduction ofTlpA which previously has been shown to literally pack thewhole cell with this protein (15).Transcription Assays Suggest in Vivo Chain Exchange—

Transcription assays provided us with an opportunity to testwhether TlpA would undergo chain exchange in vivo as hasbeen demonstrated in vitro (15). As an indirect readout ofheterodimer formation, we used the transcription activity offusion pOF14 expressing full-length TlpA in trans supple-mented with dTlp5. We reasoned that if brought in trans, amutant TlpA containing a defective DNA-binding domain couldactivate the pOF14 transcription by forming heterodimers not

FIG. 5. DNase I footprinting of thetlpA 5* region. A, a 223-bp cognate DNAfragment was labeled differentially toprobe both strands (lanes 1–4 and 5–8).Maxam-Gilbert G 1 A reaction was run toenable sequence recognition (lanes 1 and5). Abbreviations: X, no protein added; T,TlpA; T1, dTlp1; G, G 1 A sequencingreaction B, nucleotide sequence of thetlpA 59 end is shown where the regionidentified in protection assays is markedby a line above or below the correspondingstrand. In the sequence the transcriptionstart site is marked by a 11 (22), and thearrow marks the first translated codon(ATG) in tlpA.

FIG. 6. Gel mobility shift assay showing the loss of function indTlp1 and dTlp5. Abbreviations: X, no protein added; T, TlpA; T1,dTlp1; T5, dTlp5

FIG. 7. Circular dichroism spectra recorded of wild-type TlpA(open circles) and the deletion mutants, dTlp5 (open triangles)and dTlp1 (open squares). Spectra were recorded from 186 to 260 nmat 0.5-nm increments at 25 °C in 50 mM phosphate buffer pH 7.0, 150mM NaCl. Inset shows an SDS-polyacrylamide gel electrophoresis ofpurified proteins used throughout these studies.

Bacterial Coiled-coil Regulator 12629

at Karolinska institutet library on February 24, 2015

http://ww

w.jbc.org/

Dow

nloaded from

capable of repressing the tlpA promoter. Indeed, when broughtin trans to pOF14, the nonbinding TlpA derivative, dTlp5,showed an 8-fold activation of that fusion from 155 to 1250units (Table I). dTlp5 protein expressed from its native pro-moter on a multicopy plasmid can also be detected in Coomas-sie Blue-stained gels, probably due to the lack of the DNA-binding region and hence the inability to repress. This alsoindicates that there is a continuous supply of the dTlp5 proteinavailable for heterodimer formation.

DISCUSSION

Previously we have described that S. typhimurium virulenceplasmid codes for a coiled-coil protein TlpA which is a temper-ature-dependent chain-exchanging entity as shown in our invitro system and is also able to form oligomeric structuresresembling intermediate filaments in morphology (15, 22). Thebiological function (if any) of oligomerization remains at pres-ent unresolved, yet our new finding that TlpA is a gene regu-lator fits well with the flexibility offered by the monomer ex-change phenomenon.The sequence specificity of binding by TlpA is clearly dem-

onstrated by footprinting and gel mobility shift assays. Bindingwas directed to specific target DNA, and could be competedonly with a fragment containing this sequence (Fig. 4A). Theinability to see a well resolved TlpAzDNA complex in gel mo-bility shift assays could indicate that protein-protein associa-tions produce different sized oligomers (15) which dissipate thelabel throughout the running lane. The most apparent expla-nation for this is that a dimer binds DNA and undergoes higheroligomer interactions, producing complexes with different com-positions. Then again, in vivo, the amount of TlpA may be solow that the issue of oligomerization may be redundant. Foot-printing also showed a preferred region of interaction (Fig. 5)and identified the 210 and 235 elements in the broad pro-tected region. Hydroxyl radical footprinting will hopefully shedmore light on whether the large footprint is due to steric hin-drance caused by TlpA or binding to several operator sites inthe promoter region.With our mutant-protein panel we have demonstrated the

localization of the DNA-binding region with respect to thecoiled-coil domain and also begun to probe the role of the latterin the binding. The only residues whose deletion leads to abol-ished DNA binding are those that map to the N-terminal por-tion of TlpA, adjacent to the predicted coiled-coil as delineatedfrom lack of binding by dTlp1 and dTlp5 (Fig. 6). Deletionswithin the coiled-coil most adjacent to the DNA-binding regionproduced a different complex in the gel mobility shift assay asshown by dTlp2 and dTlp3 (Fig. 4). This can be interpreted aseither a higher oligomer stabilization at the expense of anysmaller complexes, or more likely as some loss of binding spec-ificity, i.e. more protein is bound per DNA, suggesting coiled-

coil serves a role in positioning the binding regions. Such anassumption is supported by the fact that dTlp4, with a consid-erable deletion in the coiled-coil but more distant to residuesimplicated in binding, showed a gel mobility shift patternwhich was similar in appearance to that produced by the wild-type TlpA (Fig. 4).The capacity for oligomerization can be ruled out as a single

key element of importance for binding since the DNA binding-deficient forms showed also a tendency for organized higherorder protein-protein interactions. Based on the dominant neg-ative phenotype of dTlp5 (and dTlp1, data not shown) we be-lieve the binding structure to be minimally a dimer. Fromprevious studies we can conclude that dTlp1 (referred to pre-viously as the 41-kDa protein) (15) is able to form parallelunstaggered dimers with TlpA. dTlp5, which has a smallerdeletion at the N terminus, shows a CD spectra nearly identicalto TlpA and dTlp1, therefore we believe it also readily formsdimers (dTlp5 is rapidly oxidized into disulfide bridge dimers;data not shown). Also, the oligomer assembly of dTlp5 showsthe capacity for formation of filament stacks in electron micros-copy. It is unlikely, yet possible, that the inability to see a fullydeveloped filament network in dTlp5 reflects an effect of thedeleted residues, because dTlp1 with an overlapping but largerdeleted segment shows all forms of oligomer arrangement. Inany case, electron microscopy shows clearly that the fibrousappearance is intact, and this would not be expected in arandomly folded polypeptide preparation (nor would the highlyhelical CD spectra). Residues deleted in dTlp5 serve as a roadmap for identification of all of the critical residues which areneeded for specific DNA interaction. We do not know to whatextent the 13 amino acids are representative of the residuescritical to function in the N-terminal DNA-binding region andwhether the DNA-binding residues form an independent do-main or are an extension of the coiled-coil. More detailed stud-ies are underway to reveal the nature of the DNA-bindingdomain in TlpA, which could represent a novel combination ofa DNA-binding structure coupled to a coiled-coil. At present weare unable to find any significant homology to known DNA-binding motifs in any part of tlpA sequence. Collectively ourdata indicates that TlpA consists of a functional outline wherethe N terminus is responsible for DNA binding and the adja-cent long coiled-coil serves to dimerize the binding interfacesand position them for sequence specific contacts.Transcription assays have shown that the region bound by

TlpA contains an active promoter which can be repressed byTlpA in trans, but not by dTlp5 (Table I). These findings alsoset the stage for testing for in vivo chain exchange. Previously,we had shown that TlpA dimers at 37 °C are capable in mon-omer exchange with related partners, underscoring the dy-namic nature of this protein (15). The transcription reporterconstruct pOF14 which is little active by itself, when propa-gated in a cell which also produces the DNA-binding mutantdTlp5, is activated to levels exhibited by the nonrepressed tlpApromoter. This can be easily explained if one considers that forevery TlpA translated from the pOF14 transcript there isbound to be a dTlp5 partner protein for dimer formation orchain exchange between homodimers. Such heterodimerswould be composed of one wild-type monomer with an intactrecognition half-site and one monomer lacking this region. This

TABLE ILacZ activities (in Miller units) of double transformants

lacZ fusionProtein encoded by co-transformed plasmid

Control TIpA TIpA (tac) dTIp5

pOF6 1170 6 214 245 6 209 50 6 0 1470 6 380pOF14 155 6 60 175 6 64 83 6 29 1250 6 255

FIG. 8. Electron microscopy of TlpA and the two nonbindingmutants showing protein-protein interaction leading to a for-mation of filaments and filament networks. A, TlpA; B, dTlp1; C,dTlp5

Bacterial Coiled-coil Regulator12630

at Karolinska institutet library on February 24, 2015

http://ww

w.jbc.org/

Dow

nloaded from

is analogous to eukaryotic CHOP or Id proteins which have adefective and a nonexistent DNA-binding domain, respectively,and form inactive heterodimers with other partners andthereby block transcription factors from binding to their tar-gets (28, 29). The heterodimerization in the case of TlpA pointsalso to the importance of the coiled-coil in organizing the struc-ture into a binding proficient form.A gene regulator such as TlpA would certainly have a role in

the pathogenesis of virulent bacteria such as S. typhimurium,which is under constant pressure to sense its environmentbefore entering the host, and while in the host as it progressesfrom one niche to another along its route of invasion experienc-ing changes in pH, temperature, and osmolarity (30). Coiled-coil structures which are known from many studies to respondto changes in the environment (31), could be ideal sensors tovariations in the intracellular environment. An elevated tem-perature or osmolarity could affect the interactions within thecoiled-coil domain and be sensed directly by the cytoplasmicTlpA. Temperature can of course influence TlpA activity, sincethere likely exists a dimer-monomer equilibrium in the cell,and by raising the temperature the equilibrium could beshifted more toward the monomer which could not bind DNAby itself. Ongoing studies are aimed at addressing the questionof inducing signals and the targets for TlpA interaction. Fi-nally, it is tempting to speculate that bacteria encode a set ofgene regulators that exploit the coiled-coil motif and het-erodimerization capacity. Another candidate for this new pro-tein family is the E. coli protein, KfrA, also characterized by anextensive coiled-coil domain and an ability to autoregulateitself (14).

Acknowledgments—We thank Hannes Loferer and Staffan Normarkfor critical discussions.

REFERENCES

1. Cohen, C., and Parry, D. A. D. (1990) Proteins 7, 1–152. Cohen, C., and Parry, D. A. D. (1994) Science 263, 488–4893. Crick, F. H. C. (1953) Acta Crystallogr. 6, 689–6974. McLachlan, A. D., and Stewart, M. (1975) J. Mol. Biol. 98, 293–3045. Lupas, A., van Dyke, M., and Stock, J. (1991) Science 252, 1162–11646. Baxevanis, A. D., and Vinson, C. R. (1993) Curr. Opin. Gen. Dev. 3, 278–2857. O’Shea, E. K., Klemm, J. D., Kim, P. S., and Alber, T. (1991) Science 254,

539–5448. O’Shea, E. K., Rutkowski, R., and Kim, P. S. (1989) Science 243, 538–5429. Sessa, G., Morelli, G., and Ruberti, I. (1993) EMBO J. 12, 3507–351710. Marmorstein, R., and Harrison, S. C. (1994) Genes & Dev. 8, 2504–251211. Lupas, A., Muller, S., Goldie, K., Engel, A. M., Engel, A., and Baumeister, W.

(1995) J. Mol. Biol. 248, 180–18912. Fischetti, V. A. (1989) Clin. Microbiol. Rev. 2, 285–29013. Niki, H., Imamura, R., Kitaoka, M., Yamanaka, K., Ogura, T., and Hiraga, S.

(1992) EMBO J. 11, 5101–510914. Jagura-Burdzy, G., and Thomas, C. T. (1992) J. Mol. Biol. 225, 651–66015. Hurme, R., Namork, E., Nurmiaho-Lassila, E.-L., and Rhen, M. (1994) J. Biol.

Chem. 269, 10675–1068216. Maxon, M. E., Wigboldus, J., Brot, N., and Weissbach, H. (1990) Proc. Natl.

Acad. Sci. U. S. A. 87, 7076–707917. Noonan, B., and Trust, T. J. (1995) Mol. Microbiol. 17, 379–38618. Levchenko, I., York, D., and Filutowicz, M. (1994) Gene (Amst.) 145, 65–6819. Sasse-Dwight, S., and Gralla, J. D. (1990) Cell 62, 945–95420. Weber, I. T., and Steitz, T. A. (1987) J. Mol. Biol. 198, 311–32621. Friedman, A. M., Fischmann, T. O., and Steitz, T. A. (1995) Science 268,

1721–172722. Koski, P., Saarilahti, H., Sukupolvi, S., Taira, S., Riikonen, P., Osterlund, K.,

Hurme, R., and Rhen, M. (1992) J. Biol. Chem. 267, 12258–1226523. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A

Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold SpringHarbor, NY

24. Rhen, M., Riikonen, P., and Taira, S. (1993) Mol. Microbiol. 10, 45–5625. Carey, J. (1991) Methods Enzymol. 208, 103–11726. Miller, J. H. (1972) Experiments in Molecular Genetics, pp. 325–355, Cold

Spring Harbor Laboratory, Cold Spring Harbor, NY27. Mora, R., Berndt, K. D., Tsai, H., and Meredith, S. C. (1988) Anal. Biochem.

172, 368–37628. Benezra, R., Davis, R. L., Lockshon, D., Turner, D. L., and Weintraub, H.

(1990) Cell 61, 49–5929. Ron, D., and Habener, J. F. (1992) Genes & Dev. 6, 439–45330. Foster, J. W., and Spector, M. P. (1995) Annu. Rev. Microbiol. 49, 145–17431. Jancso, A., and Graceffa, P. (1991) J. Biol. Chem. 266, 5891–5897

Bacterial Coiled-coil Regulator 12631

at Karolinska institutet library on February 24, 2015

http://ww

w.jbc.org/

Dow

nloaded from

Additions and Corrections

Vol. 271 (1996) 12626–12631

DNA binding exerted by a bacterial gene regulatorwith an extensive coiled-coil domain.

Reini Hurme, Kurt D. Berndt, Ellen Namork, andMikael Rhen

Page 12626: The affiliations were listed incorrectly. Thecorrect affiliations are indicated below:

Reini Hurme‡§, Kurt D. Berndt¶, Ellen Namorki, and Mikael Rhen‡

From the ‡Microbiology and Tumor Biology Center and the ¶Department of Medical Biochemistry and Biophysics, KarolinskaInstitute, 17177 Stockholm, Sweden and iElectron Microscopy Unit, National Institute of Public Health, Torshov, N-0403 Oslo,Norway

§ To whom correspondence should be addressed: Microbiologyand Tumor Biology Center, Karolinska Institute, Box 280, 17177Stockholm, Sweden. Tel.: 46-8-728-7173; Fax: 46-8-331-547; E-mail:reini.hurme@mtc.ki.se.

We suggest that subscribers photocopy these corrections and insert the photocopies at the appropriateplaces where the article to be corrected originally appeared. Authors are urged to introduce thesecorrections into any reprints they distribute. Secondary (abstract) services are urged to carry notice ofthese corrections as prominently as they carried the original abstracts.

17592

and Mikael RhenReini Hurme, Kurt D. Berndt, Ellen Namork  DomainRegulator with an Extensive Coiled-coil DNA Binding Exerted by a Bacterial GeneProtein Chemistry and Structure:

doi: 10.1074/jbc.271.21.126261996, 271:12626-12631.J. Biol. Chem. 

  http://www.jbc.org/content/271/21/12626Access the most updated version of this article at

  .JBC Affinity SitesFind articles, minireviews, Reflections and Classics on similar topics on the

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

  http://www.jbc.org/content/271/21/12626.full.html#ref-list-1

This article cites 29 references, 12 of which can be accessed free at

at Karolinska institutet library on February 24, 2015

http://ww

w.jbc.org/

Dow

nloaded from