decreased expression of the satiety signal receptor cckar is responsible for increased growth and...

Decreased expression of the satiety signal receptor CCKAR is responsible forincreased growth and body weight during the domestication of chickens

Ian C. Dunn, Simone L. Meddle, Peter W. Wilson, Chloe A. Wardle, Andy S. Law, Valerie R. Bishop,Camilla Hindar, Graeme W. Robertson, Dave W. Burt, Stephanie J. H. Ellison, David M. Morrice,and Paul M. HockingUniversity of Edinburgh, Roslin Institute and Royal (Dick) School of Veterinary Studies, Easter Bush, United Kingdom

Submitted 20 November 2012; accepted in final form 22 February 2013

Dunn IC, Meddle SL, Wilson PW, Wardle CA, Law AS, BishopVR, Hindar C, Robertson GW, Burt DW, Ellison SJ, MorriceDM, Hocking PM. Decreased expression of the satiety signalreceptor CCKAR is responsible for increased growth and bodyweight during the domestication of chickens. Am J Physiol Endo-crinol Metab 304: E909 –E921, 2013. First published February 26,2013; doi:10.1152/ajpendo.00580.2012.—Animal domesticationhas resulted in changes in growth and size. It has been suggested thatthis may have involved selection for differences in appetite. Divergentgrowth between chickens selected for egg laying or meat productionis one such example. The neurons expressing AGRP and POMC in thebasal hypothalamus are important components of appetite regulation,as are the satiety feedback pathways that carry information from theintestine, including CCK and its receptor CCKAR (CCK1 receptor).Using 16 generations of a cross between a fast and a relatively slowgrowing strain of chicken has identified a region on chromosome 4downstream of the CCKAR gene, which is responsible for up to a19% difference in body weight at 12 wk of age. Animals possessingthe high-growth haplotype at the locus have lower expression ofmRNA and immunoreactive CCKAR in the brain, intestine, andexocrine organs, which is correlated with increased levels of orexi-genic AGRP in the hypothalamus. Animals with the high-growthhaplotype are resistant to the anorectic effect of exogenously admin-istered CCK, suggesting that their satiety set point has been altered.Comparison with traditional breeds shows that the high-growth hap-lotype has been present in the founders of modern meat-type strainsand may have been selected early in domestication. This is the firstdissection of the physiological consequences of a genetic locus for aquantitative trait that alters appetite and gives us an insight into thedomestication of animals. This will allow elucidation of how differ-ences in appetite occur in birds and also mammals.

appetite; cholecystokinin type A receptor; chicken; domestication;agouti-related protein

IT HAS BEEN HYPOTHESIZED that appetite has been modified as partof the domestication process to increase food intake andfacilitate increased growth in birds (10, 17, 53) and mammals(49) in the pursuit of increased efficiency and rapid growth.Normally, appetite is regulated to ensure an optimal bodyweight and adiposity; however, there is clearly genetic varia-tion in the “set point” for body weight (36), and different setpoints may be favored in different environments (45). Theappetite control system includes central and peripheral systems(78). Activation of proopiomelanocortin (POMC)-containingneurons in the arcuate nucleus of the hypothalamus or itsequivalent in birds results in weight loss through a reduction in

appetite (9, 78); activation of agouti-related protein (AGRP)-containing neurons antagonizes the effect of POMC throughthe melanocortin MC4 receptor, and therefore, they are orexi-genic or appetite promoting. A number of peripheral systemsfeed back to these neurons to determine the level of foodintake and ultimately the growth of an animal. These includeadiposity signals such as insulin, gut peptides such ascholecystokinin (CCK), and peptide YY and the afferentvagus (78). In mammals leptin participates in the feedback,but in the chicken this system is absent (66), and the actionof ghrelin on food intake has been shown to be the oppositeof that found in mammals (25).

Utilizing a cross of fast- and relatively slow-growing chickenstrains, it has been possible to map genetic loci [quantitativetrait loci (QTL)] for growth characteristics (32, 65), the mostsignificant of which is on chromosome 4. Using an advancedintercross between a fast-growing broiler strain and a relativelyslow-growing egg laying strain, we have narrowed down theregion and identified the expression of the CCK type Areceptor (CCKAR) gene as the candidate for differences ingrowth at the locus on chromosome 4. In mammals, CCK actspredominately on the G protein-coupled receptor CCKAR(HUGO and Chicken Gene Nomenclature Consortium; http://www.agnc.msstate.edu/), also known as the CCK1 receptor(IUPHAR nomenclature), to reduce food intake and increasesatiety (67). In birds, although it is well established thatexogenous CCK inhibits short-term food intake (61), experi-ments with CCK receptor antagonists have been inconclusive(55). Our study provides new evidence for the location ofCCKAR within the avian brain and shows that CCKAR is lessabundant in birds carrying the high-growth allele. Peripheralsignaling of satiety is altered between the genotypes, resultingin reduced sensitivity to the CCK satiety signal. In turn, thecentral levels of expression of the hypothalamic orexigenicpeptide AGRP are increased in birds carrying the high-growthallele.

METHODS

Animal Populations

Advanced intercross population (advanced intercross line). Off-spring from a reciprocal mating of a White Leghorn, which is alight-layer line, and a commercial male line of broilers, which is aheavy-meat chicken, were used to establish an advanced intercrossline (AIL) to allow fine mapping (14). For the F2 onward, five malesand five females were selected from 12 families to minimize inbreed-ing (22). Female offspring in the F8 and offspring from both sexes inthe F16 were reared in floor pens (3 � 2 m) on ad libitum-layer rationson an 8:16-h (light-dark) photo period. Body weight was recorded at3, 6, 9, 12, and 20 wk of age.

Address for reprint requests and other correspondence: I. C. Dunn, TheRoslin Institute and Royal (Dick) School of Veterinary Studies, Univ. ofEdinburgh, Easter Bush, Midlothian, EH25 9RG, Scotland, UK (e-mail:[email protected]).

Am J Physiol Endocrinol Metab 304: E909–E921, 2013.First published February 26, 2013; doi:10.1152/ajpendo.00580.2012.

Licensed under Creative Commons CC-BY 3.0: the American Physiological Society. ISSN 0193-1849.http://www.ajpendo.org E909

http://www.agnc.msstate.edu/


mailto:[email protected]

http://creativecommons.org/licenses/by/3.0/deed.en_US

Four male and 11 female F16 parents heterozygous for the CCKARhaplotype (see Genotyping) were mated to avoid brother-sister mat-ings, and the offspring were reared in floor pens on a 14:10-h(light-dark) photo period. They were transferred to individual cages at2 wk of age and fed ad libitum on a standard-layer starter diet.

Multistrain. The multistrain population is not a single population,as the name suggests, but a set of samples from a large range ofchicken strains. It comprised males of 1) 13 traditional or pure breedswith a range of growth phenotypes (Auracana, Barnevelder, BrownLeghorn, Buff Orpington, Cornish Game, Friesian Fowl, Ixworth,Jersey Giant, J-line, Light Sussex, Maran, White Dorking, WhiteSussex), 2) 12 modern-meat type lines, and 3) 12 modern layer lines.The populations have been described previously (58). Twelve indi-viduals of each breed sired by two to four males were available withrecords of body weight at 10 wk of age that were used to comparegenotypes with phenotypes.

Animal care and use protocols were approved by the RoslinInstitute. All animal work was carried out under the UK Home Officelicense guidelines and regulations [Animal Scientific Procedures Act(1986)].

Genotyping

Informative single nucleotide polymorphisms (SNP) on chromo-some 4 were selected using a SNP finder (74) and targeted sequencingand from testing Beijing SNPs (76) on the founders of the AIL usinga SNPlex assay.

Genotyping was carried out using a SNPlex assay (Applied Bio-systems, Paisley, UK) and checked using a genotype checker (52) forpedigree and genotype quality. Markers and individuals were removedif there was �20% error. The 77 successful genotypes between1,759,990 and 88,895,200 on chromosome 4 were managed andstored using resSpecies (38). All positions in this article are referencedto the 2006 build of the genome. Genotyping of markers ch4snp-131-42-9157-S-2, ch4snp-85-282-3484-S-1, ch4snp-31-245-11611-S-1,ch4snp-131-132-4046-S-2, ch4snp-85-157-3063-S-2, and CCKAR_MnlI for estimation of association in generation F16 and in themultistrain animals was carried out by Kbiosciences (Hoddesdon,Herts, UK). These markers were all completely informative in theAIL. In other words, they were fixed in the founders, except forch4snp-85-282-3484-S1 and ch4snp-131-42-9157-S2, which were notfully informative; i.e, in one of the lines both alleles were found.

Genotyping of Markers in the CCKAR Gene for Selection ofExperimental Birds

A SNP marker, CCKAR_MnlI, in exon 3 of the CCKAR gene waschosen to represent the CCKAR haplotype, differentiating the AILfounders combined with the most significant marker flanking theCCKAR gene, ch4snp-131-132-4046-S-2, to produce a larger haplo-type for selection. CCKAR_MnlI was genotyped using a MnlI RFLPusing primers CCKAR_F3 and CCKAR_altR3 (Table 1), ch4snp-131-132-4046-S-2 by an AluI RFLP (G/T) using Chr4:77192329F andChr4:77192329R primers (Table 1), and ch4snp-32-183-65476-S-1by a MwoI RFLP (A/G) using Chr4:65117463F and Chr4:65117463Rprimers (Table 1).

Analysis

Screening of the data for association was carried out using Gen-Abel (1). The most significant markers were subsequently fitted byrestricted maximum likelihood (Genstat Version 12), including penand sire, using a linear model as described previously (21), followedby approximate Student t-tests to assess marker effects. In the F16generation, sex was also included in the model. The additive effect ofeach marker was estimated as one-half of the difference betweenhomozygote means.

Sequencing of CCKAR

Primers (Table 1) were designed to flank all exons, the putativeproximal promoter, and the region downstream of the CCKAR geneusing Primer 3 software (56). Resequencing was carried out at theCCKAR locus from the 16th generation of the advanced intercrossline, four individuals from the high- and four from the low-growthgenotype, by GATC-Biotech (Konstanz, Germany).

Effect of CCK Injection on Food Intake

Eight individually housed animals of each CCKAR genotype werehandled daily for 1 wk prior to injection. At 3 wk of age, 0 or 10�g/kg sulfated CCK octapeptide (Tocris Bioscience, Bristol, UK) wasadministered via an intraperitoneal (ip) injection, with 1 day betweenthe randomized doses. This is in the middle of the dose response range(8, 12). Each bird acted as its own control. Food intake was recordedat 30 min after injection. The birds were returned to their home pens,and at 12 wk of age the birds were euthanized by barbiturate overdose.The basal hypothalamus, preoptic area of the hypothalamus, pituitary,hindbrain, duodenum, small intestine, ceca, gall bladder, and pancreaswere collected and immediately frozen in liquid nitrogen and stored at�80°C. The basal and preoptic area of the hypothalamus dissection

Table 1. Primers used in the sequencing, real-time PCR, orgenotyping of the CCKAR gene loci

CCKAR exon1F GTGGTGTTGGTTGAGAGACGCCKAR exon1R CAGCAAAGCAGTGATGTTGGCCKAR exon1Fb AACCAGCCTTCTTCCTAGCAGCCKAR exon1Rb GTGCACTGCTCATTCACCACCCKAR exon2F GGCTTTTGAAAGGGTGTACCTCCKAR exon2R TTCTCACATACCCCACTGGTTCCKAR_F3 CATTTGAAAACAGCAGAAGCACCKAR_altR3 CTGCTGAATGACATCACTTGGCCKAR exon3Rb TTACAGCAGGGGCTTAGCAGCCKAR exon4F AGGCACTCCCCTTTAAGAGCCCKAR exon4R GGTCCTAATCCACAGCCAGACCKAR exon5F GGCCAAGAAACTTGTCATCCCCKAR exon5R CTCACAGCGTTTACTGTCAGCCCKAR exon5Fb AATACTGGTGGCCAGCAAACCCKAR exon5Rb CTCTAATCACAGGCGGCTTCCCKAR 3= F GTTTCCGCATGGGTTTTCTACCKAR 3= R TTCAGCCTTATCCCTGTGCTCCKAR upstreamF TACCCTTGAGGCTGGAAATGCCKAR upstreamR TCTCAGAGGGAGGTTGCTGTChr4: 77192329F TCCATGGACCTCTTATCCTCAChr4: 77192329R TGCTCTCATCCAATGACACATchr4: 65117463F CGGCGATACTTCGTAGCACTchr4: 65117463R CTCAGCTGTATCCCAGCACACCKAR ex-F2 TACAGCAAGCTGGTCCCTTTCCKAR ex-R2 AATGAAATGAGGCCATACGCRBPJ_F1 CCATGCCAGTTCACAACAGTRBPJ_R1 CGGATCATCTGCATCCAATASlc34a2_F1 TGAAGATGCCCCTGAGCTACSlc34a2_R1 GGTCCACGTCACATTTCCTTPI4K2B_F1 TGGTTCTTCCTCGCATCTCTPI4K2B_R1 GTGGCATCTGAACAAGCTGASEPSECS_F1 GTTGGCAGACATCCACAATGSEPSECS_R1 GCAGCATTGAGGTAAGCACASOD3_F1 GTTGTGTCCGATCCCACCTSOD3_R1 TGAAGTAACACGCTGCTTGGDHX15_F1 GATCTGGGCGACGATTACAGDHX15_R1 TGTGTGGAATCATTGCTGGTPPARGC1A_F1 ACAAAACCATGCGAACACAAPPARGC1A_R1 TTGGTCTGAGGAGGGTCATCLCORL_F1 AGGGCTTTATGGACCAAGGCLCORL_R1 CTGACGCACGATCACTGACTSLIT2_F2 TGGAGCCTCTGGTGTCAATGSLIT2_R2 CGGTGGTGATCTGGTTGTCATA

CCKAR, CCK type A receptor.

E910 CCKAR AND DOMESTICATION

AJP-Endocrinol Metab • doi:10.1152/ajpendo.00580.2012 • www.ajpendo.org

has been described previously (37); the duodenum sample was takenfrom the tip of the pancreatic loop and the small intestine 1 cmposterior to the junction of the ceca. The samples from the sameanimals were also used for estimation of allele-specific expression.

Expression Analysis

RNA isolation and reverse transcription. Total RNA was extractedfrom �100 mg of tissue using Ultraspec II reagent (AMS Biotech-nology, Abingdon, UK) and Lysing Matrix D tubes in a FastPrepInstrument (MP Biomedicals, Cambridge, UK) or homogenized usinga T10 Ultraturrax (IKA Werke), depending on tissue type. Total RNAwas reverse transcribed using NotI-(dT)18 primer and a First-StrandcDNA synthesis kit (GE Healthcare, Buckinghamshire, UK) accord-ing to the manufacturer’s protocol. cDNA samples were diluted �15for use in real-time PCR.

Real-time PCR assays. CCKAR-, AGRP-, and LBr-specific prim-ers were designed using Primer 3 (56) to amplify products of �100–200 bp in length crossing intron/exon boundaries, (Table 1). Similarly,assays were designed for genes in the vicinity of CCKAR and themarkers most significantly associated with body weight, i.e., RBPJ(chr4: 75,648,820), Slc34a2 (chr4: 75,884,660), PI4K2B (chr4:75,987,346), SEPSECS (chr4: 76,012,821), SOD3 (chr4: 76,176,057),DHX15 (chr4: 76,221,629), PPARGC1A (chr4: 76,629,533), SLIT2(chr4: 77,708,527), and LCORL (chr4:78,711,367) (for primers used,see Table 1). PCR products for standards were purified using aQIAEX II gel extraction kit (Qiagen, Crawley, West Sussex, UK) andtheir concentrations measured using a NanoDrop spectrophotometer(Thermo Fisher Scientific, Loughborough, Leicestershire, UK). Serialdilutions of standards were made to create standard curves for real-time PCR quantification. Real-time PCR reactions were run on anMX3000p real-time PCR machine (Agilent Technologies, Cheshire,UK) using the following conditions: 95°C for 2 min, 40 cycles of95°C for 15 s, and 60°C for 30 s. Real-time PCR reactions (25 �l)were run using a 10-�l cDNA template together with SYBR greenmaster mix (VHBio Ltd, Gateshead, UK) and gene-specific primers(100 nM). Samples and standard curves were run in duplicate on thesame 96-well plate along with water blank controls. Standards werediluted to produce top standards detectable after �15 PCR cycles.Assays were analyzed using MxPro software (Agilent Technologies),and both CCKAR and AGRP expression were normalized using laminB receptor expression (42).

Allele-specific expression. To determine whether the slow- andhigh-growth alleles were differentially expressed in heterozygotes, weutilized one of the synonymous SNPs (dbSNP ss 550122602) thatsegregated between the genotypes and was present in exon 5 of theCCKAR gene. The SNP could be diagnosed by digestion withrestriction enzyme AcuI on hypothalamic cDNA amplified usingprimer CCKARex-F2 and CCKARexon5Rb, which produced sizes of435 and 220 bp for the high-growth allele and 655 bp for thelow-growth allele. Digestion was carried out using 10 �l of PCRproduct, 1 �l of buffer 4 (New England Biolabs), 0.025 �l of 32 mMS-adenosylmethionine, 8.775 �l of H2O and 1 unit of AcuI (0.2 �l) persample and incubated for 1 h at 37°C. Products were run on a 2%agarose gel containing sybrsafe (Invitrogen, Paisley, UK). The inten-sity of the bands was calculated using Image J (http://imagej.nih.gov/ij/) on images taken using a G:Box imager (Syngene, Cambridge,UK). The sum of the intensity of the 435- and 220-bp bands wascompared with the 655-bp band intensity using a paired t-test.

Immunocytochemistry

Three peptide epitopes from chicken CCKAR (CYLHKAKR-KRKVPLQQ, LATFTCCAKQKPPVIRG, and RAFDTASADLHLS-GAP) were conjugated to KLH and used to immunize two rabbits byDundee Cell Products (Dundee, UK). Antibody titers of anti-CCKARin three bleeds from the two rabbits were measured by an ELISAusing the peptides used in raising the antibodies to coat the plates. The

final bleed from rabbit 2 (CCKAR2F) was found to have the highestantibody titer (data not shown) and was used for immunohistochem-istry.

At 12 wk of age, high-growth (n � 5 males and 2 females) andlow-growth (n � 5 males and 3 females) haplotype birds wereeuthanized by a barbiturate overdose. Brains were removed andimmediately immersed in 4% paraformaldehyde (wt/vol) in 0.1 Mphosphate-buffered saline (PBS) solution (pH 7.4) for 5 days to fix thetissue. Brains were then transferred to 15% sucrose in 4% PFA for 48h and to 30% sucrose in 0.1 M PBS for a further 48 h. All incubationswere carried out at 4°C. Brains were removed from the sucrosesolution, with excess solution blotted with tissue paper, and snap-frozen on dry ice before coronal sections (60 �m) were cut on afreezing sledge microtome [from the tractus septomesencephalicus(TSM) to the level of the median eminence]. From preliminaryinvestigations using this antibody, no evidence of positive cytoplas-mic staining was found in sections anterior or posterior to theselandmarks. Every second section was collected into 0.1 M PBS in a12-well plate and stored at 4°C until processing. Free-floating sectionswere processed for CCKAR immunoreactivity using the CCKAR2Fanti-serum diluted at 1:1,000 in 0.1 M PBS, 0.2% Triton-X-100(vol/vol), and 3% normal goat serum (vol/vol) and incubated at roomtemperature for 2 h on a shaking platform before overnight incubationat 4°C. The antibody-antigen complex was visualized using a standardABC protocol (43). CCKAR immunoreactivity was visualized using aVectastain Elite kit (Vector Laboratories, Peterborough, UK), with0.025% diaminobenzidine (wt/vol) as the chromogen and 0.03%hydrogen peroxide (vol/vol). Sections were mounted onto gelatin-coated slides, air-dried, and coverslipped with Pertex mounting me-dium (Leica Microsystems, Milton Keynes, UK). Omission of theprimary antibody, blocking using the CCKAR peptide, or incubationwith CCKAR preimmune serum resulted in a total lack of labeling(data not shown).

The total number of CCKAR-labeled cells in the hypothalamus wascounted for each bird by using a light microscope under bright-fieldillumination (mean no. of sections analyzed: low-growth haplotype �20.8; high-growth haplotype � 21.3). Throughout quantification theanalyst was unaware of which group each brain belonged to.

RESULTS

Dense genotyping of chromosome 4 identified SNPs withstrong association with body weight and growth in the F8 AILgeneration (Fig. 1). The SNPs with the most significant Pvalues were close to the CCKAR, also known as the CCK1

receptor, in the IUPHAR nomenclature or CCKAR in theChicken Gene Nomenclature Consortium nomenclature (http://www.agnc.msstate.edu/). The highest scoring marker, ch4snp-131-132-4046-S-2, is at position 77,192,329, which is 1.56Mbp downstream of the CCKAR locus (Table 2 and Fig. 2).

An additional line-specific marker in the CCKAR gene,CCKAR_MnlI, was genotyped in the AIL F8 (�350 animalswith complete genotypes) and subsequently in the F16 gener-ation (�204 animals), and the data were reanalyzed usingREML (Table 2) for the top markers from the GenAbelanalysis. The estimate of the P value and the additive effect foreach generation are shown in Table 2. The �log P values arehighest for association in the F8 for 9-wk body weight, reach-ing 7.40 for ch4snp-131-132-4046-S-2. In the F16 generation,the �log P values are highest for association between ch4snp-131-132-4046-S-2 and body weight at 6 wk of age. ch4snp-131-132-4046-S-2 is the top-ranked marker, and CCK-AR_MnlI is the second-ranked marker at all ages and genera-tions, although association strength differs across time in thedifferent generations, with no statistical association in the F8 at

E911CCKAR AND DOMESTICATION


http://imagej.nih.gov/ij/

http://imagej.nih.gov/ij/



3 wk of age and limited association in the F16 at 12 wk of age.The additive effect for body weight is correlated with the levelof significance and is up to twofold larger in the F16 genera-tion, reaching 230 g at 12 wk of age. The F16 population wasof mixed sex, which explains the larger effect since males growfaster and are larger than females. P values at 1 wk of age didnot pass a Bonferroni-corrected P value of 6.5 � 10�04 for 78genotypes (data not shown). The QTL effect expressed as apercentage of the total variance using the reduction in the sumof the squares after the addition of the marker in the fittedmodel varies between 2.3 and 4.9% in the F8 and between 4.4and 4.8% in the F16 depending on age.

To present this in a different way, the body weight (g) offemales using the ch4snp-131-132-4046-S-2 marker as a clas-sifier in the F8 population at 12 wk of age was as follows: GG:2,406 28, n � 92; GT: 2,319 17, n � 223; TT: 2,258 23, n � 120 (ANOVA, P � 0.001). Body weight of females in

the F16 population at 12 wk of age was as follows: GG:2,272 57, n � 23; GT: 2,076 29, n � 40; TT: 1,927 37,n � 40 (ANOVA, P � 0.001). Body weight of males in theF16 population at 12 wk of age was as follows: GG: 2,951 65, n � 23; GT: 2,664 41, n � 60; TT: 2,546 49, n � 46(ANOVA P � 0.001). The difference represents differences inbody weight of 6.5 to 19% between the TT and GG genotypes.

It was hypothesized that if the CCKAR gene locus was respon-sible for variation in body weight, then alleles of the gene mightbe distributed differentially across strains of chicken with differentgrowth phenotypes. Using the CCKAR_MnlI marker, which is inthe gene itself, there was a clear relationship between the fre-quency of the marker for the high-growth allele and body weightat 10 wk of age (Fig. 3). There are some exceptions among thebroiler strains, but the majority have a high frequency of the allele.The relationship is more evident when the broiler strains areremoved (see Fig. 3, inset). The regression analysis indicated acorrelation coefficient of 0.57 between the body weight of thereduced data set and the allele frequency in the population (P �0.0001). Repeating this exercise with the other markers in Table 2showed significant or nearly significant correlations only withch4snp-31-245-11611-S-1 (P � 0.01) and ch4snp-85-157-3063-S-2 (P � 0.08).

Selective Breeding for Sequencing, Physiology, andExpression

Specific characterization of the CCKAR gene was based onindividuals produced by the mating of heterozygotes at athree-loci haplotype covering the region of the CCKAR genech4snp-32-183-65476-S-1, CCKAR_MnlI, and ch4snp-131-132-4046-S-2.

Sequencing of the CCKAR locus was completed for fourhomozygote offspring. The region sequenced flanked exon 1and upstream (Chr4: 75,628,867–75,630,758 bp), exon 2 andflanking region (75,630,998–75,631,348 bp), exon 3 and flank-ing region (75,633,120–75,633,647 bp), exon 4 and flankingregion (75,634,455–75,635,076 bp), and the region flankingexon 5 and the 3= region (75,635,268–75,636,796 bp). The

Position along chromosome 4 (Mbp)

-logP

0

2

4

6

8

10

12

20 40 60 80 1000

Fig. 1. Significance (�log P) of association of markers along chromosome 4,with body weight at 12 wk of age in the F8 generation of the advancedintercross line using GenAbel (1). Pen was included as a factor. Each dotrepresents a single nucleotide polymorphism.

Table 2. Significance of association (�logP) and size of the additive effect (AA-aa/2) of body weight (g) for each of thetop-scoring SNPs at 3, 6, 9, and 12 wk of age in the F8 and F16 generation of the broiler layer advanced intercross

Marker Position*

Age, wk

3 6 9 12

F8 F16 F8 F16 F8 F16 F8 F16

Significance of association (�logP)ch4 snp-85-157-3063-S2 73855056 0.22 5.06 1.62 2.70 3.78 2.15 3.68 1.89ch4 snp-85-282-3484-S1 75174977 0.55 3.67 1.64 2.22 3.72 1.62 2.85 1.37CCKAR_MnlI 75633208 0.40 4.19 2.05 3.77 4.38 2.70 3.44 2.40ch4 snp-131-42-9157-S2 76180551 0.15 3.39 1.89 3.51 4.23 2.30 3.36 2.00ch4 snp-131-132-4046-S2 77192329 0.83 4.66 4.24 5.25 7.40 4.51 6.43 3.69ch4 snp-31-245-11611-S1 79811791 0.53 1.40 2.30 3.05 4.78 2.22 2.05 1.66

Body weight, gch4 snp-85-157-3063-S2 73855056 1.8 18.1 21.2 48.7 61.5 83.0 82.5 139.5ch4 snp-85-282-3484-S1 75174977 4.1 16.7 23.4 42.1 67.5 68.0 78.0 112.0CCKAR_MnlI 75633208 2.8 18.1 23.5 57.0 64.0 93.5 76.0 159.5ch4 snp131-42-9157-S2 76180551 1.4 16.9 24.4 58.0 69.0 90.0 83.0 151.0ch4 snp131-132-4046-S2 77192329 4.7 21.3 35.7 56.6 84.5 139.5 106.5 230.0ch4 snp31-245-11611-S1 79811791 3.8 10.6 27.9 58.1 74.0 93.0 61.5 144.5

SNP, single nucleotide polymorphism. The F8 generation was composed of female birds, whereas the F16 generation was of both sexes. *The position is givenon chromosome 4 of the 2006 build of the chicken genome.



4,917-bp sequence contained 36 variations, of which threewere insertion deletions and two were known SNPs(snp.13.786.12116.S.3, snp.13.786.5607.S.1). We found nomutations associated with an amino acid change, splicing, ordifferences in the 5= and 3= end of the gene that was potentiallyable to effect gross expression. All 36 differences formed twodistinct haplotypes. All SNP information and allele frequencieshave been submitted to dbSNP with NCBI submitter SNP (ss)accession no. 550122***, where *** is 057, 082, 118, 147,175, 200, 225, 249, 278, 304, 325, 352, 369, 405, 430, 455,478, 501, 528, 556, 583, 602, 625, 649, 666, 691, 721, 745,774, 799, 830, 855, and 890.

All of the evidence suggested that the CCKAR locus con-trolled growth rate and was responsible for an �19% differ-ence in body weight between genotypes. One mechanism forthis association was by altering the response to CCK centrallyand peripherally. This hypothesis was tested by comparing thefood intake of chickens to ip injection of CCK. This showedthat the high-growth haplotype showed minimal response to

CCK, whereas the low-growth haplotypes reduced their intakeby 81% over the test period (Fig. 4).

In the absence of mutations that affected the receptor structure,we examined whether CCKAR mRNA expression could explainthe effect on growth and response to CCK injection. Levels ofCCKAR mRNA at 12 wk of age were lower in the high-growthhaplotypes than in the low-growth haplotype, with the heterozy-gotes usually intermediate. This was statistically significant in theduodenum, cecum, pancreas, hindbrain, and basal hypothalamus(Fig. 5), whereas the levels in the pituitary were similar in allgenotypes. The magnitude of the difference was �1.6 in theduodenum and 3.1 in the cecum, with most around twofold.Expression of the receptor was highest in the pancreas, as ex-pected (48), at �35-fold higher than in the cecum. Expression inthe cecum, pituitary, and gall bladder was �10-fold more than theduodenum, hindbrain, and basal hypothalamus (Fig. 5).

Digestion of CCKAR cDNA from the hypothalamus todetermine allele-specific expression was made by comparingthe sum of the 435- and 220-bp bands for the high-growth

ch4snp-131-42-9157-S-2ch4snp-131-132-4046-S-2

ch4snp-31-245-11611-S-1ch4snp-85-157-3063-S-2 CCKAR_MnlI

ch4snp-85-282-3484-S-1

Scale bar = 1 Mbp

Fig. 2. Position of the markers genotyped in the vicinity of cholecystokinin type A receptor (CCKAR) are indicated with an arrow and their name. Underneathis the genome map from the 2006 build from the University of California Santa Cruz browser (71a) showing distance in bp and the position of refseq genes.In the F16 generation, ch4snp-131-132-4046-S-2 and CCKAR_MnlI were the most consistently highly associated markers.

10 week body weight (gms)0 1000 2000 3000 4000 5000 6000

0

20

40

60

80

100

120

% H

igh

grow

th a

llele

in th

e po

pula

tion

% H

igh

grow

th a

llele

in th

e po

pula

tion

WhiteSussex

10 week body weight (gms)

0

20

40

60

80

100

120

Friesian Fowl

WhiteSussex

FriesianFowl

R2=0.57

Fig. 3. The prevalence of the CCKAR_MnlI CC (high-growth) allele in populations of traditional breeds (�)and modern commercial meat- (Œ) and layer-typechickens (�) plotted against 10-wk mean body weight.Each population was comprised of 12 individuals with24 alleles. All of the birds were housed in pens and fedad libitum. The inset presents data for traditional andlayer strains after removal of the meat-type strains,which are selected for high growth. The r2 from theregression analysis of the means is presented for thisreduced data set.



allele and the 655-bp band corresponding to the low-growthallele by a paired t-test. This indicated that in the heterozygotesthe difference between the band intensities was significantlydifferent from zero (P � 0.009), with the ratio of the 655-bpband corresponding to the low-growth allele and the 435- and220-bp bands from the high-growth allele being 3.54 0.8(low-growth allele/high-growth allele).

In case the genetic cause underlying the difference betweenthe genotypes affected other genes in the locus, the expressionof a number of genes in the vicinity of CCKAR and themarkers with the highest association were examined. We didnot find assayable expression for RBPJ, Slc34a2, DHX15, orPPARGC1A in the tissue panel we had available; however,LCORL, SLIT2, SOD3, PI4K2B, and SEPSECS showed nodifference in expression between genotypes.

Using immunohistochemistry, CCKAR immunoreactivitywas found to be widely distributed in the brain of the chicken,with perikarya observed from the level of the TSM to themedian eminence (see Fig. 6A).

Most hypothalamic brain regions contained CCKAR-immu-noreactive nerve fibers. A dense innervation was observed inthe paraventricular nucleus (PVN) and median eminence (ME).CCKAR-immunoreactive perikarya were observed in the su-praopticus pars ventralis, magnocellularis preopticus, periven-tricularis hypothalamic (PHN), PVN, anterior medialis hypo-thalami (AM), region lateralis hypothalami, nucleus ventrolate-ralis thalami, nucleus lateralis anterior thalami, and nucleussuprachiasmaticus, pars medialis (see Fig. 6, A and B).

The total number of CCKAR-immunoreactive cells quanti-fied in the brain was significantly higher in the low-growthhaplotype compared with the high-growth haplotype birds(Fig. 7).

We anticipated that genes expressed in the feeding centerneurons of the basal hypothalamus would also be alteredbecause of the difference in CCK feedback through its recep-tor. We examined expression of AGRP and POMC genes thatare factors driving orexigenic and anorectic behavior of birds

and other vertebrates. AGRP expression in the high-growthhaplotype was approximately fourfold higher than in the low-growth haplotype (Fig. 8). Although POMC expression in thehigh-growth haplotype tended to be less than in the low-growthhaplotype, this was not significantly different between geno-types (Fig. 8).

DISCUSSION

We have for the first time demonstrated that a change in acomponent of a satiety signaling system underlies the largestQTL for growth in chickens (32, 65), the first QTL for growthin which the underlying gene function has been understood inchickens. In mammals, the role of IGF-II in pig growth (72)and the double muscling caused by myostatin in breeds ofcattle (26) are the only examples where function has beenelucidated. The CCK system has been investigated as a causeof increased appetite of rapid growing strains of chicken (60)with limited success but, it has now been proven that expres-sion of the seven-transmembrane domain CCKAR G proteinreceptor is responsible for part of the difference in growthbetween strains. This QTL has been observed repeatedly (34,47, 64, 71), and the coincidence of the CCKAR gene at thelocus has been noted (54), and a gene 5 Mbp upstream,TBC1D1, was proposed as a candidate from a selective sweepstudy (57). However, the physiological basis of the locus hasnever been elucidated. The most significant marker in both theF8 and F16 AIL generations was ch4snp-131-132-4046-S-2,1.56 Mbp downstream of the CCKAR locus. In an earlierstudy, the QTL explained 3.6% of the total variance (65) in theF2, and in this study the best marker explained just under 5%of the variance in the F8 and F16. This is somewhat less thanthe 15–30% explained by the IGF-II locus in pigs but is in linewith many QTLs (72). Comparison of the F8 and F16 popu-lations did not further define the location. There are genes inthe vicinity of this SNP, notably KCNIP4, SLIT2, and LCORL,that have been associated with human stature, but none areobvious candidates for altering growth and food intake. Of thegenes in the loci that we did measure, we saw no difference inexpression with genotype. In a whole genome study of eggweight, a trait correlated with body weight, the most significantSNP in 1-Mbp windows was at position 78,775,527, with aSNP of lesser effect at 78,724,797 (75). This may be the samelocus underlying the difference in expression of CCKAR, andit confirms that the likely locus is at least 1.5 Mbp and perhaps3 Mbp downstream of the CCKAR gene itself.

Evidence that the CCKAR locus is associated with growthand body size and that the genetic differences are not due torecent events came from the clear correlation between thefrequency of the high-growth alleles at the CCKAR locus andthe body weight at 10 wk of age in strains of chicken withmarkedly different growth rates. Because traditional heavystrains (e.g., White Sussex or Cornish game) are fixed for thehigh-growth alleles, this suggests that they were present inheavy breeds used to found modern broilers. These high-growthalleles are derived from fighting birds that tend to be larger andhave greater musculature (77). Using marker CCKAR_MnlI, thecorrelation between the frequency of the high-growth allele ina strain and body weight suggests that 57% of the variance onthe face of it can be explained by the genotype. Of course thisis an overestimate, and we are not suggesting that this locus

Haplotype High

growth Heterozygote Low

growth

Cha

nge

in fo

od in

take

(gm

s)

0.0

-0.5

-1.0

-1.5

-2.0

-2.5

-3.0

ANOVA P=0.013

Fig. 4. Difference in food intake 30 min after ip injection of CCK in homozygoushigh- or low-growth and heterozygote haplotypes. Each bird received either 0 or10 �g of sulfated CCK octapeptide/kg body wt, with 1 day between the random-ized doses. Data presented represent the mean SE of the difference between thefood intake in the 30-min period after injection of the 0 and 10 �g CCK8/kg dosesin individual animals (n � 8). The ANOVA P value is shown.



explains all of this variance. However, what it does indicate isthat this haplotype has been selected or lost along with otherloci related to growth and metabolism when selection has beenpracticed for a particular body conformation. In other words,the selection of an allele that increases food intake will havebeen accompanied by selection at other genetic loci that caninfluence utilization of the food for increased stature andmuscle growth. The results suggest that the selection of thehigh-growth haplotype predates the development of heavybreeds for meat production (77), and is not a result of recentgenetic selection. The fact that not all meat-type strains arefixed for the allele may reflect different founders for these linesor that the marker is not in complete linkage with the causativevariation. The observation that from the list of the mostsignificant markers in the region (Fig. 2) ch4snp-31-245-11611-S-1 and ch4snp-85-157-3063-S-2 were the only onesthat showed any correlation with body weight suggests that thecausative genetic loci may in fact be closer to the CCKAR geneitself than suggested by the analysis of the F8 or F16 popula-tion. Another possibility is that there are a number of indepen-dent genetic effects downstream of the CCKAR gene thatoccur in different strains that may interact with a region in theCCKAR gene locus.

The high-growth haplotype exhibited low expression of theCCKAR gene in almost all tissues examined. Also, in the

hypothalamus, the number of CCKAR-immunoreactive cellswas decreased, suggesting that the genotype also exhibitsreduced protein expression. The difference in CCKAR immu-noreactivity was not as pronounced as for mRNA in thehypothalamus, but this may reflect the limitation of countingvisible cells rather than measuring protein content directly. Thedecreased expression of CCKAR in the high-growth haplotypeappears to be functionally linked to our observation that theeffect of intraperitoneally administered CCK in acutely reduc-ing food intake was virtually abolished in that genotype com-pared with low-growth and heterozygote haplotypes. Thissuggests that the increased growth and body weight exhibitedby the high-growth haplotype is at least partly due to adecreased level of CCK satiety signaling compared with theother genotypes. This may be reflected in altered meal patternsthat promote weight gain. For example, in Otsuka-Long-Evans-Tokushima fatty (OLETF) rats (which have lost thepromoter and exons 1 and 2 of the CCKAR gene by mutation)and in CCKAR-knockout mice, meal size is increased comparedwith control animals with normally functioning CCKARs (3).Analysis of the temporal structure of feeding behavior inchickens indicates the influence of satiety mechanisms (31,70). Recent selection does not appear to have altered thisparameter (30), which from our observation on the history ofthe CCKAR alleles would be expected. By contrast, compari-

0.000

0.002

0.004

0.006

0.008

0.010

0.000

0.002

0.004

0.006

0.008

0.010

0.012

0.014Basal HypothalamusP<0.001

0

1

2

3

4

5

6PancreasP<0.001

0.000

0.002

0.004

0.006

0.008DuodenumP=0.03

0.00

0.02

0.04

0.06

0.08

0.10

0.12

0.14

0.00

0.05

0.10

0.15

0.20

0.25CecumP<0.001

Gall BladderP=0.17

Hind brainP=0.014

CC

KA

R m

RN

A (c

orre

cted

)C

CK

AR

mR

NA

(cor

rect

ed)

CC

KA

R m

RN

A (c

orre

cted

)

Haplotype

Highgrowth Het

Lowgrowth

Haplotype

Highgrowth Het

Lowgrowth

Highgrowth Het

Lowgrowth

Highgrowth Het

Lowgrowth

Highgrowth Het

Lowgrowth

Highgrowth Het

Lowgrowth

Fig. 5. Expression (SE) of CCKAR mRNA in tissuestaken from 12-wk-old homozygous high- or low-growthand heterozygote (Het) haplotypes (n � 8/group). P val-ues from the ANOVA on log-transformed data are givenin each graph.



son of fast-growing chickens did demonstrate that the amounteaten per meal was larger with fewer meals compared withlight-bodied White Leghorns (5), and overall there werechanges to the control of satiety between the strains, which thedifference in CCKAR may underlie.

Although the influence of the high-growth haplotype onfeeding behavior remains to be clarified, it is noteworthy thatour results support an endogenous role for CCK signaling inbody weight regulation in birds. In previous studies, it has beendifficult to distinguish between true physiological and aversiveeffects of exogenously administered CCK (7, 12, 59, 69), andattempts to manipulate CCK receptors pharmacologically havebeen inconclusive (55).

Given that CCKAR expression was decreased in the high-growth haplotype in several central and peripheral tissues, it is

difficult to be certain as to which tissue mediates the decreasedfeeding response to exogenous CCK, and it is indeed possiblethat several tissues are involved. Peripherally administeredCCK appears to signal to the central nervous system via thevagus nerve in rats because the inhibitory feeding response toexogenous CCK is lost after vagotomy (68). However, in thechicken there are conflicting results, with vagotomy having noeffect on preventing the reduction of food intake when CCKwas administered intravenously (62) but having an effect whenit was given intraperitoneally (13). The presence of Fos imme-diate early gene expression in the nucleus of the solitary tractafter intraperitoneal CCK administration of quail is consistentwith the activation of afferent pathways from the gut to thebrain (7). Therefore, our observations of reduced expression ofCCKAR in the high-growth haplotype in the duodenum and

e

b

g

f

h

PVNPHN

ME

a

A

SOvMPO (d) (v) (l)

PHN

PHN PVN

PHN

ME

SCNm

VLTPHN

PVN

AM

LA

LHy

c

VLT

AMPVN

PHN

LA

LHy

d

PHNPVN

AM VLT

LA

LHy

LHy

LHy

Fig. 6. A: coronal rostrocaudal sections (a–h)showing anatomic distribution of CCKAR im-munoreactivity in the hypothalamus of broilerchickens, represented by black dots. Atlasadapted from Prof. Wayne Kuenzel (http://avianbrain.org/nomen/Chicken_Atlas.html)(36a). B: localization of CCKAR immunore-activity within the chicken hypothalamus. Im-age a: magnocellularis preopticus (MPO). Im-age b: paraventricular nucleus (PVN). Image c:ventral periventricularis hypothalamic (PHNv).Image d: nucleus suprachiasmaticus pars me-dialis (SCNm), anterior medialis hypothalami(AM), lateralis hypothalami (LHy), nucleusventrolateralis thalami (VLT), and lateralis an-terior thalami (LA). Image e: supraopticuspars ventralis (SOv). Image f: fiber tracts andprocesses within the median eminence (ME).All scale bars, including image f, inset, repre-sent 10 �m. Scale bar in image F (mainimage) represents 1 �m.



http://avianbrain.org/nomen/Chicken_Atlas.html

http://avianbrain.org/nomen/Chicken_Atlas.html

cecum could account for reduced signaling from CCK secretedinto the gut to receptors on vagal afferents. The source of theligand for the CCKARs we observed to be expressed in thecentral nervous system is less clear. In addition to mRNAexpression in the hindbrain and basal hypothalamus, we foundCCKAR-like immunoreactivity to be widely distributed in thehypothalamus, and its distribution pattern was broadly similarto that described in the rat for both mRNA and peptide (27, 44).At least some of the CCKAR-immunoreactive cells may beinvolved in the feeding response to CCK, and it is noteworthythat two of those nuclei, the PVN and PHN, also expressedsignificant Fos-like immunoreactivity after intraperitoneal in-jection of CCK in quail (7). In mammals, CCK reportedly doesnot cross the blood-brain barrier (51). However, there is thepossibility that regions of the mediobasal hypothalamus andmedian eminence (where we observed dense CCKAR inner-vation) may be more directly accessible by circulating peptides(11), especially in light of the lack of effect of vagotomycombined with intravenous CCK (62). It is possible that theCCK ligand for central CCKARs is synthesized within neuronsthemselves in the chicken brain. Neuronal synthesis of CCK islong established in mammals (33, 73), and increased CCK-like

immunoreactivity has been reported after meals (63). ThusCCK may also act as a centrally expressed neurotransmitterinvolved in the integration of visceral signals with the regula-tion of food intake. There is evidence for the expression ofCCK in the avian brain (35). CCK-immunoreactive fibers wereidentified in the dorsal motor nucleus of the vagus and nucleusof the solitary tract in the pigeon (2), which were sites of Fosexpression after CCK injection in the quail (7), and can berelated to our observation of CCKAR mRNA expression in thechicken hindbrain. Immunoreactive CCK was also identified inthe chicken hypothalamus (19), but although a recent distribu-tion study of CCK mRNA in the zebra finch found widespreadCCK expression, none was detected in the hypothalamus (40).Thus the extent of endogenous CCK synthesis in the chickenhypothalamus is currently uncertain. However, it is known thatCCK reduces food intake in the chick after central administra-tion (18, 69), and therefore, it is possible that the reduction weobserved in hypothalamic CCKAR-immunoreactive cell num-bers contributed to the reduced sensitivity of the feedingresponse to CCK in the high growth-haplotype.

We hypothesized that the reduced CCKAR expression ob-served in the hypothalamus would result in an elevation of

LA

AMLHy

VLT

SCNm

20 µm

10 µm

PHNv

MPO

PVN

SOv

ME

ME

a

B

e

c d

b

f

Fig. 6—Continued



orexigenic AGRP gene expression, and this was confirmedbecause the high-growth haplotype had a fourfold elevation ofAGRP compared with the low-growth haplotype. Thus basalAGRP synthesis appears to be sensitive to the tone of CCKsignaling, and its elevation is likely to contribute to the phe-notype of the high-growth haplotype. Our finding is reminis-cent of that of increased hypothalamic NPY synthesis in theOLETF rat (1), although the NPY cells concerned were in thedorsomedial nucleus rather than the arcuate nucleus. A linkbetween melanocortin and CCK signaling has been suggestedby the observation that sensitivity of the feeding response toCCK is reduced in melanocortin receptor-4 (MC4R)-knockoutmice and that PVN neurons express the MC4R project to thenucleus of the solitary tract in the hindbrain (4). Given thatAGRP is an MC4R antagonist, our findings are consistent withthe direction of the change in sensitivity observed. It is uncer-tain as to how CCK signals are conveyed to AGRP neurons inthe arcuate nucleus to influence their expression. The possibil-ity for a direct effect of brain or circulating CCK is suggestedby the observation of CCKAR (but not CCKBR) expression in

the arcuate nucleus of the rat (27). We did not detect prominentCCKAR-like immunoreactivity in the infundibular nucleus inthe present study, but it was one of the brain nuclei in whichFos expression was detected after intraperitoneal CCK injec-tion in the quail (7). Therefore, it is possible that CCK signalsare relayed to the infundibular nucleus via afferent visceralneural pathways.

CCKAR may be responsible for growth differences in otherspecies, although function has not been proven. Polymor-phisms, including one in a YY1 transcription binding site in theCCKAR promoter, were associated with growth in pigs (28,29). It was suggested that snp.13.786.12116.S.3 might effectthis transcription binding site in chickens, but no evidence waspresented (54). The similarities between the pig and chickenloci are small, but the SNP does segregate with the high- andlow-growth haplotypes in our population observed from oursequencing study. However, there are 37 differences that seg-regate with the genotypes, 12 in the promoter, and 15 in exonsor in the immediate surrounding introns, which singularly or incombination could be responsible for differences in CCKARexpression. However, the strong association downstream of thelocus suggests that a cis-acting effect, possibly an enhancer, isresponsible. The observation that there is allele-specific ex-pression, with the low-growth allele having the highest expres-sion at �3.5 times that of the high-growth allele, stronglysupports the hypothesis that the effect is due to a cis effectrather than, say, a transcription factor acting in trans. Without

High growth

Low growth3V

PVN

0

1000

2000

3000

4000

5000

6000

high growth

low growth

Haplotype

P=0.04

Num

ber o

f CC

KA

Rim

mun

opos

itive

cel

ls

A

B

Fig. 7. A: photomicrographs comparing CCKAR immunoreactivity in thehypothalamus of high-growth and low-growth haplotype chickens. Scale bar,50 �m. B: total no. of CCKAR-immunoreactive cells observed using antibodyCCKAR2F in the hypothalamus taken from 12-wk-old high-growth (n � 7)and low-growth haplotypes (n � 8); means SE. P value from ANOVA isshown.

Hyp

otha

lam

ic A

GR

Pex

pres

sion

(cor

rect

ed)

Hyp

otha

lam

ic P

OM

Cex

pres

sion

(cor

rect

ed)

Haplotype

0

0.01

0.02

0.03

0.04ANOVA P=0.009

Highgrowth Heterozygote

Lowgrowth

Highgrowth Heterozygote

Lowgrowth

0

0.1

0.2

0.3

ANOVA P=0.116

Fig. 8. Expression of agouti-related protein (AGRP) and prooptiomelanocortin(POMC) mRNA in basal hypothalami taken from 12-wk-old homozygoushigh- or low-growth and heterozygote haplotypes (n � 8/group). P value fromthe ANOVA on log-transformed data is shown.



further testing, it is only speculative to ascribe function to anyof these polymorphisms. Polymorphism in the human CCKARpromoter has been proposed to be responsible for differences inbody fat (24), and the OLETF rat, which has a deletion inCCKAR (46), shows increased food intake. The absence of anyeffect on other genes at the locus suggests the effect is specificto CCKAR, but we cannot formally rule out effects on othergenes in tissues we have not examined. The phenotype asso-ciated with reduced expression of CCKAR in high-growthchickens is similar to that postulated for humans, and anunderstanding of its molecular mechanism may be valuable tounderstand how this gene is regulated in humans. In mammals,CCK is thought of as controlling shorter-term food intake, suchas meal size, whereas longer-term effects are mediated byfactors such as leptin (50), which is lacking in birds (66). Theseresults, along with the known mutants of CCKAR, clearlysuggest that long-term effects on body weight can result fromchanges to the short-term feedback system. The CCK systemmay be worthy of attention in birds since in the absence ofleptin it may play a more important role in the longer-termcontrol of food intake and growth.

In this study, we have characterized the effects of reducedCCKAR expression on the central feeding center and onappetite. We also anticipate that there would be reducedsecretion of bile and pancreatic polypeptides in the high-growth haplotype (39). None of these potential effects are likelyto be conducive to more rapid growth; however, the potential toincrease the transition of food through the digestive tract (15, 41)could improve growth. Further work using these genotypes willbe required to characterize the endocrine and paracrine effects inthe gut and how they promote growth.

In conclusion, we have for the first time elucidated thephysiological basis of a QTL for growth in chickens, whichaffects appetite. The possession of segregating haplotypes hasopened an opportunity to study how CCK feedback affectsgrowth through appetite and food intake control. Food intakecontrol has at times been controversial in avians, a clade thatlacks leptin (20, 23, 66). This discovery also gives us an insightinto the process of domestication and specialization of poultrystrains and improves the prospect of deriving strategies toaddress some of the management problems resulting fromcorrelated effects of selection for growth that result in the needto restrict heavy strains of poultry to permit normal reproduc-tion (16).

ACKNOWLEDGMENTS

We thank the staff in the poultry unit at Roslin for excellent animal care.We are extremely grateful to Timothy Boswell, University of Newcastle, forcritical reading of the manuscript and to the reviewers whose suggestions haveconsiderably strengthened the article.

GRANTS

All authors were supported by the Biotechnology and Biological SciencesResearch Council and the Roslin Institute through Institute Strategic Grantfunding. C. A. Wardle and C. Hindar were supported by a Wellcome Trustvacation studentship to I. C. Dunn and S. L. Meddle, respectively. S. J. L.Ellison was supported by a vacation studentship from Pfizer to S. L. Meddle.

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the authors.

AUTHOR CONTRIBUTIONS

I.C.D. and P.M.H. contributed to the conception and design of the research;I.C.D., P.M.H., P.W., C.A.W., V.B., C.H., G.W.R., D.W.B., S.J.E., andD.M.M. performed the experiments; I.C.D., P.M.H., S.M., P.W., C.A.W.,A.L., V.B., C.H., G.W.R., D.W.B., S.J.E., and D.M.M. analyzed the data;I.C.D., P.M.H., S.M., P.W., C.A.W., A.L., S.J.E., and D.M.M. interpreted theresults of the experiments; I.C.D., S.M., and V.B. prepared the figures; I.C.D.drafted the manuscript; I.C.D., P.M.H., S.M., P.W., C.A.W., V.B., and D.W.B.edited and revised the manuscript; I.C.D., P.M.H., S.M., P.W., C.A.W., A.L.,V.B., C.H., G.W.R., D.W.B., S.J.E., and D.M.M. approved the final version ofthe manuscript.

REFERENCES

1. Aulchenko YS, Ripke S, Isaacs A, Van Duijn CM. GenABEL: an Rlibrary for genome-wide association analysis. Bioinformatics 23: 1294–1296, 2007.

2. Berk ML, Smith SE, Karten HJ. Nucleus of the solitary tract and dorsalmotor nucleus of the vagus nerve of the pigeon: localization of peptide and5-hydroxytryptamine immunoreactive fibers. J Comp Neurol 338: 521–548, 1993.

3. Bi S, Scott KA, Kopin AS, Moran TH. Differential roles for cholecysto-kinin A receptors in energy balance in rats and mice. Endocrinology 145:3873–3880, 2004.

4. Blevins JE, Morton GJ, Williams DL, Caldwell DW, Bastian LS,Wisse BE, Schwartz MW, Baskin DG. Forebrain melanocortin signalingenhances the hindbrain satiety response to CCK-8. Am J Physiol RegulIntegr Comp Physiol 296: R476–R484, 2009.

5. Bokkers EA, Koene P. Eating behaviour, and preprandial and postpran-dial correlations in male broiler and layer chickens. Br Poult Sci 44:538–544, 2003.

7. Boswell T. Regulation of energy balance in birds by the neuroendocrinehypothalamus. J Poult Sci 42: 161–181, 2005.

8. Boswell T, Millam JR, Li Q, Dunn IC. Cellular localization of neuro-peptide Y mRNA and peptide in the brain of the Japanese quail anddomestic chicken. Cell Tissue Res 293: 31–38, 1998.

9. Boswell T, Takeuchi S. Recent developments in our understanding of theavian melanocortin system: its involvement in the regulation of pigmen-tation and energy homeostasis. Peptides 26: 1733–1743, 2005.

10. Burkhart CA, Cherry JA, Van Krey HP, Siegel PB. Genetic selectionfor growth rate alters hypothalamic satiety mechanisms in chickens. BehavGenet 13: 295–300, 1983.

11. Ciofi P. The arcuate nucleus as a circumventricular organ in the mouse.Neurosci Lett 487: 187–190, 2011.

12. Covasa M, Forbes JM. Effects of the CCK receptor antagonist MK-329on food intake in broiler chickens. Pharmacol Biochem Behav 48: 479–486, 1994.

13. Covasa M, Forbes JM. Exogenous cholecystokinin octapeptide in broilerchickens: satiety, conditioned colour aversion, and vagal mediation.Physiol Behav 56: 39–49, 1994.

14. Darvasi A, Soller M. Advanced intercross lines, an experimental popu-lation for fine genetic mapping. Genetics 141: 1199–1207, 1995.

15. Debas HT, Farooq O, Grossman MI. Inhibition of gastric emptying is aphysiological action of cholecystokinin. Gastroenterology 68: 1211–1217,1975.

16. Decuypere E, Bruggeman V, Everaert N, Li Y, Boonen R, De Taver-nier J, Janssens S, Buys N. The broiler breeder paradox: ethical, geneticand physiological perspectives, and suggestions for solutions. Br Poult Sci51: 569–579, 2010.

17. Denbow DM. Peripheral regulation of food intake in poultry. J Nutr 124:1349S–1354S, 1994.

18. Denbow DM, Myers RD. Eating, drinking and temperature responses tointracerebroventricular cholecystokinin in the chick. Peptides 3: 739–743,1982.

19. Dockray GJ, Dimaline R. FMRFamide- and gastrin/CCK-like peptides inbirds. Peptides 6, Suppl 3: 333–337, 1985.

20. Dunn IC, Girishvarma G, Talbot RT, Waddington D, Boswell T,Sharp PJ. Evidence for low homology between the chicken and mam-malian leptin genes. In: Avian Endocrinology, edited by Dawson A andChaturverdi CM. New Delhi: Narosa Publishing House, 2002, p. 327–336.

21. Dunn IC, Joseph NT, Bain M, Edmond A, Wilson PW, Milona P, NysY, Gautron J, Schmutz M, Preisinger R, Waddington D. Polymor-phisms in eggshell organic matrix genes are associated with eggshell



quality measurements in pedigree Rhode Island Red hens. Anim Genet 40:110–114, 2009.

22. Falconer DS. Replicated selection in mice. Genet Res 22: 291–321, 1973.23. Friedman-Einat M, Boswell T, Horev G, Girishvarma G, Dunn IC,

Talbot RT, Sharp PJ. The chicken leptin gene: has it been cloned? GenComp Endocrinol 115: 354–363, 1999.

24. Funakoshi A, Miyasaka K, Matsumoto H, Yamamori S, Takiguchi S,Kataoka K, Takata Y, Matsusue K, Kono A, Shimokata H. Genestructure of human cholecystokinin (CCK) type-A receptor: body fatcontent is related to CCK type-A receptor gene promoter polymorphism.FEBS Lett 466: 264–266, 2000.

25. Furuse M, Tachibana T, Ohgushi A, Ando R, Yoshimatsu T, DenbowDM. Intracerebroventricular injection of ghrelin and growth hormonereleasing factor inhibits food intake in neonatal chicks. Neurosci Lett 301:123–126, 2001.

26. Grobet L, Martin LJ, Poncelet D, Pirottin D, Brouwers B, Riquet J,Schoeberlein A, Dunner S, Ménissier F, Massabanda J, Fries R,Hanset R, Georges M. A deletion in the bovine myostatin gene causes thedouble-muscled phenotype in cattle. Nat Genet 17: 71–74, 1997.

27. Honda T, Wada E, Battey JF, Wank SA. Differential gene-expression ofCCK(A) and CCK(B) receptors in the rat-brain. Mol Cell Neurosci 4:143–154, 1993.

28. Houston RD, Haley CS, Archibald AL, Cameron ND, Plastow GS,Rance KA. A polymorphism in the 5=-untranslated region of the porcinecholecystokinin type a receptor gene affects feed intake and growth.Genetics 174: 1555–1563, 2006.

29. Houston RD, Rance KA, Sutcliffe E, Archibald AL, Haley CS. Thecholecystokinin type A receptor g.179A�G polymorphism affects feedingrate. Anim Genet 39: 187–188, 2008.

30. Howie JA, Avendano S, Tolkamp BJ, Kyriazakis I. Genetic parametersof feeding behavior traits and their relationship with live performancetraits in modern broiler lines. Poult Sci 90: 1197–1205, 2011.

31. Howie JA, Tolkamp BJ, Avendano S, Kyriazakis I. The structure offeeding behavior in commercial broiler lines selected for different growthrates. Poult Sci 88: 1143–1150, 2009.

32. Ikeobi CO, Woolliams JA, Morrice DR, Law A, Windsor D, Burt DW,Hocking PM. Quantitative trait loci for meat yield and muscle distributionin a broiler layer cross. Livest Prod Sci 87: 143–151, 2004.

33. Innis RB, Corrêa FM, Uhl GR, Schneider B, Snyder SH. Cholecysto-kinin octapeptide-like immunoreactivity: histochemical localization in ratbrain. Proc Natl Acad Sci USA 76: 521–525, 1979.

34. Jacobsson L, Park HB, Wahlberg P, Fredriksson R, Perez-Enciso M,Siegel PB, Andersson L. Many QTLs with minor additive effects areassociated with a large difference in growth between two selection lines inchickens. Genet Res 86: 115–125, 2005.

35. Jonson L, Schoeman N, Saayman H, Naude R, Jensen H, Johnsen AH.Identification of ostrich and chicken cholecystokinin cDNA and intestinalpeptides. Peptides 21: 1337–1344, 2000.

36. Keesey RE, Hirvonen MD. Body weight set-points: determination andadjustment. J Nutr 127: S1875–S1883, 1997.

36a.Kuenzel WJ, and Masson M. A Stereotaxic Atlas of the Brain of theChick (Gallus Domesticus). Baltimore, MD: Johns Hopkins University,1988.

37. Lal P, Sharp PJ, Dunn IC, Talbot RT. Absence of an effect of naloxone,an opioid antagonist, on luteinizing hormone release in vivo and lutein-izing hormone-releasing hormone I release in vitro in intact, castrated, andfood restricted cockerels. Gen Comp Endocrinol 77: 239–245, 1990.

38. Law AS, Archibald AL. Farm animal genome databases. Brief Bioinform1: 151–160, 2000.

39. Liddle RA. Cholecystokinin cells. Annu Rev Physiol 59: 221–242, 1997.40. Lovell PV, Mello CV. Brain expression and song regulation of the

cholecystokinin gene in the Zebra finch (Taeniopygia guttata). J CompNeurol 519: 211–237, 2011.

41. Martínez V, Jiménez M, Goñalons E, Vergara P. Effects of cholecysto-kinin and gastrin on gastroduodenal motility and coordination in chickens.Life Sci 52: 191–198, 1993.

42. McDerment NA, Wilson PW, Waddington D, Dunn IC, Hocking PM.Identification of novel candidate genes for follicle selection in the broilerbreeder ovary. BMC Genomics 13: 494, 2012.

43. Meddle SL, Bishop VR, Gkoumassi E, van Leeuwen FW, Douglas AJ.Dynamic changes in oxytocin receptor expression and activation at par-turition in the rat brain. Endocrinology 148: 5095–5104, 2007.

44. Mercer LD, Beart PM. Immunolocalization of CCK1R in rat brain usinga new anti-peptide antibody. Neurosci Lett 359: 109–113, 2004.

45. Monaghan P, Metcalfe NB. On being the right size: natural selection andbody size in the herring gull. Evolution 40: 1096–1099, 1986.

46. Moran TH, Bi S. Hyperphagia and obesity in OLETF rats lacking CCK-1receptors. Philos Trans R Soc Lond B Biol Sci 361: 1211–1218, 2006.

47. Nadaf J, Pitel F, Gilbert H, Duclos MJ, Vignoles F, Beaumont C,Vignal A, Porter TE, Cogburn LA, Aggrey SE, Simon J, Le Bihan-Duval E. QTL for several metabolic traits map to loci controlling growthand body composition in an F2 intercross between high- and low-growthchicken lines. Physiol Genomics 38: 241–249, 2009.

48. Ohkubo T, Shamoto K, Ogino T. Structure and tissue distribution ofcholecystokinin-1 receptor in chicken. J Poult Sci 44: 98–104, 2007.

49. Owen JB. Genetic aspects of appetite and feed choice in animals. J AgricSci 119: 151–155, 1992.

50. Owyang C, Heldsinger A. Vagal control of satiety and hormonal regu-lation of appetite. J Neurogastroenterol Motil 17: 338–348, 2011.

51. Passaro E Jr, Debas H, Oldendorf W, Yamada T. Rapid appearance ofintraventricularly administered neuropeptides in the peripheral circulation.Brain Res 241: 335–340, 1982.

52. Paterson T, Law A. Genotypechecker: an interactive tool for checking theinheritance consistency of genotyped pedigrees. Anim Genet 42: 560–562,2011.

53. Richards MP. Genetic regulation of feed intake and energy balance inpoultry. Poult Sci 82: 907–916, 2003.

54. Rikimaru K, Komatsu M, Suzuki K, Uemoto Y, Takeda H, TakahashiH. Association between cholecystokinin type A receptor haplotypes andgrowth traits in Japanese Hinai-dori crossbred chickens. Mol Biol Rep 39:4479–4484, 2012.

55. Rodríguez-Sinovas A, Fernández E, Manteca X, Fernández AG, Go-ñalons E. CCK is involved in both peripheral and central mechanismscontrolling food intake in chickens. Am J Physiol Regul Integr CompPhysiol 272: R334–R340, 1997.

56. Rozen S, Skaletsky HJ. Primer3 on the WWW for general users and forbiologist programmers. In: Bioinformatics Methods and Protocols: Meth-ods in Molecular Biology, edited by Krawetz S and Misener S. Totowa,NJ: Humana, 2000, p. 365–386.

57. Rubin CJ, Zody MC, Eriksson J, Meadows JR, Sherwood E, WebsterMT, Jiang L, Ingman M, Sharpe T, Ka S, Hallböök F, Besnier F,Carlborg O, Bed’hom B, Tixier-Boichard M, Jensen P, Siegel P,Lindblad-Toh K, Andersson L. Whole-genome resequencing revealsloci under selection during chicken domestication. Nature 464: 587–591,2010.

58. Sandercock DA, Nute GR, Hocking PM. Quantifying the effects ofgenetic selection and genetic variation for body size, carcass composition,and meat quality in the domestic fowl (Gallus domesticus). Poult Sci 88:923–931, 2009.

59. Savory CJ. An alternative explanation for apparent satiating properties ofperipherally administered bombesin and cholecystokinin in domesticfowls. Physiol Behav 39: 191–202, 1987.

60. Savory CJ, Gentle MJ. Brain cholecystokinin and satiety in fowls.Appetite 4: 223–223, 1983.

61. Savory CJ, Gentle MJ. Intravenous injections of cholecystokinin andcaerulein suppress food intake in domestic fowls. Experientia 36: 1191–1192, 1980.

62. Savory CJ, Hodgkiss JP. Influence of vagotomy in domestic fowls onfeeding activity, food passage, digestibility and satiety effects of 2 pep-tides. Physiol Behav 33: 937–944, 1984.

63. Schick RR, Reilly WM, Roddy DR, Yaksh TL, Go VL. Neuronalcholecystokinin-like immunoreactivity is postprandially released fromprimate hypothalamus. Brain Res 418: 20–26, 1987.

64. Schreiweis MA, Hester PY, Settar P, Moody DE. Identification ofquantitative trait loci associated with egg quality, egg production, andbody weight in an F2 resource population of chickens. Anim Genet 37:106–112, 2006.

65. Sewalem A, Morrice DM, Law A, Windsor D, Haley CS, Ikeobi CO,Burt DW, Hocking PM. Mapping of quantitative trait loci for bodyweight at three, six, and nine weeks of age in a broiler layer cross. PoultSci 81: 1775–1781, 2002.

66. Sharp PJ, Dunn IC, Waddington D, Boswell T. Chicken leptin. GenComp Endocrinol 158: 2–4, 2008.

67. Simpson K, Parker J, Plumer J, Bloom S. CCK, PYY and PP: thecontrol of energy balance. Handb Exp Pharmacol 209–230, 2012.

68. Smith GP, Jerome C, Cushin BJ, Eterno R, Simansky KJ. Abdominalvagotomy blocks the satiety effect of cholecystokinin in the rat. Science213: 1036–1037, 1981.



69. Tachibana T, Matsuda K, Kawamura M, Ueda H, Khan MS, ClineMA. Feeding-suppressive mechanism of sulfated cholecystokinin (26–33)in chicks. Comp Biochem Physiol A Mol Integr Physiol 161: 372–378,2012.

70. Tolkamp BJ, Allcroft DJ, Barrio JP, Bley TA, Howie JA, JacobsenTB, Morgan CA, Schweitzer DP, Wilkinson S, Yeates MP, KyriazakisI. The temporal structure of feeding behavior. Am J Physiol Regul IntegrComp Physiol 301: R378–R393, 2011.

71. Tsudzuki M, Onitsuka S, Akiyama R, Iwamizu M, Goto N, NishiboriM, Takahashi H, Ishikawa A. Identification of quantitative trait lociaffecting shank length, body weight and carcass weight from the Japanesecockfighting chicken breed, Oh-Shamo (Japanese Large Game). CytogenetGenome Res 117: 288–295, 2007.

71a.UCSC Genome Bioinformatics. Chicken (Gallus gallus) Genome BrowserGateway (Online). http://genome.ucsc.edu/ [6 May 2010].

72. Van Laere AS, Nguyen M, Braunschweig M, Nezer C, Collette C,Moreau L, Archibald AL, Haley CS, Buys N, Tally M, Andersson G,Georges M, Andersson L. A regulatory mutation in IGF2 causes a majorQTL effect on muscle growth in the pig. Nature 425: 832–836, 2003.

73. Vanderhaeghen JJ, Signeau JC, Gepts W. New peptide in vertebrateCNS reacting with antigastrin antibodies. Nature 257: 604–605, 1975.

74. Wilson PW, Fells M, Dunn IC. Targeted SNP discovery. 12th EuropeanPoultry Conference, Verona, Italy, 2006.

75. Wolc A, Arango J, Settar P, Fulton JE, O’Sullivan NP, Preisinger R,Habier D, Fernando R, Garrick DJ, Hill WG, Dekkers JC. Genome-

wide association analysis and genetic architecture of egg weight and egguniformity in layer chickens. Anim Genet 43: 87–96, 2012.

76. Wong GK, Liu B, Wang J, Zhang Y, Yang X, Zhang Z, Meng Q, ZhouJ, Li D, Zhang J, Ni P, Li S, Ran L, Li H, Zhang J, Li R, Li S, ZhengH, Lin W, Li G, Wang X, Zhao W, Li J, Ye C, Dai M, Ruan J, ZhouY, Li Y, He X, Zhang Y, Wang J, Huang X, Tong W, Chen J, Ye J,Chen C, Wei N, Li G, Dong L, Lan F, Sun Y, Zhang Z, Yang Z, YuY, Huang Y, He D, Xi Y, Wei D, Qi Q, Li W, Shi J, Wang M, Xie F,Wang J, Zhang X, Wang P, Zhao Y, Li N, Yang N, Dong W, Hu S,Zeng C, Zheng W, Hao B, Hillier LW, Yang SP, Warren WC, WilsonRK, Brandström M, Ellegren H, Crooijmans R, van der Poel JJ,Bovenhuis H, Groenen MA, Ovcharenko I, Gordon L, Stubbs L,Lucas S, Glavina T, Aerts A, Kaiser P, Rothwell L, Young JR, RogersS, Walker BA, van Hateren A, Kaufman J, Bumstead N, Lamont SJ,Zhou H, Hocking PM, Morrice D, de Koning DJ, Law A, Bartley N,Burt DW, Hunt H, Cheng HH, Gunnarsson U, Wahlberg P, Ander-sson L, Kindlund E, Tammi MT, Andersson B, Webber C, PontingCP, Overton IM, Boardman PE, Tang H, Hubbard SJ, Wilson SA, YuJ, Wang J, Yang H; International Chicken Polymorphism Map Con-sortium. A genetic variation map for chicken with 2.8 million single-nucleotide polymorphisms. Nature 432: 717–722, 2004.

77. Woodgush DG. A history of the domestic chicken from antiquity to the19th century. Poult Sci 38: 321–326, 1959.

78. Wynne K, Stanley S, McGowan B, Bloom S. Appetite control. JEndocrinol 184: 291–318, 2005.



decreased expression of the satiety signal receptor cckar is responsible for increased growth and...

Documents