General and Comparative Endocrinology 171 (2011) 203–210

Contents lists available at ScienceDirect

General and Comparative Endocrinology

journal homepage: www.elsevier .com/locate /ygcen

Chronic and acute stress responses in Senegalese sole (Solea senegalensis):The involvement of cortisol, CRH and CRH-BP

Yvette S. Wunderink a,b,⇑, Steef Engels b, Silke Halm c, Manuel Yúfera c, Gonzalo Martínez-Rodríguez c,Gert Flik b, Peter H.M. Klaren b, Juan M. Mancera a

a Department of Biology, Faculty of Marine and Environmental Sciences, University of Cádiz, 11510 Puerto Real (Cádiz), Spainb Department of Organismal Animal Physiology, Institute for Water and Wetland Research, Faculty of Science, Radboud University Nijmegen, Heyendaalseweg 135,6525 AJ Nijmegen, The Netherlandsc Instituto de Ciencias Marinas de Andalucía (CSIC), Apartado Oficial, 11510 Puerto Real (Cádiz), Spain

a r t i c l e i n f o a b s t r a c t

Article history:Received 13 December 2010Revised 21 January 2011Accepted 27 January 2011Available online 1 February 2011

Keywords:Solea senegalensisCortisolCRHCRH-binding proteinStressStocking densitySalinity

0016-6480/$ - see front matter � 2011 Elsevier Inc. Adoi:10.1016/j.ygcen.2011.01.010

⇑ Corresponding author at: Department of BioloEnvironmental Sciences, University of Cádiz, 11510Fax: +34 956 016019.

E-mail address: yvette.wunderink@uca.es (Y.S. Wu

The hypothalamus-pituitary-interrenal (HPI) axis is pivotal in the endocrine stress response of fish. Hypo-thalamic corticotropin-releasing hormone (CRH) initiates the endocrine stress response and stimulatesthe release of adrenocorticotropic hormone (ACTH) from the pituitary pars distalis, which in turn activatescortisol production and release by the interrenal cells of the head kidney. CRH activity depends on thelevels of a specific CRH binding protein (CRH-BP). We have characterized the cDNAs coding for CRHand CRH-BP in Senegalese sole (Solea senegalensis) and investigated their mRNA expression in juvenilesthat were submitted to a protocol that involved exposure to a chronic stressor (viz. increased cultivationdensities) followed by an acute stressor (viz. transfer to increased ambient salinity). Juveniles were cul-tivated at three densities (1.9, 4.7 and 9.8 kg/m2) for 33 days, and then exposed to an osmotic challengethat involved transfer from seawater (39‰ salinity, SW) to hypersaline seawater (55‰, HSW). The high-est density imposed stress as indicated by elevated cortisol levels and CRH mRNA expression compared tofish stocked at low density. Fish kept at high density differentially responded to a posterior transfer toHSW; no cortisol or CRH response was seen, but osmoregulatory and metabolic parameters wereaffected. No differences in CRH-BP mRNA expression levels were found at different stocking densities;transfer to HSW enhanced expression in both low and high density stocked animals, suggesting thatCRH-BP acts as a modulator of the acute stress response, not so of the chronic stress response. We con-clude that stocking of Senegalese sole at high density is a stressful condition that may compromise thecapacity to cope with subsequent stressors.

� 2011 Elsevier Inc. All rights reserved.

1. Introduction further regulated by a soluble binding protein: CRH-BP, with differ-

In vertebrates, the neuroendocrine stress axis plays a centralrole in acclimation to stress. In teleostean fishes, this axis is knownas the hypothalamus-pituitary-interrenal (HPI) axis. Here, the re-lease of corticotropin-releasing hormone (CRH) from the hypothal-amus reflects the brain’s integrative answer to stressors. CRHstimulates the release of adrenocorticotropic hormone (ACTH)from the pituitary pars distalis. ACTH derives from the precursorprotein proopiomelanocortin (POMC) and activates the interrenalcells of the head kidney to produce and release cortisol, which isconsidered to be the main stress steroid [15,49]. CRH signals viaspecific G-protein coupled receptors of which two forms have beendescribed: CRH-R1 and CRH-R2. The biological activity of CRH is

ll rights reserved.

gy, Faculty of Marine andPuerto Real (Cádiz), Spain.

nderink).

ent binding sites and affinities for these ligands [19]. CRH-BP has ahigher affinity for CRH than CRH-R1 has, so that CRH-BP is gener-ally considered to be a potent antagonist of CRH [18,19,29,47].

Chronic exposure to stressors can lead to allostatic overload (ordistress), which negatively affects reproduction, growth and im-mune functions leading to diseases and reduced animal welfare[24,31,49]. These aspects are of growing interest in intensive fishfarming. Indeed, aquaculture practice strives to realize a distress-free environment to provide optimal conditions for optimal pro-duction [5,6,12,39]. High stocking densities negatively affectgrowth performance in various fish species [21,25,34,35,41,44].Considering plasma cortisol levels in fish as a readout for distress,it appears that an increased stocking density evokes a crowdingstress, although the precise role of the central HPI axis has notyet been firmly established. The degree of stress, or allostatic load,depends on the chronicity of stress conditions, as well as a combi-nation of the nature and extent of the acute stressor. Fish in aqua-culture must cope with exposure to a series of acute stressors such

204 Y.S. Wunderink et al. / General and Comparative Endocrinology 171 (2011) 203–210

as transport, weighing, sorting/grading and sudden environmentalchanges e.g. in food availability, water temperature and salinity[1,4,36,39]. Acute stressors tend to affect the HPI axis in a morepronounced way (short duration surges of hormone release) thando chronic stressors [37,39].

The Senegalese sole (Solea senegalensis Kaup) is a flatfish spe-cies with high economic value in the North Africa Atlantic andIberian Peninsula, and is cultured at a commercial scale [10,20].S. senegalensis is euryhaline and widely distributed in littoraland estuarine habitats of the Eastern Atlantic from the Gulf ofBiscay to the coast of Senegal [9]. Previous studies on this specieshave shown that high stocking density imposes chronic stress asindicated by elevated plasma cortisol plasma levels [7,41]. Fur-thermore, it has been demonstrated that a transfer to highsalinity seawater elevates plasma cortisol levels in this species,reflecting an acute stress response [2,4].

Proceeding from this notion, we characterized the cDNAscoding for S. senegalensis CRH and CRH-BP peptides and investi-gated the role of these genes and cortisol in relation to a chronicstressor imposed by stocking density and the ability to cope witha subsequent acute stressor. Juveniles were kept at three stockingdensities and subsequently transferred from seawater to highsalinity seawater as a posterior challenge. In doing so, the adaptiveresponses to chronic (high stocking density) and acute (hypersa-line seawater) stressors can be investigated, as well as the conse-quences of a high stocking density history.

Table 1Primer oligonucleotide sequences used for RQ-PCR analysis.

Gene Primer Sequence (50 ? 30)

2. Material and methods

2.1. Animals and experimental design

Senegalese sole juveniles (S. senegalensis Kaup) with an averagebody weight of 163 ± 30 g were provided by Planta de CultivosMarinos (CASEM, University of Cádiz, Puerto Real (Cádiz), Spain),transferred to the facilities at the Faculty of Marine and Environ-mental Sciences (Puerto Real (Cádiz), Spain) and acclimated in200 L tanks with continuous seawater inflow at 18 �C under natu-ral photoperiod conditions (October–November, 2007). Fish werefed a daily ration of 1% of their estimated body weight and fastedfor 24 h before sampling. Fish were divided in three groups thatwere kept at three densities in duplicate tanks: ‘low density’ (LD,1.9 kg/m2), ‘medium density’ (MD, 4.7 kg/m2) and ‘high density’(HD, 9.8 kg/m2). Stocking densities were chosen according to previ-ous studies on flatfish [7,16]. After 33 days, 12 individuals weresampled from each stocking density.

For the second part of the experiment, the remaining animalspreviously stocked at LD and HD were transferred from seawater(SW, 39‰) to high salinity seawater (HSW, 55‰), fish transferredfrom SW to SW formed a control group. HSW was obtained by mix-ing full-strength SW with natural marine salt (Salina de La Tapa, ElPuerto de Santa Maria (Cádiz), Spain). Fish were sampled at 1, 3and 7 days after transfer (n = 7–8). Animals were anaesthetizedin 0.1% (v/v) 2-phenoxyethanol (Sigma), blood samples were col-lected from the caudal peduncle in heparinised syringes and cen-trifuged (3 min at 10,000g) to obtain plasma. After spinaltransection, brain tissues were sampled. All samples were immedi-ately frozen in liquid nitrogen and stored at �80 �C until furtheranalysis. All experimental procedures complied with the Guide-lines of the European Union Council (86/609/EU) and of the Univer-sity of Cádiz for the use of laboratory animals.

CRH qssCRH_Fw CCTGACCTTCCACCTGCTACqssCRH_Rv GAGATCTTTGGCGGAGTGAA

CRH-BP qssCRHBP_Fw GGCAATGGCATAGACACCTCqssCRHBP_Rv CACTGGACACCAGCCTCAC

b-actin qssBact_Fw TCTTCCAGCCATCCTTCCTCGqssBact_Rv TGTTGGCATACAGGTCCTTACGG

2.2. Cloning and sequencing

PCR was carried out on S. senegalensis brain cDNA with primersdesigned on homology regions of flounder (AJ555623), tilapia

(GU146060), zebrafish (BC085458), and carp (AJ317955) CRH(Table 1). For CRH-BP, primers were designed based on a knownEST sequence (FF284061.1) obtained from a Blast search for CRH-BP in a S. senegalensis EST database (Table 1). Obtained partial se-quences were used as probes for screening a kZAP cDNA libraryof S. senegalensis brain. XL1-Blue MRF’ and SOLR bacteria were usedfor in vivo excision of positive k phages. Plasmid DNA was isolatedby use of QIAprep miniprep kit (Qiagen) and outsourced forsequencing.

2.3. RNA extraction and cDNA synthesis

Total RNA was extracted using the commercial kit RNeasy�

(Qiagen) according to manufacturer’s instructions. Incubation withDNAse I (Qiagen) eliminated potential genomic DNA contamina-tion. RNA concentrations were measured by spectrophotometryand the quality of the extract was ensured using the Agilent RNA6000 Pico or Nano Assay Kit on an Agilent 2100 Bioanalyzer (Agi-lent Technologies). First strand cDNA synthesis was carried outusing the qScript™ cDNA Synthesis kit (Quanta BioSciences).

2.4. Real-time quantitative PCR

Primers for use in real-time quantitative PCR (RQ-PCR) were de-signed by use of Primer3 software (v. 0.4.0.) available at http://fokker.wi.mit.edu/primer3/input.htm, accessed in October 2010.Primer oligonucleotide sequences are shown in Table 1. To performRQ-PCR reactions, 8 ll cDNA (2 ng), forward and reverse primer(200 nM each) and 10 ll PerfeCta™ SYBR� Green Fastmix™ (Quan-ta BioSciences) were used. RQ-PCR (10 min at 95 �C, 40 cycles of30 s at 95 �C and 45 s at 60 �C) was performed on a Mastercycler�

EPgradient S RealPlex2 (Eppendorf). S. senegalensis b-actin (acces-sion number: DQ485686) remained stable during the experimentand was used as an internal control amplicon. A calibrator samplewas measured on every RQ-PCR plate to correct for inter-assay dif-ferences. PCR amplification efficiencies were similar for all genes.Expression levels R were calculated with the DDCt method.

2.5. Plasma parameters

Plasma glucose and lactate levels were measured using com-mercially available kits from Spinreact SA (Girona, Spain). Plasmaosmolality was measured using a freezing-point depression Osm-omat-030 osmometer (Gonotec). Cortisol plasma levels were mea-sured by radioimmunoassay (RIA) as described by Metz et al. [32]and validated for S. senegalensis by Arjona et al. [4]. The calculatedintra- and inter-assay coefficients of variation for the cortisol RIAused in this study are 2.0% and 10.6%, respectively.

2.6. Statistical analyses

Data were statistically analyzed by a multifactor ANOVA, one-way ANOVA or a Kruskal–Wallis one-way ANOVA by ranks fol-lowed by a Bonferroni post hoc test where appropriate. Differencesbetween two treatments at the same sample point were tested

Y.S. Wunderink et al. / General and Comparative Endocrinology 171 (2011) 203–210 205

using a Student’s t-test for unpaired data. Statistical significancewas accepted at P < 0.05.

3. Results

3.1. Cloning and characteristics of S. senegalensis CRH and CRH-BPcDNA

Partial sequences of S. senegalensis CRH and CRH-BP cDNA wereobtained with primers based on alignment of other teleost CRH

Fig. 1. Nucleotide and deduced amino acid sequences of S. senegalensis CRH cDNA. Thedisplayed above the nucleotide sequence. The predicted signal peptide M1-A24 and thepredicted mature peptide S139-Y179 is presented in bold and underlined. The cleavage sit

and CRH-BP sequences, and were used as a probe to screen aS. senegalensis brain cDNA library to obtain the complete codingsequences. Fig. 1 shows the obtained full-length nucleotide anddeduced amino acid sequence of the S. senegalensis CRH peptide.The CRH cDNA contains an open reading frame encoding a 181amino acid protein, including a conserved signal peptide (M1-A24), a cryptic motif (R61-E73) and a mature peptide (S139-Y179)based on alignment with other CRH sequences. Furthermore, a typ-ical N-terminal dibasic cleavage site (R137-R138) and C-terminalamidation site (G180-K181) of the mature peptide were observed.

start and stop codon are presented in bold. The deduced amino acid sequence isconserved cryptic motif R61-E73 are indicated in bold capitals. The sequence of thee and C-terminal amidation site are both underlined. Accession number: FR745427.

206 Y.S. Wunderink et al. / General and Comparative Endocrinology 171 (2011) 203–210

The complete coding sequence of S. senegalensis CRH-BP is pre-sented in Fig. 2. A protein of 321 amino acids is derived from thenucleotide sequence and includes an N-terminal signal peptide(M1-S23). Two conserved amino acids Arg53 and Asp59 are present,as well as ten conserved cysteine residues, which are involved inthe formation of five Cys–Cys disulfide loops.

Fig. 2. Nucleotide and deduced amino acid sequences of S. senegalensis CRH-BP cDNA. Tdisplayed above the nucleotide sequence. The predicted peptide signal M1-S23 is indicdisulfide bonds are boxed, underlined and indicated in bold. Two conserved amino acidsindicated in bold capitals. Accession number: FR745428.

3.2. Effects of stocking density

Plasma cortisol levels were significantly elevated in animalskept at the highest stocking density for 33 days, compared to ani-mals kept at the two lower densities (Fig. 3A). However, plasmaglucose and lactate levels were not affected (Table 2). CRH mRNA

he start and stop codon are presented in bold. The deduced amino acid sequence isated in bold capitals. The ten cysteines involved in the formation of five Cys–CysArg53 and Asp59, probably implicated in ligand-binding with CRH are underlined and

Fig. 3. Plasma cortisol concentrations (A) and expression levels of CRH (B) and CRH-BP (C) of fish stocked for 33 days at a low density (LD), medium density (MD) andhigh density (HD). Different letters indicate significant differences between groups(P < 0.05). Data are expressed as mean ± SEM, n = 7–8 for cortisol measurements;n = 5–6 for RQ-PCR.

Table 2Plasma glucose and lactate concentrations of fish stocked for 33 days at differentdensities.

Low density Medium density High density

Glucose (mM) 1.97 ± 0.09 1.79 ± 0.14 1.82 ± 0.05Lactate (mM) 0.39 ± 0.03 0.34 ± 0.06 0.40 ± 0.07

Data are expressed as mean ± SEM, n = 9–12.

A

B

C

Fig. 4. Cortisol plasma levels (A) and expression values of CRH (B) and CRH-BP (C)of fish transferred from seawater to seawater (SW ? SW), or seawater to highsalinity seawater (SW ? HSW). Fish were previously stocked at low density (LD) or

Y.S. Wunderink et al. / General and Comparative Endocrinology 171 (2011) 203–210 207

expression was significantly enhanced by 47% in fish stocked for33 days at high density (HD) compared to low density (LD),whereas CRH-BP mRNA expression levels were not affected(Fig. 3B and C).

high density (HD) and sampled at day 0 (pre-transfer) and 1, 3 and 7 days aftersalinity transfer. ⁄Indicates significant differences compared to day zero of the LDgroup, �represents significant differences compared to day one of the LD group,�indicates significant difference compared to day zero of the HD group (P < 0.05).Data are expressed as mean ± SEM, n = 7–8 for cortisol measurements; n = 5–6 forRQ-PCR.

3.3. Effects of hypersalinity challenge following different stockingdensity conditions

Fish initially kept at a low density (LD) showed increased plas-ma cortisol levels 1 and 3 days following transfer to hypersalineseawater (HSW); fish kept at HD did not show differences in plas-ma cortisol concentrations following transfer to HSW (Fig. 4A).Plasma glucose levels were elevated at day 1 and 3 after transferto HSW in fish previously stocked at LD, while fish maintained atHD showed a smaller enhancement and delayed in time, at day 3

and 7 (Table 3). Plasma osmolality was only disturbed at day 1after salinity transfer in fish kept at HD (Table 3). Plasma lactatevalues were not affected by salinity transfer in both density condi-tions (data not shown). CRH mRNA expression was enhanced at1 day after salinity transfer in fish kept at LD, whereas no differ-ences were seen in fish kept at HD (Fig. 4B). Enhanced expression

Table 3Plasma glucose levels and osmolalities of fish transferred from seawater to seawater(SW ? SW) or from seawater to high salinity seawater (SW ? HSW). Fish werepreviously stocked at low density (LD) or high density (HD) and sampled at day 0(pre-transfer) and 1, 3 and 7 days after transfer.

Time (Days) Low density High density

SW ? SW SW ? HSW SW ? SW SW ? HSW

Glucose (mM)0 2.0 ± 0.09a 2.0 ± 0.09a 1.8 ± 0.05a 1.8 ± 0.05a

1 2.5 ± 0.15b 6.4 ± 0.77b,� 2.1 ± 0.11a,�,* 2.1 ± 0.07a,�,*

3 ND 4.1 ± 0.29c 2.1 ± 0.03a,* 2.5 ± 0.20b,*

7 ND 3.4 ± 0.36a,c 2.5 ± 0.12b,* 2.5 ± 0.24b

Osmolality (mOsm)0 290 ± 9a 290 ± 9a 311 ± 10a 311 ± 10a

1 294 ± 6a 308 ± 6a 299 ± 7a,b 341 ± 10b,�,*,#

3 ND 321 ± 5a 318 ± 5a 327 ± 6a

7 ND 304 ± 9a 282 ± 4b,* 328 ± 2a,*,#

Different letters indicate significant differences compared to day zero (P < 0.05).Data are expressed as mean ± SEM, n = 7–8. ND = not determined.� Indicates significant differences compared to fish kept at LD transferred to SW.* Indicates significant differences compared to fish kept at LD transferred to HSW.

# Indicates significance differences compared to fish kept at HD transferred toHSW.

208 Y.S. Wunderink et al. / General and Comparative Endocrinology 171 (2011) 203–210

of CRH-BP mRNA was seen at day 1 and 3 after transfer to HSW infish kept at HD. Significant differences of CHR-BP mRNA expressionlevels of fish stocked at LD were only seen between day 1 and day 7after salinity transfer (Fig. 4C).

4. Discussion

4.1. Solea senegalensis CRH and CRH-BP protein characteristics

Two key central peptides of the endocrine stress axis, CRH andits binding protein CRH-BP, were characterized in S. senegalensis,and their roles in stress response were investigated. The deducedamino acid sequences of both proteins are highly homologous tothose in other vertebrates; this notable conservation has been re-ported for other species [18,22,48,50]. S. senegalensis CRH (ssCRH)pro-hormone shows a lower similarity, but the mature peptide ofssCRH shows a high homology of up to 72% identity with humanand 80% with Mozambique tilapia (Oreochromis mossambicus).Remarkable are the N-terminal repetitions of arginines and serinesin ssCRH, which are absent in human, rat and carp CRHs. Theyseem typical for flatfish, as they are also present in Europeanflounder (Platichthys flesus) CRH [27]. The deduced S. senegalensisCRH-BP (ssCRH-BP) amino acid sequence contains 10 cysteine res-idues, most likely participating in the formation of five Cys–Cysbridges that are important for ligand binding activity [14]. Thesecysteines appear to be conserved between insect, fish, amphibian,avian and mammalian sequences and demonstrate their key role incorrect protein folding [17,18,45,50].

4.2. Effects of stocking density

S. senegalensis juveniles kept at the highest density experiencedchronic stress as indicated by significantly increased plasma corti-sol levels, which agrees with previous studies on this species[7,41]. The elevated cortisol levels correlate with an enhancedCRH mRNA expression in the brain, and are also compatiblewith the unchanged CRH-BP mRNA expression. Compared to S.senegalensis exposed to an acute stressor (3 min air exposure) thatincreased plasma cortisol levels 20-fold, the effects are mild as iscommonly reported for chronic stress situations [8,35,37,39].Low cortisol levels are typical for sole, as they are known as anon-aggressive species and with a coping style commensurate to

their passive, benthic lifestyle [40,46,49]. The alteration of CRHexpression and no change in CRH-BP could also be the result ofadaptive responses to chronic stress. Cortisol negatively feeds backon the HPI-axis; hence an animal that is experiencing chronicstress might attenuate its own cortisol plasma levels [33,38,49].The closely related common sole (Solea solea), shows an increasein plasma cortisol levels when kept at high density, similar to whathas been observed for S. senegalensis, but the expression of pitui-tary proopiomelanocortin (POMC) mRNA is decreased. As POMCis the precursor protein for ACTH, it was suggested that this de-crease of POMC is exerted by direct negative feedback of elevatedplasma cortisol levels and can be considered as an adaptive re-sponse of fish to high stocking density [35].

4.3. Hypersalinity challenge on fish previously kept at differentdensities

Although we did not find elevated cortisol levels in fish kept atHD and transferred to HSW, a closer look reveals that osmoregula-tory and metabolic performance was disturbed at one day aftertransfer to HSW. High stocking density is known to increase dis-ease susceptibility in S. senegalensis and may demand more energyfor protein synthesis or other stress-related metabolites [7]. Nomortality or diseases were detected during our study, but the os-motic imbalance upon hypersalinity of fish previously kept at ahigh density indicates a compromised capacity to cope with a sub-sequent acute stressor, which might implicate that S. senegalensisdoes not adapt successfully to this stocking density.

S. senegalensis can trigger an acute stress response when trans-ferred to 55 ppt seawater (HSW) [2,4]. Interestingly, fish kept atlow density in our study showed a marked elevation in plasma cor-tisol levels upon transfer to a HSW, whereas those stocked at highdensity did not. Only few studies have examined the effect ofchronic stress on a subsequent acute stressor; indeed, no effector a reduction in post-stress cortisol elevation were reported forrainbow trout (Oncorhynchus mykiss) and red porgy (Pagrus pagrus)[23,38]. However, other studies report a cumulative effect of twostressors [28,39,43]. The lack of an extra cortisol elevation after asubsequent stressor in our study could indicate that chronic stressdesensitises the interrenal tissue to produce and/or release morecortisol. Although cortisol levels are elevated in fish kept at a highdensity, they could be under the influence of negative feedbackmechanisms on the HPI-axis, as mentioned previously. It wasshown that interrenal tissue from crowded fish showed an attenu-ated response to ACTH stimulation in vitro, and it is thus conceiv-able that chronic stress reduces the responsiveness of theinterrenal tissue to stimulatory factors such as ACTH [37]. Also, itis possible that there exists a limit to the capacity of the interrenaltissue to be stimulated, as proposed for red porgy [38].

An elevated level of plasma glucose is a normal response toacute stress, likely the result of glucocorticoid actions of cortisol[33,49]. Fish kept at a high density had an elevated plasma osmo-lality, whereas plasma glucose levels remained unchanged afterexposure to the second stressor. Thus, not only an inhibited corti-sol response to a subsequent stressor was seen in animals thatexperienced crowding stress, but also an inhibition of the subse-quent secondary stress response. Besides its glucocorticoid func-tion, cortisol has a mineralocorticoid function, regulating theexchange of ions and water [13,30,49]. In several teleostean fish,cortisol administration stimulates Na+/K+-ATPase (NKA) activityas well as mRNA levels of NKA subunits a1a and a1b, which are in-volved in osmoregulatory regulation [26,30]. The action of cortisolon osmoregulation is relatively slow, since it acts by binding to areceptor that regulates gene expression as a ligand-dependenttranscription factor [13]. Moreover, it is shown that acclimationto a different environmental salinity includes an adaptive phase

Y.S. Wunderink et al. / General and Comparative Endocrinology 171 (2011) 203–210 209

to regulate the recruitment of new NKAses, chloride cells and en-ergy redistribution [42]. In S. senegalensis juveniles submitted toa similar hypersalinity challenge, Arjona et al. concluded that theinitial adjustment to the stressor may take up to 3 days and thatduring this period cortisol functions mainly as a glucocorticoidrather than mineralocorticoid, increasing the availability of ATPfor the NKA pumps [2]. Interestingly, cortisol administration to S.senegalensis showed a significant enhancement of NKA activity atday three post-treatment [3]. The fact that fish glucocorticoidand mineralocorticoid receptors have highly conserved ligand(i.e. cortisol) binding domains requires careful consideration ofboth transcription factors (and their splice variants) in ionoregula-tory and metabolic actions of cortisol [15].

4.4. CRH-BP in the chronic and acute stress response

Thus far, the role of CRH-BP in adaptation to chronic stress hasnot been addressed in fish. We found that CRH-BP mRNA expres-sion was not affected in fish kept at high density. This indicatesthat CRH-BP does not play a key regulatory role during chronicstress situations. CHR-BP mRNA expression was significantlyupregulated after salinity transfer in both low and high densitystocked fish. No differences were seen between stocking densities,suggesting that CRH-BP may play a more important role in acutestress control. Upregulation of CRH-BP mRNA expression has beenreported in some studies in relation to acute stress. In rainbowtrout, stressors such as chasing and confinement elevated CRH-BP levels [11]. In addition, studies on common carp (Cyprinus car-pio) demonstrated an increase of CRH-BP expression following a24 h severe restraint [18]. In our study, CRH expression levels riseafter exposure to 55 ppt seawater in fish previously stocked at alow density. In fish kept at high density however, the CRH expres-sion remained stable. Clearly, the sequence of stressors is adetermining factor for CRH and CRH-BP gene activations inS. senegalensis. Cortisol levels can remain constant, as CRH-BPantagonises CRH activity, and the stimulating function of CRH isattenuated by the increase of CRH-BP [47,50]. According to itsupregulation in fish exposed to a hypersalinity challenge, an acutestressor, CRH-BP likely acts as an immediate modulator of thefunction of CRH, irrespective of the presence of previous chronicstressors like high stocking density.

4.5. Conclusions

In summary, CRH and CRH-BP cDNAs were sequenced in S. sen-egalensis. Fish kept at high density experienced stress and sufferfrom osmotic imbalance upon hypersalinity challenge. This indi-cates a compromised capacity to cope with a subsequent acutestressor, which might implicate that S. senegalensis does not adaptsuccessfully to high stocking density and should be reared at lowerdensities. Based on the enhanced CRH-BP mRNA expression in fishexposed to a hypersalinity challenge, independent of previousstocking densities, CRH-BP rather than CRH likely acts as a modu-lator in the acute stress response.

Acknowledgments

This work was partially funded by grants AGL2007-61211/ACU(Ministerio Educación y Ciencia of Spain) and Proyecto de Excel-encia PO7-RNM-02843 (Consejería de Innovación, Ciencia yEmpresa, Junta de Andalucía, Spain) to J.M.M., as well as by theproject AQUAGENOMICS (CSD2007-00002, Consolider-Ingenio2010 Program, MICINN, Spain). The authors are grateful to ‘‘Plantade Cultivos Marinos’’ (CASEM, Puerto Real, Spain) for the donationof S. senegalensis, and also thanks to Dr. Antonio Astola for his tech-nical advice. Y.W. is funded by Ministerio de Educación y Ciencia

(Spain) through the program ‘‘Formación de Profesorado Universi-tario’’ (Ref: AP2006-03932).

References

[1] F.J. Arjona, I. Ruiz-Jarabo, L. Vargas-Chacoff, M.P.M. Del Río, G. Flik, J.M.Mancera, P.H.M. Klaren, Acclimation of Solea senegalensis to different ambienttemperatures: implications for thyroidal status and osmoregulation, Mar. Biol.157 (2010) 1325–1335.

[2] F.J. Arjona, L. Vargas-Chacoff, M.P. Martín del Río, G. Flik, J.M. Mancera, P.H.M.Klaren, The involvement of thyroid hormones and cortisol in the osmoticacclimation of Solea senegalensis, Gen. Comp. Endocrinol. 155 (2008) 796–803.

[3] F.J. Arjona, L. Vargas-Chacoff, M.P. Martín del Río, G. Flik, J.M. Mancera, P.H.M.Klaren, Effects of cortisol and thyroid hormone on peripheral outer ringdeiodination and osmoregulatory parameters in the Senegalese sole (Soleasenegalensis), J. Endocrinol. (2011), doi:10.1530/JOE-10-0416.

[4] F.J. Arjona, L. Vargas-Chacoff, I. Ruiz-Jarabo, M.P. Martín del Río, J.M. Mancera,Osmoregulatory response of Senegalese sole (Solea senegalensis) to changes inenvironmental salinity, Comp. Biochem. Physiol. A 148 (2007) 413–421.

[5] P.J. Ashley, Fish welfare: current issues in aquaculture, Appl. Anim. Behav. Sci.104 (2007) 199–235.

[6] F.S. Conte, Stress and the welfare of cultured fish, Appl. Anim. Behav. Sci. 86(2004) 205–223.

[7] B. Costas, C. Aragão, J.M. Mancera, M.T. Dinis, L.E.C. Conceiçao, B.C. Refojos,High stocking density induces crowding stress and affects amino acidmetabolism in Senegalese sole Solea senegalensis (Kaup 1858) juveniles,Aquacult. Res. 39 (2008) 1–9.

[8] B. Costas, L. Conceição, C. Aragão, J.A. Martos, I. Ruiz-Jarabo, J.M. Mancera, A.Afonso, How does an acute stress modulate the innate immune system ofsenegalese sole (Solea senegalensis Kaup 1858)?, 7th Congreso de la AsociaciónIbérica de Endocrinología Comparada, Porto (Portugal), (2009).

[9] Desoutter, Soleidae, JNICT, Lisbon; SEI, Paris; and UNESCO, Paris, 1990.[10] M.T. Dinis, L. Ribeiro, F. Soares, C. Sarasquete, A review on the cultivation

potential of Solea senegalensis in Spain and in Portugal, Aquaculture 176 (1999)27–38.

[11] C. Doyon, V.L. Trudeau, T.W. Moon, Stress elevates corticotropin-releasingfactor (CRF) and CRF-binding protein mRNA levels in rainbow trout(Oncorhynchus mykiss), J. Endocrinol. 186 (2005) 123–130.

[12] T. Ellis, B. North, A.P. Scott, N.R. Bromage, M. Porter, D. Gadd, The relationshipsbetween stocking density and welfare in farmed rainbow trout, J. Fish Biol. 61(2002) 493–531.

[13] T.G. Evans, Co-ordination of osmotic stress responses through osmosensingand signal transduction events in fishes, J. Fish Biol. 76 (2010) 1903–1925.

[14] W.H. Fischer, D.P. Behan, M. Park, E. Potter, P.J. Lowry, W. Vale, Assignment ofdisulfide bonds in corticotropin-releasing factor-binding protein, J. Biol. Chem.269 (1994) 4313–4316.

[15] G. Flik, P.H.M. Klaren, E.H. van den Burg, J.R. Metz, M.O. Huising, CRF and stressin fish, Gen. Comp. Endocrinol. 146 (2006) 36–44.

[16] M. Herrera, L. Vargas-Chacoff, I. Hachero, I. Ruíz-Jarabo, A. Rodiles, J.I. Navas,J.M. Mancera, Physiological responses of juvenile wedge sole Dicologoglossacuneata (Moreau) to high stocking density, Aquacult. Res. 40 (2009) 790–797.

[17] M.O. Huising, G. Flik, The remarkable conservation of corticotropin-releasinghormone (CRH)-binding protein in the honeybee (Apis mellifera) dates the CRHsystem to a common ancestor of insects and vertebrates, Endocrinology 146(2005) 2165–2170.

[18] M.O. Huising, J.R. Metz, C. van Schooten, A.J. Taverne-Thiele, T. Hermsen, B.M.Verburg-van Kemenade, G. Flik, Structural characterisation of a cyprinid(Cyprinus carpio L.) CRH, CRH-BP and CRH-R1, and the role of these proteins inthe acute stress response, J. Mol. Endocrinol. 32 (2004) 627–648.

[19] M.O. Huising, J.M. Vaughan, S.H. Shah, K.L. Grillot, C.J. Donaldson, J. Rivier, G.Flik, W.W. Vale, Residues of corticotropin releasing factor-binding protein(CRF-BP) that selectively abrogate binding to CRF but not to urocortin 1, J. Biol.Chem. 283 (2008) 8902–8912.

[20] A.K. Imsland, A. Foss, L.E.C. Conceiçao, M.T. Dinis, D. Delbare, E. Schram, A.Kamstra, P. Rema, P. White, A review of the culture potential of Solea solea andS. Senegalensis, Rev. Fish Biol. Fish. 13 (2003) 379–407.

[21] S. Irwin, J. O’Halloran, R.D. FitzGerald, Stocking density, growth and growthvariation in juvenile turbot, Scophthalmus maximus (Rafinesque), Aquaculture178 (1999) 77–88.

[22] O. Jahn, K. Eckart, O. Brauns, H. Tezval, J. Spiess, The binding protein ofcorticotropin-releasing factor: Ligand-binding site and subunit structure, Proc.Nat. Acad. Sci. USA 99 (2002) 12055–12060.

[23] M.J. Kebus, M.T. Collins, M.S. Brownfield, C.H. Amundson, T.B. Kayes, J.A.Malison, Effects of rearing density on the stress response and growth ofrainbow trout, J. Aquat. Anim. Health 4 (1992) 1–6.

[24] S.M. Korte, J.M. Koolhaas, J.C. Wingfield, B.S. McEwen, The Darwinian conceptof stress: benefits of allostasis and costs of allostatic load and the trade-offs inhealth and disease, Neurosci. Biobehav. Rev. 29 (2005) 3–38.

[25] T.S. Kristiansen, A. Fernö, J.C. Holm, L. Privitera, S. Bakke, J.E. Fosseidengen,Swimming behaviour as an indicator of low growth rate and impaired welfarein Atlantic halibut (Hippoglossus hippoglossus L.) reared at three stockingdensities, Aquaculture 230 (2004) 137–151.

[26] R. Laiz-Carrión, M.P. Martín del Río, J.M. Miguez, J.M. Mangera, J.L. Soengas,Influence of cortisol on osmoregulation and energy metabolism in giltheadseabream Sparus aurata, J. Exp. Zool. A: Comp. Exp. Biol. 298 (2003) 105–118.

210 Y.S. Wunderink et al. / General and Comparative Endocrinology 171 (2011) 203–210

[27] E. Lu, L. Dow, S. Gumusgoz, M.J. Brierley, J.M. Warne, C.R. McCrohan, R.J.Balment, D. Riccardi, Coexpression of corticotropin-releasing hormone andurotensin I precursor genes in the caudal neurosecretory system of theeuryhaline flounder (Platichthys flesus): a possible shared role in peripheralregulation, Endocrinology 145 (2004) 5786–5797.

[28] J.M. Mancera, L. Vargas-Chacoff, A. García-López, A. Kleszczynska, H. Kalamarz,G. Martínez-Rodríguez, E. Kulczykowska, High density and food deprivationaffect arginine vasotocin isotocin and melatonin in gilthead sea bream (Sparusauratus), Comp. Biochem. Physiol. A 149 (2008) 92–97.

[29] S.J. McClennen, D.N. Cortright, A.F. Seasholtz, Regulation of pituitarycorticotropin-releasing hormone-binding protein messenger ribonucleic acidlevels by restraint stress and adrenalectomy, Endocrinology 139 (1998) 4435–4441.

[30] S.D. McCormick, A. Regish, M.F. O’Dea, J.M. Shrimpton, Are we missing amineralocorticoid in teleost fish? Effects of cortisol, deoxycorticosterone andaldosterone on osmoregulation, gill Na+, K+-ATPase activity and isoform mRNAlevels in Atlantic salmon, Gen. Comp. Endocrinol. 157 (2008) 35–40.

[31] B.S. McEwen, J.C. Wingfield, The concept of allostasis in biology andbiomedicine, Horm. Behav. 43 (2003) 2–15.

[32] J.R. Metz, E.J.W. Geven, E.H. van den Burg, G. Flik, ACTH, a-MSH, and control ofcortisol release: Cloning, sequencing, and functional expression of themelanocortin-2 and melanocortin-5 receptor in Cyprinus carpio, Am. J.Physiol. 289 (2005) R814–R826.

[33] T.P. Mommsen, M.M. Vijayan, T.W. Moon, Cortisol in teleosts: dynamicsmechanisms of action, and metabolic regulation, Rev. Fish Biol. Fish. 9 (1999)211–268.

[34] D. Montero, M.S. Izquierdo, L. Tort, L. Robaina, J.M. Vergara, High stockingdensity produces crowding stress altering some physiological and biochemicalparameters in gilthead seabream, Sparus aurata, juveniles, Fish Physiol.Biochem. 20 (1999) 53–60.

[35] F. Palermo, M. Nabissi, G. Cardinaletti, E. Tibaldi, G. Mosconi, A.M. Polzonetti-Magni, Cloning of sole proopiomelanocortin (POMC) cDNA and the effects ofstocking density on POMC mRNA and growth rate in sole, Solea solea, Gen.Comp. Endocrinol. 155 (2008) 227–233.

[36] N.W. Pankhurst, The endocrinology of stress in fish: An environmentalperspective, Gen. Comp. Endocrinol.(2010) doi: 10.1016/j.ygcen.2010.1007.1017.

[37] J. Rotllant, P.H.M. Balm, N.M. Ruane, J. Perez-Sanchez, S.E. Wendelaar Bonga, L.Tort, Pituitary proopiomelanocortin-derived peptides and hypothalamus-pituitary-interrenal axis activity in gilthead sea bream (Sparus aurata) duringprolonged crowding stress: differential regulation of adrenocorticotropinhormone and alpha-melanocyte-stimulating hormone release bycorticotropin-releasing hormone and thyrotropin-releasing hormone, Gen.Comp. Endocrinol. 119 (2000) 152–163.

[38] J. Rotllant, L. Tort, Cortisol and glucose responses after acute stress by nethandling in the sparid red porgy previously subjected to crowding stress, J.Fish Biol. 51 (1997) 21–28.

[39] N.M. Ruane, E.C. Carballo, J. Komen, Increased stocking density influences theacute physiological stress response of common carp Cyprinus carpio (L.),Aquacult. Res. 33 (2002) 777–784.

[40] E. Salas-Leiton, V. Anguis, M. Manchado, J.P. Cañavate, Growth, feeding andoxygen consumption of Senegalese sole (Solea senegalensis) juveniles stockedat different densities, Aquaculture 285 (2008) 84–89.

[41] E. Salas-Leiton, V. Anguis, B. Martín-Antonio, D. Crespo, J.V. Planas, C. Infante,J.P. Cañavate, M. Manchado, Effects of stocking density and feed ration ongrowth and gene expression in the Senegalese sole (Solea senegalensis):potential effects on the immune response, Fish Shellfish Immunol. 28 (2010)296–302.

[42] S. Sangiao-Alvarellos, F.J. Arjona, M.P. Martín del Río, J.M. Míguez, J.M. Mancera,J.L. Soengas, Time course of osmoregulatory and metabolic changes duringosmotic acclimation in Sparus auratus, J. Exp. Biol. 208 (2005) 4291–4304.

[43] S. Sangiao-Alvarellos, J.M. Guzmán, R. Láiz-Carrión, J.M. Míguez, M.P. Martíndel Río, J.M. Mangera, J.L. Soengas, Interactive effects of high stocking densityand food deprivation on carbohydrate metabolism in several tissues ofgilthead sea bream Sparus auratus, J. Exp. Zool. A: Comp. Exp. Biol. 303(2005) 761–775.

[44] E. Schram, J.W. van der Heul, A. Kamstra, M.C.J. Verdegem, Stocking density-dependent growth of Dover sole (Solea solea), Aquaculture 252 (2006) 339–347.

[45] A.F. Seasholtz, R.A. Valverde, R.J. Denver, Corticotropin-releasing hormone-binding protein: biochemistry and function from fishes to mammals, J.Endocrinol. 175 (2002) 89–97.

[46] P.I.M. Silva, C.I.M. Martins, S. Engrola, G. Marino, Ø. Øverli, L.E.C. Conceição,Individual differences in cortisol levels and behaviour of Senegalese sole (Soleasenegalensis) juveniles: evidence for coping styles, Appl. Anim. Behav. Sci. 124(2010) 75–81.

[47] S.W. Sutton, D.P. Behan, S.L. Lahrichi, R. Kaiser, A. Corrigan, P. Lowry, E. Potter,M.H. Perrin, J. Rivier, W.W. Vale, Ligand requirements of the humancorticotropin-releasing factor-binding protein, Endocrinology 136 (1995)1097–1102.

[48] F.H.J. van Enckevort, P.P.L.M. Pepels, J.A.M. Leunissen, G.J.M. Martens, S.E.Wendelaar Bonga, P.H.M. Balm, Oreochromis mossambicus (tilapia)corticotropin-releasing hormone: cDNA sequence and bioactivity, J.Neuroendocrinol. 12 (2000) 177–186.

[49] S.E. Wendelaar Bonga, The stress response in fish, Physiol. Rev. 77 (1997) 591–625.

[50] N.J. Westphal, A.F. Seasholtz, CRH-BP: the regulation and function of aphylogenetically conserved binding protein, Front. Biosci. 11 (2006) 1878–1891.