ancient egyptian sacred ibis mummies - griffith research online
TRANSCRIPT
ANCIENT EGYPTIAN SACRED IBIS MUMMIES:
EVOLUTIONARY MITOGENOMICS RESOLVES THE
HISTORY OF ANCIENT FARMING
Sally A Wasef
M.Sc.
Environmental Futures Research Institute
Griffith Sciences
Griffith University
Submitted in fulfilment of the requirements of the degree of Doctor
of Philosophy.
November 2015
ii
Abstract
Animal mummies were extremely important to the people of ancient Egypt. The
extraordinary number of different animal species that were mummified is evidence of
this importance. The vast majority of these mummies served as ritual offerings by
pilgrims to please the gods. These are known as “votive offerings”, and are thought to
have flourished from the Twenty-Sixth Dynasty (664-525 BC) to the Graeco-Roman
Period (30 BC–300 AD). Of these, none are found in quantities as great as the Sacred
Ibis (Threskiornis aethiopicus) that were offered to the God of Wisdom and Writing,
Thoth. It is estimated that 4 million Sacred Ibis mummies were deposited in dedicated
catacombs throughout Egypt, with approximately 10,000 mummies interred each year.
Such massive numbers suggest that ancient Egyptians perhaps kept and reared Ibis on
an industrial-scale. However, there is limited evidence in ancient writings that support
this suggestion. Sacred Ibis were once prevalent in Egypt but were driven to extinction
as early as the mid 1800's.
Mummified Sacred Ibis specimens were collected from the main Sacred Ibis catacombs
at Saqqara, Tuna el Gebel, Abydos and Thebes, as well as other mummified samples
collected from worldwide museums. The aim of this research was to determine if there
was evidence that Sacred Ibises were farmed for mummification purposes. If so, is there
evidence for the existence of large central farm(s) from which mummies were distributed
to the different catacombs by pilgrims? Alternatively, Sacred Ibises may have been
reared in smaller enclosures adjacent to each of the main Thoth worshipping temples.
Another possibility is that locals and / or priests may have caught wild Sacred Ibises
each year from migrating populations? Alternatively, did the mummification industry
source Sacred Ibis from a mix of both farmed and wild Sacred Ibises in order to meet
the extraordinary demand?
We 14C radiocarbon dated bone, wrapping and resin samples from six Sacred Ibis
mummies. These were shown to be from the Late Period or slightly earlier to the
Ptolemaic Period. Interestingly, none of the samples were dated to the Roman era. This
iii
might, of course, be due to the particular samples chosen for dating. Though, it is
possible that the need for Sacred Ibis reduced prior this period, as suggested by
archaeologists. However, it is quite possible that the habit of mummifying Sacred Ibis
and offering them to deities had ceased by the 2nd or 3rd centuries AD.
The recovery of ancient DNA from mummified Egyptian remains is notoriously difficult.
A possible reason for the failure to extract DNA may be due to the continued exposure
of the remains to the warm and humid climate common to Egypt. However, the field of
ancient genomics has advanced in recent years with the advent of second generation
sequencing platforms. Research conducted on the Egyptian Royal mummies by Hawass
et al. (2010 and 2012), have been marked by questions concerning possible
contamination. To date, only a small number of studies have addressed mummified
animal remains (Hekkala et al., 2011; Khairat et al., 2013; Kurushima et al., 2012).
We constructed a number of DNA libraries from ancient Egyptian Sacred Ibis tissue
including bone and feather. We show that using second-generation shotgun sequencing
of 30 ancient Sacred Ibis libraries yielded only 0.0003% to 0.06% mitochondrial DNA.
As a result of the low amount of endogenous DNA, we enriched Sacred Ibis
mitochondrial sequences using DNA capture methods. Using biotinylated RNA baits to
Sacred Ibis mitochondrial sequences, we were able to achieve between 5.3- to 336-fold
enrichment of original templates. Consequently, using targeted hybridisation we were
able to reconstruct 15 complete mitochondrial genomes from ancient Egyptian sub-
fossil material.
Additionally, we were able to recover 26 modern complete mitochondrial genomes,
obtained from blood and feather samples. Those samples were collected from locations
covering the geographic distribution of Sacred Ibis populations across Africa. These
samples were used to estimate the genetic diversity of Sacred Ibis across the African
continent and this diversity was compared with that of ancient Sacred Ibis populations.
Rearing Sacred Ibises in a large centralised farm as has been suggested, might result
in a low genetic variation between the mummified Sacred Ibises collected from the
various catacombs. Remarkably, our results showed a high level of mitochondrial
iv
genetic variation among ancient Egyptian Sacred Ibises, very similar to that found for all
modern wild African Ibis populations. Hence, we suggest that the ancient Egyptians
sustained the captive Sacred Ibis stocks through multiple sources one of them is the
introduction of migrating wild individuals each year. That also helped in maintain the
health of these populations and facilitated the high production levels necessary to meet
the considerable demands of mummification on such a vast scale.
v
Statement of Originality
This work has not previously been submitted for a degree or diploma in any university.
To the best of my knowledge and belief, the thesis contains no material previously
published or written by another person except where due reference is made in the thesis
itself.
Sally A Wasef
X
vi
Contents
Abstract .................................................................................................................................. ii
Statement of Originality ........................................................................................................ v
Contents ................................................................................................................................ vi
Acknowledgements .............................................................................................................. ix
Acknowledgement of Papers included in this Thesis ........................................................ xi
Thesis Aims and Structure ................................................................................................. xiv
1. Chapter One: The role of the Sacred Ibis in ancient Egyptian life and religion........ 1
1.1 Abstract ................................................................................................................. 1
1.2 Sacred Ibis species information .......................................................................... 1
1.3 Sacred Ibis mummification .................................................................................. 7
1.4 The Sacred Ibis Catacombs ................................................................................. 9
1.5 The Sacred Ibis in the ancient Egyptian texts .................................................. 18
1.6 The Sacred Ibis in the ancient Egyptian art ...................................................... 19
1.7 The role of the Sacred Ibis in religion ............................................................... 20
1.8 Conclusion .......................................................................................................... 21
References...................................................................................................................... 21
2. Chapter Two: Ancient Egyptian DNA survival debate ................................................ 29
Summary: ........................................................................................................................ 29
1. Extraordinary early results with ancient DNA ................................................... 30
2. Ancient DNA from Egypt: a checkered history. ................................................. 31
3. The future for aDNA research using the Egyptian remains..................................... 39
References...................................................................................................................... 41
3. Chapter Three: Radiocarbon dating of Sacred Ibis mummies from ancient Egypt 47
ABSTRACT ....................................................................................................................... 48
1. Introduction ........................................................................................................ 48
2. Material, Methods, and Locations: ................................................................... 50
3. Results ................................................................................................................ 54
vii
4. Discussion .......................................................................................................... 60
5. Conclusion .......................................................................................................... 60
Acknowledgments .......................................................................................................... 61
References...................................................................................................................... 61
4. Chapter Four: Fishing for mitochondrial DNA in mummified Sacred Ibises:
development of a targeted enrichment protocol for ancient Egyptian remains. ........... 65
Abstract ........................................................................................................................... 66
Introduction .................................................................................................................... 66
Material and Methods.................................................................................................... 68
Results and Discussion ................................................................................................. 77
Conclusion ...................................................................................................................... 82
Acknowledgements. ....................................................................................................... 83
References...................................................................................................................... 86
5. Chapter Five: Mitogenomics of Sacred Ibis mummies: Understanding their farming
in ancient Egypt .................................................................................................................. 89
Significance .................................................................................................................... 90
Abstract ........................................................................................................................... 90
Introduction .................................................................................................................... 91
Results ............................................................................................................................ 92
Discussion ...................................................................................................................... 95
Materials and Methods .................................................................................................. 97
ACKNOWLEDGEMENTS................................................................................................101
References....................................................................................................................110
Conclusion to Thesis ........................................................................................................113
Thesis Significance ......................................................................................................113
Thesis work Limitations ...............................................................................................117
Future Prospects ..........................................................................................................118
Final Remarks ..............................................................................................................120
References....................................................................................................................120
Appendix (A) ......................................................................................................................122
Appendix (B)......................................................................................................................125
viii
Appendix (C) ......................................................................................................................145
Appendix (D) .....................................................................................................................156
Appendix (E) ......................................................................................................................161
ix
Acknowledgements
I would like to thank all the people who contributed in some way to my passion for
research, especially in the ancient DNA field; both my previous supervisors and research
collaborators. If nothing else, this dissertation has been a lesson in collaboration. The
work that went into this thesis never would have been possible without the many
amazing people who shaped my research interests and provided important insights and
assistance. First and foremost, I would like to thank my academic advisor, Professor
David Lambert, for accepting me into his research group. During my tenure, he
contributed to a rewarding graduate school experience by giving me intellectual freedom
in my work, supporting my attendance at various conferences and workshops, engaging
me in new ideas, and demanding a high quality of work in all my endeavours. I
appreciate his contribution of time, ideas, and funding to make my Ph.D. experience
productive and stimulating.
Additionally, I would like to thank my co-supervisor Dr. Leon Huynen; every method and
result described in this thesis was accomplished with your help and support, I will forever
be grateful to you. Similarly, profound gratitude goes to my co-supervisor Dr. Sankar
Subramanian for his help with Bioinformatics, computer software and high-throughput
sequencing data analysis. I am also very grateful to the past and present members of
the Environmental Forensic Laboratory; they have contributed immensely to my
personal and professional time at Griffith. The group has been a source of friendships
as well as good advice and collaboration. I am especially grateful for, Joanne Wright who
as a good friend was always willing to help and give her best suggestions. It would have
been a lonely lab without her. Thank you as well Jo for proofreading my thesis. Moreover,
I would like to thank other members; Anne Kemp, Caitlin Curtis, Matthew Parks, and
particularly Tim, for being always helpful. Further, I would like to thank Dr Jeremy
Brownlie for his bioinformatics support.
I would like to thank the Egyptian ministry of Antiquates and the Supreme Council Higher
Committee for kindly permitting me to obtain the ancient samples and allowing me to
use the ancient DNA laboratory at El Kasr El Ani, Medical School. I am especially
indebted to Dr. Samia El Marghani for her inordinate contribution to my sampling
x
permission and collection; her wide knowledge and expertise in the ancient archeology
field were always guiding me to explore the significance of my genetic data in relation to
the Egyptian history. She contributed vast amounts of time and effort to help me choose
the right samples.
A number of museums kindly provided material for this study, special thanks goes to:
The British Museum, the Musée des Confluences, and particularly Dr. Lidija M. McKnight
and The Ancient Egyptian Animal Bio Bank at Manchester Museum.
I would like to thank our collaborative groups in Africa, who helped in obtaining the
modern Sacred Ibis blood and feather samples from the various populations.
I am especially grateful to the Human Frontier Science for funding support my research
work in the form of a grant RGP0036/2011; “Ancient Ibis Mummies from Egypt: DNA
Evolution”. Thanks to Griffith University and the School of Environment for providing me
with the facilities to do this research and also for financial support in the form of a
scholarship and stipend during my degree. Thanks to everyone at the Environmental
research institute and Griffith University DNA Sequencing Facility who helped me in
other ways to complete my research.
Also, I won’t forget to thank Prof. Salima Ikram, Prof. Eske willerslev, Dr. Rachel Wood
and Assoc. Prof. Craig Millar for their professional contribution each in his speciality on
such multidisciplinary research work.
Finally, and the Most importantly I must thank my husband George, for listening to my
incessant rambling on about this research and generally putting up with this project for
the better part of the last four years! Without your patience and understanding I would
never have finished this thesis, your love and support are invaluable. Also, I would like
to thank my beautiful two children for understanding when I say that I can’t play with
them because I am studying! They are the most important people in my world and I
dedicate this thesis to them. Further, I would never have been able to reach so far in my
life without the help and support from my parents, thank you mum and dad for shaping
me who I am.
xi
Acknowledgement of Papers included in this Thesis
Section 9.1 of the Griffith University Code for the Responsible Conduct of Research
(“Criteria for Authorship”), in accordance with Section 5 of the Australian Code for the
Responsible Conduct of Research, states:
To be named as an author, a researcher must have made a substantial scholarly
contribution to the creative or scholarly work that constitutes the research
output, and be able to take public responsibility for at least that part of the work
they contributed. Attribution of authorship depends to some extent on the
discipline and publisher policies, but in all cases, authorship must be based on
substantial contributions in a combination of one or more of:
Conception and design of the research project
Analysis and interpretation of research data
Drafting or making significant parts of the creative or scholarly work or
critically revising it so as to contribute significantly to the final output.
Section 9.3 of the Griffith University Code (“Responsibilities of Researchers”), in
accordance with Section 5 of the Australian Code, states:
Researchers are expected to:
Offer authorship to all people, including research trainees, who meet the
criteria for authorship listed above, but only those people.
Accept or decline offers of authorship promptly in writing.
Include in the list of authors only those who have accepted authorship
Appoint one author to be the executive author to record authorship and
manage correspondence about the work with the publisher and other
interested parties.
Acknowledge all those who have contributed to the research, facilities or
materials but who do not qualify as authors, such as research assistants,
technical staff, and advisors on cultural or community knowledge.
Obtain written consent to name individuals.
xii
Included in this thesis are papers in Chapters 2,3,4 and 5, which are co-authored with
other researchers.
The bibliographic details for the published or accepted for publication papers including
all authors are:
Chapter 2:
Hawass, Z., S. Ismail, A. Selim, S. N. Saleem, D. Fathalla, S. Wasef, A. Z. Gad, R.
Saad, S. Fares, H. Amer, P. Gostner, Y. Z. Gad, C. M. Pusch and A. R. Zink (2012).
"Revisiting the harem conspiracy and death of Ramesses III: anthropological,
forensic, radiological, and genetic study." BMJ (Clinical Research ed.) 345(Dec14
14): e8268-e8268.
Chapter 3:
Wasef, S., R. Wood, S. El Merghani, S. Ikram, C. Curtis, B. Holland, E. Willerslev,
C. D. Millar and D. M. Lambert (2015). "Radiocarbon dating of Sacred Ibis
mummies from ancient Egypt." Journal of Archaeological Science: Reports 4:
355-361.
The status for chapters prepared or submitted for publication for these papers including
all authors, are:
Chapter 4:
Wasef, S., L. Huynen, C. Curtis, S. El Merghani, S. Ikram, B. Holland, E. Willerslev,
C. D. Millar and D. M. Lambert (2015). “Fishing for mitochondrial DNA in
mummified Sacred Ibis: development of a targeted enrichment protocol for
ancient Egyptian remains.” Submitted to: Journal of Archaeological Science.
Chapter 5:
Wasef, S., S. Subramanian, L. Huynen, C. Curtis, S. El Merghani, S. Ikram, B.
Holland, E. Willerslev, C. D. Millar and D. M. Lambert (2015). “Mitogenomics of
Sacred Ibis mummies: Understanding their farming in ancient Egypt.”
Submitted to: Proceedings of the National Academy of Sciences of The United
States of America.
Appropriate acknowledgements of those who contributed to the research but did not
qualify as authors are included in each paper.
xiii
(Signed) _________________________________ (Date) 14/11/2015
Sally Wasef
(Countersigned) ___________________________ (Date) 14/11/2015
Supervisor: Prof. David M. Lambert
xiv
Thesis Aims and Structure
This thesis presents the research work carried out as part of the Sacred Ibis Ancient
DNA project, funded by the Human Frontier Science Program grant (RGP0036/2011),
aimed at recovering the complete mitochondrial genomes (mitogenomes) from both
modern and ancient sacred Ibis materials. The research focused on the following:
Using my expertise in ancient DNA to improve current methods for the recovery
of ancient DNA from Egyptian mummified remains, taking into consideration
previously mentioned unsearched parameters that may affect the amount of
endogenous DNA extracted.
The quantification of Ibis mitogenomic diversity across geographical space.
Using the mitochondrial genomes to help clarify our understanding of the Sacred
Ibis in ancient Egyptian society, specifically addressing the following questions:
o Were all, or some, populations of Ibis characterised by low levels of
genetic diversity, consistent with small populations of breeding (farmed)
individuals being continuously maintained? This work was facilitated
using modern blood and other tissue samples collected from a range of
sites in Africa, such as, South Africa, Ethiopia and Uganda.
o Were Ibis from the various Egyptian locations different from each other
genetically and/or did they exhibit different levels of genetic diversity?
o Were there different levels of mitochondrial diversity in males and
females, and what might this tell us about the farming systems used?
This PhD thesis is written as five chapters, formatted as a combination of published and
unpublished (either submitted or ready for future submission) papers, with addition
sections for the abstract, thesis conclusion and future prospects. The contents of the
chapters presented and their relative supplementary data are as follow:
Chapter 1 - The role of the Sacred Ibis in ancient Egyptian life and religion
This chapter presents the archaeological and historical importance of the Sacred Ibis.
xv
The ancient Egyptians considered the Sacred Ibis the incarnation of the god Thoth on
earth. The identification characteristics and all other Sacred Ibis species information
have also been presented in this chapter. This chapter contains explicit review of the
existing information about the Sacred Ibis in an ancient Egyptian context, including the
religious beliefs involving the Ibis, the mummification of millions of that bird, the main
Ibis catacombs where the samples were collected and the art depicting the sacred Ibis.
The history behind the ancient Egyptian animal mummification, the various burial
catacombs of the Sacred Ibis and the Sacred Ibis sample collections presented in this
chapter was presented as a part of a BBC Horizon documentary titled “70 million animal
mummies: Egypt’s dark secret” which aired on BBC 2 on Monday 11 May 2015. It was
also covered by BBC news as can be seen in Appendix A.
Chapter 2 - Ancient Egyptian DNA survival debate: The Secrets Buried Within Egyptian
Mummies: A Review of Ancient DNA Survival and its Prevalence in Egyptian
Mummies.
This chapter was prepared for submission to the Journal of Archaeological Sciences:
Reports. It is a review of the previous molecular work completed using the ancient
Egyptian mummified materials, both human and animals. In this chapter we present
both the positive and critical responses to the results when publicised at the time. We
showed that there was previously limited success in retrieving genetic data from
material originating from such unfavourable climatic conditions such as Egypt.
I also contributed to the two papers by Hawass et al. (2010, 2012) presented in
Appendix B, which are related to both the debate and the study presented in this
chapter. My contribution to the work published in both papers was performing the
replication for the genetic experimental work, taking part in the analysis of the generated
sequencing data, and writing and editing the sections of the papers related to my work.
Chapter 3 - Radiocarbon dating of Sacred Ibis mummies from ancient Egypt.
This published manuscript reports the first 14C dates for the animal mummies from
Egypt. We tested the precision of the reported dates using existing archaeological
evidences, and how closely those dates to the obtained 14C ages. We dated the Sacred
xvi
Ibis mummies to between the Late Period and the Ptolemaic Period, with none were
found to belong to the Roman era.
The paper was published in October, 2015 in the Journal of Archaeological Sciences:
Reports. This manuscript and its associated supplementary materials can be found in
Appendix C. My contributions to the work published in that paper included collection of
the ancient samples, preparation and transfer of the samples for analysis, analysing the
data for significance and writing and editing the paper.
Chapter 4 - Fishing for mitochondrial DNA in mummified Sacred Ibis: development of a
targeted enrichment protocol for ancient Egyptian remains.
This chapter has been submitted to the Journal of Archaeological Science. It outlines
the target enrichment methodology applied in this study and the effect of combination
of parameters optimisation had on the amount of mitochondrial data retrieved from the
different modern and ancient Sacred Ibis samples. This research led to us being the
first study to successfully retrieve complete mitochondrial genomes from ancient
Egyptian mummified materials.
A copy of this manuscript and supplementary tables can be seen in Appendix D. Being
the first author on this paper, my contributions include designing and performing the
research, analysis of the data, providing new reagents and analytic tools, collection of
the ancient samples; and writing and editing of the paper, with input from all authors.
Chapter 5 - Mitogenomics of Sacred Ibis mummies: Understanding their farming in
ancient Egypt
This paper has been submitted to Proceedings of the National Academy of Sciences of
The United States of America (PNAS), and is currently under review. It presents the main
findings of comparing the mitochondrial genomes obtained from the mummified
remains of the Sacred Ibis in comparison to those of wild African Sacred Ibis
populations. The paper investigates whether priests raised the Sacred Ibises in
centralised farms designed to meet the supply of pilgrim offerings, or if they depended
on wild migrating birds which came to Egypt each year. The generated complete
xvii
mitochondrial genomes were used to construct a haplotype network in order to
determine the relationship between the ancient and modern mitogenomes. Results
showed that both modern and ancient Sacred Ibis population were genetically diverse,
and not statistically different, which suggests that the majority of the mummified and
entombed Sacred Ibis birds were sourced from wild migrating populations.
The supplementary figure submitted with the paper can be found in Appendix E. My
contribution to that paper, as well as other authors, are outlined in chapter 5.
Chapter 6- Conclusion and Discussion
This closing chapter summarises the main findings of the research work completed in
this thesis, discussing how the results address the overall aims and significance in
relation to the Sacred Ibis farming system used in Ancient Egypt. It also discusses the
limitations of the research and makes suggestions and recommendations for future
ancient Egyptian genomic work.
1
1. Chapter One: The role of the Sacred Ibis in ancient Egyptian
life and religion
1.1 Abstract
In ancient times, the Sacred Ibis (Threskionis aethiopicus) in Egypt were regarded as the
incarnation of the God Thoth, God of wisdom, knowledge and writing. Thoth was thought
to herald of the annual floods of the river Nile. He was depicted as an Ibis headed man in
countless ancient Egyptian wall murals and sculptures. To date, Millions of Sacred Ibis have
been found in Egypt as mummified specimens at a number of burial sites. The Sacred Ibis
once played a substantial role in religion, in particular during the Late and Ptolemaic
periods. During this time Sacred Ibises were used as ‘votive’ offerings presented by
followers and believers of Thoth as a gift, or as a prayer to him. In the daily lives of ancient
Egyptian villagers, the Sacred Ibis helped to rid fishponds of water snails that may have
contained dangerous liver parasites. However, the species is now extinct throughout Egypt,
possibly due to the lack of suitable habitats resulting from gradual aridification caused by
swamp drainage and land reclamation. Generally, however, an understanding of the
biology, ecology and distribution of Sacred Ibis is central to understanding of how the
species might have been caught, and farmed by the ancient Egyptian people.
1.2 Sacred Ibis species information
The Sacred Ibis (Threskiornis aethiopicus) is a member of Family Threskiornithidae with 3
subspecies; Threskiornis aethiopicus aethiopicus (Latham), known as the African Sacred
Ibis, Threskiornis aethiopicus bemieri inhabiting only Madagascar, and Threskiornis
aethiopicus abbolti that inhabits only Aldabra
Island in the Seychelles (del Hoyo, et al., 2014).
1.2.1 Identification
The adult Sacred Ibis measures approximately 65
to 75 cm in height, has mostly white plumage with
black highlights along its featherless neck and
head, as well as on the tips of the wings and
patterned plumes on its back (figure 1-1)
(Hancock, et al., 1992). The black-tipped wings of the Sacred Ibis have areas of bare red
Figure 1-1: An Adult African Sacred Ibis bird.
Credits to Dick Daniels (http://carolinabirds.org/).
2
skin on their upper and lower surfaces, as well as on the breast and sides of the body. The
legs and feet are also covered with bare black skin (Matheu and Del Hoyo, 1992). The
downward curved black bill is one of the most prominent features of the Sacred Ibis and
beneath the lower surface of the bill is a neck sac. The iris of the African Sacred Ibis is
brown to red-brown and the lower eyelid is pink (Hancock, et al., 1992).
Male and female African Sacred Ibises are difficult to distinguish from each other in the
field. However, close observation shows that males are larger than females and commonly
have a longer bill. During courtship, the differences between male and female Sacred
Ibises becomes clearer, with males displaying a number of noticeable changes. At this time,
the male develops a blue metallic sheen across his shoulders and the black tips of the
wings appear more prominent. Additionally, the bare skin on the underside of his wings
and breast blushes vibrant red, the dull black skin of the head and neck becomes shiny,
and the legs turn red or dark red. A red ring also develops around the iris.
Nestlings have pale white to pinkish, straight short bills and are covered with white down
in all areas except their black head, neck, and back. The juvenile African Sacred Ibis is very
different in appearance to the adult. The head and neck are covered in a fine, black down
and there is a white spot on the crown of the head. The juvenile’s legs and feet are grey-
black and the tips of the wings are brown-black. The African Sacred Ibis does not gain its
full adult plumage until around three years old (Hancock, et al., 1992).
1.2.2 Ecology
The Sacred Ibis can be found in many different environments including all types of
freshwater habitat, and can often be found feeding on dry land in grasslands and cultivated
fields. In the dry season, the Sacred Ibis frequents coastal mudflats (Hancock, et al., 1992).
The Sacred Ibis is a carnivorous feeder (Kopij, et al., 1996); predating a range of insects,
worms, bird and reptile eggs, crustaceans, frogs, lizards, small mammals,
and carrion (Matheu and Del Hoyo, 1992) (Hancock, et al., 1992). It uses its long bill to
probe into mud and soil to capture prey (Matheu and Del Hoyo, 1992) (Hancock, et al.,
1992), and will searches for moving prey with its wings half open (Hancock, et al., 1992).
Certain Sacred Ibis populations have been shown to forage around rubbish dumps and
slurry pits (Matheu and Del Hoyo, 1992) (Hancock, et al., 1992), with some becoming
reliant on these areas as a food source (Matheu and Del Hoyo, 1992). T. aethiopicus feed
alone or in small groups during the non-breeding period, yet gather in large colonies for
nesting. Foraging usually occurs in groups of between 2 and 20 individuals, although
groups of up to 500 have been recorded (Matheu and Del Hoyo, 1992).
3
The breeding season of the African Sacred Ibis differs according to area (Hancock, et al.,
1992), but usually begins during or shortly after the rainy season (Hancock, et al., 1992,
Matheu and Del Hoyo, 1992). Large, mixed-species colonies are formed, which include
between 50 and 2,000 breeding pairs (Hancock, et al., 1992). Males generally arrive to
the nesting area first, where they establish a small mandate at a roosting or nesting site.
They interact using threat displays that include wing flapping, head extension, pursuit flight
and stretch-and-snap display (Urban, 1974). Once females arrive at the nesting area,
pairing occurs. Displays between pairs include bowing, intertwining of necks, billing and
presentation of nesting material. Males are responsible for the collection of nest materials,
while the female assembles the structure (Matheu and Del Hoyo, 1992). The nest
comprises a large platform of sticks and branches, lined with leaves and grass and placed
in a tree, bush, or on the ground (Matheu and Del Hoyo, 1992) (Hancock, et al., 1992).
Once the nest has been constructed, the female African Sacred Ibis then lay an average
clutch of two to three eggs. These typically have a rough surface and are dull white with a
blue or green tinge and red-brown spots (Matheu and Del Hoyo, 1992) (Hancock, et al.,
1992).
Males and females take turns to incubate the eggs, and usually changing every 24 hours.
The incubation period lasts for approximately 28 days, after which the nestlings are fed
and cared for by both adults (figure 1-2) (Matheu and Del Hoyo, 1992) (Hancock, et al.,
1992), with one finding food while the other remains at the
nest (Hancock, et al., 1992). The nestlings eventually fledge at
between 35 and 40 days old (Matheu and Del Hoyo,
1992) (Hancock, et al., 1992) and leave the colony when they
are between 44 and 48 days old (Matheu and Del Hoyo, 1992).
The established pair bond between male and female African
Sacred Ibis only lasts for the breeding season (Matheu and Del
Hoyo, 1992).
A gregarious species, the African Sacred Ibis roosts in large
numbers at communal roosting sites, which are usually located
on islets in rivers or in trees (Hancock, et al., 1992).
1.2.3 Distribution
The Sacred Ibis is widespread throughout Africa, south of the Sahara Desert, from Senegal
in the west to Ethiopia in the east, and southward to the Cape (Table 1). The species is
absent from certain regions within Cameroon, Congo, Gabon, and the Central African
Figure 1-2: The chicks thrust their
heads into the adults’ open bills
in order to stimulate adults to
regurgitate food. Credits to Dick
Daniels
(http://carolinabirds.org/).
4
Republic, as well as areas on the west coast of Africa including Namibia, Ghana, Côte
d’Ivoire, and Liberia. Iraq is the only place outside Africa where Sacred Ibis nesting has
been recorded, especially in the southern areas of Amara to Fao (Cramp, 1977).
African Sacred Ibis migrate with seasonal rainfall. At the commencement of breeding, birds
north of the equator migrate in a northwards direction, while birds south of the equator
migrate southwards mostly to Zambia, with smaller numbers reaching Botswana and
Namibia. It has been shown that Sacred Ibis are capable of migrating up to 1336 km
(Dowsett, 1969). Conversely, other Sacred Ibis populations have been shown to be
sedentary, especially those at the southern limit of the African Sacred Ibis’s range. Birds in
Iraq remain present throughout the year with only a proportion travelling to Kuwait and
Iran. The Sacred Ibis was once very common in Egypt, but was driven to extinction by 1850
(Cramp, 1977). The last recorded sighting of the Sacred Ibis was in Lower Egypt by Mr. E.
C. Taylor in 1864, but the authenticity of this sighting however, has been questioned (19).
Table 1-1 The African Sacred Ibis populations’ distribution in the African and non-African countries, showing the
occurrence status (native or wandering) and whether they are still present or extinct.
Country/Territory Occurrence
status
Presence
Angola, Benin, Botswana, Burkina Faso, Burundi,
Cameroon, Central African Republic, Chad, Comoros,
The Democratic Republic of the Congo, Côte d'Ivoire,
Djibouti, Equatorial Guinea, Eritrea, Ethiopia, Gabon,
Gambia, Ghana, Guinea, Guinea-Bissa, Islamic
Republic of Iran, Iraq, Kenya, Lesotho, Malawi, Mali,
Mauritania, Mozambique, Namibia, Niger, Nigeria,
Rwanda, Senegal, Sierra Leone, Somalia, South Africa,
South Sudan, Sudan, Swaziland, Tanzania, Togo,
Uganda, Yemen, Zambia, Zimbabwe.
Native Present
Azerbaijan, Kazakhstan, Kuwait, Oman, Saudi Arabia. Wandering Present
Bahrain, France, Spain. Introduced Present
Egypt Native Extinct
5
1.2.4 Domestication and the Mitochondrial Genome: What to expect in Domesticated
animals and Birds vs. their Wild relatives.
The process of domestication has played an important role in the history of human
civilization and is a useful tool for a wide variety of analyses. Darwin himself recognised
the importance of domestication in helping to explain variation within species and his
model of evolution was informed by studies of domestication (Darwin, 1868). The origin
and dispersal of major domestic animals have been widely studied in recent years and
there has been a series of advances in our general understanding of domestication have
resulted (Loftus et al. 1994; Bradley et al. 1996; Fumihito et al. 1996; Yu et al. 1999;
Giuffra et al. 2000; Zeder and Hesse 2000; Luikart et al. 2001; Troy et al. 2001; Vila et al.
2001; Hanotte et al. 2002; Jansen et al. 2002; Bruford, Bradley, and Luikart 2003; Beja-
Pereira et al. 2004; Lindgren et al. 2004; Watanobe et al. 2004; Larson et al. 2005; Liu et
al. 2006; Chen et al. 2006). Comparative studies of domesticated animals and wild
populations have suggested that domestication may have substantial effects on patterns
of molecular evolution. For example, comparisons of the mitochondrial genomes of
domesticated dog, yak, pigs and silkworms and their respective wild populations has
shown that the domesticated lineages have a higher ratio of non-synonymous to
synonymous substitutions (higher dN/dS) (Bjornerfeldt, Webster, and Vila 2006; Wang et
al. 2011; Hughes 2013). These studies point toward domestication having a significant
effect on molecular evolution in a relatively short time (Moray, Lanfear, and Bromham
2014). Generally speaking, the domestication process could affect the patterns of
molecular evolution in three possible ways (1) artificial selection, where selection for traits
during domestication either directly or indirectly increase the rate of non-synonymous
mutations (dN) at specific loci related to the selected traits. A good example of this is the
reported change of coat colour in pigs (Fang et al. 2009). A proposed link between artificial
selection regimes and increased recombination has been found in several examples in
different animal kingdoms (Otto and Barton 2001). Strong directional selection pressure,
where an advantageous allele increases as a result of differences in survival and
reproduction among different phenotypes, and /or reduced effective population size might
theoretically lead to an increase in the mutation rate (Sniegowski, Gerrish, and Lenski
1997; Lynch 2010, 2011). Nevertheless, even a minor increase in the production of unique
traits can lead to a higher rate of deleterious mutations (King and Kashi 2007). In contrast,
the mitochondrial genomes of birds and animals rarely recombine,. If domestication does
indirectly select for the generation of variation through recombination or mutation
6
(Denamur and Matic 2006; Dobney and Larson 2006), it could potentially influence rates
of molecular evolution. (2) Relaxed selective constraints, may influence the molecular
evolution rate in domesticated generations through the fixation of a majority of non-
synonymous mutations. Also previous studies have suggested a link between some of the
traits that experienced relaxed selection during the domestication process and
environmental or lifestyle changes (Clutton-Brock 1999; Bjornerfeldt, Webster, and Vila
2006; Driscoll, Macdonald, and O'Brien 2009; Rubin et al. 2010). A good example of this
is the effect of relaxed selection on the metabolic efficiency of domesticated dogs
(Bjornerfeldt, Webster, and Vila 2006) and yaks (Wang et al. 2011) which has been linked
to humans changing their behaviour by selecting for tameness and providing protection
from predators. (3) Reduction in effective population sizes as a result of inbreeding and
genetic bottlenecks experienced in domesticated populations (Vila, Seddon, and Ellegren
2005; Xia et al. 2009). Reduced effective population size leads to increases in the dN/dS
ratio, which can be explained by the increase in the probability of population fixation of
deleterious mutations through genetic drift (Kimura and Ohta 1971; Ohta 1992).
Domesticated lineages may experience severe bottlenecks, however, as the domestication
process likely occurred over long time scales, the bottlenecks are often interspersed with
periods of introgression and population expansion (Allaby, Fuller, and Brown 2008; Meyer
and Purugganan 2013). This may help the lineage to recover from potentially catastrophic
bottlenecks (Vila, Seddon, and Ellegren 2005). Ongoing selective breeding and narrowing
of the breeding pool can also reduce effective population size in some domesticated
lineages (Medugorac et al.). For example, dogs are thought to have experienced a
prehistoric bottleneck after their split from wolves (Vila et al.), but it is likely that some dog
populations have experienced more severe bottlenecks in recent history as a result of
breeding practices (Wayne and Ostrander).
Why is the mitochondrial genome used to test for domestication? Mitochondrial DNA
(mtDNA) is one of the most widely used markers for exploring genetic diversity and tracing
evolutionary history for humans, and domestic and wild animals. The preferential use of
complete or partial mitochondrial genomes in such studies can be explained in several
ways: the molecular rate of evolution in the animal mitochondrial genome is higher than
the nuclear genome by 5 to 10 times (Rand ; Ballard and Whitlock), and is therefore more
likely to reflect recent changes in rates and patterns of molecular evolution than the
nuclear genome. The mitochondrial genome also has a smaller effective population size
than the nuclear genome because it is haploid, rarely if ever recombines, and is inherited
7
through the maternal line (Harrison ; Moore ; Rokas, Ladoukakis, and Zouros ; Ballard and
Whitlock). It can then be expected to have a higher rate of fixation of nearly neutral
substitutions (Ohta), which are thought to dominate mitochondrial genome evolution (Rand
and Kann ; Bazin, Glémin, and Galtier).
In recent studies, the use of a phylogeny of complete mtDNA sequences allowed many
researchers to conduct a fine-grained phylogeographic analyses and to reappraise the
previously published data. Since 2006, researchers have transitioned from partial mtDNA
sequences (e.g. control region) to complete mitochondrial genomes in abundant studies of
various domestic animals (Wang et al.). Yet, until 2014 the vast majority of complete or
near-complete mtDNA sequences deposited to GenBank were for only eight common
domestic animals (i.e. cattle, dog, goat, horse, pig, sheep, yak and chicken) and their close
wild ancestors or relatives (Shi et al. 2014). Wherever these mitochondrial sequences were
used in building phylogenetic trees they have clarified the origin of several domestic
animals such as pigs (Wu et al. 2007), cattle (Achilli et al. ; Achilli et al. ; Bonfiglio et al. ;
Bonfiglio et al.), horse (Bonfiglio et al.), chicken (Miao et al.), and sheep (Lancioni et al.).
These mtDNA studies have been informative in differentiating between large distinct
populations and tracing the movements of populations on a continental scale. However,
one of the major limitations of using mitochondrial genomic data to precisely quantify the
degree of admixture that has occurred between populations is that these data are
maternally inherited and essentially represent a single non-recombining locus (Larson and
Burger 2013). In fact, even with the great success achieved using these genetic tools we
have available to characterise the genetic differences between the domesticated and
relative wild populations, our understanding of the the origin of domestic animals remains
generally poor.
1.3 Sacred Ibis mummification
8
At the Ibis catacombs of Saqqara, an estimated 1.75 million Sacred Ibis mummified
remains were buried, while at Abydos the numbers are far greater. The largest number of
Sacred Ibis mummies discovered to date was found in the catacomb of Tuna el-Gebel
where approximately four million have been recorded (Wade, et al., 2011). However, not
all of the millions of mummified Ibises (Figure 1-3) discovered were genuine with a good
number being fake. Some of these elaborately wrapped mummies contained no bird at all
and consist of only dried grass from the bird’s nest (Kessler and Nur el-Din, 2005). Others
were filled with feathers or other fragments of the bird as it was thought that with the
correct spell performed by the priests, fragments symbolized the whole bird and the Ibis
would become complete once offered to the god Thoth (Ikram, 2005).
Animal mummification differs from that of humans, as in most cases the internal organs
were not removed. However, in 2006, an excavation of a Late Period tomb revealed a
mummified Sacred Ibis with snails in its bill (Wade, et al., 2011). This was not an isolated
case, as other mummies with similar foodstuffs placed within them have also been found
Figure 1-3 Sacred Ibis fully wrapped mummy. Picture provided by the Ancient Egyptian Animal Bio Bank at Manchester
Museum.
9
within museum collections (Wade, et al., 2011). Based on ancient Egyptian beliefs, priests
may have placed food items within the remains during the mummification process, possibly
as a source of nourishment in the afterlife (Wade, et al., 2011). However, some exceptions
have been discovered; with some birds having had their body cavities emptied of organs
and replaced by small packets of rocks with perhaps some fish and a feather within them
and some grains of wheat (Wade, et al., 2011).
The mummification of the Sacred Ibis as well as other animals varied according to the
importance of the animal (i.e whether they are sacred, beloved pets or votive offerings)
(Ikram, 2005). The Sacred Ibises vary in age-at-death, their position, resin treatment and
ornamentation (Wade, et al., 2011). Additional information about the mummification
techniques used has been obtained through various radiographic studies of museum
collections (Wade, et al., 2011), which have shown the head and the bill were placed
between the tail feathers. A layer of resin-impregnated linen surrounds the birds followed
by further layers of plain linen (Wade, et al., 2011). Also, it revealed the possible cause of
death to be by spinal fracture (Wade, et al., 2011). Other studies have shown that some
birds were prepared for mummification by dehydration through natron without evisceration
(Ikram, 2012). These studies also show that the birds were covered in linen decorated with
painted images of Thoth, the god whom the Ibis represented, painted features and
embossed artificial eyes, sometimes with the pupils made of glass (Ikram, 2012). Although
a blue faience wadjet-eye amulet (a magical blue eye figure that was placed among the
wrappings of mummies to provide protection for the deceased in his afterlife journey) was
found in a Sacred Ibis from Abydos most birds were buried without funerary jewellery
(Ikram, 2012). Radiographic analysis of mummified Sacred Ibises from the Ancient
Egyptian Tissue Bank in Manchester showed evidence of frequent skeletal pathologies that
indicated that the birds were mummified at a young age, they also conducted further
research on soft-tissue samples looking for pathological disease markers, that may have
been prevalent in the ibiotropheia (the Ibis feeding places) due to overcrowding, in-
breeding and other dietary factors (McKnight, 2012).
1.4 The Sacred Ibis Catacombs
The use of birds in cultic activities reached its zenith from the Twenty-Sixth Dynasty (664-
525 BCE) to the Roman Period (30 BC–300 AD) when sanctuaries dedicated to the cult of
the Sacred Ibis were scattered throughout Egypt (Bailleul-Le Seur, 2012).
10
Animal catacombs are only one part of the sacred complex landscape. Catacombs were
typically placed adjacent to temples or shrines of a specific god. Pilgrims would journey to
these sites to make offerings in the form of animal mummies, to accompany a personal
request to the gods. Pi lgrims seeking the aid of Thoth would visit catacombs such as those
at Saqqara, Tuna al-Gebel, Abydos or Thebes. These sites contained dedicated Sacred Ibis
cemeteries such as the Sacred
Animal Necropolis (SAN) in
Saqqara, the subterranean
ibiotapheion in Tuna al- Gebel,
and various Sacred Ibis burials
at Abydos.
1.4.1 Necropolis at North
Saqqara
Saqqara is a village on the
west bank of the Egyptian Nile,
about 30 km south from the
capital city Cairo. North of the
famous Step Pyramid (c. 2600
BCE) lies an area known as
North Saqqara that has yielded
evidence of one of most
important archaeological locations for animal mummies in Egypt. Animal mummification
was practiced more during the Late Period (712-332 BC) and the Ptolemaic era (332-30
BC). The Sacred Animal Necropolis (SAN) is located in the centre of North Saqqara.
The SAN itself comprises two Ibis catacombs and a Main Temple complex with cult
chambers and catacombs for mummified cows and baboons (Figure 1-4). The discovery of
the Sacred Ibis tombs dates back to the 18th and 19th centuries (Nicholson, 2005). The
bird catacombs were intentionally built to resemble the tombs of the Late Old Kingdoms
(Martin, 1981). The catacombs consist of a number of main arterial passageways (Figure
1-5) lined with ‘galleries’. The numerous galleries functioned as storage areas for mummy
pots. These were stacked carefully in layers, with a layer of sand separating each layer of
vessels. Furthermore, some of the walls in the galleries had a series of ‘niches’ cut to store
Figure 1-4: Map of the SAN (Sacred Animal Necropolis) at Saqqara. Original
Drawing by J. Hodges edited by Miriam Alexander.
11
a small limestone chest that
housed a mummified bird. This
type of burial may be indicative
of a special offering from a high-
ranking person or a sacred bird
burial (Nicholson, 2005).
The cultic Sacred Ibis at
Saqqara, considered a small-
scale Sacred Ibis farm, where a
limited number of birds were
raised in the temple courtyard
at the SAN (Sacred Animal
Necropolis), was planted with
bushes to imitate the natural
Sacred Ibis habitats (Martin,
1981). It was the job of the
priests of Thoth to look after
these temple birds (Ray, 1978).
It has been estimated that
four million votive offerings of
Sacred Ibises were buried in the SAN (Ray, 1978), with ten thousand birds buried annually.
In order to supply such a large volume of Sacred Ibis mummies it has been hypothesised
that farms were located either in or around the temples and may have reared Sacred Ibises
for that purpose (Ikram, 2005). Evidence of an Ibis breeding hatchery at the SAN of
Saqqara is supported by archaeological findings of several Sacred Ibis eggs located within
the courtyard (Davies and Smith, 1997). It has also been suggested that “the Lake of
Pharaoh”, known later as the Lake of Abusir, would have been the perfect place for
breeding the Sacred Ibis (Ray, 1978). Added supportive evidence is found in the archive of
a scribe and priest named Hor of Sebennytos, who worked in the Saqqara’s Sacred Ibis
enclosure in the second century B.C. (Ray, 1978). He discussed a scandal involving stolen
food, which led to many of the birds dying of hunger (Ray, 1978). In another passage he
mentioned supplying around 60,000 Ibises with clover and bread (Ray, 1978), and
indicated the existence of a building, or complex, where eggs were incubated and Sacred
Ibis chicks reared (Ray, 1978). The archive of Hor of Sebennytos’ also outlines a system in
Figure 1-5 The North Ibis catacomb at Saqqara. (b) Sacred Ibis mummified
leg bone. (c) One of the arterial passageways stacked with jars filled with
Sacred Ibis mummies. (d) A piece of wrapping used to wrap the Sacred
Ibis mummies. Images were taken during the sampling collection from
Egypt by the author.
12
which bird mummies were collected all year, stored in a place called the ‘rest house’ inside
the temple, before being moved to the unfilled galleries of the catacomb once a year. This
practice continued until all the galleries within the catacomb were filled (Ray, 1978).
1.4.2 Tuna al-Gebel
Tuna al-Gebel is a small village located in Al Minya. Tuna al-Gebel was also known as
Hermopolis Magna by the ancient Greeks as it was the necropolis of Khmun, originally the
god of the source of the River Nile. In the southern part of the site there is an animal
necropolis filled up with several million mummified Sacred Ibis and a significant number of
baboons. As both animals represented the god Thoth, they were buried together in
subterranean galleries.
From 1919–1920 the Egyptian Antiquities Service, excavated this site. Later, Cairo
University assigned Sami Gabra to continue the excavation of the Sacred Ibis galleries,
Figure 1-6: Map of the Sacred Ibis catacomb (Ibiotropheion) at Tuna el Gebel showing the different galleries. Original
map is a courtesy of Dieter Kessle
13
between 1931 and 1952,
although the results were never
fully published. Twenty years
later, excavations were renewed
again, carried out by the
University of Hamburg (in 1979)
and led by Dieter Kessler (Kessler
and Nur el-Din, 2005) (Figure 1-
6). The catacombs date from the
26th Dynasty to Greco-Roman
times and are estimated to
contain more than 4 million
Sacred Ibis mummies. Tuna al-
Gebel ‘Ibiotropheion’ was the
Greek name for a special place for
breeding Sacred Ibis, or in Egyptian
it was the resting place of Sacred
Ibises and the gods who rested with
them (Herodotus II, 1989). This area represents an ideal opportunity to understand both
the evolution of an animal cemetery and related ritual beliefs over more than 700 years of
ancient Egyptian history. By examining the clay sealing used for the pottery jars found
inside the galleries containing the Sacred Ibis mummies, it has been predicted that the
central Egyptian ibiotapheion was constructed sometime between the reign of Pharaoh
Psametik I (664-610 B.C) and that of Amasis (570-526 B.C) (Kessler and Nur el-Din, 2005).
The papyri found inside the jars in the subterranean galleries date to the time of the Persian
ruler Darius I (522-486 B.C) and records the transportion of mummified Sacred Ibises from
the El Fayoum region and their subsequent offering at Tuna al-Gebel (Zaghloul, 1985).
Sending mummified Sacred Ibises from numerous Egyptian locations to Tuna al-Gebel was
sustained after 305 B.C. based on evidence found with the buried mummies. Typically this
evidence was in the form of demotic inscriptions on the containers holding the mummy,
either a pot, or a wooden, or stone chest, and gave information such as: Year X month Y
day Z- the god of Thoth, whom NN has brought, from the town A in the hand of scribe NN
(Kessler and Nur el-Din, 2005) (Figure 1-8).
Figure 1-7 Insied Tuna el-Gebel catacomb. (b) A gallery filled with broken
pottery jars and Sacred Ibis mummified remains. (c) Sacred Ibis skull
and part of beak collected from the same catacomb. Images were taken
during the sampling collection from Egypt by the author
14
Part B-A of the gallery (Figure 1-6) was constructed within the 26th Dynasty, also as the
early Saite Period (c. 685–525 BC) and had been cut in a westward direction. A long
passage stretching from north to south is filled with pottery jars that contain Sacred Ibis
mummy bundles; with a small entrance toward the north. The main subterranean passage
had rock cut chambers along its sides. The jars of that period were wide-mouthed and
closed with plastered linen (Kessler and Nur el-Din, 2005) (Figure 1-7).
The galleries which expanded to the east, forming Gallery Part C-D, were a necessity to
accommodate the large increase in the number of Sacred Ibis bundles brought from
numerous locations in Egypt to Tuna al-Gebel during the Persian Period. Dating this
passage was conducted using the well-decorated wooden Sacred Ibis chests harbouring
inscriptions in the name of King Darius (Kessler and Nur el-Din, 2005).
Towards Dynasty 30, Sacred Ibis’ burials were constructed to the north (i.e. the southern
part of G-C-D and crossing gallery C-D and C_C). These changes maybe have been adapted
by Pharaoh Nectanebo II (360- 342 B.C) who is thought to have established local Sacred
Ibis breeding sites. A painted pre-Ptolemic inscription on a reused amphora (the Egyptian
Figure 1-8: Demotic inscriptions left on a pottery jar used for mummification recording the date the mummy was
offered to Thoth, by whom, where it was bought from and the priest who took it from the worshipper.
15
amphora is a vase with a cover intended for storing water, oil or wine) originating from the
Phoenician coast mentioned King Tyre and was found in Gallery C-C-35 (Figure 1-6).
The early presence of Sacred Ibis mummies found in Tuna al-Gebel, is thought to be
sourced from all over Egypt as indicated by the demotic writings found (figure 1-8)
accompanying the mummy wrappings, papyri, or jars (Kessler and Nur el-Din, 1994). It
appears it was not only big cities like Aswan, Ptolemais-Psois, Hermopolis or Heliopolis that
were providing Sacred Ibis to Tuna but also smaller sites which have not yet been located
(Kessler and Nur el-Din, 1994). Important information on how the special Sacred Ibis were
transferred from the Fayoum region to Tuna al-Gebel has also been recorded on papyri
(Zaghloul, 1985) and it is believed that these transfers continued into late Ptolemaic times.
During the Third Intermediate Period (c. 1069 BC – c. 664 BC), it has been suggested that
the Sacred Ibis may have been reared in colonies around “the swamp”, referring to a
natural basin that was filled annually by the Nile inundation, which provided the sacred
animals to the temple (Kessler and Nur el-Din, 1994).
By the Ptolemaic period, the demand for Sacred Ibis mummies intensified, leading to a
more localised system, rather than depending on transfers from all over Egypt to the main
burial necropolis (Kessler and Nur el-Din, 2005). The transfers became limited to only the
Sacred ‘ritual’ Ibis. During the reign of King Ptolemy I (c. 367BC – c. 283 BC), villagers were
forced to both work and pay for the support of Sacred Ibis farming (ibiotropheia), which led
to the presence of around a dozen Sacred Ibis breeding farms in the area of Hermopolis
which were surrounded with fields that supplied Sacred Ibis colonies with cereals (Kessler
and Nur el-Din, 2005).
During the Ptolemaic era, the level of production of each of the local Hermopolitan breeding
Sacred Ibis’ farms has been estimated to be around a thousand mummies annually. If we
assume the existence of fifteen local ibiotropheia, this suggests approximately fifteen
thousand mummies were brought to Tuna each year (Kessler and Nur el-Din, 2005).
Sacred Ibis eggs were collected during the Saite period (664 BC – 525 BC) from breeding
places and wild colonies, and sent to Tuna together with wrapped mummies (Kessler and
Nur el-Din, 2005). No evidence has been found to suggest that the eggs originated from
an artificial breeding hatchery, a claim made by some scholars (Meeks 1997).
1.4.3 Abydos
Abydos is one of the most ancient cities of Upper Egypt. It is about 11 kilometres (6.8 mi)
west of the river Nile at latitude 26°10' N, near the modern towns of el-'Araba el Madfuna
16
and al-Balyana. The city was known as Abdju in hieroglyphics (3bdw or AbDw), which means
"the hill of the symbol or shrine".
The Ibis cemetery is located to the east of Wadi leading to Umm el-Qaab, and was part of
Peet and Loat’s Cemetery (Figure 1-9) containing not only mummified Ibis, but also human
burials. Human burials differ from those of the animal mummies in that they are often
buried closer to the surface (Peet, 1999).
In 1914, an article published in the first volume of the Journal of Egyptian Archaeology by
W. Leonard S. Loat, concerning his excavation works at Abydos, described an Ibis cemetery
that was located on one of the ridges. This ridge runs at right angles to the edge of a
cultivation area back into the desert towards the Royal Tombs. Here they found ninety-
three large jars that were placed randomly in the open (figure 20). They are made of
unbaked clay and varied in size but typically comprised of two or three sections and had
their mouths are sealed with a covering of unbaked bricks. From the shape of the jars, Loat
(Loat, 1914) was able to date them back to the Roman era (30BCE to CE 379).
A detailed examination of the mummies contained in the jars suggested they belonged to
the Sacred Ibis, with a smaller number being hawk mummies. Approximately fifteen
hundred of these mummies have been recorded, as well as a large number of bundles
(also carefully preserved and wrapped) containing the remains of young birds, feathers, or
bones (Loat, 1914).
Other denser Ibis burials in the Abydos region are found in Shunet el-Zebib; the funerary
enclosure for King Khasekhemwy (2690 BC). These burials were used as Ibis cemeteries
from the 22nd Dynasty (945 BC – 715 BC) onward (Ayrton, et al., 1904). Poorly embalmed
Ibis were found mostly in the northern part of the Shunah and several hundreds of which
were enclosed in oblong shaped pots. In contrast, more elaborate shaped jars were found
in the eastern part. The enclosure jars from both sites in the Shunah have been dated back
to the Late Period or earlier (Ikram, 2008).
17
Excavations done later in the south-west of the Shunah enclosure, led to the discovery of
charred Ibis remains in chamber G. This chamber dates from the 22nd to the 26th dynasty
(Ayrton, et al., 1904). It is not clear if this compartment was used as a burial chamber or
as merely just a place where Sacred Ibises were mummified.
1.4.4 Thebes
Figure 1-9: (a) Map of Peet and Loat’s Cemetery at Abydos showing the location of the Ibis cemetery. (b) Mummified
Ibis leg collected from Sohag. (c) Complete unwrapped Sacred Ibis mummy from Abydos. Images were taken during
the sampling collection from Egypt by the author
18
Ibis burials are found throughout Egypt, particularly in a number of areas in Thebes (Ikram,
2009). In the latter region there are a several burial places for the Sacred Ibises, and in
most cases the ancient Egyptians made use of pre-existing human tombs for burial of the
birds. The Theban cult seemed to pair the god Thoth with Horus, the god of Sky, and thus
Ibis are often found in conjunction with raptors. In Thebes such burials have been identified
at the tomb of Ankh Hor (Boessneck and von den Driesch, 1982), while Northampton
reports similar burials near TT 141 (Bekenkhons) (William, et al., 1908). Another set of
burials was found in area TT 156 (Pennesuttaui), and in the environs of TT 11/12 (Ikram
personal communication). Many mummified Sacred Ibises have been extracted from these
areas and sold to collectors, particularly in the 19th and early 20th centuries.
1.5 The Sacred Ibis in the ancient Egyptian texts
The Sacred Ibis was also a hieroglyphic writing characters that was used to symbolise the
God Thoth (Gaudard and Johnson, 2012) as the ‘Lord of the Divine Words’ and recognised
as the god of writing, scribes and wisdom. The ancient Egyptians believed that Thoth
invented alphabetic letters with the first letter of the Greek alphabet being hb thought to
represent the Sacred Ibis (Gaudard and Johnson, 2012). According to the Egyptian myth of
the “Contending of Horus and Seth”, Horus-Re emerges victorious to claim the throne but
having lost an eye in doing so. Thoth reassembles the eye and accounts for it in The Eye of
Horus: “I came seeking the eye of Horus,/ that I may bring it back and count it./ I found it
[and now it is] complete, counted and sound, /so that it can flame up to the sky and/ blow
above and below...” (Clark, 1959). Consequently, the Eye of Horus became a counting tool
that was used by scribes in their calculations, known as Horus Eye fractions (Ezzamel,
2009). An interesting inscription described scribal students and their life of continual
study: “So he says namely, The one-who praises-knowledge, he says, “The Ibises who are
here, difficult is their food, painful is their mode of life.”(Jasnow and Zauzich, 2005).
Another script titled, The Book of Thoth, from the Greco-Roman period outlined the
commencement at the House of Life (Jasnow and Zauzich, 2005). It was used for training
scribes and is written as a dialogue between a master, thought to represent Thoth or a
priest acting on his behalf, and a disciple (Jasnow and Zauzich, 2005).
At line 420 Jasnow suggests that it describes Thoth destroying an enemy of the sun-god: ‘I
shall raise my hand to the great, great, great one [Thoth], and jubilate to the Ibis who
tramples the turtle. At line 412 Jasnow suggests it describes the weighing of the dead’s
heart against the feather of Maat, a symbol of truth: “Let me hurry to the Ibis who is at the
19
top of his brush, he who has ordered the earth with his scale plates” (Jasnow and Zauzich,
2005).
Thoth played a major role as the god of justice, which was documented in the form of a
letter written on a papyrus known as IM E19422, kept in the necropolis of Tuna el-Gebel
and dated to the time of the Persian rule of Egypt in the period of Darius I (522-486BCE).
In that letter, an administrator of the cult of the Sacred Ibis at Hermopolis wrote it as a plea
to Thoth (as the god of justice) to listing injustices committed against the man (Bailleul-Le
Seur, 2012).
1.6 The Sacred Ibis in the ancient Egyptian art
Being the incarnation of the God Thoth, the Sacred Ibis is depicted in many forms of
Egyptian art, from appliqué to large three-dimensional sculpture. In the earliest times it
was depicted as an ensign of the provinces and later became a hieroglyphic sign (Clark,
1959).
Thoth in art took different shapes according to the period. In the Middle Kingdom (2000
BC – 1700 BC) Sacred Ibises were presented on gold amulet necklaces and later often as
faience, finely glazed ceramic beads or decorated wooden inlays. While, in the Late Period
(664 BC – 332 BC) it was frequently found as a votive figure in Sacred Ibis burial grounds.
It has also been rendered many times as a life-size figure in painted wood or bronze (Clark
2013). Sacred Ibises were also featured as a human with an Sacred Ibis head on stone
reliefs at the Temple of Luxor and the Temple of Horus at Edfu, the Philae Temple of Isis
(Stadler, 2012) and on wall paintings at Beni Hasan and Thebes (Clark 2013). In 2010,
archaeologists unearthed two large four-metre granite statues of the god Thoth as an Ibis-
headed human from the New Kingdom Period (1550 BC - 1070 BC) in the city of Luxor at
the temple of Amenhotep III.
Sacred Ibises are also found as appliqués sewn onto linen-covered mummified bird
remains (Clark 2013). The Thoth Rebus is a post-New Kingdom amulet, which portrays a
walking Sacred Ibis with a moon crown. The hieroglyph of Thoth is inscribed where it holds
the feather of Maat in its beak. The amulet can be interpreted as ‘Thoth, Lord of Truth’ and
highlights the primary aspects of Thoth as a moon deity and the healer of the eye of Horus,
and also in his position as scribe in the underworld court of Osiris (Bailleul-Le Seur, 2012).
A wooden Sacred Ibis coffin decorated with silver, gold leaf, rock crystal and pigment dated
to the Ptolemaic period and depicting Thoth with silver legs bent as if brooding (Bailleul-Le
20
Seur, 2012) was found at the chief sanctuary of Thoth in Hermopolis. That temple had
been used for ceremonies and festivals (Bailleul-Le Seur, 2012). Inside the coffin were the
remains of a Sacred Ibis within a cavity made from a covered hole in its back. It is also
covered in such details as a necklace incised at the base of the neck, carefully rendered
scaly skin and creases on the legs, with rock crystals outlined in gold inserted for the eyes
(Bailleul-Le Seur, 2012).
1.7 The role of the Sacred Ibis in religion
Animals played a significant role in ancient Egyptian religion. In hieroglyphic scripts,
animals constitute a quarter of all hieroglyphs. In the ancient Egyptian life humans were
not considered masters of animals but more like partners (Velde, 1980) as animals were
perceived as living beings just like humans and gods. Due to their beliefs it was simple to
consider animals the equivalent of humans, as it was stated in a text of the first millennium
BCE: ‘I have given bread to the hungry, water to the thirsty, clothing to the naked. I have
given food to the Sacred Ibis, the falcon, the cat and the jackal’ (Velde, 1980). Animals as
well as humans were considered living beings in the form of which gods could be
represented as well as in hybrid form (Velde, 1980).
Thoth was the moon-god and the healer of the sacred eye of Horus-Re (Bleeker, 1973). In
the Book of the Dead, Thoth prepared the way for Re to travel, as one of the texts
mentioning Thoth saying of himself: “ I have knotted the rope of the ship, I let the ferry sail,
I bring the East nearer to the West”, Consequently Thoth is seen standing in the prow of
the sun-boat (Bleeker, 1973).
Thoth being the god of wisdom, through his rational and ordered mortals was capable of
defeating the demonical and unpredictable gods such as Seth and Tefnet (Bleeker, 1973).
Other gods would seek Thoth’s assistance, as mentioned in the Pyramid Texts; Thoth is the
dreaded avenger of injustice (pyr. 2213) (Bleeker, 1973). In two funerary texts Thoth acts
as legislator and judge: “I, Thoth, am the eminent writer, pure of hands...the writer of the
truth (maat) whose horror is the lie...the lord of the law...I am the lord of maat, I teach maat
to the gods, I test (each) word for its veracity...I am the leader of the sky, the earth and the
netherworld”. “I, Thoth, am protector of the weak and of him whose property is violated”
(Bleeker, 1973). Thoth is the word of the creator and the guardian of the regulations of
creation (Bleeker, 1973).
21
1.8 Conclusion
The Sacred Ibis played a significant role in ancient Egypt through its representation of
Thoth, the god of writing, scribes, wisdom, time and justice and as the deputy of the sun-
god Horus-Re. The Sacred Ibis was bred, nurtured, and mummified with the same attention
to ritual given to many humans of that time. There is a large amount of archaeological
evidence for Sacred Ibis in ancient Egypt, particularly in the burial grounds at Saqqara,
Abydos, Tuna el-Gebel and Hermopolis. The use of the Sacred Ibis in cultic activities meant
that they played a major role in daily life helping to keep water clean and cleaning up refuse.
Ancient Egyptian hieroglyphs feature the Sacred Ibis as the first letter due to Thoth’s
association with writing and scribes. The Sacred Ibis, in both the human hybrid form of
Thoth and its own form, occurs across many art forms in Egypt, particularly due to its
significance from the New Kingdom period onwards. Although it is extinct in modern Egypt
due to aridification, it is now found throughout the world where it successfully cohabits with
humans in parklands and wetlands.
References
Achilli, A., S. Bonfiglio, A. Olivieri, A. Malusa, M. Pala, B. Hooshiar Kashani, U. A. Perego, P.
Ajmone-Marsan, L. Liotta, O. Semino, H. J. Bandelt, L. Ferretti, and A. Torroni. 2009.
'The multifaceted origin of taurine cattle reflected by the mitochondrial genome',
PLoS One, 4: e5753.
Achilli, A., A. Olivieri, M. Pellecchia, C. Uboldi, L. Colli, N. Al-Zahery, M. Accetturo, M. Pala, B.
Hooshiar Kashani, U. A. Perego, V. Battaglia, S. Fornarino, J. Kalamati, M.
Houshmand, R. Negrini, O. Semino, M. Richards, V. Macaulay, L. Ferretti, H. J.
Bandelt, P. Ajmone-Marsan, and A. Torroni. 2008. 'Mitochondrial genomes of extinct
aurochs survive in domestic cattle', Curr Biol, 18: R157-8.
Allaby, R. G., D. Q. Fuller, and T. A. Brown. 2008. 'The genetic expectations of a protracted
model for the origins of domesticated crops', Proc Natl Acad Sci U S A, 105: 13982-
6.
Ayrton, Edward R, Charles T Currelly, and Arthur EP Weigall. 1904. 'Abydos III', EEF, London.
Bailleul-Le Seur, R. 2012. Between heaven and earth : birds in ancient Egypt (University of
Chicago Oriental Institute Museum: Chicago).
Ballard, J. W., and M. C. Whitlock. 2004. 'The incomplete natural history of mitochondria',
Mol Ecol, 13: 729-44.
22
Bazin, Eric, Sylvain Glémin, and Nicolas Galtier. 2006. 'Population size does not influence
mitochondrial genetic diversity in animals', Science, 312: 570-72.
Beja-Pereira, A., P. R. England, N. Ferrand, S. Jordan, A. O. Bakhiet, M. A. Abdalla, M.
Mashkour, J. Jordana, P. Taberlet, and G. Luikart. 2004. 'African origins of the
domestic donkey', Science, 304: 1781.
Bjornerfeldt, S., M. T. Webster, and C. Vila. 2006. 'Relaxation of selective constraint on dog
mitochondrial DNA following domestication', Genome Res, 16: 990-4.
Bleeker, Claas Jouco. 1973. Hathor and Thoth: Two Key Figures of the Ancient Egyptian
Religion. With 4 Plates (Brill).
Boessneck, Joachim, and Angela von den Driesch. 1982. Studien an subfossilen
Tierknochen aus Ägypten (Deutscher Kunstverlag).
Bonfiglio, S., A. Achilli, A. Olivieri, R. Negrini, L. Colli, L. Liotta, P. Ajmone-Marsan, A. Torroni,
and L. Ferretti. 2010. 'The enigmatic origin of bovine mtDNA haplogroup R: sporadic
interbreeding or an independent event of Bos primigenius domestication in Italy?',
PLoS One, 5: e15760.
Bonfiglio, S., C. Ginja, A. De Gaetano, A. Achilli, A. Olivieri, L. Colli, K. Tesfaye, S. H. Agha, L.
T. Gama, F. Cattonaro, M. C. Penedo, P. Ajmone-Marsan, A. Torroni, and L. Ferretti.
2012. 'Origin and spread of Bos taurus: new clues from mitochondrial genomes
belonging to haplogroup T1', PLoS One, 7: e38601.
Bradley, D. G., D. E. MacHugh, P. Cunningham, and R. T. Loftus. 1996. 'Mitochondrial
diversity and the origins of African and European cattle', Proc Natl Acad Sci U S A,
93: 5131-5.
Bruford, M. W., D. G. Bradley, and G. Luikart. 2003. 'DNA markers reveal the complexity of
livestock domestication', Nat Rev Genet, 4: 900-10.
Chen, S. Y., Z. Y. Duan, T. Sha, J. Xiangyu, S. F. Wu, and Y. P. Zhang. 2006. 'Origin, genetic
diversity, and population structure of Chinese domestic sheep', Gene, 376: 216-23.
Clark, Robert Thomas Rundle. 1959. Myth and symbol in ancient Egypt (Thames and
Hudson).
Clutton-Brock, Juliet. 1999. A natural history of domesticated mammals (Cambridge
University Press).
Cramp, S. 1977. 'Handbook of the Birds of Europe, The Middle East and North Africa. The
Birds of the Western Palearctic', 1: 1-687.
Davies, S., and H. S. Smith. 1997. 'Sacred Animal Temples at Saqqara.' in S. Quirke (ed.),
The Temple in Ancient Egypt: New Discoveries and Recent Research (London).
23
del Hoyo, Josep, Nigel J Collar, David A Christie, A Elliot, and LDC Fishpool. 2014. Illustrated
Checklist of the Birds of the World (Lynx Edicions).
Denamur, E., and I. Matic. 2006. 'Evolution of mutation rates in bacteria', Mol Microbiol,
60: 820-7.
Dobney, K., and G. Larson. 2006. 'Genetics and animal domestication: new windows on an
elusive process', Journal of Zoology, 269: 261-71.
Dowsett, R. J. 1969. "Ringed Sacred Ibis Threskiornis aethiopica recovered in Zambia "
In Puku, Occasional Papers of the Wildlife, Fisheries and National Parks.
Driscoll, C. A., D. W. Macdonald, and S. J. O'Brien. 2009. 'From wild animals to domestic
pets, an evolutionary view of domestication', Proc Natl Acad Sci U S A, 106 Suppl 1:
9971-8.
Ezzamel, Mahmoud. 2009. 'Order and accounting as a performative ritual: Evidence from
ancient Egypt', Accounting, Organizations and Society, 34: 348-80.
Fang, Meiying, Greger Larson, Helena Soares Ribeiro, Ning Li, and Leif Andersson. 2009.
'Contrasting mode of evolution at a coat color locus in wild and domestic pigs', PLoS
Genet, 5: e1000341.
Fumihito, A., T. Miyake, M. Takada, R. Shingu, T. Endo, T. Gojobori, N. Kondo, and S. Ohno.
1996. 'Monophyletic origin and unique dispersal patterns of domestic fowls', Proc
Natl Acad Sci U S A, 93: 6792-5.
Gaudard, François, and Janet H Johnson. 2012. 'Chicago Demotic Dictionary (CDD)'.
Giuffra, E., J. M. Kijas, V. Amarger, O. Carlborg, J. T. Jeon, and L. Andersson. 2000. 'The
origin of the domestic pig: independent domestication and subsequent
introgression', Genetics, 154: 1785-91.
Hancock, J. A., J. A. Kushlan, and M. P. Kahl. 1992. Storks, Ibises and Spoonbills of the
World (Academic Press: London).
Hanotte, O., D. G. Bradley, J. W. Ochieng, Y. Verjee, E. W. Hill, and J. E. Rege. 2002. 'African
pastoralism: genetic imprints of origins and migrations', Science, 296: 336-9.
Harrison, Richard G. 1989. 'Animal mitochondrial DNA as a genetic marker in population
and evolutionary biology', Trends in ecology & evolution, 4: 6-11.
Hughes, A. L. 2013. 'Accumulation of slightly deleterious mutations in the mitochondrial
genome: a hallmark of animal domestication', Gene, 515: 28-33.
Ikram, S. 2005. Divine Creatures: Animal Mummies in Ancient Egypt (Amercain University
in Cairo Press: Cairo).
———. 2008. "Animal Mummies." In, 176-78.
24
———. 2012. 'An Eternal Aviary, Bird Mummies from Ancient Egypt.' in R. Bailleul Le-Suer
(ed.), Between Heaven and Earth: Birds in Ancient Egypt (The Oriental Institute of
the University of Chicago: Chicago).
Ikram, Salima. 2009. Ancient Egypt: an introduction (Cambridge University Press).
Jansen, T., P. Forster, M. A. Levine, H. Oelke, M. Hurles, C. Renfrew, J. Weber, and K. Olek.
2002. 'Mitochondrial DNA and the origins of the domestic horse', Proc Natl Acad Sci
U S A, 99: 10905-10.
Jasnow, Richard Lewis, and Karl-Theodor Zauzich. 2005. The Ancient Egyptian Book of
Thoth: Text (Otto Harrassowitz Verlag).
Kessler, D., and A. Nur el-Din. 1994. 'Der Tierfriedhof von Tuna el-Gebel', Antike Welt, 3:
252-65.
———. 2005. 'Tuna al-Gebel.' in S. Ikram (ed.), Divine creatures: Animal mummies in ancient
Egypt (Amercain University in Cairo Press: Cairo).
Kimura, Motoo, and Tomoko Ohta. 1971. Theoretical aspects of population genetics
(Princeton University Press).
King, David G, and Yechezkel Kashi. 2007. 'Mutability and evolvability: Indirect selection
for mutability'.
Kopij, Grzegorz, Ordino B Kok, and Zennon N Roos. 1996. 'Food of sacred ibis Threskiornis
aethiopicus nestlings in the Free State province, South Africa', Ostrich, 67: 138-43.
Lancioni, Hovirag, Piera Di Lorenzo, Simone Ceccobelli, Ugo A Perego, Arianna Miglio,
Vincenzo Landi, Maria T Antognoni, Francesca M Sarti, Emiliano Lasagna, and
Alessandro Achilli. 2013. 'Phylogenetic relationships of three Italian Merino-derived
sheep breeds evaluated through a complete mitogenome analysis', PLoS One, 8:
e73712.
Larson, G., and J. Burger. 2013. 'A population genetics view of animal domestication',
Trends Genet, 29: 197-205.
Larson, G., K. Dobney, U. Albarella, M. Fang, E. Matisoo-Smith, J. Robins, S. Lowden, H.
Finlayson, T. Brand, E. Willerslev, P. Rowley-Conwy, L. Andersson, and A. Cooper.
2005. 'Worldwide phylogeography of wild boar reveals multiple centers of pig
domestication', Science, 307: 1618-21.
Lindgren, G., N. Backstrom, J. Swinburne, L. Hellborg, A. Einarsson, K. Sandberg, G.
Cothran, C. Vila, M. Binns, and H. Ellegren. 2004. 'Limited number of patrilines in
horse domestication', Nat Genet, 36: 335-6.
25
Liu, Y. P., G. S. Wu, Y. G. Yao, Y. W. Miao, G. Luikart, M. Baig, A. Beja-Pereira, Z. L. Ding, M.
G. Palanichamy, and Y. P. Zhang. 2006. 'Multiple maternal origins of chickens: out
of the Asian jungles', Mol Phylogenet Evol, 38: 12-9.
Loat, W Leonard S. 1914. 'The ibis cemetery at Abydos', The Journal of Egyptian
Archaeology: 40-40.
Loftus, R. T., D. E. MacHugh, D. G. Bradley, P. M. Sharp, and P. Cunningham. 1994.
'Evidence for two independent domestications of cattle', Proc Natl Acad Sci U S A,
91: 2757-61.
Luikart, G., L. Gielly, L. Excoffier, J. D. Vigne, J. Bouvet, and P. Taberlet. 2001. 'Multiple
maternal origins and weak phylogeographic structure in domestic goats', Proc Natl
Acad Sci U S A, 98: 5927-32.
Lynch, M. 2010. 'Evolution of the mutation rate', Trends Genet, 26: 345-52.
———. 2011. 'The lower bound to the evolution of mutation rates', Genome Biol Evol, 3:
1107-18.
Martin, G. T. 1981. "The Sacred Animal Necropolis at North Saqqâra: The Southern
Dependencies of the Main Temple Complex." In EES Excavation Memoir. London.
Matheu, E, and J Del Hoyo. 1992. 'Family Threskiornithidae (ibises and spoonbills)',
Handbook of the Birds of the World, 1: 472-506.
McKnight, LM. 2012. 'Studying Avian Mummies at the KNH Centre for Biomedical
Egyptology: Past, Present, and Future', Between Heaven and Earth: Birds in Ancient
Egypt, The Oriental Institute of the University of Chicago: 99-106.
Medugorac, I., A. Medugorac, I. Russ, C. E. Veit-Kensch, P. Taberlet, B. Luntz, H. M. Mix,
and M. Forster. 2009. 'Genetic diversity of European cattle breeds highlights the
conservation value of traditional unselected breeds with high effective population
size', Mol Ecol, 18: 3394-410.
Meyer, R. S., and M. D. Purugganan. 2013. 'Evolution of crop species: genetics of
domestication and diversification', Nat Rev Genet, 14: 840-52.
Miao, Y. W., M. S. Peng, G. S. Wu, Y. N. Ouyang, Z. Y. Yang, N. Yu, J. P. Liang, G. Pianchou,
A. Beja-Pereira, B. Mitra, M. G. Palanichamy, M. Baig, T. K. Chaudhuri, Y. Y. Shen, Q.
P. Kong, R. W. Murphy, Y. G. Yao, and Y. P. Zhang. 2013. 'Chicken domestication:
an updated perspective based on mitochondrial genomes', Heredity (Edinb), 110:
277-82.
Moore, William S. 1995. 'Inferring phylogenies from mtDNA variation: mitochondrial-gene
trees versus nuclear-gene trees', Evolution: 718-26.
26
Moray, C., R. Lanfear, and L. Bromham. 2014. 'Domestication and the mitochondrial
genome: comparing patterns and rates of molecular evolution in domesticated
mammals and birds and their wild relatives', Genome Biol Evol, 6: 161-9.
Nicholson, P.T. 2005. 'The Sacred Animal Necropolis at North Saqqara', Divine creatures:
Animal mummies in ancient Egypt, 7948: 44.
Ohta, Tomoko. 1992. 'The nearly neutral theory of molecular evolution', Annual Review of
Ecology and Systematics, 23: 263-86.
Otto, S. P., and N. H. Barton. 2001. 'Selection for recombination in small populations',
Evolution, 55: 1921-31.
Peet, Thomas Eric. 1999. The Cemeteries of Abydos: Part 2. 1911-1912 (Adegi Graphics
LLC).
Rand, D. M. 1994. 'Thermal habit, metabolic rate and the evolution of mitochondrial DNA',
Trends Ecol Evol, 9: 125-31.
Rand, D. M., and L. M. Kann. 1996. 'Excess amino acid polymorphism in mitochondrial
DNA: Contrasts among genes from Drosophila, mice, and humans', Molecular
Biology and Evolution, 13: 735-48.
Ray, J.D. . 1978. 'Observations on the Archive of Ḥ or', Journal of Egyptian Archaeology, 64:
113–20.
Rokas, A., E. Ladoukakis, and E. Zouros. 2003. 'Animal mitochondrial DNA recombination
revisited', Trends in ecology & evolution, 18: 411-17.
Rubin, C. J., M. C. Zody, J. Eriksson, J. R. Meadows, E. Sherwood, M. T. Webster, L. Jiang,
M. Ingman, T. Sharpe, S. Ka, F. Hallbook, F. Besnier, O. Carlborg, B. Bed'hom, M.
Tixier-Boichard, P. Jensen, P. Siegel, K. Lindblad-Toh, and L. Andersson. 2010.
'Whole-genome resequencing reveals loci under selection during chicken
domestication', Nature, 464: 587-91.
Shi, N. N., L. Fan, Y. G. Yao, M. S. Peng, and Y. P. Zhang. 2014. 'Mitochondrial genomes of
domestic animals need scrutiny', Mol Ecol, 23: 5393-7.
Sniegowski, P. D., P. J. Gerrish, and R. E. Lenski. 1997. 'Evolution of high mutation rates in
experimental populations of E. coli', Nature, 387: 703-5.
Stadler, Martin A. 2012. 'Thoth', UCLA Encyclopedia of Egyptology, 1.
Troy, C. S., D. E. MacHugh, J. F. Bailey, D. A. Magee, R. T. Loftus, P. Cunningham, A. T.
Chamberlain, B. C. Sykes, and D. G. Bradley. 2001. 'Genetic evidence for Near-
Eastern origins of European cattle', Nature, 410: 1088-91.
27
Urban, Emil K. 1974. 'Breeding of Sacred ibis Threskiornis aethiopica at lake Shala,
Ethiopia', Ibis, 116: 263-77.
Velde, H te. 1980. 'A few remarks upon the religious significance of animals in ancient
Egypt', Numen: 76-82.
Vila, C., J. A. Leonard, A. Gotherstrom, S. Marklund, K. Sandberg, K. Liden, R. K. Wayne,
and H. Ellegren. 2001. 'Widespread origins of domestic horse lineages', Science,
291: 474-7.
Vila, C., P. Savolainen, J. E. Maldonado, I. R. Amorim, J. E. Rice, R. L. Honeycutt, K. A.
Crandall, J. Lundeberg, and R. K. Wayne. 1997. 'Multiple and ancient origins of the
domestic dog', Science, 276: 1687-9.
Vila, C., J. Seddon, and H. Ellegren. 2005. 'Genes of domestic mammals augmented by
backcrossing with wild ancestors', Trends Genet, 21: 214-8.
Wade, Andrew D, Salima Ikram, Gerald Conlogue, Ronald Beckett, Andrew J Nelson, and
Roger Colten. 2011. 'Backroom Treasures: CT Scanning of Two Ibis Mummies from
the Peabody Museum Collection'.
Wang, Chengmin, Jing Wang, Wen Su, Shanshan Gao, Jing Luo, Min Zhang, Li Xie, Shelan
Liu, Xiaodong Liu, and Yu Chen. 2014. 'Relationship between domestic and wild
birds in live poultry market and a novel human H7N9 virus in China', Journal of
Infectious Diseases, 209: 34-37.
Wang, Z., T. Yonezawa, B. Liu, T. Ma, X. Shen, J. Su, S. Guo, M. Hasegawa, and J. Liu. 2011.
'Domestication relaxed selective constraints on the yak mitochondrial genome', Mol
Biol Evol, 28: 1553-6.
Watanobe, T., N. Ishiguro, M. Nakano, A. Matsui, H. Hongo, K. Yamazaki, and O. Takahashi.
2004. 'Prehistoric Sado Island populations of Sus scrofa distinguished from
contemporary Japanese wild boar by ancient mitochondrial DNA', Zoolog Sci, 21:
219-28.
Wayne, R. K., and E. A. Ostrander. 2007. 'Lessons learned from the dog genome', Trends
Genet, 23: 557-67.
William, G, Wilhelm Spiegelberg, and Percy E Newberry. 1908. Report on some excavations
in the Theban necropolis: during the winter of 1898-9 (Constable).
Xia, Q., Y. Guo, Z. Zhang, D. Li, Z. Xuan, Z. Li, F. Dai, Y. Li, D. Cheng, R. Li, T. Cheng, T. Jiang,
C. Becquet, X. Xu, C. Liu, X. Zha, W. Fan, Y. Lin, Y. Shen, L. Jiang, J. Jensen, I.
Hellmann, S. Tang, P. Zhao, H. Xu, C. Yu, G. Zhang, J. Li, J. Cao, S. Liu, N. He, Y. Zhou,
H. Liu, J. Zhao, C. Ye, Z. Du, G. Pan, A. Zhao, H. Shao, W. Zeng, P. Wu, C. Li, M. Pan,
28
J. Li, X. Yin, D. Li, J. Wang, H. Zheng, W. Wang, X. Zhang, S. Li, H. Yang, C. Lu, R.
Nielsen, Z. Zhou, J. Wang, Z. Xiang, and J. Wang. 2009. 'Complete resequencing of
40 genomes reveals domestication events and genes in silkworm (Bombyx)',
Science, 326: 433-6.
Yu, Y., L. Nie, Z. Q. He, J. K. Wen, C. S. Jian, and Y. P. Zhang. 1999. 'Mitochondrial DNA
variation in cattle of south China: origin and introgression', Anim Genet, 30: 245-
50.
Zaghloul, H. O. 1985. "Fruhdemotische Urkunden aus Hermupolis." In Bulletin of the Center
of Papyrological Studies. Cairo.
Zeder, M. A., and B. Hesse. 2000. 'The initial domestication of goats (Capra hircus) in the
Zagros mountains 10,000 years ago', Science, 287: 2254-7.
29
2. Chapter Two: Ancient Egyptian DNA survival debate
The Secrets Buried Within Egyptian Mummies: A Review of Ancient DNA
Survival and its Prevalence in Egyptian Mummies
Summary:
The long-term preservation of DNA requires a number of optimal conditions, including
consistent exposure to cool, dry, and dark environments. As a result, the reporting of the
successful recovery of ancient DNA from material from warmer climates such as those in
Egypt has often been met with scepticism. Egypt has an abundance of ancient mummified
animals and humans, whose genetic analyses would offer important insights into ancient
cultural practices. The mummification processes carried out by ancient Egyptians were
intended to artificially preserve animal bodies, and may have incidentally assisted in the
preservation of DNA. Humans, in addition to other animals, were mummified in massive
numbers. With human mummification, the methods and materials used varied according
to the importance and the social ranking
of the individuals being mummified. Animals were either elaborately mummified, as sacred
representations of gods on earth, or were uncaringly mummified for mass production as
votive offerings. Pilgrims presented the mummified offerings to the deity god for the
granting of wishes. Tracing DNA in mummified remains of Egyptian mummies began in
1985, but not long after, it gained a wide research attention. Despite the reporting of
successful ancient DNA analyses from mummified remains, the validity of the results has
been debated since the early days of ancient DNA research. Recent ancient DNA work
carried out on Egyptian Royal mummies has been plagued with questions concerning the
likelihood of being able to extract endogenous DNA from tissues exposed to warm climates,
common to Egypt. Advances in ancient genomics in recent years, including the advent of
second generation sequencing platforms, has allowed in-depth genetic analyses of
Egyptian human mummified remains. As work with ancient human DNA can be confounded
by modern human contamination, animal DNA research in Egypt has been met with greater
acceptance. Yet to date, only a small number of studies have being carried out using
mummified animal remains.
In this study we review the previous studies reporting success in retrieval of partial DNA
sequences from Egyptian material and reporting what parameters has been taken in
consideration on our work with the Sacred Ibis mummified samples.
30
1. Extraordinary early results with ancient DNA
Early work with ancient DNA seemed to know no limits. Reports of successful amplification
of DNA from 20 (Cano and Borucki, 1995), 80 (Woodward, et al., 1994), and 120 (Cano,
et al., 1993) million year old tissue samples suggested it was possible to perform genetic
analyses on a number of iconic extinct animals, including dinosaurs. Even greater claims
have been made regarding DNA preserved in ancient rock salt (halite) ponds for up to 425
million years (Vreeland, et al., 2000, Park, et al., 2009, Fish, et al., 2002), a time when the
first jawed fish were evolving. Early work on ancient DNA however, suffered from a lack of
specialised facilities, combined with the use of high PCR amplification cycles and low
primer annealing temperatures; conditions that favour the production of amplified
contaminants with miss-incorporated bases, giving the misguided impression of a unique
target sequence. These inconsistencies led to the introduction of a rigorous set of
guidelines by many researchers (Richards, et al., 1995, Roberts and Ingham, 2008) for
dealing with ancient DNA, including independent replication of results at a second ancient
DNA facility,
1.1 Ancient DNA; degradation, processes, and rates
Ancient DNA refers to genetic data recovered from biological tissues that has not been
preserved for later DNA analysis, and is characterised by being highly degraded and
fragmented. DNA is thought to degrade rapidly post-mortem possibly through necrotic and
apoptotic processes that result in the activation of non-specific lysosomal nucleases and
Caspase-Activated DNases respectively (Enari, et al., 1998, Kelman and Moran, 1996).
DNA starts to degrade to units of approximately 160 bp in length; the length of DNA
protected from nuclease digestion due to its association with histones. Subsequent
degradation of the histones and nucleases exposes the DNA to chemical modification,
resulting in base alteration, cross-linking (Hansen, et al., 2006) and strand breakage. The
most common chemical modifications occur by hydrolysis with the conversion of cytosines
to form uracils (Brotherton, et al., 2007) and the depurination of mostly guanosine residues
that subsequently lead to basic sites prone to strand breakage (Overballe-Petersen, et al.,
2012).
Early experiments to determine rates of DNA degradation were carried out in vitro (Lindahl
and Nyberg, 1972) or on a limited number of samples from different environments (Poinar,
31
et al., 1996) (Höss, et al., 1996). Recent work by Allentoft et al (Allentoft, et al., 2012) using
158 dated moa bones from anoxic limestone-buffered sediments have calculated a rate of
DNA degradation (k) that suggests a limit for DNA preservation in bone, at a constant -5°C,
of a remarkable 6.83 million years. The rate was determined using in vitro analyses of DNA
depurination by Lindahl and Nyberg (Lindahl and Nyberg, 1972), combined with the
measurement of in situ DNA fragment copy number in radio-carbon dated moa bones. Their
equation calculates DNA decay rate (k) per site per year (d/s/yr) in bone in relation to
temperature as lnk = 41.2 - 15267.6 x 1/T (where T = temperature in degrees Kelvin). This
equation shows that temperature is the main driver of DNA preservation and suggests that
in warm climates such as those experienced in Egypt, the rate of degradation can be
several-fold greater than that from more temperate locations.
2. Ancient DNA from Egypt: a checkered history.
In 1985, Pääbo et al. were the first to report the retrieval of DNA from an Egyptian mummy.
The research team used dried tissue of a 2430-year-old Egyptian mummy and successfully
cloned a 3400 bp long DNA fragment (Paabo, 1985). With the later introduction of PCR
techniques, work with ancient DNA could be analysed for contamination with microbial and
modern DNA (Paabo, 1989, Lindahl, 1993). The stage was set for the analysis of ancient
or historical DNA. However reports of the recovery of ancient Egyptian DNA were treated
with caution as many arguing that there is little chance of the recovery of endogenous DNA
(Gilbert, et al., 2005). Despite early setbacks, a number of studies using ancient DNA
extracted from Egyptian mummified remains have been reported on a number of
occasions, all with different aims (Nerlich, et al., 1997, Zink, et al., 2000, Zink, et al.,
2003a, Zink and Nerlich, 2005, Nerlich, et al., 2008, Nerlich and Lösch, 2009, Zweifel, et
al., 2009, Woide, et al., 2010, Donoghue, et al., 2010, Hawass, et al., 2010, Hekkala, et
al., 2011, Hawass, et al., 2012, Kurushima, et al., 2012)
The successful amplification of short fragments of nuclear (Hawass, et al., 2010, Hawass,
et al., 2012) or mitochondrial DNA (Hanni, et al., 1994) from either ancient Egyptian human
remains or even from human microbial infections (Zink, et al., 2000) have often been met
with scepticism (Gilbert, et al., 2005, Marota, et al., 2002). Most sceptics argue that the
DNA degradation rate (Marota, et al., 2002) of Egyptian material, due to the combination
of high temperatures, elevated humidity, extreme alkaline conditions (Gilbert, et al., 2005,
Zink and Nerlich, 2005), and other factors such as flooding and fire (Zivie and Lichtenberg,
32
2005), precludes the recovery of authentic ancient Egyptian DNA (Gilbert, et al., 2005, Zink
and Nerlich, 2005).
First studies into the decay rate of Egyptian material were carried out by Marota et al.,
2002, where the DNA decay rate was calculated using both Egyptian human remains and
ancient writing sheets (papyri). These authors amplified a short DNA (90 bp) DNA sequence
of the chloroplast’s ribulose bisphosphate carboxylase large subunit (rbcL) gene in papyri
samples from 0 to 100 years BP and 1,300 to 3,200 years BP. These studies showed
that chloroplast DNA has a half-life in papyri of only 19 - 24 years, suggesting that no DNA
fragments are likely to survive more than 532 - 672 years from when the sheets were
manufactured. Using aspartic acid racemisation as an indicator of DNA decay Poinar et al.
(1996) and Morta et al. (2002) also reported that the upper limit for DNA preservation in
Egypt is approximately 700 - 800 years and that the regression rate of DNA decay in human
and papyri material was almost identical.
In 2003, Zink and Nerlich suggested, contrary to the claims made by Marota et al. (2002),
that DNA could survive for long periods in Egyptian materials. They argued that several
factors contributed to DNA degradation rates in Egypt being lower than those calculated by
Marota et al. (2002): First, the authors showed that temperatures inside most of the tombs
are considerably lower than the 35°C suggested by Marota et al. (2002). Secondly, the
samples used by Marota et al (2002) that did not yield DNA were retrieved from unstable
environments that had fluctuating moisture levels due to the annual flooding of the Nile.
Thirdly, the mummification process used for Egyptian mummies resulted in extreme
desiccation as a result of using the salt natron, allowing DNA to be protected from
damaging hydrolytic processes post mortem (Zink and Nerlich, 2003, Zink, et al., 2003b).
In reply to Zink and Nerlich (2003); Gilbert et al. (2005) argued against each of the points
raised (Zink and Nerlich, 2003): Firstly, they suggested that the temperature in Egyptian
burial sites did fluctuate and that the 15°C to 25°C that was mentioned in Zink and
Nerlich, 2003 was not supported by any references. On the contrary, Howard Carter
(Gilbert, et al., 2005) who excavated Tutankhamun’s tomb, reported hot air escaping from
the chamber upon their first attempt to open it. Gilbert et al. (2005) went on to suggest
that a more accurate way to calculate DNA survival time is to use the annual mean air
temperature as a proxy to estimate burial tomb temperature (Gilbert, et al., 2005). In
conclusion, the authors suggested that even under these proposed temperature
conditions, it is doubtful that DNA could be retrieved from ancient Egyptian material.
Secondly, in terms of humidity, Gilbert et al., 2005 argued that in general tombs are very
33
humid even if they have not been exposed to a flood, and for this reason DNA decay is
likely accelerated (Waite, et al., 1997, Nielsen-Marsh and Hedges, 2000). Thirdly, Gilbert
et al (2005) pointed out several problems that might rule out the effect of natron on DNA
preservation; i.e. one of the successful samples of Zink and Nerlich (2003) was from a
predynastic burial, where natron was not used (Aufderheide, 2003). Furthermore, the
action of natron (thought to help DNA survival by elevating the pH of the body, presumably
through the action of sodium bicarbonate in the natron) would be counteracted by the
acidic resins used to cover the body. Gilbert et al, 2005 went on to suggest that the
mummification techniques used are detrimental to the survival of DNA.
In conclusion, Gilbert et al (2005) argued that the probability of DNA survival should be
determined separately for each case and based on factors such as, burial location, post
mortem practices, time period, and social class.
2.1 Recent ‘successes’ with ancient DNA in Egypt: DNA recovery from the Egyptian Royal
mummies using polymerase chain reaction (PCR)
Ancient DNA studies using mummified materials from Egypt have become the most
controversial of all, in relation to the other molecular genetics work done using ancient
materials (Marchant, 2011). Although the recovery of DNA from much older specimens
such as Woolly mammoths (Höss, et al., 1994, Hagelberg, et al., 1994, Taylor, 1996, Noro,
et al., 1998), horse and bison (Seco-Morais, et al., 2007), the unfavourable conditions
common to Egyptian environments has promoted cynicism surrounding any report of the
successful isolation of ancient DNA from Egyptian material.
Nevertheless, work with ancient Egyptian Royal mummies commenced in 2008 at an
ancient DNA laboratory at the Egyptian Museum, comparing DNA from the newly
discovered mummy of Hatshepsut with DNA sequences recovered from a previously
identified mummy putatively belonging to the same family. Being the first attempt in Egypt
at using DNA to verify a mummy's identity, the work was recorded by The Discovery
Channel, but showed that the DNA results were inconclusive. Many concerns were raised
about the expectations placed on the new DNA laboratory, in particular, the lack of an
independent second lab to replicate the results to prove authenticity. However, a second
separate ancient DNA laboratory was subsequently established at the Kasr El-Aini Medical
School, with the aim of DNA testing all the royal mummies and the nearly two dozen
unidentified mummies stored in the Egyptian Museum. Two recently published papers
34
arising from this work are outlined below.
i- Revisiting the harem conspiracy and death of Ramesses III: an
anthropological, forensic, radiological, and genetic study (Hawass, et al.,
2012) (Appendix B)
Summary. The objective of this work was to investigate the relationship between two
mummies from the 20th dynasty (c. 1190-1070 BCE) of ancient Egypt; the mummy of
Ramesses III and Unknown Man E, who was the suspected son of the king. Genetic
analyses showed that both mummies were male and shared the same Y-chromosomal
haplotypes. This genetic relationship of Ramesses III and Unknown Man E makes Unknown
Man E a possible candidate as the son Pentaware, thereby shedding new light on the
harem conspiracy.
For this work, bone samples were taken from the interior of the left and right humerus,
tibia, femur, and iliac with sterilized biopsy needles (HS Trapsystem©). Bone sampling was
carried out under sterile conditions in a dedicated room of the Cairo Museum. All persons
involved in the sampling wore protective clothing, sterile gloves, and facemasks to prevent
exogenous contamination. DNA extraction and purification were performed in the
dedicated ancient DNA laboratory in the Egyptian Museum in Cairo and then replicated at
a second laboratory at the Faculty of Medicine, Cairo University (Hawass, et al., 2010). In
both laboratories the DNA typing was performed under strict conditions following previously
published criteria for ancient DNA authentication (Hofreiter, et al., 2001) (Roberts and
Ingham, 2008).
Although the mummy of Ramesses III’s wife, Queen Tiy, was not available for testing,
identical Y-chromosomal haplotypes and autosomal half-allele sharing of the two male
mummies suggest the possibility of a father-son relationship.
Possible problems with methodology and results. Possible problems with this work arise
from the use of traditional PCR amplification of each specific DNA loci prior to being
sequenced. This method can lead to the preferential amplification of contaminants rather
than endogenous mummy DNA. However, the consistency of the repeated work, as well as
the consistency between the Y and autosomal chromosome markers for both individuals
limit the possibility of contamination, and suggest that the DNA sequences obtained were
authentic.
35
ii- The Ancestry and Pathology of King Tutankhamun’s Family (Hawass, et al., 2010)
(Appendix B)
Summary. The late 18th dynasty of the New Kingdom era in ancient Egypt included the
reigns of pharaohs Akhenaten and Tutankhamun. Eleven royal mummies from this era have
been identified, but the exact relationships between members of the royal family, as well
as the possible illnesses they carried and causes of their deaths have been matters of
debate.
From September 2007 to October 2009, royal mummies were subjected to detailed
anthropological, radiological, and genetic studies as part of the King Tutankhamun Family
Project. Mummies distinct from Tutankhamun’s immediate lineage served as genetic and
morphological references. To authenticate DNA results, analytical steps were repeated and
independently replicated in a second ancient DNA laboratory staffed by a separate group
of personnel. Eleven royal mummies dating from circa 1410-1324 BC and suspected of
being kin of Tutankhamun and 5 royal mummies dating to an earlier period, circa 1550-
1479 BC, were examined. Genetic fingerprinting using sixteen Y-chromosomal short
tandem repeats (DYS456, DYS389I, DYS390, DYS389II, DYS458, DYS19, DYS385,
DYS393, DYS391, DYS439, DYS635, DYS392, Y-GATA-H4, DYS437, DYS438, DYS448)
and 8 polymorphic microsatellites of the autosome (D13S317, D7S820, D2S1338,
D21S11, D16S539, D18S51, CSF1PO, FGA) allowed the construction of a 5-generation
pedigree of Tutankhamun’s immediate lineage. The KV55 mummy and KV35YL were
identified as the parents of Tutankhamun (Hawass, et al., 2010). Genetic testing for
STEVOR, AMA1, or MSP1 genes specific for Plasmodium falciparum revealed Malaria
tropica in 4 mummies, including that of Tutankhamun. The results suggest that avascular
bone necrosis in conjunction with a malarial infection as the most likely cause of death in
Tutankhamun.
36
Figure 2-1 Tutankhamun genetic-based family tree as presented in the original publication. Hawass et al. 2010.
Possible problems with methodology and results. A number of letters contesting the results
were published in the same journal; The Journal of the American Medical Association
(Hawass, et al., 2010), in 2010, with replies from Hawass et al. The first letter was from
the research team from the Center for GeoGenetics at the Natural History Museum of
Denmark, they queried the reliability of the genetic data presented and argued against the
survival of authentic ancient DNA in the context of DNA degradation and contamination
(Lorenzen and Willerslev, 2010). These authors argued that, due to the age of the
mummies (more than 3,300 years before the present) and their preservation history, no
DNA would have survived. Due to the lack of any published results of even mtDNA
sequences from these mummies, they remarked that the survival of nuclear DNA
sequences is also highly unlikely. Furthermore, the reported success of the retrieval of
nuclear DNA sequences is also surprising given the use of traditional polymerase chain
reaction techniques, rather than newly developed capture approaches coupled with
second-generation sequencing that allow for the successful capture of degraded (shorter)
DNA sequences (Briggs, et al., 2009). In addition, the likelihood of modern day human
37
contamination was also presented as a possible problem (Willerslev and Cooper, 2005).
Although all laboratory members involved in the study were genotyped; no persons
handling the specimens prior to the study were included, questioning the reliability of the
microsatellite profiles generated. A lack of supporting information on the genotyping of
associated non-human remains and microsatellite allele frequencies in present day Egypt
was regarded as problematic given the authors’ claims that contamination with modern
human DNA was not an issue. Finally, the absence of quality control measures to counter
errors in microsatellite genotyping such as allelic stutters, allelic dropout, short allele
dominance, and null alleles, all of which can result in the incorrect identification of alleles,
were also noted. In this regard, even small error rates (0.01 per allele) can lead to high
error rates downstream, such as false paternity exclusion in kinship testing (Lorenzen and
Willerslev, 2010).
In reply, Gad et al., 2010 defended their research and suggested that claims about the
lack of quality control testing (to eliminate modern contamination) were unreliable. These
authors suggested that the DNA extracted was likely to be authentic and likely had been
adequately preserved in Egyptian mummy tissue. However, the suggestion was that the
analyses required the use of specifically developed extraction protocols. Gad et al (2010)
defended their results by stating nine points: (1) Well-known and accepted conditions for
ancient DNA authentication (Roberts and Ingham, 2008) were strictly followed at all stages
of analysis as described in the main article. (2) Possible contamination by previous people
handling the mummies was monitored. (3) All female mummies were shown to be negative
for Y-chromosomal markers. (4) All male mummies showed homozygous Y-chromosomal
profiles. (5) The profiles and haplotypes of individual mummies showed specific differences
that could not have originated from a single source of contaminant DNA. (6) The
combination of nuclear data (Y - and autosomal chromosome - related markers)
complemented each other. (7) Reproducible genotypes were obtained from separate
biopsies and extractions per mummy. (8) Subsets of the data were independently
replicated in a second, separate ancient DNA laboratory staffed by a separate group of
personnel, who reconfirmed the authenticity of the results. (9) DNA isolated from Egyptian
mummies was highly informative when processed with next generation sequencing.
2.2 Ancient DNA from mummified Egyptian animal remains: First steps to prove
38
authenticity.
Despite the results above, a number of experts in the field continue to query the work
carried out on the Royal mummies, arguing that it would never be possible to know for
certain that results obtained are not due to contamination by people who had previously
handled the mummies, or by the researchers themselves (Lorenzen and Willerslev, 2010).
For this reason, work with non-human materials such as the crocodile mummified samples
or the mummified cat remains has been encouraged.
Ancient Egyptians embalmed animals, birds, and reptiles as votive offerings to the deities
(Ikram, 2005). Examination of crocodile mummy haplotypes, up to 2,200 years old,
Hekkala et al., 2011, has revealed a cryptic evolutionary lineage of the Nile crocodile that
has clarified the biogeographic history of the genus and settled long-standing arguments
over the species’ taxonomic identity and conservation status. The work also suggested that
both African Crocodylus lineages historically inhabited the Nile River. One of the central
outcomes of this research was that it proved beyond doubt that ancient Egyptian mummies
can harbour authentic ancient DNA. Interestingly this was reported by Gilbert (2011) who
actually criticised the authenticity of DNA from human mummified materials (Gilbert,
2011). This work emphasized the importance of the preservation conditions, as the
mummified crocodile hatchings sampled proved to be an exceptional source for ancient
DNA. The specimens were kept in dry, sealed, relatively cool burial chambers and were
dated at 1,800 - 2,200 years old. This was comparatively young compared to other ancient
Egyptian mummified materials used in previous studies (Hofreiter, et al., 2004, Shapiro, et
al., 2004). In this case the exceptional DNA preservation conditions were likely to have
been aided by the crocodile having nucleated red blood cells and a thick protective
keratinized skin layer (Hekkala, et al., 2011).
A second successful DNA analysis was carried out on mummified cats by Kurushima et al,
2012. In this study mitochondrial DNA (mtDNA) sequences were used to identify the
species of cat mummified, and the genetic relationship between ancient Egyptian and
modern day domestic cats. Yet, they were only able to report incomplete sequences of the
control region for the 3 samples used in that study. The authors only obtained mtDNA CR
mitochondrial haplotypes for two of the cat mummies and a subset of possible mitotypes
was implicated for the third mummy.
The cat and crocodile results argued for the preservation of DNA inside the Egyptian
mummies. The ancient DNA was however, shown to be highly fragmented and required the
39
use of second-generation sequencing, thereby foregoing the use of single locus
amplifications, which are prone to contamination (Lambert and Millar, 2006, Metzker,
2010, Pareek, et al., 2011).
2.3 What second generation sequencing advances have added to the ancient Egyptian
genetics studies.
Second-generation sequencing of millions of short informative DNA fragments
simultaneously in a single sample (Lambert and Millar, 2006, Metzker, 2010, Pareek, et
al., 2011, Millar, et al., 2008), together with appropriate computational methods now
facilitate the production of highly informative datasets. Moreover, authentic DNA can be
identified from the modern DNA contamination by the presence of characteristic DNA
damage and short read lengths.
Khairat et al. (Khairat, et al., 2013) were the first to use second-generation technology on
ancient Egyptian human DNA. They were able to provide insights into the metagenome of
5 Egyptian human mummies that were kept at the University of Tübingen (Khairat, et al.,
2013). The authors concluded that warm temperature did not result in complete
degradation of the DNA, possibly due to the mummification method used. The authors go
on to suggest that the DNA preservation of these human mummies was sufficient to allow
complete coverage of both the nuclear and mitochondrial genomes (Khairat, et al., 2013).
3. The future for aDNA research using the Egyptian remains.
A central problem in all ancient DNA studies is the level of endogenous DNA recovered,
in comparison to the level of contaminating exogenous sequences (Khairat, et al.,
2013).
In our work with the mummified remains of the Sacred Ibises collected from the
Egyptian catacombs, we used different types of samples; tissue, bone or feathers
aiming to use the retrieved complete mitochondrial genomes to clarify our
understanding of Sacred Ibis in the ancient Egyptian context.
When working with the Sacred Ibis mummies crucial parameters that can affect DNA
extraction processes were taken into account such as: (a) the mummification
techniques that were used for each bird, even the ones collected from the same burial
site because those birds might have been serving different purposes (e.g. sacred or
votive animals); (b) the age of the mummies and the period of the Egyptian chronology
40
to which they belonged; (c) the location and type of burial place each individual mummy
had, e.g. in a pottery jar, or a wall slap or a stone/ wood sarcophagus and what is the
catacomb location on the Egyptian map. Moreover, (d) the conditions inside the
catacomb, e.g. whether it is hot, humid or well ventilated. (e) The physical condition of
the mummy used for sampling from which of course will affect the quality and
preservation of the DNA e.g., whether the mummy had been well preserved and still
fully wrapped or simply a collection of bones. (f) Finally, the sampling collection process
was conducted with precautions to eliminate possible environmental contamination.
Figure 2-2 Sampling collection from the South Sacred Ibis catacomb, Saqqara.
Through the work done on the Sacred Ibises’ mummies in this study, and as it will be
explained in more details later on other chapters of this thesis, we have found that
some sample types like soft tissue (i.e toe pads) and feathers yielded more
endogenous DNA than bone samples. By adapting the extraction technique used and
modifying the cleaning methods we were able to eliminate PCR inhibitors, while
retaining the short fragmented DNA. Besides, using the shotgun sequencing
techniques was not sufficient to retrieve complete mitochondrial genomes. We had to
develop an enrichment method to capture the limited amount of the endogenous DNA
and elute the contaminants.
We were able to retrieve 15 complete ancient mitochondrial genomes of the ancient
Egyptian Sacred Ibis and used those results for further evolutionary analysis.
41
References
Allentoft, M. E., Collins, M., Harker, D., Haile, J., Oskam, C. L., Hale, M. L., . . . Willerslev,
E. (2012). The half-life of DNA in bone: measuring decay kinetics in 158 dated fossils.
Proceedings of the Royal Society of London B: Biological Sciences, 279(1748), 4724-
4733.
Aufderheide, A. C. (2003). The Scientific Study of Mummies. Cambridge: Cambridge
University Press.
Briggs, A. W., Good, J. M., Green, R. E., Krause, J., Maricic, T., Stenzel, U., . . . Paabo, S.
(2009). Targeted retrieval and analysis of five Neandertal mtDNA genomes. Science,
325(5938), 318-321. doi:10.1126/science.1174462
Brotherton, P., Endicott, P., Sanchez, J. J., Beaumont, M., Barnett, R., Austin, J., &
Cooper, A. (2007). Novel high-resolution characterization of ancient DNA reveals C> U-
type base modification events as the sole cause of post mortem miscoding lesions.
Nucleic acids research, 35(17), 5717-5728.
Cano, R. J., & Borucki, M. K. (1995). Revival and identification of bacterial spores in 25-
to 40-million-year-old Dominican amber. Science, 268(5213), 1060-1064.
Cano, R. J., Poinar, H. N., Pieniazek, N. J., Acra, A., & Poinar, G. O., Jr. (1993).
Amplification and sequencing of DNA from a 120-135-million-year-old weevil. Nature,
363(6429), 536-538. doi:10.1038/363536a0
Donoghue, H. D., Lee, O. Y., Minnikin, D. E., Besra, G. S., Taylor, J. H., & Spigelman, M.
(2010). Tuberculosis in Dr Granville's mummy: a molecular re-examination of the
earliest known Egyptian mummy to be scientifically examined and given a medical
diagnosis. Proc Biol Sci, 277(1678), 51-56. doi:10.1098/rspb.2009.1484
Enari, M., Sakahira, H., Yokoyama, H., Okawa, K., Iwamatsu, A., & Nagata, S. (1998). A
caspase-activated DNase that degrades DNA during apoptosis, and its inhibitor ICAD.
Nature, 391(6662), 43-50.
Fish, S. A., Shepherd, T. J., McGenity, T. J., & Grant, W. D. (2002). Recovery of 16S
ribosomal RNA gene fragments from ancient halite. Nature, 417(6887), 432-436.
doi:10.1038/417432a
Gad, Y. Z., Selim, A., & Pusch, C. M. (2010). KIng tutankhamun’s family and demise—
reply. JAMA, 303(24), 2471-2475. doi:10.1001/jama.2010.823
Gilbert, M. T. (2011). The mummy returns... and sheds new light on old questions. Mol
Ecol, 20(20), 4195-4198.
42
Gilbert, M. T., Barnes, I., Collins, M. J., Smith, C., Eklund, J., Goudsmit, J., . . . Cooper, A.
(2005). Long-term survival of ancient DNA in Egypt: response to Zink and Nerlich
(2003). Am J Phys Anthropol, 128(1), 110-114; discussion 115-118.
doi:10.1002/ajpa.20045
Hagelberg, E., Thomas, M. G., & Cook, C. E. (1994). DNA from ancient mammoth bones.
Nature, 370(6488), 333-334.
Hanni, C., Laudet, V., Coll, J., & Stehelin, D. (1994). An unusual mitochondrial DNA
sequence variant from an Egyptian mummy. Genomics, 22(2), 487-489.
doi:10.1006/geno.1994.1417
Hansen, A. J., Mitchell, D. L., Wiuf, C., Paniker, L., Brand, T. B., Binladen, J., . . . Willerslev,
E. (2006). Crosslinks rather than strand breaks determine access to ancient DNA
sequences from frozen sediments. Genetics, 173(2), 1175-1179.
Hawass, Z., Gad, Y. Z., Ismail, S., Khairat, R., Fathalla, D., Hasan, N., . . . Pusch, C. M.
(2010). Ancestry and Pathology in King Tutankhamun's Family. Jama-Journal of the
American Medical Association, 303(7), 638-647. doi:10.1001/jama.2010.121
Hawass, Z., Ismail, S., Selim, A., Saleem, S. N., Fathalla, D., Wasef, S., . . . Zink, A. R.
(2012). Revisiting the harem conspiracy and death of Ramesses III: anthropological,
forensic, radiological, and genetic study. BMJ (Clinical research ed.), 345(dec14 14),
e8268-e8268. doi:10.1136/bmj.e8268
Hekkala, E., Shirley, M. H., Amato, G., Austin, J. D., Charter, S., Thorbjarnarson, J., . . .
Blum, M. J. (2011). An ancient icon reveals new mysteries: mummy DNA resurrects a
cryptic species within the Nile crocodile. Mol Ecol, 20(20), 4199-4215.
doi:10.1111/j.1365-294X.2011.05245.x
Hofreiter, M., Serre, D., Poinar, H. N., Kuch, M., & Paabo, S. (2001). Ancient DNA. Nat
Rev Genet, 2(5), 353-359. doi:10.1038/35072071
Hofreiter, M., Serre, D., Rohland, N., Rabeder, G., Nagel, D., Conard, N., . . . Pääbo, S.
(2004). Lack of phylogeography in European mammals before the last glaciation.
Proceedings of the National Academy of Sciences of the United States of America,
101(35), 12963-12968.
Höss, M., Jaruga, P., Zastawny, T. H., Dizdaroglu, M., & Paabo, S. (1996). DNA damage
and DNA sequence retrieval from ancient tissues. Nucleic acids research, 24(7), 1304-
1307.
Höss, M., Pääbo, S., & Vereshchagin, N. (1994). Mammoth DNA sequences. Nature,
370(6488), 709-715.
43
Ikram, S. (2005). Divine Creatures: Animal Mummies in Ancient Egypt. Cairo: Amercain
University in Cairo Press.
Kelman, Z., & Moran, L. (1996). Degradation of ancient DNA. Current Biology, 6(3), 223.
Khairat, R., Ball, M., Chang, C. C. H., Bianucci, R., Nerlich, A. G., Trautmann, M., . . .
Pusch, C. M. (2013). First insights into the metagenome of Egyptian mummies using
next-generation sequencing. Journal of applied genetics, 54(3), 309-325.
doi:10.1007/s13353-013-0145-1
Kurushima, J. D., Ikram, S., Knudsen, J., Bleiberg, E., Grahn, R. A., & Lyons, L. A. (2012).
Cats of the Pharaohs: Genetic Comparison of Egyptian Cat Mummies to their Feline
Contemporaries. J Archaeol Sci, 39(10), 3217-3223. doi:10.1016/j.jas.2012.05.005
Lambert, D. M., & Millar, C. D. (2006). Evolutionary biology: ancient genomics is born.
Nature, 444(7117), 275-276.
Lindahl, T. (1993). Instability and decay of the primary structure of DNA. Nature,
362(6422), 709-715. doi:10.1038/362709a0
Lindahl, T., & Nyberg, B. (1972). Rate of depurination of native deoxyribonucleic acid.
Biochemistry, 11(19), 3610-3618.
Lorenzen, E. D., & Willerslev, E. (2010). King Tutankhamun's family and demise. JAMA,
303(24), 2471; author reply 2473-2475. doi:10.1001/jama.2010.818
Marchant, J. (2011). Curse of the Pharoah's DNA: some researchers claim to have
analysed DNA from Egyptian mummies. Others say that's impossible. Could new
sequencing methods bridge the divide? Nature, 472(7344), 404.
Marota, I., Basile, C., Ubaldi, M., & Rollo, F. (2002). DNA decay rate in papyri and human
remains from Egyptian archaeological sites. Am J Phys Anthropol, 117(4), 310-318.
doi:10.1002/ajpa.10045
Metzker, M. L. (2010). Sequencing technologies—the next generation. Nature Reviews
Genetics, 11(1), 31-46.
Millar, C. D., Huynen, L., Subramanian, S., Mohandesan, E., & Lambert, D. M. (2008).
New developments in ancient genomics. Trends in ecology & evolution, 23(7), 386-
393.
Nerlich, A. G., Haas, C. J., Zink, A., Szeimies, U., & Hagedorn, H. G. (1997). Molecular
evidence for tuberculosis in an ancient Egyptian mummy. Lancet, 350(9088), 1404.
doi:10.1016/S0140-6736(05)65185-9
Nerlich, A. G., & Lösch, S. (2009). Paleopathology of human tuberculosis and the
potential role of climate. Interdisciplinary perspectives on infectious diseases, 2009.
44
Nerlich, A. G., Schraut, B., Dittrich, S., Jelinek, T., & Zink, A. R. (2008). Plasmodium
falciparum in ancient Egypt. Emerging infectious diseases, 14(8), 1317.
Nielsen-Marsh, C. M., & Hedges, R. E. (2000). Patterns of diagenesis in bone I: the
effects of site environments. Journal of Archaeological Science, 27(12), 1139-1150.
Noro, M., Masuda, R., Dubrovo, I. A., Yoshida, M. C., & Kato, M. (1998). Molecular
phylogenetic inference of the woolly mammoth Mammuthus primigenius, based on
complete sequences of mitochondrial cytochrome b and 12S ribosomal RNA genes.
Journal of Molecular Evolution, 46(3), 314-326.
Overballe-Petersen, S., Orlando, L., & Willerslev, E. (2012). Next-generation sequencing
offers new insights into DNA degradation. Trends in biotechnology, 30(7), 364-368.
Paabo, S. (1985). Molecular cloning of Ancient Egyptian mummy DNA. Nature,
314(6012), 644-645.
Paabo, S. (1989). Ancient DNA: extraction, characterization, molecular cloning, and
enzymatic amplification. Proc Natl Acad Sci U S A, 86(6), 1939-1943.
Pareek, C. S., Smoczynski, R., & Tretyn, A. (2011). Sequencing technologies and
genome sequencing. Journal of applied genetics, 52(4), 413-435.
Park, J. S., Vreeland, R. H., Cho, B. C., Lowenstein, T. K., Timofeeff, M. N., & Rosenzweig,
W. D. (2009). Haloarchaeal diversity in 23, 121 and 419 MYA salts. Geobiology, 7(5),
515-523. doi:10.1111/j.1472-4669.2009.00218.x
Poinar, H. N., Hoss, M., Bada, J. L., & Paabo, S. (1996). Amino acid racemization and
the preservation of ancient DNA. Science, 272(5263), 864-866.
Richards, M. B., Sykes, B. C., & Hedges, R. E. (1995). Authenticating DNA extracted
from ancient skeletal remains. Journal of Archaeological Science, 22(2), 291-299.
Roberts, C., & Ingham, S. (2008). Using ancient DNA analysis in palaeopathology: a
critical analysis of published papers, with recommendations for future work.
International Journal of Osteoarchaeology, 18(6), 600-613.
Seco-Morais, J., Oom, M. M., Quesada, F., & Matheson, C. D. (2007). Ancient Iberian
horses: a method to recover DNA from archaeological samples buried under sub-
optimal conditions for preservation. Journal of Archaeological Science, 34(10), 1713-
1719. doi:10.1016/j.jas.2006.12.009
Shapiro, B., Drummond, A. J., Rambaut, A., Wilson, M. C., Matheus, P. E., Sher, A. V., . .
. Binladen, J. (2004). Rise and fall of the Beringian steppe bison. Science, 306(5701),
1561-1565.
45
Taylor, P. G. (1996). Reproducibility of ancient DNA sequences from extinct Pleistocene
fauna. Molecular Biology and Evolution, 13(1), 283-285.
Vreeland, R. H., Rosenzweig, W. D., & Powers, D. W. (2000). Isolation of a 250 million-
year-old halotolerant bacterium from a primary salt crystal. Nature, 407(6806), 897-
900. doi:10.1038/35038060
Waite, E. R., Child, A. M., Craig, O. E., Collins, M. J., Gelsthorpe, K., & Brown, T. A. (1997).
A preliminary investigation of DNA stability in bone during artificial diagenesis. Bulletin
de la Société Géologique de France, 168(5), 547-554.
Willerslev, E., & Cooper, A. (2005). Review Paper. Ancient DNA (Vol. 272).
Woide, D., Zink, A., & Thalhammer, S. (2010). Technical note: PCR analysis of minimum
target amount of ancient DNA. Am J Phys Anthropol, 142(2), 321-327.
doi:10.1002/ajpa.21268
Woodward, S. R., Weyand, N. J., & Bunnell, M. (1994). DNA sequence from Cretaceous
period bone fragments. Science, 266(5188), 1229-1232.
Zink, A., & Nerlich, A. G. (2003). Molecular analyses of the “Pharaos:” feasibility of
molecular studies in ancient Egyptian material. American Journal of Physical
Anthropology, 121(2), 109-111.
Zink, A., Reischl, U., Wolf, H., & Nerlich, A. G. (2000). Molecular evidence of bacteremia
by gastrointestinal pathogenic bacteria in an infant mummy from ancient Egypt. Arch
Pathol Lab Med, 124(11), 1614-1618. doi:10.1043/0003-
9985(2000)124<1614:MEOBBG>2.0.CO;2
Zink, A. R., Grabner, W., Reischl, U., Wolf, H., & Nerlich, A. G. (2003). Molecular study
on human tuberculosis in three geographically distinct and time delineated populations
from ancient Egypt. Epidemiology and Infection, 130(2), 239-249.
doi:10.1017/s0950268802008257
Zink, A. R., & Nerlich, A. G. (2005). Long-term survival of ancient DNA in Egypt: Reply to
Gilbert et al. American Journal of Physical Anthropology, 128(1), 115-118.
doi:10.1002/ajpa.20046
Zink, A. R., Sola, C., Reischl, U., Grabner, W., Rastogi, N., Wolf, H., & Nerlich, A. G.
(2003). Characterization of Mycobacterium tuberculosis complex DNAs from Egyptian
mummies by spoligotyping. J Clin Microbiol, 41(1), 359-367.
doi:10.1128/JCM.41.1.359-367.2003
46
Zivie, A., & Lichtenberg, R. (2005). The cats of the goddess Bastet. In S. Ikram (Ed.),
Divine creatures: Animal mummies in ancient Egypt (pp. 106-119). Cairo: The American
University in Cairo Press.
Zweifel, L., Büni, T., & Rühli, F. (2009). Evidence-based palaeopathology: meta-analysis
of PubMed-listed scientific studies on ancient Egyptian mummies. HOMO-Journal of
Comparative Human Biology, 60(5), 405-427.
47
3. Chapter Three: Radiocarbon dating of Sacred Ibis mummies
from ancient Egypt
S. Wasefa, R. Woodb, S. El Merghanic, S. Ikramd, C. Curtisa, B. Hollande, E. Willerslevf, C.D.
Millarg, D.M. Lamberta
aEnvironmental Futures Research Institute, Griffith University, 170 Kessels Road, Nathan
4111, Australia
bRadiocarbon Facility, Research School of Earth Sciences, The Australian National
University, Canberra 0200, Australia
C Ministry of Antiquities, Cairo, Egypt
dDepartment of Sociology, Anthropology, Psychology and Egyptology, American University
in Cairo, Cairo, Egypt
eSchool of Mathematics and Physics, University of Tasmania, Hobart, Australia
fCentre for GeoGenetics, University of Copenhagen, Copenhagen, Denmark
gAllan Wilson Centre for Molecular Ecology and Evolution, School of Biological Sciences,
University of Auckland, Private Bag 92019, Auckland, New Zealand
ARTICLE INFO
Keywords:
Radiocarbon dating
Egypt
Animal mummies
Sacred Ibis
Reservoir effect
Carbon 14
Corresponding author. Tel: +61 7 37355298.
Email address: [email protected] (David Lambert)
48
ABSTRACT
Sacred Ibis (Threskiornis aethiopicus) were widespread in Egypt until the eighteenth
century. Today the species is extinct in modern Egypt but millions of mummified specimens
are scattered geographically in dedicated Sacred Ibis burial sites throughout the country.
Ibises were regarded as physical manifestations of the god Thoth and worshiped by the
ancient Egyptians. A small number of Sacred Ibis were chosen as ‘sacred animals’, based
on physical markings, and were reared for the temples. However, the majority of the
mummified Sacred Ibis were ‘votive animals’, that were given as offerings to the deities by
pilgrims, and then buried in catacombs associated with the temple. Their supply became
an industry that is thought to have flourished from the Late Period, well into the Roman
Period (c. 664 BC to AD 350). Dating of the Sacred Ibis mummies, as well as other
mummified animal specimens, has been based on
archaeological evidence such as the age of
catacombs, the design of enclosures and the shape
of the mummy containers (pottery jars, wooden
chests or stone boxes). Here we present the first ages
of a selection of Sacred Ibis mummies using 14C
methods in order to establish how closely they match
the archaeological chronology. Dates are reported
from museum samples provenience from Saqqara,
Roda and Thebes. Our 14C radiocarbon results date
the Sacred Ibis mummies between c.450 and 250 cal
BC and represent a short period of time. Those dates
are falling from the Late Period to the Ptolemaic
Period at maximum. Surprisingly, none of the samples
were dated to the Roman era.
1. Introduction
The ancient Egyptians’ phenomenal success in preserving bodies was not only practiced
on humans, but on a wide range of animals as well. Many attempts were made to
understand and explain the cultural and religious significance behind the mummification
of different animals (e.g. Ikram, 2005). For the ancient Egyptians, animals, or at least
Figure 3-1 Thoth, the Egyptian God of Wisdom
and Writing who is often depicted as a man
with the head of an Ibis.
49
animals kept in the temple, were
considered ethically in much the same
way as humans. This was exemplified by
a text from the first millennium BC: “I
have given bread to the hungry, water to
the thirsty, clothing to the naked. I have
given food to the Ibis, the falcon, the cat
and the jackal’ (Bergmann, 1879). The
Egyptians believed that both humans and
animals were equivalent forms of living
beings. Therefore, the gods could be
represented in any of those forms, or as
a hybrid (Te Velde, 1980).
Animal mummification is thought to have
occurred for varying reasons. Sometimes
it was because the individuals were
‘beloved pets’, interred with or near their
owners. Others, known as food or
‘victual mummies’, were served as
funerary food supplied for the
deceased in the afterlife, and formed
part of the grave goods. Still others were ‘sacred animals’ that represented the presence
of gods in the temple. These mummies were buried in elaborate containers and placed in
designated catacombs. Many animals were mummified as ‘votive animals’ and offered by
pilgrims to the gods to secure a prayer (Ikram, 2005), and then buried in catacombs or in
pit-tombs by the god’s priests. The latter were the most numerous type of animal mummy.
Animal catacombs form one part of a complex sacred landscape, and were typically placed
adjacent to temples or shrines of a specific god (Ikram, 2005; Ray 2001).
The large number of different animals offered to the Egyptian gods indicates the
significance of animal mummies to the ancient Egyptians. Literally millions can be found
in many geographically separate catacombs (Ikram et al, 2012; Ikram, 2005). The use of
birds and other animals in cultic activities is thought to have reached its zenith in the
Twenty-Sixth Dynasty (664-525 BC), lasting into the Graeco-Roman Period (ending about
AD 350 or slightly earlier, with the advent of Christianity and the banning of paganism)
Figure 3-2 The location of the main archaeological sites of
Ancient Egypt. The Ibis symbol indicates the location of the
main Sacred Ibis catacombs.
50
(Ikram, 2005). The most popular of these cults was that of Thoth, with burials of Ibises
scattered throughout Egypt (Bailleul-Le Seur, 2012; Ikram 2012).
Sacred Ibis (Threskiornis aethiopicus) are the most plentiful animal mummies found in the
dedicated burial sites in Egypt. They were associated with Thoth (Fig. 1), the god of wisdom,
writing, moon and magic, the heavenly body that was equivalent to the sun at night, and
known as the ‘silver Aten’ (silver disk) in the Late Period (Kurth 1986). The Ibis, as the
human hybrid form of Thoth occurs in two- and three-dimensional representations
throughout Egyptian history. Ibis were not only key to cultic activities associated with Thoth,
but they also played a significant role in daily life by both recycling refuse and helping to
keep water clean by consuming bilharzia-carrying snails.
The remarkable Sacred Ibis mummies, which are found in their millions in the ancient
catacombs of Egypt represent a unique reservoir for scientific studies. This material is not
just important for studies of the traditions and customs of ancient Egypt, but also for
investigations into ornithology and evolutionary biology.
Although it has been suggested by a variety of scholars that the practice of offering animal
mummies was popular from c. 664 BC until approximately AD 350, to date no 14C dates
have been published, although this technology has been used on human mummies
(Dunand and Lichtenberg, 2006). Thus far, most of the dating of the Sacred Ibis mummies,
as well as other mummified animal specimens, has been based merely on archaeological
evidence such as the architecture of the catacombs and the shape of the mummy
containers such as the pottery jars, wooden chests or stone boxes. This article presents
the results of 14C tests carried out on Ibis mummies coming from Saqqara, Roda and
Thebes (Fig. 2). We also consider the textual and archaeological evidence for the likely
chronology of the practice of offering animal mummies.
2. Material, Methods, and Locations:
For research purposes, samples of Sacred Ibis mummy bone, tissue, and feathers were
obtained from museum collections for both radiocarbon dating and molecular evolutionary
studies (to be published elsewhere). Additionally, a sample of textile wrapping was
collected to assess the potential scale of the radiocarbon freshwater reservoir effect. The
51
mummification materials
surrounding the Ibis
mummies were sampled to
assess whether bitumen-
containing ancient carbon
was used during the
embalming process.
2.1 Sampling:
A total of six samples were
taken from collections
curated by European
museums. The samples were
collected (table 1) either in
zipped plastic bags or
Eppendorf tubes. Gloves and
masks were used during the
sampling process.
The Necropolis at North Saqqara
Saqqara on the west bank of the Egyptian Nile, lies approximately 30 km south of the
capital city Cairo and is the location of the famous Step Pyramid (c. 2600 BC). The area of
North Saqqara contains one of most important archaeological locations for animal
mummies in Egypt: The Sacred Animal Necropolis (SAN) (Fig. 2). This comprises two Ibis
catacombs and a Main Temple complex with cult chambers and catacombs for mummified
baboons, cattle, and raptors (Nicholson, 2005; Martin 1981; Smith 1974; Davies and
Smith 1997). The catacombs consist of a number of main arterial passageways with
galleries along either side. These functioned as the burial places for the mummy pots,
which were stacked carefully, with a layer of sand separating each row of vessels. In
addition, some of the galleries had a series of ‘niches’ cut into the walls, to store small
limestone chests housing mummified birds. This type of burial may indicate a special
offering from a high-ranking person or a Sacred Animal burial (Nicholson, 2005). Two bone
Figure 3-3 Ancient mummified Sacred Ibis bone fragments covered with resin
from (a) Roda, (b)Saqqara, and (c,d) Thebes.
52
samples (Fig. 3) were dated from the collection of the Musée des Confluences, Lyon,
France.
Thebes
Thebes contains several burial places for Ibis, and in most cases the ancient Egyptians
made use of pre-existing human tombs for the burial of birds (Ikram, 2009). The Theban
cult pairs Thoth with Horus and hence it is common for the Ibis to be found in conjunction
with raptors. In Thebes such burials have been identified at the tomb of Ankh Hor
(Boessneck, 1982), while they have also been reported near TT 141 (Bekenkhons)
(Northampton, 1908). Another concentration occurs in the area of TT 156 (Pennesuttaui),
and in the environs of TT 11/12 (Ikram, 2009 and personal observation Ikram et al. in
preparation). Many Ibises were extracted from these venues and sold to private collectors,
particularly in the 19th and early 20th centuries. Only one museum bone sample was
available for dating from Thebes (Fig. 3). This was obtained from the British Museum
collections.
2.2 Methods:
In total, collagen was extracted from six samples of Ibis bone (Table1). The bone was
physically cleaned with a scalpel, subjected to a series of solvent washes to remove
possible fats and resins before acid-base-acid washes were carried out to demineralise
and remove secondary carbonates and to remove humics, gelatinisation and filtration to
extract gelatin, and ultrafiltration to collect the largest fragments of protein following a
protocol similar to Brock et al. (2010). Details of pre-treatment protocols are given in
(Supplementary Material)
Stable isotope analyses were also undertaken, additionally providing atomic C:N ratios and
%C contents. Carbon and nitrogen stable isotopes were measured in a second aliquot of
gelatine in an elemental analyser (ANCA-GSL) that was connected to an isotope ratio-mass
spectrometer (IRMS, Sercon 20-22) operating in continuous flow mode. Samples were
measured against an in-house gelatine reference and corrected against USGS-40 and
USGS-41.
53
Sacred Ibis eat foods from both terrestrial and freshwater environments (Marion 2013)
and their radiocarbon age could be affected by a freshwater radiocarbon reservoir effect,
where ancient carbon, for example from limestone, is dissolved in water and incorporated
into the aquatic food chain (Lanting et al. 1998, Keaveney et al. 2012). Despite the
extensive limestone deposits in the Nile river catchment, particularly north of Luxor (Bauer
1974, Arnold 1991), few have investigated this effect in the Nile. However, from an
analysis of two modern shells Burleigh (1983) suggest a radiocarbon reservoir of
approximately 500 14C years. To test whether Ibis were affected by a freshwater
radiocarbon reservoir, a mummy wrapping provenanced from Saqqara (Sample1) was
dated after cleaning with a series of solvents and an acid base acid pre-treatment protocol
(Supplementary Material).
The fabric was dated using an acid-base-acid method. As part of the laboratory quality
assurance protocol, where c.1 in 20 dates are duplicated, the sample was treated and
dated twice. Using the same series of solvent washes that had been applied to bone
material, the sample was treated with 1 M hydrochloric acid for 30 min at 80°C, then 0.2
M sodium hydroxide for 1 hour at room temperature, and finally 1 M hydrochloric acid for
1 hour at 80°C. After each treatment the sample was rinsed with ultrapure water. The
cleaned sample was combusted, graphitised, and dated using the methods described for
bone. Stable isotope analysis was not undertaken for this sample.
A second possible difficulty in dating mummified material arises when bitumen or tree resin
is used during the embalming process. Solvent washes were used in an attempt to remove
resinous material, as well as lipids originally derived from the bone and flesh, from the
samples. However, those materials are exceptionally difficult to fully remove from samples
(Dee et al. 2010) and bitumen consists of ancient carbon. Although, thus far there is no
evidence that bitumen was used in the embalming of these Ibises. The black resinous
material usually found surrounding and in Ibis mummies is more often a mixture of resin
and oil, sometimes with beeswax added into the mixture (Buckley et al. 2004, Clark et al.,
2013 and Ikram, S. 2013) Hence dates may appear erroneously old (Dee et al. 2010). To
assess whether large amounts of resin were used during the embalming procedure, a
sample of the embalming materials attached to the sample 1 from Saqqara was dated.
This sample was dated at the ANU after a gentle acid-base-acid procedure (Supplementary
Material)
Radiocarbon dates were calibrated against IntCal13 (Reimer et al. 2013) in OxCal v4.2
(Bronk Ramsey 2009). The inter-tropical convergence zone lies over Egypt during the
54
growing season bringing air depleted in 14CO2 from the southern hemisphere northward.
Hence, a regional reservoir effect of 19±5 14C years was applied to all dates (Dee et al.
2010, Bronk Ramsey et al. 2010) (Table 1). Dates from Saqqara and Roda were then
modelled (4) as single Phases using Bayesian procedures in OxCal v.4.2, assuming that all
dates have a 5% prior probability of being an outlier within the General t-type Outlier Model
(Bronk Ramsey 2009).
3. Results
In total one textile, one resinous substance and six bone samples were dated (Table 1)
and have been calibrated and/or modelled (Figure 4 and Table 2). The dates on textile
and bone are consistent, with no samples identified as outliers by the model. All bones
contained more than 1% collagen, suggesting adequate collagen preservation (van
Klinken 1999) (Table 1).
Two potential difficulties in radiocarbon dating the Ibis mummies were identified and
tested. Both contamination from resin within the embalming mixture and a freshwater
reservoir effect could cause the collagen to appear inaccurately older. We see no indication
of a radiocarbon reservoir effect, and with the possible exception f AAA-19860, it is unlikely
that the collagen is significantly affected by the presence of old carbon contaminants.
3.1 Contamination from the embalming mixtures
Although δ13C values appear reasonable for collagen, the C:N ratios are towards the higher
end expected for collagen (van Klinken 1999). Although most are less than 3.4, SANU-
40231 has a C:N of 3.6 whilst AAR-19860 has a C:N of 4.0. Despite the use of a series of
solvent washes, these samples may still contain substantial quantities of lipids (up to 4%
of the sample), some of which may be a different age to the collagen.
To investigate how much of an effect contamination from this source might have, a sample
of the embalming materials attached to Saqqara 1 (SANU-40232) was dated. With an age
of nearly 7000 BP, it does suggest that some resinous material has been used during the
embalming process. This sample had a C:N of 23 and 58 %C. Although a high C:N ratio of
collagen in well preserved bone can result from the inclusion of lipids derived from the
bone, we will consider the worst-case scenario where all of the excess carbon is derived
from exogenous resin. If we make the assumption that the resin added to all of the
mummies had a similar age and C:N ratio as SANU-40232, the age of the collagen would
55
only extend beyond a typical quoted 2 sigma error range if the C:N exceeded 3.7 (table 3).
We are therefore concerned only with the accuracy of date AAR-19860 from Thebes.
Of course, the embalming recipes may have varied. If we were to assume the resin
contained only fossil carbon and had an age >55,000 BP, i.e. be entirely formed of resin
mixed with very little bitumen, the age of collagen with a C:N of 3.5 would be considered
inaccurate. Buckley et al. (2004) found that balms used during the preparation of animal
mummies were complex mixtures of e.g. beeswax, sugar gum, coniferous and Pistacia
resins, as well as little or no bitumen. Therefore, although possible, it is highly unlikely that
contaminating carbon is fossil in age. This conclusion is supported by the consistency of
dates from all three sites.
3.2 A radiocarbon freshwater reservoir effect
It is unlikely that the dates are affected by a radiocarbon reservoir. First, radiocarbon dates
from the Ibis bone and wrapping from a single mummy at Saqqara, are identical, with
calibrated dates overlapping at 95.4% probability. Second, the radiocarbon dates on bone
within each site are highly consistent. A characteristic of the freshwater reservoir is its large
variability, even within a single lake (Ascough et al. 2010, Keaveney et al. 2012). Therefore,
the consistency of the dates can be very tentatively used to suggest a large reservoir is not
affecting the results at sites where textile could not be dated.
Because Ibis eat both freshwater foods and terrestrial foods (Marion 2013), it is unclear
whether these results can provide any information on the presence and possible size of a
radiocarbon reservoir effect in the Nile. The enriched δ13C and δ15N values of the collagen
may indicate that some freshwater foods were eaten (Schoeninger et al., 1984, France
1995, Post 2002), but these may also reflect the warm arid climate and the presence of
some C4 plants at the base of the food chain (Touzeau et al. 2014). Without an in depth
study into the isotopic signature of Sacred Ibis from this period, a more detailed
interpretation of the stable isotopes is not possible.
3.3 Bayesian analysis
Bayesian models could be built using radiocarbon dates from Saqqara and Roda. Although
the small number of samples means that the modelled Boundaries are imprecise, they
demonstrate that the radiocarbon dates are consistent with a short period of activity.
Samples from Saqqara, Roda, Thebes are all of a similar age, falling between c.450 and
56
250 cal BC and represent a short (< 500 years, 68.2% probability) period of time (Fig. 5).
None of the raw dates returned any probability later than the 2nd century BC; although,
upon Bayesian modelling the end boundaries tapered into the early Roman Period.
Figure 3-4 Duration of burial activity at Saqqara, and Roda, calculated using the Interval function in OxCal.
57
Table 3-1 Radiocarbon results. δ13C values measured on the AMS were used to correct the conventional radiocarbon dates for isotopic fractionation, but they are not accurate or precise
and cannot be used for dietary reconstruction. δ13C values obtained with IRMS are used for dietary information. Errors for IRMS δ13C are ± 0.1 and δ 15N ± 0.1 at 1σ. For a reliable date,
collagen yield should be >1% and C:N ratio should be between 2.9-3.4 (van Klinken 1999). Dates are calibrated against IntCal13 (Reimer et al. 2013) with a 19±5 14C year reservoir
(Dee et al. 2010) in OxCal v4.2 (Bronk Ramsey 2009).
Sample
Name
Sample
Source
Analysis
Code
14C age
(BP)
Error d13C
(AMS)
Error Collagen
yield
(mg)
Collagen
yield (%)
IRMS results
Material δ13C
(deltaPDB)
δ15N
(deltaAIR)
%C C:N
Saqqara_
sample1
Musée des
Confluences,
Lyon, France
Bone SANU-
40233
2320 25 -26 1 19.68 10.5 -18.2 12.2 43.7 3.3
Saqqara-
Wrapping
Musée des
Confluences,
Lyon, France
Wrapping SANU-
40235
2220 25 -19 1 -24.4 42.5
Saqqara-
Resin
Musée des
Confluences,
Lyon, France
Resin SANU-
40232
6895 25 -20 1 -26.0 58.5
Saqqara_
sample2
Musée des
Confluences,
Lyon, France
Bone SANU-
40906
2430 20 -21 1 8.5 7.1 -17.7 10.8 45.1 3.5
Saqqara_
Sample3
Musée des
Confluences,
Lyon, France
Bone SANU-
40907
2365 20 -16 1 25.1 9.6 -17.8 13.0 44.2 3.4
Roda_
Sample1
Musée des
Confluences,
Lyon, France
Bone SANU-
40227
2325 25 -23 1 15.64 7.8 -19.1 10.2 45.6 3.4
Roda_
Sample2
Musée des
Confluences,
Lyon, France
Bone SANU-
40231
2320 25 -29 1 11.05 7.1 -19.7 13.3 44.0 3.6
Thebes British Musum Bone AAR-
19860
2345 25 -18.85 0.64 - 6.6 -19.1 11.88 - 4.0
58
Table 3-2 Details of calibrated and modelled dates of Sacred Ibis material investigated in this study.
Name Calibrated date (cal BC/AD) Modelled date (cal BC/AD)
68.2 % probability 95.4% probability 68.2 % probability 95.4% probability
From to from to
from to from to
Thebes -400 -374 -453 -356
Roda end -388 -324 -399 10
Interval Roda 0 113 0 722
SANU-40231 -390 -365 -400 -352 -390 -367 -398 -356
SANU-40227 -392 -368 -401 -353 -391 -368 -399 -357
Roda start -435 -368 -792 -355
Saqqara end -347 -317 -356 -223
Interval Saqqara 52 106 32 215
SANU-40907 -408 -380 -472 -371 -402 -382 -415 -367
SANU-40906 -514 -412 -725 -398 -421 -391 -441 -343
SANU-40235 -346 -204 -355 -193 -359 -331 -377 -273
SANU-40233 -390 -365 -400 -352 -390 -365 -398 -353
Saqqara start -425 -394 -457 -379
SANU-40232 -5779 -5720 -5826 -5707
59
Table 3-3 The impact of contamination from resin, as represented by a high C:N ratio, on the age of a collagen sample (C:N of 3.2 and 44 %C) with a measured age of 2300 BP. The resin
from Saqqara, SANU-40232 6895 BP (C:N ratio 23, 58 %C), was taken as the contaminant.
Measured C:N of collagen % resin in the sample % carbon in the sample derived from resin Actual age of the sample (BP)
3.2 0.0 0.0 2300
3.3 0.5 0.7 2275
3.4 1.0 1.3 2255
3.5 1.5 2.0 2230
3.6 2.0 2.6 2205
3.7 2.5 3.3 2180
3.8 3.0 4.0 2155
3.9 3.5 4.6 2135
4.0 4.0 5.3 2110
60
4. Discussion
The 14C radiocarbon results date the Sacred Ibis mummies to a range from the Late Period
to the Ptolemaic Period. None of the samples were dated to the Roman era. This might, of
course, be due to the samples chosen, but might also indicate that the practice was
declining at a time prior to that suggested previously by archaeologists (Bailleul-Le Seur,
2012; Ikram 2012). Quite possibly the habit of mummifying animals and offering them to
deities had ceased or declined by the 2nd or 3rd centuries AD.
Our dating results also show that there was no detectable influence of a freshwater
reservoir effect. This was particularly well demonstrated by the Saqqara sample. This
seems to be contradictory to previously published results for the 14C dating of a Sacred Ibis
and wrapping by Gove et al. (1997), as our results show that the ages of the Ibis bone
sample and mummy wrapping from Saqqara are almost identical, with calibrated dates
overlapping at 95.4% probability. A characteristic of the freshwater reservoir effect is its
large variability, even within a single lake (Ascough et al. 2010, Keaveney et al. 2012). The
fact that we have recorded very low variability among dates recorded this suggests that the
freshwater radiocarbon reservoir effect is negligible.
On the whole, the 14C dates of the samples and the majority of the archaeological and
textual evidence fit well together. Interestingly, none of the dates from these samples
extend into the Roman era. Thus far, the results of our work indicate that the zenith of
activity for these sites might well have ended by the 1st century BC, rather than carrying
into the 4th century AD, as others have suggested (Bailleul-Le Seur, 2012; Ikram 2012;
Kessler 1986). Certainly, the textual evidence for the Roman period is negligible. Perhaps
a renewed focus on this time period in terms of artefacts and texts, as well as an increased
number of samples analysed, will elucidate the temporal range of the practice of offering
animal mummies.
5. Conclusion
By using radiocarbon dating methods, we show that these mummies date to approximately
2220 - 2430 yr BP, which may indicate that, the most of the Ibis mummies production
happened from the Late Period to the Ptolemaic Period. Still those dates maybe restricted
to the samples that have been used which provenience from Saqqara, Roda and Thebes.
61
This suggests that archaeologists might have to re-evaluate their dating of animal
catacombs, perhaps with an earlier terminus of the practice of animal mummification than
hitherto thought.
Acknowledgments
We are especially grateful to the Human Frontier Science for funding support in the form
of a grant (RGP0036/2011 “Ancient Ibis Mummies from Egypt: DNA Evolution”). We are
also grateful for research funding from Griffith University and for a PhD scholarship for S.W.
A number of museums kindly provided material for this study including: The British
Museum and the Musée des Confluences, Lyon, France, particularly Stephanie Porcier.
Thanks to Aarhus University, the Institut for Fysik og Astronomi, AMS 14C Dating Centre,
for dating the British museum sample. Thanks to Vivian Ward from the University of
Auckland for drawing Figure 2 and Miriam Alexander for Figures 4 and 5.
References
Arnold, D., 1991. Building in Egypt. Pharaonic Stone Masonry. New York/Oxford.
Ascough, P.L., Cook, G.T., Church, M.J., Dunbar, E., Einarsson, A., McGovern, T.H., Dugmore,
A.J., Perdikaris, S., Hastie, H., Fridriksson, A., Gestsdóttir, H., 2010. Temporal and
spatial variations in freshwater 14C reservoir effects: Lake Mývatn, Northern
Iceland. Radiocarbon 52(3): 1098-1112.
Bailleul-Le Seur, R., 2012..From Kitchen to Temple: The Practical Role of Birds in Ancient
Egypt. in Rozenne Bailleul Le-Suer (ed), Between Heaven and Earth: Birds in
Ancient Egypt,p.30.
Bauer, J., 1974. A Field Guide in Colour to Minerals, Rocks and Precious Stones. London
(translation by F. Tvrz).
Bergmann, E. von., 1879. Hieroglypische Inschriften.Wien, Pl. VI 9-10.
Boessneck, J., and A. von den Driesch., 1982. Zoologische Bestimmunge der Tiermummien
aus einem Grab der 30. Dynastie in Luqsor. Das Grab des ‘Anch-Hor II, M. Bietak
and E. Reiser-Haslauer, eds. Vienna: p. 285-89.
Brock, F., Higham, T., Ditchfield, P., Ramsey, C.B., 2010. Current pretreatment methods for
AMS radiocarbon dating at the Oxford Radiocarbon Accelerator Unit (ORAU).
Radiocarbon 52:,103-112.
62
Bronk, R.C., Dee, M. W., Rowland, J.M., Higham, T.F.G., Harris, S.A., Brock, F., Quiles, A.,
Wild, E.M., Marcus, E.S., Shortland, A.J. 2009. Dealing with outliers and offsets in
radiocarbon dating. Radiocarbon, 51(3): 1023-1045.
Brown, T.A., NELSON, D.E., VOGEL, J.S. and SOUTHON, J.R., 1988. Improved collagen
extraction by modified Longin method. Radiocarbon 30, 171-177.
Buckley, S.A., Clark, K.A., Evershed, R.P., 2004. Complex organic chemical balms of
Pharonic animal mummies. Nature 431, 294-299.
Burleigh, R., 1983. Two radiocarbon dates for freshwater shells from Hierakonpolis:
Archaeology and geological interpretations. Journal of Archaeological Science, 10,
361-367.
Clark, K.A., Ikram, S. and Evershed, R.P., 2013. Organic Chemistry of Balms Used in the
Preparation of Pharaonic Meat Mummies. Proceedings of the National Academy
of Sciences 110 (51): 20392–95.
Davies, S. and Smith, H., 1997. Sacred Animal Temples at Saqqara, The Temple in Ancient
Egypt. S. Quirke, ed., London: British Museum: 112-31.
Dee, M.W., Brock, F., Harris, S.A., Bronk Ramsey, C., Shortland, A.J., Higham T.F.G.,
Rowland, J.M., 2010. Investigating the likelihood of a reservoir offset in the
radiocarbon record for ancient Egypt. Journal of Archaeological Science 37, 687–
693.
Dee, M.W., Brock, F., Bowles, A.D., Bronk Ramsey, C., 2011. Using a silica substrate to
monitor the effectiveness of radiocarbon pretreatment. Radiocarbon, 53(4), 705-
711.
Dunand, F. and Lichtenberg, R., 2006. Mummies and Death in Egypt. Ithaca, NY: Cornell
University Press.
France.1995. Stable nitrogen isotopes in fish: literature synthesis on the influence of
ecotonal coupling. Esturine, Coastal and Shelf Science, 41: 737-742.
Gove, H.E., Mattingly, S.J., David, A.R., Garza-Valdes, L.A., 1997. A problematic source of
organic contamination of linen. Nuclear Instruments and Methods in Physics
Research B123, 504-507.
Ikram, S., 2012. An Eternal Aviary: Bird Mummies from Ancient Egypt, in Between Heaven
and Earth: Birds in Ancient Egypt, R. Bailleul-LeSuer, ed. Chicago: Oriental
Institute, 41-48.
Ikram, S., 2005. Divine Creatures: Animal Mummies in Ancient Egypt. Cairo: American
University in Cairo Press, 1:5-14.
63
Ikram, S., Bosch, F., Spitzer, M., in preparation. ‘The Bird Mummies from TT 12’
Ikram, S., 2009. The Forgotten Dead: Animal Burials in the Theban Necropolis. Proceedings
of the Colloquium on Theban Archaeology at the Supreme Council of Antiquities,
Z. Hawass, T. A. Bacs, and G. Schreiber (eds.). Cairo: Supreme Council of
Antiquities, 73-5.
Ikram, S., 2013. A Re-Analysis of Part of Prince Amenemhat Q’s Eternal Menu. JARCE
48:119–35.
Keaveney, E.M., Reimer, P.J., 2012. Understanding the variability in freshwater
radiocarbon reservoir offsets: A cautionary tale. Journal of Archaeological Science,
39(5): 1306-1316.
Kessler, D., 1986. “Tierkult.” LÄ 6: 571–87.
Kurth, D., 1986. Toth. In W. Helck and E. Otto (eds.), LÄ VI: 497–523.
Lanting, J.N., van der Plicht, J., 1998. Reservoir effects and apparent 14C-ages. The Journal
of Irish Archaeology, 9: 151-165.
Marion, L., 2013. Is the Sacred Ibis a real threat to biodiversity? Long-term study of its diet
in non-native areas compared to native areas. Comptes Rendus Biologies, Vol.
336 (4): 207–220.
Martin, G.T., 1981. The sacred Animal Necropolis at North Saqqara. (London:EES)
Nicholson, P. T., 2005. The sacred animal necropolis at North Saqqara: the cults and their
catacombs. In: Ikram, S. ed. Divine Creatures: Animal Mummies in Ancient
Egypt. Cairo: American University in Cairo Press, pp. 44-71.
Nicholson, P., Jackson, C., Frazer, K., 1999. The North Ibis Catacomb at Saqqara: The Tomb
of the Birds.Studies on Ancient Egypt in Honour of H. S. Smith, A. Leahy and J. Tait,
eds. (London: EES), 209-214.
Northampton, W. G., Spiegelberg, W., Newberry, P. E., 1908. Report on some Excavations
in the Theban Necropolis. (London: Archibald Constable).
Post, D.M., 2002. Using stable isotopes to estimate trophic position: Models, methods, and
assumptions. Ecology, 83(3): 703-718.
Ramsey, B., et al., 2010. Radiocarbon-based chronology for dynastic Egypt. Science 328,
1554
Ray, J.D., 2001. Animal cults. The Oxford Encyclopedia of Ancient Egypt. D.B. Redford, ed.
(Oxford: Oxford University Press), 345-348.
Reimer, P.J., Bard, E., Bayliss, A., Beck, J.W., Blackwell, P.G., Bronk Ramsey, C., Buck, C.E.,
Cheng, H., Edwards, R.L., Friedrich, M., Grootes, P.M., Guilderson, T.P., Haflidason,
64
H., Hajdas, I., Hatté, C., Heaton, T.J. Hoffmann, D.L., Hogg, A.G., HughenK.A.,
Kaiser, K.F., Kromer, B., Manning, S.W., Niu, M., Reimer, R.W. RichardsD.A., Scott,
E.M., Southon, J.R., Staff, R.A., Turney, C.S.M., van der Plicht J., 2013. IntCal13
and Marine13 radiocarbon age calibration curves 0–50,000 years cal BP.
Radiocarbon, 55(4) 1869-1887.
Schoeninger, M.J., Deniro, M.J., 1984. Nitrogen and carbon isotope composition of bone
collagen from marine and terrestrial animals, Geochimica et Cosmochimica Acta,
48: 625-639.
Smith, H. S., 1974. A Visit to Ancient Egypt: Life at Memphis and Saqqara (c. 500-30BC).
(Warminster: Aris and Phillips).
Te Velde, H., (1980). A few remarks on the religious significance of animals in ancient
Egypt. Numen 27 (1980), 76-82.
Touzeau, A., et al., 2014. Diet of ancient Egyptians inferred from stable isotope
systematics. Journal of Archaeological Science Vol.46: 114-124.
Van Klinken, G.J., 1999. Bone collagen quality indicators for palaeodietary and radiocarbon
measurements. Journal of Archaeological Science, 26(6): 687-6.
65
4. Chapter Four: Fishing for mitochondrial DNA in mummified
Sacred Ibises: development of a targeted enrichment
protocol for ancient Egyptian remains.
S. Wasefa,b, L. Huynena, C. Curtisa, C.D. Millarf, S. Subramaniana, S. Ikramc, B. Hollandd, E.
Willersleve, D.M. Lamberta
aEnvironmental Futures Research Institute, Griffith University, 170 Kessels Road, Nathan
4111, Australia
bAncient DNA laboratory, Learning Resource center , Kasr Al Ainy Faculty of Medicine, Cairo
University, Egypt
cDepartment of Sociology, Anthropology, Psychology and Egyptology, American University
in Cairo, Cairo, Egypt
dSchool of Mathematics and Physics, University of Tasmania, Hobart, Australia
eCentre for GeoGenetics, University of Copenhagen, Copenhagen, Denmark
fAllan Wilson Centre for Molecular Ecology and Evolution, School of Biological Sciences,
University of Auckland, Private Bag 92019, Auckland, New Zealand
ARTICLE INFO
Article history:
Received …
Keywords:
Ancient DNA
Egypt
Animal mummies
Sacred Ibis
Target capture hybridisation
Mitochondrial genomes
Corresponding author. Tel: +61 7 37355298.
Email address: [email protected] (David Lambert)
66
Abstract
To date, the retrieval of even partial genomes from ancient Egyptian remains of humans
or other animals has been largely unsuccessful. In order to test for the presence of even
short DNA sequences in Egyptian material, we performed second-generation shotgun
sequencing of 14 ancient Sacred Ibis mummies. Since most of the Illumina libraries were
shown to contain extremely low levels (less than 0.06%) endogenous mitochondrial DNA,
we attempted to enrich the Sacred Ibis mitochondrial sequences using targeted in solution
hybridisation enrichment. Using biotinylated RNA baits designed to Sacred Ibis
mitochondrial sequences, we trialled a number of conditions and parameters and
achieved up to 542- and 4705-fold enrichment from modern and ancient tissue samples
respectively. We found that a combination of hybridisation temperature and the use of the
polymerase KAPA HiFi significantly increased both the efficiency of targeted hybridisation
and post-hybridisation amplification. In addition, improved enrichment was accompanied
with minor increases in clonality. Targeted enrichment enabled us to reconstruct the first
complete mitochondrial genomes from ancient Egyptian sub-fossil material.
Introduction
Ancient Egyptians mummified animals either as beloved pets, or as sacred representation
of Gods, or as ‘votive offerings’ presented by to the Gods (Ikram, 2005). Of the votive
offerings, most involved the Sacred Ibis (Threskiornis aethiopicus). Several million Ibis
mummies were offered to Thoth, the god of writing and wisdom (Ikram, 2005). Nowadays,
the Sacred Ibises are no longer seen in Egypt, becoming extinct by approximately 1850
(Cramp, 1977). We attempted to reconstruct the complete mitochondrial genome of a
number of these mummified birds, as well as modern individuals of the same species in
order to determine the variation that may have existed amongst ancient Egyptian Sacred
Ibises, relative to wild populations now.
Genetic analyses of ancient Egyptian animals have been notoriously difficult due to the
warm and humid climate of Egypt, conditions which are generally detrimental to the
survival of DNA (Gilbert, et al., 2005).
Preliminary successes have been achieved with studies of both mummified crocodiles
(Hekkala, et al., 2011) and cat remains (Kurushima, et al., 2012). Both studies
successfully amplified using the Polymerase Chain Reaction and sequenced a fragment of
mitochondrial DNA (mtDNA) that identified the species and established a genetic
67
relationship between ancient Egyptian and modern day species (Hekkala, et al., 2011,
Kurushima, et al., 2012). However, subsequent work using second-generation sequencing
has been largely unsuccessful in obtaining significant coverage of ancient Egyptian animal
nuclear or mitochondrial genomes (Khairat, et al., 2013). Nevertheless, these initial
successes have paved the way for further research on ancient Egyptian materials.
Ancient DNA (aDNA), existing in very low concentrations if at all in archaeological materials
from harsh climates, is typically fragmented and damaged, and contains high levels of
contamination (Knapp and Hofreiter, 2010). Such samples would require an improved
extraction (Dabney, et al., 2013) and library construction protocols (Gansauge and Meyer,
2013). This, in conjunction with targeted hybridisation enrichment systems adapted for
ancient DNA (Briggs, et al., 2009, Maricic, et al., 2010, Fu, et al., 2013) have been shown
to result in the retrieval of orders of magnitude more sequence data, particularly from
short, highly contaminated, and limited ancient DNA samples.
Targeted enrichment typically uses biotinylated DNA or RNA baits complementary to the
target DNA or RNA of interest (Gnirke, et al., 2009). In a typical hybridisation reaction
biotinylated baits are hybridised to the desired DNA fragment, and are then captured by
binding to streptavidin beads (Gnirke, et al., 2009). The targeted sequences that have
been hybridised to the driver baits are then released by denaturation with hydroxide, and
amplified and sequenced using a second-generation platform (Mamanova, et al., 2010).
The efficiency of the capture system is commonly expressed as x-fold enrichment in target
DNA.
Unfortunately, for reasons unknown, enrichment rates for different samples using the
same experimental conditions often differ, sometimes dramatically. Enrichment rates vary
particularly when targeting mtDNA, where rates have been shown to vary from 22- to 2217-
fold (Enk, et al., 2013). Parameters that may influence enrichment efficiency include the
enzymes and chemistry used, sequence similarity between the baits and target, depth of
bait tiling, and hybridisation and washing temperatures (Avila-Arcos, et al., 2011, Bodi, et
al., 2013, Li, et al., 2013). Work by Li et al. 2013 showed that for MYcroarray’s MYbaits™
in-solution capture system, a gradual decrease in hybridisation temperature (touchdown)
significantly improved capture efficiency (Gnirke, et al., 2009). Pajimans et al. (Paijmans,
et al., 2015) also showed the importance of hybridisation temperature when dealing with
different sample types.
Egypt is rich in ancient cultural practices, the study of which would benefit greatly from
successful analyses of DNAs from flora and fauna known to be important in a number of
68
ancient Egyptian traditions. The Sacred Ibis was revered in ancient Egypt to such an extent
that they were mummified in their millions as offerings to the Gods. In this pilot study we
attempt to retrieve complete mitochondrial genomes from ancient mummified Sacred Ibis
tissue. Previous studies with Egyptian mummified animal samples (Hekkala, et al. 2011;
Khairat, et al. 2013); showed that the amount of endogenous DNA in tissues was
extremely low, precluding significant analyses. In this work we use targeted hybridization
to extract endogenous Sacred Ibis mitochondrial DNA, and varied a number of parameters
using MYcroarray’s MyBaits™ in-solution capture RNA hybridisation baits to enhance the
retrieval of selected DNAs from modern (blood and feathers) and ancient Egyptian
mummified Sacred Ibis bone, tissue, and feathers.
Material and Methods
Sacred Ibis samples
Samples were collected for research purposes from the main Sacred Ibis catacombs at
Saqqara, Tuna El-Gebel, and Sohaj (Table 1, figure 1a) with permission from the Ministry
of State for Antiquities, Egypt. Further Sacred Ibis samples were obtained from a number
of museums (Table 1). The age of the ancient samples ranged between c.450 and 250 cal
BC (Wasef, et al., 2015). In addition, fresh blood and feather samples were sourced from
wild Sacred Ibis populations from the geographic distribution across Africa (Table 1, Figure
1b).
69
(1-a)
Figure 4-1 (a): The location of archeological (catacomb) sites in Egypt from which ancient Sacred Ibis mummified
material was sampled.
70
DNA extraction
Ancient Sacred Ibis samples were processed in accordance with requirements for handling
ancient DNA as outlined by Knapp et al. (2012). For Sacred Ibis samples collected from
Egyptian catacombs (Table 1) preliminary DNA extractions were carried out at an ancient
DNA facility at Al Kasr Al Ani Medical School in Cairo, Egypt, while Sacred Ibis samples
obtained from museum collections (Table 1) were extracted for DNA at the ancient DNA
Figure 4-2 (b): The collection locations of modern feather and blood samples from the wild Sacred Ibis
populations indicated with (red star).
(1-b)
71
Laboratory facility at Griffith University, Brisbane, Australia. Ancient bone samples were
initially treated with 10% bleach and then 80% alcohol to remove surface contamination.
The outer layer was then removed and the remaining bone fragment was shaved with a
scalpel and homogenised into fine powder. Approximately 50 mg of bone powder was
digested in 600 μL of extraction buffer (0.45 M EDTA, 0.5% N-lauryl sarcosine, 1 mg/mL
proteinase K and 20 uL of 1 M DTT) overnight at 560C with rotation. The residual bone
powder was pelleted by centrifugation and the DNA in the supernatant was extracted
several times with buffer-equilibrated phenol (pH 7.5) and then chloroform. 10 volumes
of PB buffer (Qiagen) was then added to the extract (Dabney, et al., 2013) and the DNA
was purified using Qiagen DNeasy Blood & Tissue columns, as recommended by the
manufacturer. Purified DNA was then eluted from the column using 50 to 70 μL of ultra-
pure water.
For ancient toe pads, soft tissue, and feathers samples, were sliced with a scalpel to
increase surface area exposed to the extraction buffer. To those samples we added 200
uL of SET buffer, 40 uL of 10% SDS, 20 uL of 20 mg/ml Proteinase and 20 uL of 1 M DTT.
Samples were incubated at 56 0C, overnight with rotation, until completely digested. The
extract was then purified following the same steps as for ancient bone. Final DNA
concentrations and sizes were determined using a Qubit® 2.0 Fluorometer and a
Bioanalyzer 2100 (Agilent Technologies, Palo Alto, CA, US) respectively.
For Sacred Ibis blood and feather samples, either 5 uL of blood or 1–3 feather calami were
incubated on a rotator overnight at 560C in 200 uL of SET buffer containing 20 uL of 10%
SDS, 20 uL of 20 mg/mL proteinase K, and 20 uL of 1 M DTT. The mix was then extracted
with an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1), and then
chloroform, and finally purified using a Qiagen DNeasy Blood & Tissue Kit and MinElute
column as outlined by the manufacturer.
72
Table 4-1 Sacred Ibis samples. Details of the location, tissue type and estimated ages of both modern and ancient
Sacred Ibis samples are shown.
Sample Estimated
Age
Sample type Provenance Source
TG_B6 Between
c.450 and
250 cal BC
Bone Tuna el Gebel-
Egypt
Sacred Ibis
catacomb,
Tuna el-
Gebel
BM_L1_35750 Tissue Thebes- Egypt British
Museum
collection
BM_L2_35750 Bone Thebes- Egypt British
Museum
collection
BM_L4_35481 Feather+Tissue Thebes- Egypt British
Museum
collection
BM_L5_35475 Tissue Thebes- Egypt British
Museum
collection
TG_B29 Bone Tuna el Gebel-
Egypt
Sacred Ibis
catacomb,
Tuna el-
Gebel
BM4_35475 Tissue Thebes- Egypt British
Museum
collection
BM5_35479 Bone Thebes- Egypt British
Museum
collection
L5_KomOmbo Bone Kom Ombo-
Egypt
Musée des
Confluences,
Lyon, France
L8_Roda Bone Rodah- Egypt Musée des
Confluences,
Lyon, France
SG_F2 Feather Abydos- Egypt Sacred Ibis
catacomb,
Abydos
SG_F3 Bone Abydos, Egypt Smithsonian
institute
SG_L1 Toe pad Abydos, Egypt Sacred Ibis
catacomb,
Abydos
SG_L2 Bone Abydos, Egypt Sacred Ibis
catacomb,
Abydos
73
Illumina sequencing library preparation
For modern DNA: DNA from fresh blood was sheared using a Covaris AFA to between 500
to 700 bp and used to construct sequencing libraries with a NEBNext® DNA Library
Preparation Kit (E6070) from New England Biolabs (NEB) following the manufacturer’s
instructions. Illumina sequencing libraries were constructed from feather DNA using a
NEBNext® UltraTM DNA Library Prep Kit (E7370; NEB) as described by the manufacturer.
Briefly, 22 ul of DNA extract was made blunt-ended and A-tailed, then purified using a
Qiagen Minelute column (Qiagen, Hilden, Germany). The hairpin NEBNext® Illumina
Adaptor (5´-/Phos/GAT CGG AAG AGC ACA CGT CTG AAC TCC AGT C/U/A CAC TCT TTC CCT
ACA CGA CGC TCT TCC GAT C*T-3´) was then ligated to the A-tailed DNA. The Uracil base
was removed from the hairpin adapter with USERTM enzyme (NEB) and the resulting
libraries were amplified by PCR for 15 – 22 cycles using Phusion® High-Fidelity PCR
Master Mix in GC Buffer (NEB) with a NEBNext Universal PCR Primer and an Illumina
multiplex index primer (5’-CAA GCA GAA GAC GGC ATA CGA GAT NNN NNN GTG ACT GGA
GTT C, where Ns represent the index sequence). Amplified libraries were initially checked
by agarose gel electrophoresis then purified using Agencourt AMPure XP beads and
South Africa TA11 Fresh Blood Lake
Zeekoeivlei
South Africa
South Africa TA12 Blood Lake
Zeekoeivlei
South Africa
South Africa TA21 Blood Robben
Island
South Africa
South Africa TA24 Blood Robben
Island
South Africa
South Africa TA26 Blood Robben
Island
South Africa
Kenya_F1 Feather Kenya (near
Equator)
Mount Kenya
Safari Club,
Kenya_F3 Feather Kenya (near
Equator)
Mount Kenya
Safari Club,
Kenya_F4 Feather Kenya (near
Equator)
Mount Kenya
Safari Club,
Kenya_F5 Feather Kenya (near
Equator)
Mount Kenya
Safari Club,
Kenya_F6 Feather Kenya (near
Equator)
Mount Kenya
Safari Club,
Kenya_F7 Feather Kenya (near
Equator)
Mount Kenya
Safari Club,
74
visualized by Bioanalyzer 2100.
For ancient DNA: Ancient DNA Illumina sequencing libraries were constructed using a
NEBNext® DNA Library Preparation Kit with modifications proposed by Meyer and Kircher
(Meyer and Kircher, 2010). A solution of 22 ul of ancient DNA was end repaired for 30
mins at 37°C then purified using a Qiagen Minelute column with 10 volumes of Qiagen PN
or PB buffer and finally eluted in 18 uL of ultrapure water. 17 uL of the end repaired DNA
was then ligated to blunt-end Illumina specific adapters (P5F, 5’-
A*C*A*C*TCTTTCCCTACACGACGCTCTTCCG*A*T*C*T; P5+P7.R, 5’-
A*G*A*T*CGGAA*G*A*G*C; P7F, 5’-
G*T*G*A*CTGGAGTTCAGACGTGTGCTCTTCCG*A*T*C*T) in a 30 uL reaction and
incubated for 25 mins at 200C. Libraries were then purified using Qiagen Minelute
columns and 5 volumes of PB buffer. Adapter fill-in reactions were carried out with BstI
polymerase in a final volume of 25 uL. The mix was incubated for 20 min at 65°C, before
the BstI was heat inactivated at 80°C for 20 min. The ancient DNA Illumina libraries were
then amplified in a 50 uL PCR reaction using 15 uL of the library template and the same
primers as for modern DNA libraries. Amplifications were carried out using either Phusion®
High-Fidelity PCR Master Mix in GC Buffer (NEB) for 20 to 22 cycles or KAPA HiFi Uracil+
polymerase Master Mix (KAPABiosystems) for 10 to 17 cycles. Amplified libraries were
purified using 1 x Agencourt AMPure XP beads and then analysed using a Bioanalyzer
2100.
75
Target capture hybridisation:
A MYcroarray MyBaits™ in-solution capture system was used to recover complete
mitochondrial genomes from 9 modern and 14 ancient samples. Capture Baits to the
complete Sacred Ibis mitochondrial genome were designed as 80-mer biotinylated RNAs
with 5 base overlaps by MYcroarray. Approximately 100 – 500 ng of amplified Illumina
library was denatured and then hybridised to adapter blocking primers. The blocked library
was then hybridised to the single-stranded RNA baits at constant temperature; for modern
samples we tested 65°C and 60°C, while for the ancient samples we tested more varied
temperatures (45°C, 55°C, 57°C or 65°C). Incubation was carried out for 2 -3 days before
being bound to magnetic streptavidin beads. The beads were washed with buffer to
remove non-specifically bound DNAs and the captured DNA was eluted from the RNA baits
with 100 mM NaOH and then neutralized with 1 M Tris-Cl pH 8.0. Finally, the DNA was
purified using a Qiagen MinElute column before amplification.
Illumina second generation sequencing
Indexed libraries were purified using 1 x Agencourt AMPure XP beads, then quantified and
visualized using a Bioanalyzer 2100. 3 to 6 Libraries were then pooled together in
equimolar amounts and sequenced using either an Illumina MiSeq sequencer at Griffith
University, Brisbane, Australia, or sequenced as single-end reads for 100 cycles using a
single lane of an Illumina HiSeq2000 at the Danish National High-Throughput DNA
Sequencing Facility in Copenhagen, Denmark.
NGS data processing
Sequence reads were initially analysed using the fastx toolkit V0.0.13. Reads shorter than
25 bases and adapter sequences were removed, and low quality bases were trimmed.
Following these initial analyses, reads were aligned to the Sacred Ibis mitochondrial
reference genome (GenBank accession number: NC 013146.1) using BWA V0.6.2-r126
(Li and Durbin, 2009). SAMtools (Li and Durbin, 2009) was used to extract data, index,
sort, and view output files. Qualimap (Okonechnikov, et al., 2015) was used to assess
alignment quality. The presence of endogenous ancient DNA was determined by using
mapDamage2.0 (Jonsson, et al., 2013), to measure the introduced specific nucleotide
misincorporations and DNA fragmentation post-mortem using next-generation sequencing
76
reads mapped against a reference genome (figure 3) . Each sequence read was directly
aligned with the reference genome. The consensus genome sequences as well as the
coverage statistics were deduced using the grand alignment including all mapped
sequence reads. To construct population phylogeny, complete genomes were aligned
using the program Muscle embedded in the MEGA 6.06 software (Tamura, et al., 2013).
TG.B29
TG. B6
Kom Ombo
Roda
BM. L2
77
Figure 4-3 Nucleotide misincorporation patterns observed on the Sacred Ibis ancient libraries. Damage is represented
by observed 3' guanine to adenine substitutions (G>A; blue) and 5' cytosine to thymine substitutions (C>T; red).
Results and Discussion
Pre-capture Results
Using a DNA extraction method (Dabney, et al., 2013) and library building protocol specific
for ancient DNA (Meyer and Kircher, 2010), we reconstructed 14 ancient and 11 modern
second generation sequencing DNA libraries from various Sacred Ibis tissues. Initial
shotgun sequencing of these libraries showed that modern feather DNA harboured the
most endogenous mitochondrial DNA (x̄ = 0.04%; calculated as percentage of unique
sequences versus total number of reads) followed by ancient toe pad (x = 0.01%), ancient
feather and bone, and modern blood (x̄ = 0.002%), and finally ancient soft tissue (x̄=
BM. L1
SG. F3
SG. F2
78
0.0002%). The low amount of endogenous mitochondrial DNA detected in modern blood
is likely to be due to the low mitochondrial DNA copy number in avian blood (approximately
one mitochondrial genome per nuclear genome, compared to that of bone and feathers at
approximately 100 mitochondrial genomes per nuclear genome – results not shown). DNA
length varied significantly amongst the ancient samples, with DNA from bone averaging
63 ± 16 bp, soft tissue averaging 45.2 ± 1.1 bp, and single toe pads and feathers being
44.9 and 53.9 bp respectively. Average read length for modern feather was shown to be
103.5 ± 7.4 bp, suggesting that initial DNA degradation is likely to be the result of rapid
endonuclear digestion followed by slow exonuclear ‘nibbling’. Duplicates varied
considerably amongst ancient tissues from 3.03% to 89.26% with no significant
differences noted between the various tissues. Modern feathers were shown to have the
least number of duplicates at 10.6 ± 9.6%, while modern blood had an unexpectedly high
level of duplicates at 82.4 ± 38.6%. The reason for fresh blood having such a high level of
duplicates is unclear but may be due to the relatively high concentration of DNA in the
amplification reaction driving the formation of DNAs with high secondary structures
resistant to amplification. Biases in duplicate amplification also appear to be influenced
by the polymerase used. Libraries amplified using KAPA HiFi Uracil+ have been shown to
display clearer damage and fragmentation patterns characteristic of endogenous ancient
DNA (figure3) (Jonsson, et al., 2013). In addition, we show that pre-capture amplification
using KAPA HiFi Uracil+ polymerase resulted in the production of more unique sequences
as well as more duplicates (table 2) than when Phusion® High-Fidelity polymerase was
used.
Capture Results
Due to the limitation of the numbers of ancient samples available for analysis as well as
the sequencing costs involved, we could not compare the effects of different parameters
using the same sample sets. Hence we compared the simultaneous effects of different
parameters (Phusion® High-Fidelity polymerase or KAPA HiFi Uracil+ polymerase) and
different hybridisation temperatures (550C-650C) on the enrichment of the endogenous
DNA using different samples. However, the levels endogenous DNA in different ancient
samples before enrichment (using direct sequencing) was not statistically different
between the sets of samples compared (P=0.051). This suggests that there is no sample
specific bias in the levels of ancient Sacred Ibis DNA.
79
Target capture enrichment rates. Enrichment rates were determined for each sample by
calculating the percentage of the unique (non-clonal) sequences aligned to the Sacred Ibis
mitochondrial reference genome; pre- and post- capture hybridisation enrichment (table
2). We found that regardless of the sample type used, the library build method or the
hybridisation temperature, there was an increase in the unique endogenous content of the
captured libraries in comparison to the shotgun-sequenced counterpart libraries (table 2).
Figure 4-4 Optimisation of enrichment for ancient Sacred Ibis mitochondrial DNA. All libraries were constructed using a
NEBNext kit with modifications by Meyer and Kircher (2010). Mean fold enrichment with Std. error are shown for ancient
Sacred Ibis DNA hybridised using the following conditions: A. Hybridisation at 450C; amplified using Phusion polymerase;
Sequencing performed on HiSeq2000. B. Hybridisation at 550C; amplified using Phusion polymerase; Sequencing
performed on HiSeq2000. C. Hybridisation at 570C; amplified using KAPA HiFi polymerase; Sequencing performed on
MiSeq. D. Hybridisation at 650C; amplified using Phusion polymerase; Sequencing performed on MiSeq.
For ancient DNA a significant difference in enrichment efficiency was found to be
dependent on the polymerase used. The polymerase KAPA HiFi Uracil+ enriched between
54 x - 4705 x requiring only 26 – 37 cycles, while enrichment using Phusion® High-Fidelity
45°C 55°C 57°C 65°C
Mean (x) enrichment 25 21 960.6 0.64
Std. error 0 5.32 749.9 0.35
80
PCR Master Mix in GC Buffer (NEB) resulted in only 0.3 – 38 x enrichment and required up
to 41 cycles. For fresh samples, DNA from feathers showed enrichment rates between 5 x
to 98 x, while DNA from blood showed enrichment rates between 23 x to 542 x.
Interestingly, in accordance with observations made by Carpenter et al. 2013 and Enk et
al. 2014, we found that with modern samples; the lower the initial endogenous content of
the sample, the higher the enrichment rate
achieved.
Figure 4-5 Mean fold enrichment and Std. error are shown for
modern Sacred Ibis mitochondrial DNA. Hybridised using the
following conditions: A. Hybridisation at 600C; libraries from
feather samples were constructed using a NEBNext Ultra kit
and amplified using Phusion polymerase; Sequencing was
performed on a MiSeq. B. Hybridisation at 650C; libraries from
blood samples were constructed using a NEBNext kit and
amplified using Phusion polymerase; Sequencing was
performed using a HiSeq2000.
Mean read length. A MYcroarray MyBaits™ in-solution capture system was used to enrich
for Sacred Ibis mitochondrial DNA. 80-mer biotinylated RNA baits were used with a 5 base
tiling depth. To test for the efficiency of the bait length and tiling system to capture different
sized DNAs, we looked at the mean read length variations after capture. By comparing the
insert size of the ancient and modern pre-capture sequences to their equivalent post-
capture sequences (Supplementary table I), we found a slight increase in the mean read
length of the unique sequences for most samples (1.2 fold). Those results are consistent
with the previous observations (Carpenter et al. 2013; Enk et al. 2014).
Hybridisation Temperature. In addition to using a hybridisation temperature of 65˚C, as
recommended by the manufacturer, we also tested enrichment efficiencies at 45˚C, 55˚C,
and 57˚C. All post-capture washes were carried out at the same temperature as the
hybridisation temperature. Enrichment rates were calculated for each sample by
comparing the percentage of unique Sacred Ibis mitochondrial sequences pre- and post-
enrichment (Table 2). A hybridisation and washing temperature of 65˚C (figure 5) was
shown to result in greater enrichment of modern mitochondrial DNA (x̄= 199 fold) when
81
compared to ancient DNA. This is possibly due to the longer DNA fragments present in
modern DNA (ancient mitochondrial DNA fragment length, x̄ = 45; modern mitochondrial
DNA fragment length, x̄ = 90). In contrast to results published by Paijmans et al. (2015),
we show that the best enrichment temperature for ancient DNA was 57˚C (Figure 4), with
enrichment rates between 54 x to 4705 x, resulting in up to 121 x coverage of the Sacred
Ibis mitogenome (Table 2) (supplementary table I, figure I). Further enrichment may be
achieved using a touchdown hybridisation temperature regime, shown to be effective by
Li et al., 2013.
Clonality after capture. The duplicate sequence percentages were calculated for the
modern and ancient samples from the total mapped reads. In this study, we found that
with ancient samples as well as modern feather samples, post-capture libraries had higher
clonality than pre-capture libraries (Figure 5, 6). Whereas, the clonality for blood samples
remain the same after captures, possibly due to the high hybridisation temperature. We
(A)
(B)
Figure 4-6 Figure 4-7 %Clonality for Modern (A) and Ancient (B) Sacred Ibis libraries. The bars represent the %
clonality pre-capture shotgun sequenced libraries (DS) vs. %Clonality after target capture for the same libraries (TC).
82
also found the lower the endogenous content of the ancient pre-capture libraries; the
higher the clonality becomes post-capture. This increase in clonality percentage is almost
certainly due to the loss of sequences during the washes, as more amplification cycles
were required post-capture.
Conclusion
The feasibility of retrieving authentic and informative DNA sequences from ancient
materials originating from the hot and humid climate of Egypt has been intensively
debated (Gilbert, et al., 2005). We show that it is possible to retrieve significant amounts
of endogenous DNA from ancient Sacred Ibis mummified material from deep within
Egyptian catacombs. This is particularly surprising because Egyptian animal mummies in
general were not mummified with the same care and attention shown towards royal or
other human mummies.
We show that in addition to this work, recent advances in ancient DNA extraction and
library building can result in the successful retrieval of ancient DNA from a number of
Egyptian tissues such as bone, feather, tissue, and toe pad. Our results show that for highly
contaminated and fragmented Egyptian ancient DNA, a combination of parameters,
including the use of a modified DNA extraction method (Dabney, et al., 2013), an efficient
ancient DNA library building protocol (Meyer and Kircher, 2010), the polymerase KAPA HiFi
Uracil+, and a hybridisation temperature of 57˚C it was possible to achieve up to 4705 x
enrichment of targeted DNA.
Sacred Ibis mitochondrial DNA was enriched using the MYbaits enrichment protocol. We
examined the significance of temperature as a main, but not sole, parameter to maximise
the recovery of endogenous DNA from the contaminant sequencing pool. The results show
that the percentage of target unique sequences was significantly influenced by minor
changes of the hybridisation conditions as well as both the after capture wash temperature
and the sample in use (i.e modern or ancient). Post capture temperature was always kept
the same as the hybridisation temperature in use to maintain a higher stringency when
washing away the contaminant sequences. For ancient Egyptian samples, hybridisation at
57˚C, lower than the recommended 65˚C, appears ideal. This lower temperature allowed
more on-target specificity for fragmented and damaged sequences. However, dropping the
hybridisation temperature too low to be at 45˚C, had led to the loss of selectivity of the
baits toward the Sacred Ibis mitogenome. In contrast, Sacred Ibis samples such as blood
and feathers, where modern DNA is more preferentially hybridised by the baits than the
83
adjoining exogenous sequences, higher temperatures such as 60˚C or 65˚C is preferred.
Thus, decreased hybridisation temperatures may be beneficial for ancient samples but are
not recommended for modern samples.
Acknowledgements.
We are grateful to Human Frontier Science for financial support in the form of grant to PIs,
Lambert, Ikram, Holland, and Willerslev. We are also grateful to The Danish National High-
Throughput DNA Sequencing Centre for sequencing the samples. We thank Manaasa
Raghavan and Morten Rasmussen for help with Illumina library construction methods. We
are grateful to Greg Baillie for advice regarding DNA extraction. We are thankful to Doug
Harebottle for collecting the blood samples from SA; Clive Richard Barlow for collecting the
feathers from Gambia; and SI for collecting feathers from Kenya. SW is really appreciative
to the Ministry of Antiquities for permitting ancient samples collection from the catacombs;
also to Al Kasr Al Ani medical school for allowing her to use the ancient DNA laboratory. A
number of museums kindly provided material for this study including: The British Museum,
The Ancient Egyptian Animal Bio Bank at Manchester Museum, Manchester, UK, especially
Dr. Lidija M. McKnight and the Musée des Confluences, Lyon, France, particularly
Stephanie Porcier. SW thanks Griffith University for a PhD scholarship and DML and SW
thank the Environmental Futures Research Institute and Griffith University for additional
support.
84
Table 4-2 Description of data generated using the Modern and Ancient Sacred Ibis samples showing; Shotgun sequencing results for unique mitochondrial endogenous content, coverage
and clonality; The target capture hybridisation results for unique mitochondrial sequences, coverage, enrichment and clonality. ‘Total reads’ refers to the sequence data generated
before aligning to the Sacred Ibis mitochondrial genome. ‘Unique’ refers to the fraction of mapped mitochondrial reads after removing the clonal sequences. The enrichment rate (x fold)
is calculated by dividing the % of unique endogenous mitochondrial sequences after capture by the total number of shotgun sequences. Since, the nuclear reference modern Ibis genome
is not available, we could only calculate the levels using the known Sacred Ibis mitogenome. Hence the nuclear reads in the raw data could not be included in calculating the endogenous
DNA levels.
Shotgun sequencing Target capture
Unique
enrichem
ent (x)
Method
Total
No.
cycles Sample
Total
reads
(Millions)
Unique
mapped
Clonality
(%)
Mean
read
lengt
h
Mean
coverag
e
Total
reads
(Million
s)
Unique
mapped
Clonality
(%)
Mean
read
lengt
h
Mean
coverage
Temp.
(˚C)
1. Sacred Ibis ancient samples
TG_B6 47,4 22 4 60.1 0.06 60,2 701 96 73.8 1.94 45 25
Ph
usi
on
41
BM_1_357
50 30,5 68 7 44.4 0.16 32,6 1,301 97 46.6 3.29 55 18 41
BM_2_357
50 27,9 13 19 49.9 0.04 27,6 346 96 53.4 0.9 55 27 41
BM_4_354
81 23,8 13 13 49.9 0.04 28,2 582 95 64.9 1.58 55 38 41
BM_5_354
75 17,68 32 3 45.9 0.07 16,6 212 99 53.3 0.53 55 7 41
TG_B29 20,7 377 11 45.6 0.86 20,8 5,668 97 47.7 14.05 55 15 41
BM4_3547
5 7,54 17 35 45.9 0.07 3,8 1,108 81 77.6 3.34 57 127.4
Kap
a H
iFi
30
BM5_3547
9 20,6 793 6 66.6 2.35 0,84 11,401 86 73.3 37.62 57 354 32
KomOmbo 6,2 238 89 77.8 0.63 0,91 8,781 97 75.9 22.86 57 250 36
85
Roda 2,3 36 68 90 0.09 5,7 4,810 96 69.3 13.83 57 54 29
SG_F2 63,61 1,177 65 53.9 4.13 5,2 23,361 99 92.3 121.88 57 242 27
SG_F3 61,5 144 67 67.7 0.57 1,9 21,063 99 87 82.63 57 4705 27
SG_L1 22,8 2,236 51 44.9 5.61 13,3 962 99 43 2.73 65 1 Phusion
41
SG_L2 6,75 2,870 38 45.6 6.84 26,1 3,249 99 46.2 10.4 65 0.29 41
2. Sacred Ibis Modern Samples
TA11 11,8 98 100 59.9 0.51 18,2 9,510 100 89.9 55.15 65 63
Illu
min
a 4
54
lib
rary
wit
h P
hu
sio
n
39
TA12 33,3 59 100 53.1 0.29 35,4 19,936 100 89.9 116.81 65 318 39
TA21 206,2 6,663 13 93.2 36.43 21,5 15,899 100 91.8 92.75 65 23 39
TA24 46,3 58 99 50.6 0.26 22,2 15,129 100 88.7 88.05 65 542 39
TA26 7,06 28 100 73.3 0.11 21,2 4,207 100 89.1 23.49 65 50 39
Kenya_F1 5,6 1,900 13 110.9 12.59 6,5 31,331 98 116.5 259.22 60 14
Ult
ra K
it w
ith
Ph
usi
on
36
Kenya_F3 0,75 1,034 6 92.1 6.1 3,5 26,489 99 100.5 206.06 60 5 36
Kenya_F4 2,3 677 5 103.6 3.86 4,5 25,102 96 108.5 193.3 60 19 36
Kenya_F5 1,6 25 4 100.3 0.1 2,4 3,673 84 105.9 24.42 60 98 36
Kenya_F6 1,5 780 29 102 4.1 3,6 28,280 98 112.7 232.89 60 16 36
Kenya_F7 1.55 956 7 112.1 6.62 2,6 29,507 96 117.3 243.32 60 18 36
86
References
Avila-Arcos, M. C., Cappellini, E., Romero-Navarro, J. A., Wales, N., Moreno-Mayar, J.
V., Rasmussen, M., . . . Gilbert, M. T. (2011). Application and comparison of
large-scale solution-based DNA capture-enrichment methods on ancient
DNA. Sci Rep, 1, 74. doi:10.1038/srep00074
Bodi, K., Perera, A. G., Adams, P. S., Bintzler, D., Dewar, K., Grove, D. S., . . . Zianni,
M. (2013). Comparison of commercially available target enrichment methods
for next-generation sequencing. J Biomol Tech, 24(2), 73-86.
doi:10.7171/jbt.13-2402-002
Briggs, A. W., Good, J. M., Green, R. E., Krause, J., Maricic, T., Stenzel, U., . . . Kućan,
Ž. (2009). Targeted retrieval and analysis of five Neandertal mtDNA genomes.
Science, 325(5938), 318-321.
Cramp, S. (1977). Handbook of the Birds of Europe, The Middle East and North
Africa. The Birds of the Western Palearctic. 1, 1-687.
Dabney, J., Knapp, M., Glocke, I., Gansauge, M. T., Weihmann, A., Nickel, B., . . .
Meyer, M. (2013). Complete mitochondrial genome sequence of a Middle
Pleistocene cave bear reconstructed from ultrashort DNA fragments. Proc
Natl Acad Sci U S A, 110(39), 15758-15763.
doi:10.1073/pnas.1314445110
Enk, J., Rouillard, J. M., & Poinar, H. (2013). Quantitative PCR as a predictor of
aligned ancient DNA read counts following targeted enrichment.
Biotechniques, 55(6), 300-309. doi:10.2144/000114114
Fu, Q., Meyer, M., Gao, X., Stenzel, U., Burbano, H. A., Kelso, J., & Paabo, S. (2013).
DNA analysis of an early modern human from Tianyuan Cave, China. Proc Natl
Acad Sci U S A, 110(6), 2223-2227. doi:10.1073/pnas.1221359110
Gansauge, M. T., & Meyer, M. (2013). Single-stranded DNA library preparation for
the sequencing of ancient or damaged DNA. Nat Protoc, 8(4), 737-748.
doi:10.1038/nprot.2013.038
Gilbert, M. T., Barnes, I., Collins, M. J., Smith, C., Eklund, J., Goudsmit, J., . . . Cooper,
A. (2005). Long-term survival of ancient DNA in Egypt: response to Zink and
Nerlich (2003). Am J Phys Anthropol, 128(1), 110-114; discussion 115-118.
doi:10.1002/ajpa.20045
87
Gnirke, A., Melnikov, A., Maguire, J., Rogov, P., LeProust, E. M., Brockman, W., . . .
Nusbaum, C. (2009). Solution hybrid selection with ultra-long
oligonucleotides for massively parallel targeted sequencing. Nat Biotechnol,
27(2), 182-189. doi:10.1038/nbt.1523
Hekkala, E., Shirley, M. H., Amato, G., Austin, J. D., Charter, S., Thorbjarnarson, J., . .
. Blum, M. J. (2011). An ancient icon reveals new mysteries: mummy DNA
resurrects a cryptic species within the Nile crocodile. Mol Ecol, 20(20), 4199-
4215. doi:10.1111/j.1365-294X.2011.05245.x
Ikram, S. (2005). Divine Creatures: Animal Mummies in Ancient Egypt. Cairo:
Amercain University in Cairo Press.
Jonsson, H., Ginolhac, A., Schubert, M., Johnson, P. L., & Orlando, L. (2013).
mapDamage2.0: fast approximate Bayesian estimates of ancient DNA
damage parameters. Bioinformatics, 29(13), 1682-1684.
doi:10.1093/bioinformatics/btt193
Khairat, R., Ball, M., Chang, C. C. H., Bianucci, R., Nerlich, A. G., Trautmann, M., . . .
Pusch, C. M. (2013). First insights into the metagenome of Egyptian
mummies using next-generation sequencing. Journal of applied genetics,
54(3), 309-325. doi:10.1007/s13353-013-0145-1
Knapp, M., & Hofreiter, M. (2010). Next Generation Sequencing of Ancient DNA:
Requirements, Strategies and Perspectives. Genes (Basel), 1(2), 227-243.
doi:10.3390/genes1020227
Kurushima, J. D., Ikram, S., Knudsen, J., Bleiberg, E., Grahn, R. A., & Lyons, L. A.
(2012). Cats of the Pharaohs: Genetic Comparison of Egyptian Cat Mummies
to their Feline Contemporaries. J Archaeol Sci, 39(10), 3217-3223.
doi:10.1016/j.jas.2012.05.005
Li, C., Hofreiter, M., Straube, N., Corrigan, S., & Naylor, G. J. (2013). Capturing protine-
coding genes across highly divergent species. Biotechniques, 54, 321-326.
Li, H., & Durbin, R. (2009). Fast and accurate short read alignment with Burrows-
Wheeler transform. Bioinformatics, 25(14), 1754-1760.
doi:10.1093/bioinformatics/btp324
Mamanova, L., Coffey, A. J., Scott, C. E., Kozarewa, I., Turner, E. H., Kumar, A., . . .
Turner, D. J. (2010). Target-enrichment strategies for next-generation
sequencing. Nat Methods, 7(2), 111-118. doi:10.1038/nmeth.1419
88
Maricic, T., Whitten, M., & Paabo, S. (2010). Multiplexed DNA sequence capture of
mitochondrial genomes using PCR products. PLoS One, 5(11), e14004.
doi:10.1371/journal.pone.0014004
Meyer, M., & Kircher, M. (2010). Illumina sequencing library preparation for highly
multiplexed target capture and sequencing. Cold Spring Harb Protoc,
2010(6), pdb.prot5448. doi:10.1101/pdb.prot5448
Okonechnikov, K., Conesa, A., & Garcia-Alcalde, F. (2015). Qualimap 2: advanced
multi-sample quality control for high-throughput sequencing data.
Bioinformatics. doi:10.1093/bioinformatics/btv566
Paijmans, J. L., Fickel, J., Courtiol, A., Hofreiter, M., & Forster, D. W. (2015). Impact
of enrichment conditions on cross-species capture of fresh and degraded
DNA. Mol Ecol Resour. doi:10.1111/1755-0998.12420
Tamura, K., Stecher, G., Peterson, D., Filipski, A., & Kumar, S. (2013). MEGA6:
Molecular Evolutionary Genetics Analysis version 6.0. Mol Biol Evol, 30(12),
2725-2729. doi:10.1093/molbev/mst197
Wasef, S., Wood, R., El Merghani, S., Ikram, S., Curtis, C., Holland, B., . . . Lambert, D.
M. (2015). Radiocarbon dating of Sacred Ibis mummies from ancient Egypt.
Journal of Archaeological Science: Reports, 4, 355-361.
doi:10.1016/j.jasrep.2015.09.020
89
5. Chapter Five: Mitogenomics of Sacred Ibis mummies:
Understanding their farming in ancient Egypt
Sally Wasefa,f, Sankar Subramaniana, Leon Huynena, Craig D. Millarb, Caitlin Curtisa,
Samia El-Marghanic, Barbara Hollandd, Salima Ikrame, Eske Willerslevg, David M.
Lamberta1,
aEnvironmental Futures Research Institute, Griffith University, 170 Kessels Road,
Nathan, QLD 4111 Australia. bAllan Wilson Centre for Molecular Ecology and
Evolution, School of Biological Sciences, University of Auckland, Private Bag 92019,
Auckland 1142, New Zealand. dSchool of Mathematics and Physics, University of
Tasmania, Sandy Bay Campus, 7005, Hobart, Australia. eDepartment of Sociology,
Anthropology, Psychology, and Egyptology, American University in Cairo, Cairo, Egypt.
fAncient DNA laboratory, Learning Resource Center, Kasr Al-Ainy Faculty of Medicine,
Cairo University, Egypt. gCentre for GeoGenetics, University of Copenhagen,
Denmark.
Edited by ….
Author contributions: D.M.L., C.D.M. and E.W. designed the research; S.W. and L.H.
performed the research; S.W., S.S. and D.M.L. analysed data; S.W, S.S., C.C.
contributed new reagents / analytic tools; S.W, S.E.M. and S.I collected the ancient
samples; S.I. and C.C. acquired modern museum samples; S.W., D.M.L., C.D.M.,
wrote the paper, with input from all authors
The authors declare no conflict of interest.
This article is a PNAS Direct Submission.
Data deposition: Contemporary and ancient mitogenomic sequences reported in this
paper have been deposited in GenBank (accession nos. XXXX).
1 To whom correspondence may be addressed: E-mail [email protected]
90
This article contains supporting information online at www.pnas.org
Significance
The feasibility of recovering endogenous DNA sequences from Egyptian mummies
has long been unclear. We show here that DNA capture methods, in combination
with second-generation Illumina sequencing, enables the recovery of complete
mitochondrial genomes of Sacred Ibis mummies. By comparison with mitogenomes
of modern Sacred Ibis collected from throughout the African range of the species,
we tested archaeological theories about the possible ancient farming system. Some
form of farming seems likely because the Egyptians mummified literally millions of
these birds and placed them in catacombs. Comparisons of genetic variation ancient
and modern Ibis suggests that the migrating Sacred Ibises into Egypt were collected
and directly mummified or bred for a short time in a large number of temple-based
small-scaled farms.
Abstract
Ancient catacombs throughout Egypt harbour millions of well-preserved mummified
Sacred Ibises (Threskiornis aethiopicus), the source of which has been a mystery for
thousands of years. Since the Predynastic period (7,500-5,100 yr BP) these birds
were regarded as manifestations of the Egyptian God Thoth, and were used as
offerings by pilgrims to their Gods. The demand for Sacred Ibis was so great it was
estimated that each year ~10,000 mummies were interred at one site alone. To
determine if these mummies were farmed or collected from the wild, we collected
Sacred Ibis mummies from four of the main Ibis catacombs. We then used ancient
DNA technology and targeted hybridization enrichment methods to retrieve complete
mitochondrial genomes of 14 ancient Sacred Ibis mummies together with 26
modern Sacred Ibises from nine geographically widespread African populations.
Unexpectedly, we show a remarkably high level of mitochondrial genetic variation
among ancient Egyptian Sacred Ibis, very similar to that found for all modern wild
African Ibis populations. We used these data to test the hypothesis that ancient
Egyptians farmed these birds for large-scale mummification. We found no genetic
evidence to support the existence of a single large centralised Sacred Ibis farm in
Ancient Egypt, nor for the presence of smaller localised farms. Mitochondrial
haplotype and network analyses however support the hypotheses that ancient
91
Egyptian priests maintained wild migrating Sacred Ibises probably in localised
enclosures to ensure Sacred Ibis supply in response to the year-by-year demand for
sacrificial birds.
Introduction
Despite the millions of Sacred Ibis (Threskiornis aethiopicus) mummies entombed
in the catacombs of Egypt, no modern populations of this bird remain in Egypt today.
The reason for their local extinction and the source of these remarkable bird
mummies remains unknown. Historically vast numbers of Sacred Ibises were
sacrificed to the Egyptian God Thoth as ‘votive’ offerings to either fulfil a vow made
to God, to present a request to him, or in gratitude for a granted prayer (1) (2). Other
Sacred Ibises were worshiped as sacred and represented were regarded as a divine
incarnation (1). Those sacred individuals were thought to have been reared in the
temples and upon death were subjected to elaborate mummification and burial
ceremonies (1).
Sacred Ibises were mummified in enormous quantities from the Twenty-Sixth
Dynasty (664-525 BCE) to the early Roman Period (30 BC–300 AD) when
sanctuaries dedicated to their sacrifice were scattered throughout Egypt (3). Recent
radiocarbon ages of Sacred Ibis mummies (4) have recently suggested that birds
were mummified between c.450 and 250 cal BC. Those dates fall within the Late
Period and the Ptolemaic Period. Interestingly, no samples were dated to the Roman
era (4). The massive Sacred Ibis internments in Egypt (5) have led to the suggestion
that ancient Egyptians kept and reared these birds in industrial-scale enclosures (1)
(2). This suggestion is supported by the sheer number of mummies and eggs found
in their burial places (5). Archived written material (6), as well as the inscriptions
attached to the mummies themselves (7), suggest that mummified Sacred Ibises
were likely to have been reared in captivity, tamed, but not domesticated birds.
However, to date little is known as to how exactly these sacred birds were obtained
in such large numbers. Martin, 1981, suggest that Sacred Ibises were raised next to
or within temple enclosures, while Kessler and Nur el-Din, 2005 proposed a series
of large farms located in the main cities where pilgrims would bring Sacred Ibis
mummies as offerings to Thoth temples (8). A third hypothesis proposes that small
92
groups of Sacred Ibises may have been reared from wild populations by local temple
priests (6) (9).
Present day Sacred Ibis populations are widely distributed across the African
continent and are recognized as comprising three sub-species: T. a. aethiopicus,
from the African mainland south of the Sahara, Ethiopia, and Senegal to the Cape of
Good Hope; T. a. berneri, found mainly in west Madagascar; and T. a. abboti, from
the island of Aldabra in the Seychelles (10). African Sacred Ibises migrate at the
commencement of the breeding season with birds north of the Equator typically
migrating northwards and those south of the Equator generally moving southwards
(11)
To test the hypotheses regarding the possible farming of Sacred Ibis, we recovered
material from four catacombs in Egypt. We also collected modern samples of Sacred
Ibis covering the geographic range of T. a. aethiopicus in Africa. We then used
ancient DNA technologies, combined with targeted DNA hybridisation to recover
complete mitogenomes from both ancient and modern Sacred Ibises. We used
these data to directly test the genetic predictions based on a range of scenarios
about likely farming of Sacred Ibis, for the purposes of mummification.
Despite the field of ancient genomics advancing in recent years, the recovery of
ancient DNA from mummified Egyptian material remains notoriously difficult.
Opinions vary about the authenticity of the results obtained from a number of studies
and about the general possibility of endogenous DNA surviving in Egyptian remains.
The likely rate at which DNA degrades in warm climates (12) has prompted debates
about the feasibility of recovering ancient DNA from any Egyptian mummified
remains (13). Environmental conditions such as constant high temperature and
elevated humidity, in addition to the extreme alkaline conditions (13, 14), and
factors such as the likelihood of flooding in tombs or accidental fire (15) have led to
debates over the authenticity of results using PCR-based approaches, especially
when analysing ancient Egyptian human remains (16). As a result only studies that
involved the use of mummified animal remains (17) (18) (19) have been regarded
as likely to be authentic and devoid of modern contamination (20).
Results
93
DNA was extracted from 26 modern and 40 ancient Sacred Ibis samples (Table 1).
Our data suggests that DNA may have been better preserved in Sacred Ibis feathers
and soft tissue (such as toe pads) than bone, and as a result these tissues were used
when possible. Of these ancient samples, 20 were chosen for DNA library
construction and second-generation shotgun sequencing in order to measure the
levels of endogenous DNA. Endogenous DNA yields obtained by shotgun sequencing
were typically low; ranging from only 0.0003% - 0.06% mitochondrial DNA and 0.02%
- 4.3% nuclear DNA. Due to the low amount of endogenous DNA estimated using
shotgun sequencing, DNA libraries were enriched for mitochondrial DNA by targeted
hybridisation using biotinylated 80-mer RNA baits (MYcroarray) designed to the
complete Sacred Ibis mitochondrial genome (GenBank acc. no. NC_013146.1). As a
result of using these baits, mitochondrial enrichment levels ranged from 5.3 x – 336
x, with genome coverage ranging from 1.5 x – 35 x. Of these, 14 ancient Sacred Ibis
mitochondrial genomes and 21 modern Sacred Ibis mitochondrial genomes were
chosen for further analysis. A further 5 modern Sacred Ibis mitochondrial genomes
were obtained from tissue samples by shotgun sequencing (Table 1).
Relationships between the ancient and modern Sacred Ibis mitogenomes were
determined by constructing haplotype networks with NETWORK (Figure 2).
The results (Figure 2) show that both the modern African Sacred Ibis populations and
ancient Egyptian mummy populations were genetically diverse. Moreover,
comparison of these populations shows that they are not statistically different
(P=0.23, Table 3), suggesting that the ancient Egyptian Sacred Ibises were likely to
have been sourced from migrating African Ibis populations .
Three farming hypotheses (FH1-3) have been proposed for the production of the
large numbers of Egyptian Sacred Ibis required for sacrifice (Table 2). Briefly, these
consist of, for the sake of the argument, a single centralised Sacred Ibis farm
supplying all of Egypt’s catacombs (FH1); a few smaller farms (FH2); and a large
number of local temple based farms that count mainly for their sustainability on the
opportunistic collection of Ibises on a seasonal basis (FH3). The likely effects of
these farming methods on ancient Sacred Ibis genetic diversity are shown in Table
2, thus three distinct patterns (listed below) are expected based on these three
hypotheses. Based on Figure 2, supplementary figure 1 and Table 3 modern Sacred
Ibis populations do not show significant population structure and the inter- and intra-
population diversities suggest an almost panmictic mode of mating between them.
94
Hence we used these as a control to compare the diversity and structure of the
ancient Ibises.
For FH1: A single centralised farm is expected to result in low levels of genetic
diversity among the ancient Sacred Ibis mummies when compared with the modern
Ibises. We would also expect low diversity among samples obtained from different
catacombs (inter-catacomb diversity) as well as a low diversity within catacombs
(intra-catacombs). In contrast we would expect a higher ratio of non-synonymous-to-
synonymous diversities (dN/dS) in ancient Sacred Ibises compared to those from
modern populations, due to the accumulation of deleterious variants. Finally, a
single farming location will also result in no or very low population structure between
ancient Sacred Ibises from various catacombs.
FH2: Alternatively, the existence of a large number of small Sacred Ibis farms might
have been established from birds from different geographical locations and might
have been reared for some time. Such a scenario will result in intermediate diversity
i.e. higher than that expected for inbreeding but lower than that expected for
panmictic populations (e.g. the modern populations). In this case, we would expect
low intra-catacomb diversity due to rearing them in isolation over a significant period
of time and high inter-catacomb diversity due to their diverse ancestry. Therefore,
the sum of these two scenarios will result in a reduction in overall Sacred Ibis
diversity compared to those from the panmictic modern populations. Similarly, this
hypothesis predicts an intermediate value of dN/dS that is higher than that expected
based on panmixia and less than that is expected for inbreeding populations. The
existence of a number of small Sacred Ibis farms will also result in higher population
structure (FST) between the populations from different catacombs compared to that
of widespread modern Sacred Ibises from different locations.
FH3: The third hypothesis predicts that a large number of temple-based farms
sourced from migratory birds will possess high overall diversity and high inter-
catacomb mitogenomic diversity. In contrast this hypothesis predicts a low overall
dN/dS ratio for ancient Sacred Ibis populations and also a low population structure
similar to that of modern populations.
To test these hypotheses, we examined the overall genome diversity (p), the ratio of
non-synonymous to synonymous site diversities (dN/dS) and fixation index (FST). The
overall mitogenome diversity observed for ancient samples was not significantly
different to those of modern samples (P=0.23, Table 3). The inter-catacomb
95
diversities of ancient populations were also similar to the inter-population diversities
obtained for the modern populations. Furthermore, the dN/dS ratio estimated for
ancient mitogenomes was almost identical to that estimated for modern populations
(P=0.41). Finally, we examined the levels of population structure between the
populations from different catacombs. The FST estimated for ancient mitogenomes
revealed very low levels of structure (0.06). However, this was not statistically
different from that obtained for the modern populations (P=0.20). Together these
results support farming hypothesis FH3 (Table 3).
Molecular sexing of both ancient and modern Sacred Ibises was carried out to test
the possibility that there was a marked difference in the sex ratio of mummies that
may have been a bias in Sacred Ibis farming for one sex. If those Sacred Ibis were
farmed for mummification the results would had a strong bias towards males as they
would be preferentially chosen to be scarified first, while a bias against females that
would be retained to sustain breeding in the farms. Our results showed no significant
indication of sex bias as of the seven ancient Sacred Ibis sampled successfully
sexed, four were females and three were males. Similar results were obtained for
wild Sacred Ibis populations; sexing of 5 Kenyan samples showed 3male and 2
females, and the same ratio from 5 Gambian feather samples where we found 3
males and 2 females (P = 0.4, Fisher's exact test).
Discussion
An analysis of 14 ancient and 26 modern complete Sacred Ibis mitogenomes has
allowed us to clarify how the priests maintained sustainable annual supplies for
some of the millions of mummified Sacred Ibises entombed in Egypt’s ancient
catacombs. Comparisons of genetic variation within and among ancient and modern
Sacred Ibis populations strongly supports the farming hypothesis FH3 where there
was likely to have existed a large number of small localized temple-based farms were
likely to have existed, and which were continually supplemented by migrating
individuals from adjacent African Sacred Ibis populations. We provide three lines of
evidence for this. First the overall genomic diversity of ancient Sacred Ibises from
within as well as among catacombs were largely comparable to that recorded from
modern Sacred Ibis from different locations across Africa. It would be expected that
breeding using a small number of founding populations would likely result in low
96
diversity compared to that of modern Sacred Ibis. Second, the diversity observed at
evolutionarily constrained (non-synonymous) sites of the protein-coding genes of
ancient samples was also similar to that of contemporary Sacred Ibis populations.
In contrast we would expect a much higher diversity in ancient Sacred Ibises if they
were bred in centralised farms. Finally, we did not observe significant population
structure between the Sacred Ibis populations from different catacombs. This rules
out the third possibility that Sacred Ibises collected from different parts of Africa
were bred in small farms for a prolonged period of time. Hence the most probable
scenario is that Sacred Ibises migrating into Egypt were collected and directly
mummified or bred for a short time, before being entombed.
Some archaeological evidence suggests that Sacred Ibises were bred at a hatchery
in Saqqara, which is based on the discovery of several Sacred Ibis eggs located in a
local courtyard (5). Furthermore, it has been claimed that Sacred Ibis eggs were
collected during the Saite period from anticipated breeding sites (although to date
no such place has been discovered), as well as from wild colonies, and sent to Tuna
el-Gebel together with the wrapped mummies (9). In addition, Ikram (1), suggested
that the most common mummies offered as votive offerings, were reared in farms
located either in or around the temples. In this way Sacred Ibises may have been
reared in natural habitats close to a temple such as ‘the swamp’ near Tuna el-Gebel.
‘The swamp’ probably refers to a natural basin that was filled annually by the Nile
inundation, and which provided the sacred animals for the local temple (7). Similarly,
‘the lake of pharaoh’, known later as the Lake of Abusir near Saqqara, provided ideal
breeding conditions for Sacred Ibis propagation (6). An additional, but unlikely,
source of Egyptian Sacred Ibises may be been their importation as part of an active
African live animal trade Africa (1).
An interesting observation lending evidence to the notion that at least some Sacred
Ibises were sourced from wild migrating birds each year is the fact that large
numbers of elaborately wrapped mummies contained no bird at all; only dried grass
from the bird’s nest (9), indicating that there were periods (between migrations)
when priests faced a shortage of Sacred Ibises.
The analysis of mitogenomic data from a number of ancient and modern Sacred
Ibises has allowed us to test theories proposed by archaeological studies and has
clarified the origin of one of Egypt’s iconic birds. The use of newly developed ancient
DNA technologies will no doubt allow us to test further theories associated with
97
ancient civilisations.
Materials and Methods
Sacred Ibis samples. Sacred Ibis mummies are found in large numbers in a number
of Egyptian catacombs. In addition, many museums hold elaborately wrapped
Sacred Ibises sourced from Egypt within their collections. With the permission of the
Ministry of State for Antiquity, samples were collected from the main Ibis catacombs
at Saqqara, Tuna El-Gebel, and Sohaj. Blood and feather samples from
contemporary African Sacred Ibis were collected from various locations across Africa
(Table 1).
Extraction of DNA. From modern samples: DNA was extracted from modern Sacred
Ibis blood and feather samples by incubation, with rotation, overnight at 56°C, of 5
uL of blood or part of the feather including its base in 200 uL of SET buffer containing
20 uL of 10% SDS, 20 uL of 20 mg/mL proteinase K, and 20 uL of 1 M DTT. The mix
was then extracted with an equal volume of phenol:chloroform:isoamyl alcohol
(25:24:1), followed by chloroform step and finally purified using a Qiagen DNeasy
Blood & Tissue Kit and Minelute column as outlined by the manufacturer. From
ancient samples: Sacred Ibises were commonly preserved by being dipped in melted
resin or turpentine (21) that can be detrimental to the recovery of DNA. This is
because this process initiates an oxidation reaction that burns the bones from the
inside leaving only powder inside the wrapping (9). Luckily, not all the Sacred Ibises
were mummified in this way and some mummies were found in a well-preserved
manner with feathers and tissue still largely intact. These mummies were our main
source for DNA.
DNA extractions were carried out in dedicated ancient DNA facilities at the Al Kasr Al
Ani medical school in Cairo. Subsequent library building and DNA capture work was
performed in the dedicated Ancient DNA Facility at Griffith University, Nathan,
Australia. Sacred Ibis samples obtained from museum collections were extracted
for DNA and later methods were also conducted in the same Griffith University
Facility (soaked in ethanol and water overnight to rehydrate prior to DNA extraction).
Prior to extraction, ancient bone, feather or tissue samples were wiped with 10%
bleach and then 80% alcohol. The outer bone layer was then removed and the
remaining bone fragment was crushed to a fine powder. Approximately 50 mg of
98
bone powder was combined with 600 μL of extraction buffer (0.45 M EDTA, 0.5% N-
lauryl sarcosine, 1 mg/mL proteinase K and 20 uL of 1 M DTT) and incubated
overnight at 40°C with rotation. Residual bone powder was pelleted by
centrifugation and the supernatant was extracted several times with buffer-
equilibrated phenol (pH 7.5) and then chloroform. 10 x PB buffer (Qiagen) was then
added to the extract (22) and the DNA was purified using Qiagen DNeasy Blood &
Tissue Kit columns as recommended by the manufacturer. DNA was finally eluted
from the column using 50 μL of MilliQ water. For ancient toe pads, tissue, and
feathers, the samples were sliced with a scalpel, and extracted with 200 uL of SET
buffer, 40 uL of 10% SDS, 20 uL of 20 mg/ml Proteinase K and 20 uL of 1 M DTT
and incubated at 40°C overnight, with rotation, until digested. The extract was then
purified as outlined for ancient bone samples.
Construction of Illumina sequencing libraries. For modern DNA: Illumina sequencing
libraries were constructed from modern DNA using a NEBNext UltraTM DNA Library
Prep Kit (NEB) as described by the manufacturer. Briefly, DNA extracts with an insert
size of more than 1 kb were sheared using Covaris AFA M220TM, targeted size of
between 300 to 500 bp was selected using magnetic beads. Around 5 to 50ng/ul of
the adjusted size extracts were made blunt-ended and A-tailed, then purified using
a Qiagen Minelute column. The hairpin NEBNext Illumina Adaptor (5´-
/Phos/GATCGG
AAGAGCACACGTCTGAACTCCAGTC/U/ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-
3´) was then ligated to the A-tailed DNA. The Uracil base was removed from the
hairpin adapter with USERTM enzyme (NEB) and the resulting library was amplified
by PCR for 15 – 22 cycles using Phusion® High-Fidelity PCR Master Mix in GC Buffer
(NEB) and a NEbNext Universal PCR Primer for Illumina and an Illumina multiplex
index primer (5’-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTC, where
Ns represent the index sequence). Amplified libraries were initially checked by
agarose gel electrophoresis then purified using AMPure XP beads for library clean-
up and visualized by Bioanalyzer 2100. For ancient DNA samples: Ancient DNA
Illumina Sequencing libraries were constructed using a modification of the method
of Meyer and Kircher (23). Briefly, 22ul of extracted ancient DNA was made blunt-
ended, purified using Qiagen Minelute columns with 10 x Qiagen PN or PB buffer,
and then ligated to blunt-end Illumina adapters (P5F, 5’-
99
A*C*A*C*TCTTTCCCTACACGACGCTCTTCCG*A*T*C*T; P5+P7.R, 5’-
A*G*A*T*CGGAA*G*A*G*C; P7F, 5’-
G*T*G*A*CTGGAGTTCAGACGTGTGCTCTTCCG*A*T*C*T). Libraries were then
purified using Qiagen Minelute columns and 5 x PB buffer, before adapter fill-in
reactions were carried out using BstI polymerase. The ancient DNA Illumina libraries
were then amplified using the same primers as for modern DNA libraries with either
Phusion® High-Fidelity PCR Master Mix in GC Buffer (NEB) or with KAPA HiFi Uracil+
polymerase Master Mix (KAPABiosystems) for between 14 to 20 cycles. Amplified
libraries were cleaned up with 1x AMPure XP beads before being checked with
Bioanalyzer 2100.
Quality control. Extracted modern and ancient DNAs and amplified sequencing
libraries were visualized and quantified using a High-Sensitivity DNA chip on an
Agilent Bioanalyzer 2100. Modern blood extracts were visualized to check on the
DNA size before and after using the Covaris for shearing the DNA and the AMPure XP
beads for size selection. Ancient Extracts that showed bacterial or modern
contamination in the form of high molecular weight product in the Agilent Bioanalyzer
2100 were excluded. Amplified libraries were checked; to adjustment for the optimal
number of PCR cycles with the minimal percentage of PCR clonal sequences; check
on the insert size of the library; and determine the required amount of each library
for either direct sequencing or target capture hybridization.
Target capture hybridisation. Capture Baits to the complete Sacred Ibis
mitochondrial genome were designed as single stranded 80-mer biotinylated RNAs
with 5 base overlaps by MYcroarray. In summary, approximately 100-500 ng of
amplified Illumina library was denatured and then hybridised to adapter blocking
primers. The blocked library was then hybridised to single-stranded biotinylated RNA
baits at 55°C-65°C for 2-3 days, and then captured by magnetic streptavidin beads.
The beads were washed with SSPE / SDS to remove non-specifically bound DNAs
and the captured DNA was eluted from the RNA baits with 100 mM NaOH and
neutralized with 1 M Tris-Cl pH 8.0. The DNA was then purified using a Qiagen
Minelute column before being amplified for 10-18 cycles using Phusion® High-
Fidelity PCR Master Mix and GC Buffer (NEB).
100
Illumina second-generation sequencing. Purified indexed libraries were pooled in
equimolar amounts and tested for quality using an Illumina MiSeq sequencer at
Griffith University, Brisbane, Australia, before being sequenced as single-end reads
for 100 cycles using a single lane of an Illumina HiSeq 2000 at the Danish National
High-Throughput DNA Sequencing Facility in Copenhagen.
Molecular Sexing of Sacred Ibis. Primers were designed from a 336 bp Ajaia ajaja Z
chromosome CHD sequence (GenBank acc. no. AF440750.3), shown by BLAST to
harbour Z / W chromosome differences. A set of primers were designed that
amplified a 48 bp product from both the W and Z chromosome CHD copies, with the
Z chromosome copy containing a HaeIII restriction enzyme site (GGCC).
Amplifications were carried out in 10 ul volumes containing; 50 mM Tris-Cl pH 8.8,
2.5 mM MgCl2, 20 mM (NH4)2SO4, 2 uM of each primer (IsFHaeIII 5’-
GACTCCATCTCAGAAAGAAAAC and IsRHaeIII 5’-TCGTGGTCGTCCACGTT), 200 uM of
each dNTP, 2 mg/ml BSA, and 0.5U of platinum Taq. The reaction mixes were
amplified in an Applied Biosystems GeneAmp PCR System 9700 thermal cycler using
the following programme: 94°C for 2 min, then 44 x (94°C for 20 secs, 60°C for 1
min). PCR products were then digested by adding 1U of HaeIII and CutSmartTM
buffer, and incubating at 37°C for 20 min before being visualized by agarose gel
electrophoresis. Positive samples were tested up to three times. Primers IsFHaeIII
and IsRHaeIII were shown to preferentially amplify the W chromosome CHD fragment
when present, such that females showed no digestion products when digested with
HaeIII.
Bioinformatics. Sequence reads were initially processed using the fastx_toolkit
V0.0.13. Adapter sequences and reads shorter than 25 bases were removed, and
low quality bases were trimmed. Following processing, reads were aligned to the
Sacred Ibis mitochondrial reference genome (GenBank accession number: NC
013146.1) using BWA V0.6.2-r126 (24). SAMtools (25) was used to extract data,
index, sort, and view output files. Qualimap (26) was used to assess alignment
quality. The presence of endogenous ancient DNA was determined by using
mapDamage2.0 (27) measuring the levels of post-mortem damage. The fourteen
ancient and twenty-six modern sequences were used to construct both a median-
joining networks and phylogenies. These sequences were aligned with Muscle from
101
MEGA 6.06 software (28). Population genetics analyses from DNA sequence data
was carried out using DnaSP v5 software (29), it has been used to generate the
empirical distribution of the following statistics: Haplotype diversity (30), the number
of haplotypes (30) in the Sacred Ibis genomes. The whole mitochondrial genome
sequences of the forty-one samples in total excluding alignment gaps were used in
the network and phylogenetic construction. Median-joining networks were
constructed with NETWORK v. 4.6.13 (31). We also constructed a Maximum
likelihood tree using MEGA. For this purpose we first obtained the best model of
evolution using the Modeltest (32) application available in MEGA and this (TN-
Gamma) was then used to build a phylogenetic tree. To obtain confidence intervals
for the nodes a bootstrap procedure with 1000 replication was used. Mitogenomic
diversities within and between populations were estimated using the Maximum
composite likelihood method employed in MEGA. Using a likelihood-based method
in MEGA we first estimated the extent of rate variation among sites (α) and this was
then used to estimate the diversity within and among populations. To estimate the
diversities at synonymous and nonsynonymous sites we used the Pamilo-Bianchi-Li
method (33) (34). The variance for these estimates were obtained using a bootstrap
method (1000 replications).
ACKNOWLEDGEMENTS
We are grateful to Human Frontier Science for financial support in the form of grant
to PIs, Lambert, Ikram, Holland, and Willerslev. We are also grateful to The Danish
National High-Throughput DNA Sequencing Centre for sequencing the samples. We
thank Manaasa Raghavan and Morten Rasmussen for help with Illumina library
construction methods. We are grateful to Greg Baillie for advice regarding DNA
extraction. We are thankful to Doug Harebottle for collecting the blood samples from
SA; Clive Richard Barlow for collecting the feathers from Gambia; and SI for collecting
feathers from Kenya. SW is really appreciative to the ministry of Antiquities for
permitting the ancient samples collection from the catacombs; also to Al Kasr Al Ani
medical school for allowing her to use the ancient DNA laboratory. A number of
museums kindly provided material for this study including: The British Museum, The
Ancient Egyptian Animal Bio Bank at Manchester Museum, Manchester, UK,
especially Dr. Lidija M. McKnight and the Musée des Confluences, Lyon, France,
102
particularly Stephanie Porcier. CC thanks the Academy of Natural Sciences of Drexel
University (Philadelphia, PA), The American Museum of Natural History (New York,
NY), and the British Museum of Natural History for donating modern Sacred Ibis
samples. SW thanks Griffith University for a PhD scholarship and DML and SW thank
the Environmental Futures Research Institute and Griffith University for additional
support.
Table 5-1 Sacred Ibis samples. Details of the location, tissue type and estimated ages of both modern and
ancient Sacred Ibis samples sequenced in this research project.
Sample
name
Source Place of origin Sample
type
Estimated
Age
Sequencing
method
Ancient Egyptian Mummy samples
Saqqara 14 South Ibis
catacomb
Saqqara-
Egypt
Bone,
tissue
and
feathers
c.450 and
250 cal BC
Targeted
hybridization
Saqqara (15,
16, 33)
South Ibis
catacomb
Saqqara-
Egypt
Bone c.450 and
250 cal BC
Targeted
hybridization
Tuna (1, 2) Sacred Ibis
catacomb,
Tuna el-Gebel
Tuna el-Gebel
Egypt
Bone
c.450 and
250 cal BC
Targeted
hybridization
Sohag 1 Abydos Abydos, Egypt Toe pad
Targeted
hybridization
Sohag 2 Abydos Abydos, Egypt Feather c.450 and
250 cal BC
Targeted
hybridization
Sohag 3 Smithsonian
institute
Abydos, Egypt Bone c.450 and
250 cal BC
Targeted
hybridization
Thebes (1, 2,
3)
British
Museum
collection
Thebes, Egypt Bone
c.450 and
250 cal BC
Targeted
hybridization
Kom Ombo The Musée
des
Confluences
Kom Ombo,
Egypt
Bone
c.450 and
250 cal BC
Targeted
hybridization
Rodah The Musée
des
Confluences
Rodah, Egypt Bone
c.450 and
250 cal BC
Targeted
hybridization
103
Modern samples from throughout Africa
Kenya (1-7) Mount Kenya
Safari Club,
(on Equator)
Kenya Feathers Wild
population
Targeted
hybridization
Gambia (1-6) Gambia Gambia Feathers Wild
population
Targeted
hybridization
South Africa
Population 1
(1-3)
Lake
Zeekoeivlei
South Africa Blood Wild
population
Targeted
hybridization
South Africa
Population
2(1,2)
Robben
Island
South Africa Blood Wild
population
Targeted
hybridization
Cairo (1,2) Cairo Zoo Cairo Feathers Zoo
captivated
birds
Targeted
hybridization
Gabon American
Museum of
Natural
History
Chinchoua,
Gabon
Toe pad Modern
museum
samples
Shotgun
sequencing
Tanzania ANS Drexel
University
Tanzania Toe pad Modern
museum
samples
Shotgun
sequencing
Zimbabwe British
Museum of
Natural
History
Zimbabwe Toe pad Modern
museum
samples
Shotgun
sequencing
Malawi American
Museum of
Natural
History
Upper Shire,
Nyasaland,
British Central
Africa
Toe pad Modern
museum
samples
Shotgun
sequencing
Madagascar American
Museum of
Natural
History
Madagascar Toe pad Modern
museum
samples
Shotgun
sequencing
104
Table 5-2 Hypotheses relating to likely farming methodologies and the expected levels of mitogenome variation.
Expected nucleotide divergences (Low, Intermediate, and High) and phylogenetic trees that support each of the
three farming hypotheses are shown. Ancient Sacred Ibis population diversity from Egypt’s catacombs are
compared to that from modern migrating Sacred Ibis populations (modern pop.): FH1 – One central large Sacred
Ibis farm that supplied all Egyptian catacombs; FH2 – A number of small Sacred Ibis farms in Egypt’s main
centres; FH3 – A large number of small-scale farms operating for short periods only that were supplemented by
migrating birds.
* Low: less than that of Modern populations (typically that is expected for inbred populations)
Intermediate: less than that of Modern populations but greater than that expected for inbred populations
High: equal (similar) to Modern populations
FST Tree
Overall Between Within
FH1 Low Low Low High Low
(<<Modern Pop.)
FH2 Intermediate High Low Intermediate High
(<Modern Pop.)
FH3 High High High Low Low
(=Modern Pop.)
Genome diverisitesFarming
Hypotheses
Nonsyn/Syn
diverisites
105
Table 5-3 Intra and inter population pairwise comparisons of mitogenomic variation in ancient and modern
Sacred Ibis populations. P-values > 0.05 suggest there is no significant difference between ancient and modern
Sacred Ibis populations
Ancient Modern Significance
(P)
Overall Genome
diversity
0.001304
(0.000176)
0.001030
(0.000149)
0.2348
Between Populations 0.000077
(0.000052)
0.000160
(0.000073)
0.3544
Within Populations 0.001227
(0.000166)
0.000870
(0.000114)
0.0763
dN 0.000571
(0.000260)
0.000536
(0.000195)
0.9142
dS 0.002498
(0.000571)
0.001363
(0.000267)
0.0718
dN/dS 0.229 (0.116) 0.393 (0.162) 0.4101
FST 0.059 (0.039) 0.155 (0.065) 0.2005
106
Figure Legends
Figure 5-1 Sacred Ibis mummified as representations of the God Thoth, (a,b,and d) and demonstrating
three of the wrapping methods used for Ibis mummification. (C) The passageways of the North Ibis
catacomb at Saqqara stacked with layers of the pottery jars containing the bird mummies presented
as votive offerings to the Gods, North-birds Catacomb, Saqqara.
Figure 5-2 A median-joining network of the Sacred Ibis haplotypes derived using the entire
mitochondrial genome sequences generated for the modern and ancient samples. Black nodes are
hypothetical haplotypes and the size of the red and yellow nodes is proportional to the number of
samples represented. Red nodes represent the modern African populations (CA: Cairo zoo; GB:
Gabon; GM: Gambia; KN: Kenya; ML: Malawi; SA: South Africa; TZ: Tanzania; ZM: Zimbabwe). The blue
node represents MG: Madagascar as an out-group. The purple node represents the Sacred Ibis
mitochondrial reference genome (GenBank accession number: NC 013146.1). Yellow nodes
represent the ancient Egyptian population (AB: Abydos; KM: KomOmbo; RD: Rodah; SQ: Saqqara; TH:
Thebes; TG: Tuna El Gebel).
Figure 5-3 The location of (a) archeological (catacomb) sites in Egypt from which ancient Sacred Ibis
mummified material was sampled. (b) The collection locations of samples from wild populations are
shown.
107
Figure 5-1
108
Figure 5-2
109
Figure 5-3
110
References
1. Ikram S (2005) Divine Creatures: Animal Mummies in Ancient Egypt
(Amercain University in Cairo Press, Cairo).
2. Massiera M, Mathieu B, & Rouffet F (2015) Speculations on the Role of
Animal Cults in the Economy of Ancient Egypt. Apprivoiser le sauvage/Taming the
Wild 11:211-228.
3. Bailleul-Le Seur R (2012) Between heaven and earth : birds in ancient Egypt
(University of Chicago Oriental Institute Museum, Chicago).
4. Wasef S, et al. (2015) Radiocarbon dating of Sacred Ibis mummies from
ancient Egypt. Journal of Archaeological Science: Reports 4:355-361.
5. Davies S & Smith HS (1997) Sacred Animal Temples at Saqqara. The Temple
in Ancient Egypt: New Discoveries and Recent Research, ed Quirke SLondon), pp
112–131.
6. Ray JD (1978) Observations on the Archive of Ḥor. Journal of Egyptian
Archaeology 64:113–120.
7. Kessler D & Nur el-Din A (1994) Der Tierfriedhof von Tuna el-Gebel. Antike
Welt 3:252-265.
8. Zaghloul HO (1985) Fruhdemotische Urkunden aus Hermupolis. in Bulletin of
the Center of Papyrological Studies (Cairo).
9. Kessler D & Nur el-Din A (2005) Tuna al-Gebel. Divine Creatures: Animal
Mummies in Ancient Egypt, ed Ikram S (Amercain University in Cairo Press, Cairo),
pp 120-163.
10. Cramp S (1977) Handbook of the Birds of Europe, The Middle East and North
Africa. The Birds of the Western Palearctic. 1:1-687.
11. Brown LH, Urban EK, Newman K, Woodcock M, & Hayman P (1982) The birds
of Africa (Academic Press London).
12. Marota I, Basile C, Ubaldi M, & Rollo F (2002) DNA decay rate in papyri and
human remains from Egyptian archaeological sites. Am J Phys Anthropol
117(4):310-318.
13. Gilbert MT, et al. (2005) Long-term survival of ancient DNA in Egypt: response
to Zink and Nerlich (2003). Am J Phys Anthropol 128(1):110-114; discussion 115-
118.
111
14. Zink AR & Nerlich AG (2005) Long-term survival of ancient DNA in Egypt: Reply
to Gilbert et al. American Journal of Physical Anthropology 128(1):115-118.
15. Zivie A & Lichtenberg R (2005) The cats of the goddess Bastet. Divine
Creatures: Animal Mummies in Ancient Egypt ed Ikram S (The American University in
Cairo Press, Cairo), pp 106-119.
16. Hawass Z, et al. (2010) Ancestry and Pathology in King Tutankhamun's
Family. Jama-Journal of the American Medical Association 303(7):638-647.
17. Hekkala E, et al. (2011) An ancient icon reveals new mysteries: mummy DNA
resurrects a cryptic species within the Nile crocodile. Mol Ecol 20(20):4199-4215.
18. Kurushima JD, et al. (2012) Cats of the Pharaohs: Genetic Comparison of
Egyptian Cat Mummies to their Feline Contemporaries. J Archaeol Sci 39(10):3217-
3223.
19. Khairat R, et al. (2013) First insights into the metagenome of Egyptian
mummies using next-generation sequencing. Journal of Applied Genetics 54(3):309-
325.
20. Gilbert MT (2011) The mummy returns... and sheds new light on old
questions. Mol Ecol 20(20):4195-4198.
21. Moodie RL (1931) Roentgenologic studies of Egyptian and Peruvian
mummies. in Field Museum Press (Field Museum Press, Chicago).
22. Dabney J, et al. (2013) Complete mitochondrial genome sequence of a
Middle Pleistocene cave bear reconstructed from ultrashort DNA fragments. Proc
Natl Acad Sci U S A 110(39):15758-15763.
23. Meyer M & Kircher M (2010) Illumina sequencing library preparation for
highly multiplexed target capture and sequencing. Cold Spring Harbor protocols
2010(6):pdb.prot5448.
24. Li H & Durbin R (2009) Fast and accurate short read alignment with Burrows-
Wheeler transform. Bioinformatics 25(14):1754-1760.
25. Li H, et al. (2009) The Sequence Alignment/Map format and SAMtools.
Bioinformatics 25(16):2078-2079.
26. Okonechnikov K, Conesa A, & Garcia-Alcalde F (2015) Qualimap 2: advanced
multi-sample quality control for high-throughput sequencing data. Bioinformatics.
27. Jonsson H, Ginolhac A, Schubert M, Johnson PL, & Orlando L (2013)
mapDamage2.0: fast approximate Bayesian estimates of ancient DNA damage
parameters. Bioinformatics 29(13):1682-1684.
112
28. Tamura K, Stecher G, Peterson D, Filipski A, & Kumar S (2013) MEGA6:
Molecular Evolutionary Genetics Analysis version 6.0. Mol Biol Evol 30(12):2725-
2729.
29. Librado P & Rozas J (2009) DnaSP v5: a software for comprehensive analysis
of DNA polymorphism data. Bioinformatics 25(11):1451-1452.
30. Nei M (1987) Molecular Evolutionary Genetics (Columbia University Press,
NY).
31. http://www.fluxus-engineering.com/ (2015) Network ( Fluxus Technology
Ltd), 4.6.1.1.
32. Posada D & Crandall KA (1998) MODELTEST: testing the model of DNA
substitution. Bioinformatics 14(9):817-818.
33. Pamilo P & Bianchi NO (1993) Evolution of the Zfx and Zfy, genes: Rates and
interdependence between the genes. Molecular Biology and Evolution 10:271-281.
34. Li WH (1993) Unbiased estimation of the rates of synonymous and
nonsynonymous substitution. J Mol Evol 36(1):96-99.
113
Conclusion to Thesis
The recovery and analysis of ancient DNA (aDNA) from archeological specimens in
general, but particularly that from ancient Egyptian remains, has gained increasing
attention in the past few decades. Through the genetic testing of human, animal or
plant remains, researchers have been able to reveal new insights into evolutionary
trails, speciation events and domestication processes. By applying cutting-edge
approaches, that is those that rely on next-generation sequencing, it has allowed
researchers to investigate ancient Egyptian materials with increased success (1).
However, the recovery of complete genomic data from ancient Egyptian materials
has remained a significant challenge and success has been limited. These
limitations are due to the difficulty of obtaining samples as well as the nature of
those samples, being highly degraded and contaminated. Consequently, it is of
extreme importance that researchers examine the DNA preservation in mummified
Egyptian samples, optimise methodologies identifying the best ways to test those
remains, and develop ways in which to maximise the amount of useful data obtained
from minimal numbers of samples.
Thesis Significance
In this thesis, ancient molecular data of ancient Sacred Ibis mummified remains
were used to identify the probable farming system used by ancient Egyptian priests
in order to maintain sufficient numbers of Sacred Ibises to meet the demands for
ancient cultic activities. This thesis is presented as a collection of chapters in the
form of existing publications: two submitted papers in review, and a paper in the
process of submission. Each of these chapters contains a detailed discussion and
conclusion of the research presented therein and is intended to help propel ancient
Egyptian DNA studies forward. The purpose of this final chapter is to draw together
each of the main findings of this thesis, establish the significance of the work done
and outline the future prospects for ancient Egyptian genetic research.
Historically, Sacred Ibis mummies have played an important role in the study of
evolution, even before the time of Darwin. In 1794 Cuvier conducted a study of
Sacred Ibis mummies in order to disprove Lamarck’s evolutionary ideas. Cuvier
114
compared Sacred Ibis mummies to the bones and plumage of living Sacred Ibis of
the same species. He concluded that there were no morphological differences
between the two populations and then publicly argued that this was evidence for the
‘fixity of species’, in opposition to Lamarck. Cuvier’s study was only possible because
of the large number and excellent preservation of Sacred Ibis mummies. This
preservation may be due to the stability of the environmental conditions inside the
catacombs in which many Sacred Ibis were stored. More importantly from our
perspective, the excellent preservation of those mummies has ensured the
preservation of Sacred Ibis DNA obtained and analysed in this thesis.
Due to their local extinction sometime in the 19th Century, there are no Sacred Ibis
populations currently living in Egypt. Their absence from the area being studied limits
our knowledge about the Sacred Ibis in ancient Egyptian times, and made it
necessary to collect modern samples from a number of different countries across
the African continent in order to facilitate analysis.
The aim of the first chapter was to provide information about the wild modern
populations currently living in Africa, as well as outlining what is known about the
ancient Sacred Ibis from ancient Egyptian literary sources. In line with ancient
Egyptian religious beliefs, enormous numbers of mummies were offered by pilgrims
from all over Egypt as a way of pleasing the God Thoth. After the annual celebratory
feast, priests entombed the mummies in dedicated Sacred Ibis catacombs at
different locations in Egypt. For this study, samples were obtained from six of these
catacombs; Saqqara, Tuna El Gebel, Abydos, Thebes and Kom-Ombo.
Chapter two discusses the feasibility and difficulties involved in conducting research
using ancient Egyptian genetic materials. The major concern in all ancient DNA
studies is the typically Low level of endogenous DNA recovered, in comparison to the
level of exogenous contaminant sequences (2, 3). That made the results obtained of
previous studies through the traditional methods (i.e PCR and Sanger Sequencing),
were subjected to scrutiny and criticism regarding the authenticity (1, 4, 5). Many
researchers in the field of ancient Egyptian DNA were optimistic that next-generation
sequencing would lead to results that would help to bring together the different
perspectives and might lead to an end to the disputes (1). In our work, we have
shown that it is feasible to work with ancient Egyptian material and retrieve authentic
complete mitochondrial genomes from the varied types of samples available. We
concluded that a number of different factors should be considered when attempting
115
to extract DNA from ancient Egyptian material such as, the mummification
techniques that were used and how the mummies were stored in (e.g. in a pottery
jar, or a wall slap or a stone/ wood sarcophagus); the conditions inside the catacomb,
e.g. whether it is hot, humid or well ventilated; the age of the mummies and the
period of the Egyptian chronology to which they belonged; and the catacomb
location. Moreover, the physical condition of the mummy used for sampling will affect
the quality and preservation of the DNA e.g., whether the mummy had been well
preserved and is still fully wrapped, or is it simply a collection of bones. We conducted
the sample collection process using strict protocols in order to eliminate the
possibility of introducing contamination.
As we were the first to apply 14C analysis to six samples of Sacred Ibis mummified
remains, we were able to publish dates for the remains and investigate the
archaeological chronology of ancient Egyptian animal mummification practices in the
Journal of Archeological Sciences: Reports. These results form the basis of chapter
three of this thesis. It has always been thought that animal mummification in general,
specifically that of the Sacred Ibis, had flourished from the Late Period until the
Roman Period (c. 664 BC to AD 350). This suggestion was based mainly on
archaeological evidence (6). Using 14C,, we show that the mummies analysed date
to approximately 2220 - 2430 yr BP, which may indicate that the majority of Sacred
Ibis mummification occurred between the Late Period to the Ptolemaic Period and
may not have continued until the Roman Period (7). However, our reported dates
were restricted to samples that were collected from only Saqqara, Roda and Thebes,
and it is possible that this is a limiting factor.
In chapter four, we reported a detailed modification that we introduced to the
previously established experimental ancient DNA methodology. We found that
working with highly contaminated and fragmented ancient DNA required a
combination of methods to enrich for endogenous sequences. Those parameters
are: the use of a modified extraction method that accommodates the different types
of samples (i.e soft tissue, bone, feather, etc.) (8); An efficient ancient DNA library
building protocol (9), employing the polymerase KAPA HiFi Uracil; Using an optimal
hybridization temperature for ancient DNA in the tested samples, which was 57˚C in
our study. These recommendations allowed us to attain up to 4705x enrichment of
targeted mtDNA from the Sacred Ibis mummified materials. The results show that
the percentage of on-target unique sequences was significantly influenced by minor
116
changes of the hybridisation temperature as well as the after capture wash
temperature and the particular sample being used (i.e modern or ancient). We found
that using a hybridisation temperature of 57°C constantly during the hybridisation
time was optimum for working with the ancient materials. This lower temperature
allowed more on-target specificity for fragmented and damaged sequences, but was
still not low enough to lose the selectivity of the baits and increase the capture of
contaminants. In contrast, modern DNA from samples such as blood and feathers
preferentially bonded to the baits when compared with exogenous sequences, at
higher temperatures such as 60°C or 65°C. Thus, decreased hybridisation
temperatures may be beneficial for ancient samples but are not recommended for
fresher modern samples.
Generally, this study has demonstrated the feasibility of recovering aDNA from
Egyptian materials, despite the hot climates. In chapter five of this thesis, we used
the retrieved complete mitogenomes to investigate and identify the possible farming
system used by ancient Egyptian priests to rear the Sacred Ibis as supply for cultic
activities.
By analysing the genetic variation among 14 ancient and 26 modern complete
Sacred Ibis mitogenomes we were able to determine the likely farming practices
employed to supply some of the millions of mummified Sacred Ibises entombed in
Egypt’s ancient catacombs. Comparisons of genetic variation within and among
ancient and modern Sacred Ibis populations strongly suggested the existence of a
large number of localised temple-based small-scaled farms. Our conclusions were
supported by the following; firstly, the overall genomic diversities of ancient Sacred
Ibis from within, as well as among, catacombs were largely comparable to that
recorded from modern Sacred Ibis from different locations across Africa; secondly,
the diversity observed at evolutionarily constrained (non-synonymous) sites of the
protein-coding genes of ancient samples was also similar to that of contemporary
Sacred Ibis populations; finally, no significant population structure was found
between the Sacred Ibis populations from different catacombs, which eliminates the
possibility that Sacred Ibises were collected from different parts of Africa and then
reared in small farms for a prolonged period of time. As a result, the most probable
scenario is that Sacred Ibis migrating into Egypt were collected and directly
mummified or bred for a short time, before being entombed.
The analysis of mitogenomic data from a number of ancient and modern Sacred
117
Ibises has allowed us to test theories proposed from archaeological studies and has
clarified the origin of one of Egypt’s iconic birds. The use of newly developed ancient
DNA technologies will no doubt allow us to test further theories associated with
ancient civilisations.
Thesis work Limitations
Extensive regulations and laws are in place when working with Egyptian antiquities,
due to the venerable value of these ancient samples. As such, researchers can often
face challenges in obtaining a sufficient number of samples for their research. In
addition, both the Egyptian Antiquities Ministry and museums would rather give
permission for work to be completed on samples using non-destructive research
methodologies rather than molecular analysis or other methods involving destructive
sampling.
The sampling permission granted to us by the Egyptian authorities to collect material
from Sacred Ibis catacombs, was on the conditioned that the initial DNA extraction
was only permitted in a specified ancient DNA laboratory in Egypt. Consequently, only
samples collected from museums could be used for 14C dating analysis due to the
deficiency of AMS equipment in Egypt, and therefore the dating results do not
represent the diverse mummified Sacred Ibis populations buried in geographically
separated catacombs. Also, the question of whether the offerings of Sacred Ibis
mummies by pilgrims did or did not last until the Roman period requires further
research.
The constraints of working with highly degraded material has limited the amount of
data compiled from previous studies (1, 4, 5), but has succeeded in demonstrating
the potential for hot and humid climate source material to yield results (1). In our
study, more than 50 samples collected from different Sacred Ibis individuals /
catacombs were used for aDNA extraction analysis. After purification of the extracted
DNA and the construction of Illumina libraries, only 20 libraries built from these
samples were found suitable for further analyses (i.e capture hybridisation or
shotgun sequencing) generating 14 complete mitochondrial genomes. Several
studies assessed the preservation characteristics of the bone as a proxy for DNA
preservation using different methods(10-12). Although each of these methods can
assist in characterising bone preservation, their use in identifying specimens for
118
sampling cannot guarantee success in DNA recovery. Furthermore, all of these
methods require destructive sampling on some scale. Therefore, their utility may vary
depending upon the collection and sampling requirements for the proposed
research.
Although bone is thought to protect endogenous DNA against degradation, other
tissues have been successfully used in this study including soft tissue, feather and
toe pads. However, those types of samples are not always as readily available as that
of bone samples.
Future Prospects
There are numerous ways in which the methodology we used here can be widely
used to answer important genetic questions in archaeology. In particular, it will be
worthwhile to expand research such further to include human remains and samples
from other tropical climates.
In this thesis, I present proof-of-concept work to demonstrate that ancient Egyptian
Sacred Ibis samples preserve mitochondrial DNA at least. However, there are areas
of research that were not addressed in this study. This study did not test the
preservation of nuclear DNA within the same type of samples, something that should
be encouraged for future studies. It is hoped that the results presented herein will
encourage more attempts to be made to collect varied specimens from a wide range
of animal mummies to estimate the endogenous levels of the nuclear and
mitochondrial contents.
Despite decades of aDNA research, the conservation and degradation of nucleic acid
is still not fully understood. While scarcity of human samples has been a major
limitation for predicting DNA survivability in the ancient Egyptian materials, other
types of samples such as mummified Sacred Ibis, cats, jackals, dogs, crocodiles,
snakes and birds, could be used for testing the preservation of genetic material and
estimate the endogenous DNA contents level. In other words, it is important to have
a good understanding of DNA preservation under different environmental conditions.
Such knowledge would prevent geneticists from needlessly destroying precious
human mummified samples, just to prove that it contains endogenous DNA. By
testing large collections of mummified animal remains, using target capture
methods combined with second-generation sequencing (SGS), researchers will be
119
able to develop better models of DNA degradation over time using different
environmental variables, such as average annual temperature. An advantage of
using Egyptian animal materials is that samples can be sourced from different time
periods and geographical locations. In contrast to human remains, Egyptian
authorities and museum curators may be more open to permitting the complete
destruction of a few isolated animal remains, of which there might be a large
number, rather than destroying parts of precious human mummies. By using target
capture hybridisation methods coupled with SGS, instead of traditional PCR or
Sanger sequencing, researchers can utilise very short DNA fragments, and thereby
achieve more reliable estimates of DNA’s half-life. This may help to establish a
criteria able to predict DNA preservation based on the type of remains, sample age,
ambient temperature, humidity, and pH value of the depositional environment.
Experiments conducted in chapter four of this thesis demonstrated that certain
extraction methods work better than others, based on the nature of the Sacred Ibis
sample used (i.e bone, feather, toe pad, etc.). This can be explained by the fact that
different tissues containing variable amounts of DNA protectants, such as
hydroxyapatite in bones, or low moisture levels that may slow hydrolytic damage of
DNA. These findings are important and can be used by researchers in order to assist
in the re-evaluation of methodological approaches when working with aDNA.
However, since it is critical to maximise aDNA recovery for SGS, it is anticipated that
future projects will conduct more experiments to modify and optimise DNA extraction
procedures.
Another significant research opportunity using SGS methodology is the ability to
detect and analyse aDNA adhering to archaeological artefacts. This has the potential
to widen the prospects of genetic studies of ancient Egyptian materials by revealing
details about the origins and nature of the plant resins used by ancient Egyptians
when preserving the bodies of the deceased.
While much of the presented chapters herein has emphasised genetic aspects of
aDNA research, the overall objectives of these projects require collaborations
between molecular biologists and archaeologists. Without the clear presentation of
the Sacred Ibis in an archaeological context, the resulting data from the collected
samples are meaningless. Many of the museum samples supplied for this research
were not provenanced, with their origin unknown. Therefore, geneticists are required
to be very familiar with the archaeological sites from which samples originate. In this
120
sense, not only must the genetic research be conducted to a high standard, but also
the archaeological recovery and interpretation of ancient samples must be
scientifically rigorous. It is important to know the exact location of any sample and
the approximate time period or age, these details may impact our understanding of
the results obtained. In this way, the future of aDNA research will be brighter, as
researchers in the molecular field and archaeologists come to form closer
collaborations. It would be advantageous to establish a generation of researchers
with direct experience of both archaeology and genetics. Neither archaeology nor
genetics can give the complete picture about the past; rather, when the fields are
used in tandem, researchers in both groups can reach important new
understandings of the past. There is much room for improvement in this arena, but
there is reason to be hopeful as more researchers, including myself, begin to cross-
interdisciplinary boundaries.
Final Remarks
Broadly, this thesis will hopefully contribute to the growing connection between
archeological sciences and ancient DNA research. Various components of this
dissertation may become central to future genetic studies of Egyptian remains, and
will hopefully encourage new research aimed at the intersection of archaeology,
anthropology, and molecular biology.
References
1. Khairat R, et al. (2013) First insights into the metagenome of Egyptian
mummies using next-generation sequencing. Journal of Applied Genetics 54(3):309-
325.
2. Gilbert MT, et al. (2005) Long-term survival of ancient DNA in Egypt: response
to Zink and Nerlich (2003). Am J Phys Anthropol 128(1):110-114; discussion 115-
118.
3. Lorenzen ED & Willerslev E (2010) King Tutankhamun's family and demise.
JAMA 303(24):2471; author reply 2473-2475.
4. Hawass Z, et al. (2010) Ancestry and Pathology in King Tutankhamun's
Family. Jama-Journal of the American Medical Association 303(7):638-647.
121
5. Hawass Z, et al. (2012) Revisiting the harem conspiracy and death of
Ramesses III: anthropological, forensic, radiological, and genetic study. BMJ (Clinical
research ed.) 345(dec14 14):e8268-e8268.
6. Ray JD (1978) Observations on the Archive of Ḥor. Journal of Egyptian
Archaeology 64:113–120.
7. Wasef S, et al. (2015) Radiocarbon dating of Sacred Ibis mummies from
ancient Egypt. Journal of Archaeological Science: Reports 4c:355-361.
8. Dabney J, et al. (2013) Complete mitochondrial genome sequence of a
Middle Pleistocene cave bear reconstructed from ultrashort DNA fragments. Proc
Natl Acad Sci U S A 110(39):15758-15763.
9. Meyer M & Kircher M (2010) Illumina sequencing library preparation for
highly multiplexed target capture and sequencing. Cold Spring Harbor protocols
2010(6):pdb.prot5448.
10. Colson IB, Richards MB, Bailey JF, Sykes BC, & Hedges REM (1997) DNA
Analysis of Seven Human Skeletons Excavated from the Terp of Wijnaldum. Journal
of Archaeological Science 24(10):911-917.
11. Götherström A, Collins M, Angerbjörn A, & Lidén K (2002) Bone preservation
and DNA amplification. Archaeometry 44(3):395-404.
12. Poinar HN (2002) The genetic secrets some fossils hold. Accounts of
chemical research 35(8):676-684.
122
Appendix (A)
70 million animal mummies: Egypt’s dark secret
BBC News
BBC documentry movie
123
70 million animal mummies: Egypt’s dark secret
Desert cemetery
Saqqara is an ancient Egyptian temple complex around an hour's drive from Cairo where millions of animal mummies are still buried.
We filmed molecular biologist Sally Wasef from Griffith University, Australia as she clambered down a narrow twelve-metre-deep shaft into an underground catacomb filled with the ancient mummified remains of wading birds called Sacred Ibis.
Sally collected samples of bones from the mummies so she could extract and compare their DNA, helping her to understand whether they had been intensively farmed.
BBC News: http://www.bbc.com/news/science-environment-32685945
124
BBC Horizon Documentary Movie:
https://www.youtube.com/watch?v=JzHvtMV4mfo
125
Appendix (B)
The Ancestry and Pathology of King Tutankhamun’s Family
(Hawass, et al., 2010)
Revisiting the harem conspiracy and death of Ramesses III:
anthropological, forensic, radiological, and genetic study.
(Hawass, et al., 2010)
126
127
128
129
130
131
132
133
134
135
136
137
138
139
140
141
142
143
144
145
Appendix (C)
Radiocarbon dating of Sacred Ibis mummies from Ancient
Egypt (Wasef et al., 2015).
Supplementary Information (SI)
In order to comply with copyright this article has been removed.