analysis of antibiotic resistance regions in gram-negative

R E V I E W A R T I C L E

Analysis ofantibiotic resistance regions inGram-negative bacteriaSally R. Partridge

Centre for Infectious Diseases and Microbiology, The University of Sydney, Westmead Hospital, Sydney, NSW, Australia

Correspondence: Sally Partridge, CIDM,

Level 3, ICPMR Building, Westmead Hospital,

NSW 2145, Australia.

Tel.: 161 2 9845 5246;

fax: 161 2 9891 5317;

e-mail:

[email protected]

Received 31 August 2010; revised 10 March

2011; accepted 5 April 2011.

Final version published online 16 June 2011.

DOI:10.1111/j.1574-6976.2011.00277.x

Editor: Teresa Coque

Keywords

insertion sequence; transposon; integron; gene

cassette; homologous recombination;

annotation.

Abstract

Antibiotic resistance in Gram-negative bacteria is often due to the acquisition of

resistance genes from a shared pool. In multiresistant isolates these genes, together

with associated mobile elements, may be found in complex conglomerations on

plasmids or on the chromosome. Analysis of available sequences reveals that these

multiresistance regions (MRR) are modular, mosaic structures composed of

different combinations of components from a limited set arranged in a limited

number of ways. Components common to different MRR provide targets for

homologous recombination, allowing these regions to evolve by combinatorial

evolution, but our understanding of this process is far from complete. Advances in

technology are leading to increasing amounts of sequence data, but currently

available automated annotation methods usually focus on identifying ORFs and

predicting protein function by homology. In MRR, where the genes are often well

characterized, the challenge is to identify precisely which genes are present and to

define the boundaries of complete and fragmented mobile elements. This review

aims to summarize the types of mobile elements involved in multiresistance in

Gram-negative bacteria and their associations with particular resistance genes, to

describe common components of MRR and to illustrate methods for detailed

analysis of these regions.

Introduction

Antibiotic resistance, especially simultaneous resistance to

multiple classes of antibiotics (multiresistance), is an in-

creasing global problem. Gram-negative bacteria, in parti-

cular the Enterobacteriaceae, are adapted to exchanging

genetic information and antibiotic resistance in these organ-

isms is often due to the acquisition of genes from a shared

pool (Iredell & Partridge, 2010). Genes in this pool are not

intrinsically mobile and appear to have been captured from

the chromosomes of various species, where they may have

originally had other functions (Martinez et al., 2009). Such

capture involves two different types of mobile genetic

elements: those able to transfer genes between DNA mole-

cules, referred to here as mobile elements, for example

insertion sequences (IS) (Chandler & Mahillon, 2002), gene

cassettes (Partridge et al., 2009), integrons (Cambray et al.,

2010) and transposons (Grinsted et al., 1990; Grindley,

2002), and those able to transfer between cells, for example,

conjugative and mobilizable plasmids (Carattoli, 2009;

Smillie et al., 2010) and integrative conjugative elements

(ICE; Waldor, 2010; Wozniak & Waldor, 2010).

The reservoir of potential antibiotic resistance genes

detected in different environments, for example by metage-

nomic analysis (D’Costa et al., 2006; Sommer et al., 2009),

appears to be extremely large (Martinez et al., 2009).

However, it is not possible to predict which of these genes

will emerge into the pool accessible to potentially patho-

genic Gram-negative species (Courvalin, 2005, 2008), which

contains only a limited variety of mobilized resistance genes

(Martınez et al., 2007; Martinez et al., 2009). Successful

mobilization of a resistance gene into this pool presumably

requires a combination of events. The relevant mobile

element must have access to the organism that carries the

resistance gene in question, the mobile element must

happen to interact with the gene to allow ‘capture’ (Baquero,

2004) and must be able to transfer the gene to a plasmid or a

similar genetic vehicle that is able to enter the relevant pool.

It seems likely that such successful capture/mobilization

events would be rare and the subsequent acquisition of a

gene from this pool by many different bacteria would be

more efficient than relying on additional capture events.

Mobilized resistance genes identified in Gram-negative

bacteria also vary in their distribution, suggesting that entry

FEMS Microbiol Rev 35 (2011) 820–855c� 2011 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

MIC

ROBI

OLO

GY

REV

IEW

SD

ownloaded from

https://academic.oup.com

/femsre/article/35/5/820/2680374 by guest on 25 Septem

ber 2022

mailto:[email protected]

into the appropriate pool is not always sufficient for a new

gene to become widely established (Shaw et al., 1993; Walsh,

2006; Partridge et al., 2009). Under strong selection, such as

the use of an antibiotic, the first element to enter the pool

that confers an advantage would have the highest chance of

spreading and becoming predominant, but as new genes

enter the pool and selective pressures change, new elements

may take over (Martinez et al., 2009).

Available evidence indicates that in Gram-negative bac-

teria, particularly the Enterobacteriaceae, the resistance genes

and associated mobile elements carried on plasmids are

often found clustered together in large multiresistance

regions (MRR). Similar conglomerations are also found in

ICE (Wozniak et al., 2009) and various chromosomal

‘resistance islands’, for example SGI1 in Salmonella spp.

(Hall, 2010) and AbaR in Acinetobacter baumannii (Post &

Hall, 2009; Adams et al., 2010). Insertions into a particular

region of a plasmid or a chromosome may disrupt vital

functions, preventing replication or conjugation, for exam-

ple, or disrupting cell growth or division, and insertions into

the chromosome usually occur at specific sites. Certain hot-

spots for the integration of different genetic information

have been identified in the Escherichia coli genome (Tou-

chon et al., 2009), SXT elements insert into the prfC gene of

Vibrio cholerae (Hochhut & Waldor, 1999) and SGI variants

insert at the same position between the thdF and yidY genes

in Salmonella (Doublet et al., 2005), Proteus mirabilis (Boyd

et al., 2008) and potentially other bacteria (Doublet et al.,

2007). There is also evidence for the targeted insertion of

transposons into plasmids (Sota et al., 2007).

If a mobile element is inserted into a location where it has

no deleterious effects, either due to such targeting or by

chance, it may then act as a ‘founder element’ (Parks &

Peters, 2007) that provides a target for further insertions

that also do not disrupt vital functions. Such events may be

exceptionally rare ‘one-offs,’ but structures derived from

them may spread widely if they provide a strong selective

advantage. As we only see the ‘tip of the iceberg’ of

structures that are successful in terms of the biased sets of

samples that have been studied, rather than the results

of all possible insertion events, the observed accretion of

mobile elements and associated resistance genes into MRR

makes sense.

Examination of the available sequences of MRR on

plasmids and resistance islands suggests that they are

modular, mosaic structures, consisting of different combi-

nations of highly conserved components from a limited set

(Baquero, 2004). The number of different configurations of

these components is also smaller than would be expected if

they were assembled by random interactions (Baquero,

2004). While some combinations can be explained by the

targeted insertion mentioned above, some elements, includ-

ing many IS, do not appear to target specific sites. Instead,

common components present in different MRR provide

homologous regions that allow ‘combinatorial evolution’

based on new interactions between existing pieces (O’Brien,

2002; Baquero, 2004; Walsh, 2006). The composition of a

particular MRR will depend on the availability of different

components and some interactions may be more favourable

than others. Combined with selection pressure, this may

result in ‘winner’ combinations that are very common

(Baquero, 2004).

Accretion of resistance genes into MRR means that a

bacterium may be able to rapidly acquire a combination of

resistance genes en bloc and that the biological success of a

resistance gene is dependent on its wider genetic context

(Walsh, 2006). The association of a particular resistance

gene with others may allow co-selection for its maintenance

by several different antibiotics. The insertion of a resistance

gene into an MRR may also enable incorporation into new

mobile entities that may not have some of the limitations of

the original capturing element (O’Brien, 2002). Thus,

although the mechanisms of action of the products of many

resistance genes are well characterized and many of the

associated mobile elements have been studied, our under-

standing of the complexities of multiresistance is still very

limited (Walsh, 2006). There are clearly rules that govern

how MRR arise, evolve and spread (Baquero, 2004), and

potentially their associations with different types of plas-

mids, but understanding these rules requires comparison of

many examples.

Until recently, relatively few complete MRR or plasmids

had been sequenced (Frost et al., 2005), but advances in

technology are leading to the availability of increasing

amounts of sequence data. Unfortunately, meaningful com-

parison of MRR is often hampered by inconsistent annota-

tion and incomplete analysis (Iredell & Partridge, 2010), as

most automated sequence annotation programs focus on

identifying genes and the potential function of their pro-

ducts (or individual domains) by homology to known

examples. This is of limited use in DNA segments relating

to antibiotic resistance in Gram-negative bacteria, where

very similar or even identical genes with known functions

have often already been identified many times. In these

sequences, identifying precisely which genes are present and

their genetic context, i.e. the associated mobile elements and

the boundaries between these elements, is more important.

This type of detailed analysis of all of the components of a

sequenced MRR still usually requires manual input (Frost

et al., 2005) in addition to automated annotations. This

review aims to summarize the characteristics of the most

common components of available MRR and the principles

needed to fully analyse sequences relating to antibiotic

resistance from Gram-negative bacteria and their plasmids,

using examples to illustrate these principles and to demon-

strate ways of analysing these complex sequences.

FEMS Microbiol Rev 35 (2011) 820–855 c� 2011 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

821Analysis of the antibiotic resistance regions

Dow

nloaded from https://academ

ic.oup.com/fem

sre/article/35/5/820/2680374 by guest on 25 September 2022

Mobile elements and capture ofresistance genes

The main types of mobile elements currently known to be

involved in the capture and mobilization of antibiotic

resistance genes found in Gram-negative bacteria are certain

IS (Chandler & Mahillon, 2002), gene cassettes/integrons

(Partridge et al., 2009) and transposons of the Tn3 (Grind-

ley, 2002) and Tn5053 families (Radstrom et al., 1994;

Kholodii et al., 1995) (Fig. 1). These elements have some

features in common, but capture and/or move genes by

different mechanisms.

‘Classic’ IS and composite transposons

Classic IS are compact mobile elements usually bounded by

short, identical or imperfect inverted repeats (IR). One or

two genes encoding transposase proteins generally cover

almost the entire region between these IR, which are defined

as IRL, at the left end relative to the direction of transcrip-

tion of the transposition gene(s), and IRR, at the right end.

Recognition of the IR by the transposase protein enables the

movement of the IS to a new location by a ‘cut and paste’

and/or a ‘copy and paste’ process, depending on the

particular IS (Chandler & Mahillon, 2002). Transposition

of most IS generates direct repeats (DR) of a characteristic

length, usually 2–14 bp (Chandler & Mahillon, 2002).

Although classical IS as originally defined do not carry

resistance genes within them, two copies of the same IS (or

two closely related IS) that happen to insert either side of a

gene can capture it as part of a composite transposon that

can move as a unit. IS may also provide complete or partial

promoters that can drive the expression of captured (or

adjacent) genes.

IS related to known families but carrying ‘passenger’

genes are now being identified, blurring the distinction with

transposons, and have been designated tIS (Siguier et al.,

2009). Two other types of IS, ISEcp1-like elements and ISCR,

are unusual in that a single copy of the element is able to

capture and move resistance genes.

ISEcp1 and related elements

ISEcp1 is flanked by 14-bp IR, but appears to move adjacent

regions by failing to recognize IRR and instead using a

weakly related downstream sequence (designated IRalt here)

in combination with IRL (Poirel et al., 2003, 2005a; Lartigue

et al., 2006). DR (5 bp) flanking the entire ‘transposition

unit’, i.e. IRL to IRalt, are created on insertion. Several other

elements (ISEnca1, ISSm2, IS1247) appear to mobilize

adjacent regions, including antibiotic resistance genes, in

the same way as ISEcp1 (van der Ploeg et al., 1995).

IRL

ISEcp1 tnp

IRaltIRL IRRDR(5)

DR(5)

Insertion sequence tnp

IRR

(DR) (DR)

Composite transposontnp tnp (DR)(DR)

Terminal inverted repeat (IR)

Antibiotic resistance gene

ISCRoriIS

rcr

terIS

Transposition unit

Genecassettes attC attC

Tn3-subgrouptransposon tnpA tnpR

IRtnpresDR

(5)DR(5)

IR

IntegronCassette arrayintI

attI

Tn21-subgrouptransposon tnpA tnpR

IRtnp resDR(5)

DR(5)

IR

Tn5053-familytransposon

IR resDR(5)

DR(5)

IRt

mer or

tniAtniR tniQ tniBintI1/attI1or mer

Fig. 1. Summary of the characteristics of mobile

elements involved in the capture and mobilization

of antibiotic resistance genes in Gram-negative

bacteria. tnp, tni, transposition functions; IRL and

IRR, left and right inverted repeats; IRalt, alterna-

tive IR; rcr, rolling circle replicase; oriIS, origin of

ISCR elements; terIS, terminus of ISCR elements;

res, res site. Elements that create DR are indicated

and the DR length given, except for IS, where

the DR length varies for different elements.

Tn21-subfamily transposons may carry resistance

genes as part of class 1 integrons inserted in or

near the res site.


822 S.R. Partridge

Dow


ic.oup.com/fem


ISCR elements

ISCR elements are similar to a distinctive family of IS that

includes IS91, IS801 and IS1294, which move by rolling circle

replication (Garcillan-Barcia et al., 2002). ISCR appear to

move in the same way (Toleman et al., 2006a, b) and the name

rcr (for rolling circle replicase) has been suggested for their

‘transposases’ (Levings et al., 2008). ISCR elements are

bounded by an origin (oriIS) downstream of this gene and a

terminus (terIS) upstream, rather than IR, and do not create

DR. Like IS91 (Garcillan-Barcia et al., 2002) and IS1294

(Tavakoli et al., 2000), ISCR elements appear to mobilize

genes by failing to recognize terIS and continuing replication

into the adjacent sequence (Toleman et al., 2006a, b).

Gene cassettes and integrons

Gene cassettes are the smallest mobile elements associated

with antibiotic resistance and each consists of a gene, often

preceded by a ribosome-binding site, but usually not a

promoter, and an attC recombination site (or 59-base

element). The attC sites of different cassettes vary in length

and sequence, but include conserved regions at their ends.

Gene cassettes can transiently exist as circular molecules

(Collis & Hall, 1992), but do not encode the mechanism for

their own movement and are usually found inserted into

integrons (In; Stokes & Hall, 1989) or, rarely, at secondary

sites (Francia et al., 1993; Recchia et al., 1994).

The minimum components of an integron are an intI

gene and an attI recombination site, plus a Pc promoter. The

intI gene encodes an IntI integrase that catalyses site-specific

recombination between the attI1 site and the attC site of the

gene cassette (or between two attC sites) to insert or release

cassettes (Collis et al., 1993). Several cassettes may be

inserted in tandem into the same integron to create a

cassette array, with the expression of cassette-borne genes

driven by Pc. Integrons have been divided into classes on the

basis of their IntI sequences and chromosomal integrons

with arrays of tens to hundreds of cassettes, usually with

related attC sites, are found in some species. Chromosomal

integrons collectively provide a reservoir of cassettes that can

be acquired by mobile or potentially mobile integrons asso-

ciated with antibiotic resistance (Rowe-Magnus et al., 2001).

The latter contain fewer cassettes, often with quite different

attC sites, with class 1 integrons being the most common in

available MRR. The mechanism by which genes acquire attC

sites remains unknown, although generation from mRNA

(Recchia & Hall, 1997) and the involvement of group IIC-attC

introns (Leon & Roy, 2009) have been suggested.

Unit transposons -- the Tn3 family

Unit or complex transposons (Tn) as originally defined are

larger than IS and carry antibiotic resistance and/or other

genes in addition to genes encoding transposition functions.

The Tn3 transposon family (Grindley, 2002) includes two

subgroups: Tn3-like and Tn21-like transposons. Both types

are bounded by 38-bp IR and include a transposase gene

(tnpA), a resolvase gene (tnpR) and a resolution site (res).

These transposons move by a replicative process that

involves the recognition of the IR by TnpA and the genera-

tion of a cointegrate intermediate consisting of the donor

and the recipient molecules separated by two copies of the

transposon. The cointegrate is resolved by TnpR-mediated

site-specific recombination between directly oriented res

sites and transposition creates 5-bp DR (Grindley, 2002).

The two subgroups are distinguished by differences in

both sequence and organization. In members of the Tn3-like

subgroup, res lies between tnpA and tnpR, which face in

opposite directions (Grindley, 2002). In transposons of the

Tn21-like subgroup (Grinsted et al., 1990) tnpA and tnpR

are in the same orientation, with res near the start of tnpR. In

Tn3-like and some Tn21-like transposons resistance gene(s)

lie beyond tnpR, but the means by which they were captured

is not known. Many Tn21-like transposons include a

mercury resistance (mer) operon beyond the res site and

the resistance gene(s) are carried as part class 1 integrons

inserted in or near the res site. Related structures including

only tnpR and tnpA genes (e.g. Tn5403) are still defined as

transposons (Grindley, 2002).

Unit transposons -- the Tn5053 family

Some members of the Tn5053 family of transposons are

important in the spread of antibiotic resistance. Transpo-

sons of this family have three transposase genes, called

tniA, tniB and tniQ (or tniD) separated from a resolvase

gene tniR (or tniC) by a res site, and are flanked by 25-bp IR

(Radstrom et al., 1994; Kholodii et al., 1995). These trans-

posons move in a manner similar to members of the Tn3-

family, with TniA, TniB and TniQ mediating the formation

of a cointegrate, which is resolved by recombination at the

res site catalysed by TniR, and they also generate 5-bp DR on

transposition (Kholodii et al., 1995; Kamali-Moghaddam &

Sundstrom, 2000). Tn5053-family transposons target the res

sites of Tn21-subgroup transposons and related partitioning

(par) regions in plasmids (Minakhina et al., 1999; Kamali-

Moghaddam & Sundstrom, 2000; Petrovski & Stanisich,

2010) and they may carry class 1 integrons or mercury

resistance operons (Kholodii et al., 1995).

Associations between particular resistancegenes and particular mobile elements

Many different genes conferring resistance to a particular

antibiotic or class/group of antibiotics have been (and

continue to be) identified in Gram-negative bacteria. How-

ever, examination of the available sequences that include



Dow


ic.oup.com/fem


context information as well as the resistance gene suggests

that, as might be expected from the considerations outlined

in the Introduction, each particular resistance gene is

generally immediately associated with the same mobile

element (Table 1). In some cases, the source of a captured

resistance gene can be identified, when the same (or a very

closely related) DNA segment is found both associated with

a mobile element on a plasmid and without the mobile

element on the chromosome of certain species (Table 2). For

example, plasmid-borne ampC genes are derived from the

chromosomal ampC genes of various Enterobacteriaceae and

ancestors of most of the blaCTX-M groups of b-lactamases

have been identified on the chromosomes of different

Kluyvera species (Table 2). Capture of the blaCTX-M-2 gene

from the Kluyvera ascorbata chromosome by ISEcp1 and

transfer to a plasmid has also been demonstrated (Lartigue

et al., 2006). In other cases, the source of the gene remains

unknown, even if an associated mobile element has been

identified, for example blaTEM genes associated with Tn3-

like transposons.

The same mobile element (or type of mobile element)

may be associated with genes conferring resistance to

different classes of antibiotics and genes conferring similar

resistance phenotypes may be associated with quite different

mobile elements (Table 1), but all types of mobile elements

are not associated with all types of resistance genes. For

example, no plasmid-mediated ampC genes (Class C in

Table 1), which originate from Enterobacteriaceae, have been

found in gene cassettes, which may be generated in ‘envir-

onmental’ species. Conversely, in Gram-negative bacteria,

most of the genes encoding aminoglycoside-modifying en-

zymes, the exact sources of which are unknown, are found in

gene cassettes. This may reflect the limited possibilities for

interaction between mobile elements and genes originating

from species that are not normally found together.

At least one gene, blaCTX-M-14a, does appear to have been

captured in two separate events: either by ISEcp1 or by

ISCR1 (Valverde et al., 2009). In other cases, different

extents of the source chromosome have apparently been

captured by the same mobile element. For example, blaSHV

genes are found in two different composite transposons,

both flanked by IS26, apparently due to separate mobiliza-

tions of chromosomal regions of Klebsiella pneumoniae of

different lengths giving rise to two different lineages of genes

(Ford & Avison, 2004). Available sequences also include

examples of minor gene variants associated with different

mobile elements. For example, genes designated catA2

(formerly catII) are apparently found associated with ISCR1

or as part of an IS26-mediated composite transposon.

Closer examination indicates that these genes and flanking

regions are only 96% identical and could have been captured

from slightly different sources. These genes are designated

catA2a (ISCR1-associated) and catA2b (IS26-associated)

here. Similarly, the catA1 genes and flanking regions asso-

ciated with IS1 (catA1a here) and with IS26 (catA1b, also

known as pp-cat) are about 98% identical.

In other cases where the same resistance gene is appar-

ently closely associated with different mobile elements,

detailed examination reveals a more complex picture. In

one sequence where blaCTX-M-14a is apparently associated

with ISCR1 (EU056266) (Bae et al., 2008), the IRR end of

ISEcp1 is present between ISCR1 and blaCTX-M-14a, suggest-

ing initial capture by ISEcp1. Another example is provided

by the blaVEB-1 gene, first identified as part of a gene cassette

in an array in a class 1 integron (Poirel et al., 1999). blaVEB-1

and minor variants have since been found in contexts other

than cassette arrays, associated with ISCR1 (Naas et al.,

2006), ISCR2 (Poirel et al., 2009) or a 135-bp repeated

element (Re; see Zong et al., 2009 and references therein).

Examination of the sequences surrounding blaVEB indicates

that it is still part of the same gene cassette, i.e. associated

with the expected attC site, although the cassette is missing

the first 7 bp in some contexts.

If a resistance gene was first captured some time ago, it

may no longer be possible to identify exactly which element

was responsible. For example, minor variants of the aphA1

gene have been found in at least two different composite

transposons flanked by IS26, Tn4352 (Wrighton & Strike,

1987) and Tn6020 (Post & Hall, 2009), Tn903 flanked by

IS903 (Oka et al., 1981) and Tn2680, flanked by IS26, but

also carrying IS903 (Mollet et al., 1985a). The region

common to these structures extends beyond the aphA1 gene

itself but, as the chromosomal source is not known, it is

more difficult to identify the region that was initially

captured and the element responsible.

Recombination is important in theassembly and evolution of resistanceregions

Individual mobile elements and specific gene capture pro-

cesses may be crucial in the entry of genes into the mobile

pool, but repeated identification of the same assemblies of a

few components, with the same boundaries between them,

in different contexts suggests that recombination between

common components also plays a large role in the assembly

and evolution of MRR. In addition to homologous recom-

bination, which can occur between essentially any closely

related sequences, some MRR also show evidence of resol-

vase-mediated site-specific recombination in the res sites of

Tn3-family and Tn5053-family transposons.

Homologous recombination

Homologous recombination requires breaking and joining

of DNA strands and its likelihood is dependent on the length


824 S.R. Partridge

Dow


ic.oup.com/fem


Tab

le1.

Exam

ple

sof

obse

rved

asso

ciat

ions

bet

wee

nan

tibio

tic

resi

stan

cegen

esan

dm

obile

elem

ents

Res

ista

nce

toM

echan

ism

Com

posi

teTn

ISEc

p1-lik

eIS

CR

elem

ents�

Gen

eca

sset

tesw

Tn3-lik

eTn

ISR

gen

eIS

Rgen

eIS

Rgen

eTn

Rgen

e(s)

Am

inogly

cosi

des

Ace

tyltra

nsf

eras

e1247

aac(

3)-

IIfz

16

aac(

3)-

VIa

aacA

1,4

,7

Sm2

aac(

3)-

IIbaa

cC1

Aden

ylyl

tran

sfer

ase

6an

t(40 )-IIb

aadA

1,2

,5

aadB

Phosp

hotr

ansf

eras

e26

aphA

1a,

bEn

ca1

aph(200 )

-eap

hA

15

5393

strA

B

903

aphA

1

16S

rRN

Am

ethyl

ase

26

npm

AEc

p1

rmtC

1ar

mA

14

rmtD

b-la

ctam

sC

lass

A26

bla

SH

VEc

p1

bla

CTX

-M-1

4‰

1bla

CTX

-M-2

bla

PSE-1

1,2

,3bla

TEM

Ecp1

bla

CTX

-M-1

51

bla

CTX

-M-9

,14‰

bla

VEB

4401

bla

KPC

20

bla

TLA

-1bla

GES

Cla

ssB

4bla

SPM

-1bla

IMP

15

bla

AIM

-1bla

VIM

Cla

ssC

26

bla

CM

Y-1

3Ec

p1

bla

AC

C-1

1bla

CM

Y-1

Ecp1

bla

CM

Y-2

1bla

DH

A-1

8bla

MIR

-1

Cla

ssD

Aba1

bla

OX

A-2

35

bla

OX

A-4

5bla

OX

A-2

,10,

30

1999

bla

OX

A-4

819

bla

OX

A-1

8

Quin

olo

nes

(low

leve

l)Pe

nta

pep

tide

pro

tein

Ecp1

qnrB

19

1qnrA

qnrV

C1

Ace

tyltra

nsf

eras

e1

qnrB

2,4

aacA

4cr

Efflux

3qep

A

Sulp

honam

ides

Dih

ydro

pte

roat

esy

nth

ase

2su

l2

Trim

ethoprim

DH

FRty

pe

A1

dfr

A10,1

9,2

3dfr

A1,1

2,1

7

2dfr

A9,1

8,2

0

DH

FRty

pe

Bdfr

B1-8

Tetr

acyc

line

Efflux

10

tetA

(B)

3te

tA(G

)1721

tetA

(A)

26

tetA

(C)

2te

tA(3

1)

26

tetA

(D)

Chlo

ram

phen

icol

Ace

tyltra

nsf

eras

e1

catA

1a

1ca

tA2a

catB

2,3

,5

26

catA

2b

Efflux

3floR

cmlA

1,2

,8

Rifam

pic

inA

DP-

ribosy

ltra

nsf

eras

e1247

arr6z

arr2

,4,5

Mac

rolid

es,lin

cosa

mid

esan

dst

repto

gra

min

sN

ucl

eotidyl

tran

sfer

ase

lnu(F

)1,2z

Eryt

hro

myc

ines

tera

se3

ere(

B)

ere(

A)1

,2

23S

rRN

Am

ethyl

ase

14

erm

(B)

� Det

ails

and

more

exam

ple

sca

nbe

found

inTo

lem

anet

al.(2

006b)an

dat

htt

p:/

/med

icin

e.cf

.ac.

uk/

en/r

esea

rch/r

esea

rch-g

roups/

i3/r

esea

rch/a

ntibac

terial

-agen

ts/is

cr-e

lem

ents

/w M

ore

exte

nsi

velis

tsca

nbe

found

inPa

rtridge

etal

.(2

009)an

dat

htt

p:/

/ww

w2.c

hi.u

nsw

.edu.a

u/r

acz T

he

nam

esaa

c(3)-

IIfan

dar

r6hav

ebee

npro

pose

dher

e,w

hile

lnu(F

)1an

dln

u(F

)2co

rres

pond

togen

esorigin

ally

calle

dlin

Fan

dlin

G,re

spec

tive

ly.

‰Both

the

bla

CTX

-M-1

4a

and

bla

CTX

-M-1

4b

varian

tshav

enow

bee

nfo

und

tobe

asso

ciat

edw

ith

eith

erIS

Ecp1

or

ISC

R1

(Val

verd

eet

al.,

2009).



Dow


ic.oup.com/fem


of the homologous region as well as the degree of related-

ness. The complexities of recombination mechanisms will

not be discussed here (reviewed by Clark & Sandler, 1994);

rather, some of the potential consequences of this process

will be described, as an aid to analysing MRR.

Recombination can occur between regions in the same

DNA molecule or on different DNA molecules in the same

cell. Recombination between two inversely oriented copies

of the same element on the same DNA molecule will result

in inversion of the segment between them (Fig. 2a). If the

repeated element is an IS or transposon that creates DR,

then examination of adjacent sequences may provide evi-

dence of inversion (Fig. 2a). Recombination between two

directly oriented copies of a duplicated element in the same

DNA molecule will release a circular molecule, which carries

one copy of the element and the region that lay between the

elements, and leave a single copy of the element (Fig. 2b).

Such circles may potentially reinsert at a different location

by recombination with another copy of the same element, or

with a sequence that matches any part of the circle.

Recombination between copies of the same element on

different DNA molecules (e.g. two plasmids) may result in

the fusion of these molecules (Fig. 2c). ‘Double crossover’

between each of two pairs of repeated elements flanking

different DNA segments can result in exchange of these

segments between the two locations (Fig. 2d). Recombina-

tion can also occur between elements that are closely related

rather than identical, forming hybrids that may be apparent

from an unequal distribution of nucleotide differences in

sequence alignments.

Site-specific recombination in res sites ofTn3-like and Tn5053-like transposons

In Tn3 family and Tn5053 family transposons, resolvase-

mediated site-specific recombination between res sites is

required to resolve the cointegrate intermediates of transpo-

sition (Grindley, 2002). The res sites of Tn3-like transposons

contain three subsites (resI, resII and resIII) (Rogowsky &

Schmitt, 1984), with recombination occurring at a specific

AT dinucleotide in resI in res sites that are aligned in the

same orientation (Grindley, 2002). The res sites of Tn5053-

family transposons include six IRs (r1-r6), with recombina-

tion taking place between r1 and r2 (Kholodii et al., 1995).

Recombination between the res sites of related, but

different, Tn3 family (e.g. Partridge & Hall, 2004, 2005) or

Tn5053 family (e.g. Mindlin et al., 2001; Labbate et al., 2008;

Petrovski & Stanisich, 2010) transposons can also contribute

to the evolution of MRR and exchange of components. If

adjacent parts of a sequenced region are found to match two

different transposons, then determining whether the bound-

ary between the two matching regions is close to resI could

indicate whether res-mediated recombination has taken

place. Simple diagrams showing the sequences of the res

sites of various Tn3-like and Tn5053-family transposons can

Table 2. Examples of sources of antibiotic resistance genes

Gene Source Reference

blaSHV Klebsiella pneumoniae Ford & Avison (2004)

blaOXA-48 Shewanella spp. Aubert et al. (2006)

blaDHA-1 Morganella morganii Verdet et al. (2000)

blaCMY-2-like Citrobacter freundii Barlow & Hall (2002)

blaACC-1 Hafnia alvei Nadjar et al. (2000)

blaACT-1 Enterobacter asburiae Rottman et al. (2002)

blaFOX Aeromonas caviae Fosse et al. (2003)

blaCTX-M-3 Kluyvera ascorbata Rodrıguez et al. (2004)

blaCTX-M-5 Kluyvera ascorbata Humeniuk et al. (2002)

blaCTX-M-8 group Kluyvera georgiana Poirel et al. (2002)

blaCTX-M-14 Kluyvera georgiana Olson et al. (2005)

blaCTX-M-25 group Kluyvera georgiana Rodrıguez et al. (2010)

qnrA Shewanella algae Poirel et al. (2005b)

qnrS Vibrio splendidus Cattoir et al. (2007)

(b)(a)

+

(d)(c)

Fig. 2. Common outcomes of homologous recombination. Identical (or

closely related) DNA segments are represented by the same shape

coloured blue or red. Horizontal arrows represent genes and recombina-

tion is indicated by a cross. (a) A single recombination between homo-

logous regions in opposite orientations in the same DNA molecule will

invert the intervening structure. The filled circles flanking the blue

element represent DR. Recombination reverses the direction of the right

end of this element, so that the adjacent sequence (shown as an open

circle) is the reverse complement of the original DR sequence. (b) A single

recombination between homologous regions in the same orientation in

the same DNA molecule will excise a circle, consisting of one copy of the

repeated element and the region originally found between the repeats,

and leave a single copy of the repeated element in the original location.

The reverse process may occur to reinsert the circular molecule at a new

location with homology to any part of the circle. (c) A single crossover

between the same element on each of two circular molecules will result

in a fused molecule. (d) Two recombination events (double crossover)

between pairs of homologous regions flanking different DNA segments

will result in the exchange of these segments.


826 S.R. Partridge

Dow


ic.oup.com/fem


be found in a number of references (e.g. Partridge & Hall,

2004, 2005; Labbate et al., 2008) and related sites in other

similar transposons can be identified from these.

Characteristics of common MRRcomponents and modules

The following sections provide details about some of the

most common components and combinations of these

components in currently available MRR, mainly focusing

on the Enterobacteriaceae. It is not possible to describe all

known components and some not listed here may be more

frequently identified in the future, but similar principles

would be expected to apply to identifying these elements

and analysing sequences that contain them.

IS26

IS26 is very common in MRR, with 4 10 copies present in

some plasmids. This 820-bp element has a single reading

frame encoding the transposase, perfect 14-bp IR (Table 3)

and generates 8-bp DR. IS26 creates replicon fusions (coin-

tegrates), suggesting that transposition is accompanied by

replication and that homologous recombination is necessary

to resolve the cointegrates (Chandler & Mahillon, 2002). A

number of IS later found to be identical or closely related to

IS26 were originally given different names (e.g. IS6, IS15D,

IS46, IS140, IS160, IS176). IS15 corresponds to one copy of

IS26 inserted inside another (Labigne-Roussel & Courvalin,

1983) and a remnant of this structure, consisting of adjacent

complete and partial copies of IS26, is found in Tn6020 in an

AbaR (Post & Hall, 2009). Examples of different fragments

of IS26 adjacent to a complete copy are also found in

available sequences.

IS26 is the flanking element in a number of different

composite transposons that each carry a single antibiotic

resistance gene (Table 1; Fig. 3). These are found inserted

directly into some plasmid backbones and also as part of

larger MRR, but IS26 can cause adjacent deletions (Mollet

et al., 1985b), removing the evidence of insertion provided

by DR.

IS1 and Tn9

IS1 was one of the first IS to be identified in bacteria and is

one of the smallest at 768 bp. IS1 has 23-bp IR (Table 3) and

usually creates DR of 9 bp, but 8, 10 and 14-bp DR have also

been observed (Chandler & Mahillon, 2002). IS1 includes

two overlapping ORFs, known as insA and insB, which are

fused by translational frameshifting to produce the func-

tional transposase. IS1 generates both simple insertions and

cointegrates and, like IS26, can cause adjacent deletions

(Turlan & Chandler, 1995). In plasmids and other sequences

relating to antibiotic resistance, IS1 is most often found

alone or as part of a derivative of Tn9, which consists of two

directly oriented copies of IS1 flanking a region that includes

the catA1a gene (Fig. 3d), in MRR.

IS10 and Tn10

IS10 is 1329 bp in length, has 22-bp IR (Table 3), transposes

by a ‘cut and paste’ mechanism that creates 9-bp DR and

shows some target site specificity (Chandler & Mahillon,

2002). IS10 is commonly found as part of the composite

transposon Tn10 (Lawley et al., 2000) that carries tetA(B)

encoding a tetracycline efflux protein, tetR(B) encoding a

tetracycline repressor protein, the tetC transcriptional reg-

ulator gene, tetD and several other genes (Fig. 3b).

ISAba1

ISAba1 was first identified in A. baumannii (Corvec et al.,

2003) and initially appeared to be restricted to this species

(Segal et al., 2005). This IS is 1180 bp in length, has 16-bp IR

(Table 3) and creates 9-bp DR. In addition to forming a

composite transposon (Tn2006) carrying the blaOXA-23 gene

(Corvec et al., 2007), the insertion of ISAba1 upstream of A.

baumannii chromosomal ampC genes (blaADC), blaOXA-51-

like genes and blaOXA-58-like genes provides a promoter that

enhances their expression (Corvec et al., 2003; Poirel &

Nordmann, 2006; Turton et al., 2006).

ISEcp1 and related elements

ISEcp1 (also called ISEc9), first identified in E. coli in about

1999 (AJ242809), is a member of the IS1380 family. ISEcp1 is

1656 bp in length and is flanked by 14-bp IR (Table 3). As

stated above, ISEcp1 uses IRL in combination with IRalt

sequences to move adjacent genes, inserting a ‘transposition

unit’ at new locations, flanked by 5-bp DR. The availability

of matching chromosomal regions including some captured

genes (e.g. Fig. 4a) indicates that different-sized transposi-

tion units may be moved following the insertion of ISEcp1

adjacent to a gene (Fig. 4b). In other cases, additional

segments adjacent to insertion of the first transposition unit

may be picked up in subsequent transposition events (Fig.

4c). This process is also evident from transposition experi-

ments using cloned ISEcp1-resistance gene combinations,

where adjacent vector sequence may also be captured and

moved (Poirel et al., 2005a; Wachino et al., 2006). ISEcp1

therefore has the potential to mobilize regions that include

more than one resistance gene.

As IRalt do not fit an easily defined consensus (Lartigue

et al., 2006), different methods may be needed to identify the

end of the transposition unit distal to IRL. If the ancestral

resistance gene has been identified in a chromosomal

sequence, it may be possible to identify (or confirm) the

end of the transposition unit from the boundary of



Dow


ic.oup.com/fem


homology with this sequence (see Fig. 4a). If the transposi-

tion unit is inserted within another mobile element or well-

characterized region, the IRalt end should become apparent

when the remainder of the sequence is annotated (see Fig.

4b). Searching the sequence beyond the resistance gene for a

DR of the 5-bp sequence found immediately adjacent to IRL

may identify the boundary of a potential transposition unit.

The sequences flanking this region can then be joined (minus

one copy of the DR) and used to search for identical or closely

related sequences that represent an uninterrupted ancestor. If

none of these approaches yield results, it may be possible to

identify putative IRalt by the boundary of identity to another

known sequence (Partridge, 2007; Zong et al., 2010).

In some cases, an ‘inside-out’ ISEcp1 structure has been

identified, for example ISEcp1 associated with blaCTX-M-3b in

pK29 (EF382672) and with blaCTX-M-62 (1 nt difference) in

pJIE137 (EF219134). The arrangement in pJIE137 suggests the

insertion of a transposition unit into another copy of ISEcp1,

Table 3. Sequences defining the ends of common mobile elements

Mobile element

IR or ends

DR (bp)Length (bp) Sequence (out ! in)�

IS1 23 GGTGATGCTGCCAACTTACTGAT 9 (8, 10, 14)

GGTAATGACTCCAACTTATTGAT

IS10 22 CTGATGAATCCCCTAATGATTT 9

CTGAGAGATCCCCTCATAATTT

IS26 14 GGCACTGTTGCAAAw 8

IS1326 26 TGTTGAGTTGCATCTAAAATTGACCC –

TGTTGATTTGCACCCAAATTTGACCC

IS1353 24 TGGGG-TGCGGACAAAATCTTGGA 2

TGGGGGTGCGGACGATTTCTTGGA

IS6100 14 GGCTCTGTTGCAAA 8

IS903 18 GGCTTTGTTGAATAAATC 9

ISAba1 16 CTCTGTACACGATAAA 9

CTCTGTACACGACAAA

ISEcp1 14 CCTAGATTCTACGT 5

CCTAAATTCCACGT

IS4321 11 taatgagATGGTCACTCCz –

IS5075 tctATGGTCACTCC

ISCR1 – 30-CS-AATATCTCCTTTTGGGTTG‰ –

GGGTATAGGAAGTATAAAC (oriIS)

ISCR2 – GGGAGTGACGGGCACTGGC (terIS) –

ACGTATAGGAAGAATAAAC (oriIS)

ISCR3 groEL-GGTTGGCCCGGTCGTCAGG‰ –

GCGTATAGGAAGTTCAAAC (oriIS)

IRi 25 TGTCGTTTTCAGAAGACGGCTGCAC 5

IRt TGTCATTTTCAGAAGACGACTGCAC

IRchrA 38 GGGATCGCCTCAGAAAACGGAAAATAAAGCACGCTAAG –

Tn21 38 GGGGTCGTCTCAGAAAACGGAAAATAAAGCACGctaAG 5

Tn5060 GGGGGCACCTCAGAAAACGGAAAATAAAGCACGCTAAG

Tn1696 38 GGGGTCGTCTCAGAAAACGGAAAATAAAGCACGctaAG 5

Tn5036 GGGGTCGTCTCAGAATTCGGAAAATAAAGCACGCTAAG

Tn1721 38 GGGGAGCCCGCAGAATTCGGAAAAAATCGTCAGctaAGz 5

GGGGGAACCGCAGAATTCGGAAAAAATCGTACGCTAAG

Tn1,2,3 38 GGGGTCTGACGCTCAGTGGAACGAAAACTCACGttaAG 5

Tn5393 k81 GGGGTCGTTTGCGGGAGGGGGCGGAATCCTACGctaAG

GGGGTCGTTTGCGGGAGAGGGCGAAATCCTACGCTAAG��

�If both IR are identical, the sequence is only shown once. For IS where the IR differ, IRL is shown above IRR. For transposons where the IR differ, IRtnp is

shown above, with the stop codon of the tnpA gene in lowercase. For Tn21-like transposons the position of IS4321/IS5075 insertion is in bold.wThe underlined A in IRL is G in a few examples of IS26.zThe lowercase letters indicate the bases that lie outside the IR, but that are still part of the IS (Partridge & Hall, 2003b).‰As the terIS ends of ISCR1 and ISCR3 have not really been defined, the boundaries with conserved adjacent sequences (the 30-CS or groEL are given).zTn1721 includes two identical copies of IRtnp, represented by the top sequence.kTn5393 has 81-bp IR (1 nt difference), but the outer 38 bp are related to IR of other Tn3 family transposons and only these are shown here.��The underlined A residues in IRstr can be Gs and the underlined G can be an A. RSF1010 includes an IR with all of these changes (Fig. 8)


828 S.R. Partridge

Dow


ic.oup.com/fem


followed by recombination between duplicated regions (Zong

et al., 2010). Similarly, in some IncA/C plasmids and partially

sequenced regions, blaCMY-2 is duplicated and associated with

complete and partial copies of ISEcp1 (Welch et al., 2007;

Verdet et al., 2009; Call et al., 2010). The insertion of one

ISEcp1-blaCMY-2 transposition unit into a related unit, fol-

lowed by different recombination events could explain these

different structures (Fig. 4d). A Tn10-mediated composite

transposon inserted into an SXT/R391-related ICE (Harada

et al., 2010) and a similar structure in a partial plasmid

sequence (Verdet et al., 2009) could also be derived from one

of these structures (Fig. 4d).

A few related elements that appear to operate by the same

mechanism as ISEcp1 have been identified adjacent to

antibiotic resistance and other genes. ISEnca1, found up-

stream of aph(200)-Ie (AY939911) (Chen et al., 2006), is 91%

identical to ISEcp1. IS1247 is found in several sequences

(e.g. AJ971344) as part of a transposition unit carrying an

aac(3)-II gene [suggested name aac(3)-IIf; see section on

aac(3)-II genes and regions] and a putative rifampin ADP-

ribosyl transferase (suggested name arr6) inserted into the

ere(A)2 cassette and flanked by 4-bp DR (van der Ploeg

et al., 1995). A partial ISSm2 (�88% nucleotide identity to

IS1247) is found adjacent to the aac(3)-IIb gene (van der

Ploeg et al., 1995).

Gene cassettes and cassette arrays

Over 130 different (o 98% identical) gene cassettes carrying

antibiotic resistance genes and found in mobile resistance

integrons are listed in a recent review, with suggested

nomenclature, references to exemplar sequences and in-

structions for identifying cassette boundaries and attC sites

(Partridge et al., 2009). Several modifications to cassettes

have been observed, including insertions of group IIC-attC

introns and IS1111-attC elements into the attC site, specific

deletions in the attC site and the creation of hybrid cassettes

(see Partridge et al., 2009 and references therein). Certain

cassettes appear to be much more common than others in

available sequences and surveys and some cassette arrays

(e.g. |dfrA17|aadA5| and |dfrA12|gcuF|aadA2|) also seem to

be particularly common (Partridge et al., 2009).

Class 1 integrons -- creation and definitions

The first integrons were discovered due to their association

with antibiotic resistance genes (Stokes et al., 2006). Sub-

sequent identification of other ‘mobile resistance integrons’

and many different chromosomal integrons led to classifica-

tion by IntI sequences and the original integrons became

known as class 1. The ancestor of the first type of class 1

integron structures to be identified was created by the

acquisition of intI1 and attI1 from a chromosomal integron

by a Tn5053-family transposon (Fig. 5a) (Stokes et al., 2006;

Gillings et al., 2008). This coupling of the gene-acquisition

and expression properties of the integron with the mobility

of the transposon was clearly an important ‘winner’ event

(Labbate et al., 2008). The best-known example of this type

of structure was named Tn5090 when it was first sequenced

(X72585; Radstrom et al., 1994) but, as these authors had

suggested, it was later found to equate to Tn402, previously

identified as a transposable region on the same plasmid,

R751 (Shapiro & Sporn, 1977). Names such as Tn5090/

Tn402 or Tn402(Tn5090) have been used, but are cumber-

some and this transposon is referred to as Tn402 in the

remainder of this review. Tn402 is bounded by the 25-bp IR

of the ancestral transposon, named IRi, at the intI1 end, and

IRt, at the tni end (Fig. 3b; Table 3).

6 6

26 26lacY repF bla deoR ygbJ ygbK ygbL ygbM

AAAGCGGGCGAAGGTG

26GCTCGGGGGGCCGCAA

26

(a)

26

GTAAGCTG GAAAAACG

26tetR(D)tetA(D)

10ydjABydhA yeaA tetR(A) tetC tetD

ACGTAACGGACGACTCGT

tetA(A)10Tn10

(b)

Tn6020catA2b

Tn4352 26

CTCTGATG CATAAATT

26aphA1a

26

GATAAAAA CTAAATTC

26aphA1b

(d)(c)

26CTGTTTAG

26TTTCAGAA

catA1a11Tn9

CGACGCACT CGTCCGGGG

1 kb

Fig. 3. Composite transposons. The extents and

directions of various antibiotic resistance (wide ar-

rows) and other (thin arrows) genes are indicated. IS

are shown as pointed boxes labelled with the IS

number. Sequences of DR length are used to indicate

the boundaries between the IS and the captured

region. (a) IS26-flanked composite transposons car-

rying different length regions from the Klebsiella

pneumoniae chromosome that include blaSHV. (b)

Composite transposons carrying different tetA and

tetR genes, the sources of which are currently

unknown. (c) IS26-flanked composite transposons

carrying aphA1 gene variants. (d) Composite trans-

posons carrying catA genes. The sequences used to

draw the diagrams were from the following Gen-

Bank accession numbers: larger blaSHV and tet(D)

composite transposons, CP000603; smaller blaSHV

and catA2b composite transposons, EU855787;

Tn10 and Tn9, AP000342; Tn4352, AJ851089;

Tn6020, FJ172370.



Dow


ic.oup.com/fem


blaCMY-2 blcampR sugE ecnRBAC. freundii

(a)

(b)

ISEcp1

GATTA

blaCMY-36

GATTApH205 (ColE1-like)(2.369 kb)

ISEcp1

GATAA GATAApSC138 (IncI)

ISEcp1

TGGGT

blaCMY-2

pCVM29188_101 (IncI)(2.254 kb)

TGGGT

pAR060302 (IncA/C)(2.823 kb)

TN44889(1.422 kb C. freundiiplus 0.503 kb E. coli)

ATTTC ATTTC

ISEcp1blaCMY-2

blaCMY-2(2.431 kb)

blaCMY-2

ISEcp1

ATTTG ATTTG(c)

E. coli

ISEcp1

TATGA TATGAATTTC

ISEcp 1

ATTTC ATTTC

blaCMY-2

pAR060302

blaCMY-2

blaCMY-2

blaCMY-2

blaCMY-2

500 bp

(d)

peH4H

blaCMY-2

ATTTCATTTC

ATTTCATTTC

pAM04258 ISEcp1blaCMY-2

ATTTC

ISEcp1

11 22

pSN254 ISEcp1blaCMY-2

ICEPmiJpn1blaCMY-2

IS10 IS10

TCGATCCGCTCGATCCGC

Fig. 4. ISEcp1 transposition units. (a) The chromosomal region of Citrobacter freundii (dotted line) that includes the blaCMY-2 gene. The extents and

directions of various genes are shown by labelled arrows. (b) Examples of ISEcp1 transposition units carrying blaCMY-2 and variants. ISEcp1 is shown as a

pointed box, IRL and IRR by solid vertical bars, IRalt as broken vertical bars and DR sequences are given. The type of plasmid and the size of the C. freundii

chromosomal region captured are indicated. (c) The transposition unit in TN44889 includes a segment 100% identical to various Escherichia coli

chromosomes adjacent to blaCMY-2 and IRalt could be identified because the flanking sequence corresponds to an IS200-like element. (d) A possible

explanation for complex ISEcp1-blaCMY-2 arrangements in IncA/C plasmids with two copies of blaCMY-2. The IncA/C backbone is represented by a shaded

box (not shown to scale). Insertion of a transposition unit derived from pAR060302 that includes 7.148 kb of IncA/C backbone (shown in blue) back into

the pAR060302 structure, in the inverse orientation, would create the structure seen in pAM04258. Recombination between the 5 0-ends of ISEcp1

duplicated in opposite orientations (marked 1) would create the structure seen in peH4H. Recombination between the duplicated, inversely oriented

regions that include blaCMY-2 (marked 2; recombination shown as occurring at the end of the blaCMY-2 gene for simplicity) would create the structure

seen in pSN254. The structure in ICEPmiJpn1 could have been created by the insertion of two copies of IS10 into the pAM04258 or pSN254 structure,

followed by transposition to a new location. The sequences used to draw the diagrams were from the following GenBank accession numbers: C.

freundii chromosome, U21727 and AY125469; pCVM2988_101, CP001121; pH205, EU331426; pSC138, AY509004; pAR0060302, FJ621588;

TN44889, FM246884; pAM04258, FJ621587; peH4H, FJ621586; pSN254, CP000604; ICEPmiJpn1, AB525688.


830 S.R. Partridge

Dow


ic.oup.com/fem


IR

tniR tniQ tniB tniA

(a)

IR

intI1

attI1

+

CA

qacE

IRt(b)

(c)

IRi 5′-CS tni402

CA

IRtIS

IRiCA

tniB�1

1326

1353

3′-CS

IS

In0/In2-like

IRi IRt

(d)

IRt

6100 6100

IRt

dfrA14

IRi

IRi

CACA

3′-CS23′-CS1IR

1326

sul1qacE�1 tniB�2orf5 orf6

IRt

CA3′-CS

3′-CS

In5-like

In4-like

IRi

sul3IS440tnp

mef(B)

6100

IRt

(e) IRi

1 kb

CA

CA

qacI

IRiCA CR1

3′-CS(f)

chrA tnpAtnpR

IR

IR

IR

orf98

chrA orf98

6100CA

Fig. 5. Creation and structures of class 1 In/Tn. The attI1 site is represented by an oval. Cassette arrays are represented by a box labelled CA, but

selected cassettes are shown as small open boxes, with a filled box at the 30-end representing the attC site. Antibiotic resistance genes outside cassettes

are shown as wide arrows and various other genes by thin arrows. Different regions are represented by lines of different thickness with their names

given above and IS are shown as pointed boxes containing their name or number. (a) The top line represents an ancestral chromosomal class 1 integron

that was acquired by a Tn5053-family transposon (shown below) to yield a functional Tn402-like transposon with qacE as the final cassette in the array

(b), which may have required more than one step. Further steps, including capture of sul1 and various deletions and insertions, were required to

generate the structures in part (c), which contain different extents of the 3 0-CS found in ‘clinical’ or ‘sul1-type’ integrons. The start of the 30-CS

corresponds to the start of the qacE cassette and the truncated qacED1 gene overlaps with sul1. In2 and In5-like class 1 In/Tn have different extents of

the 30-CS and tni402 (see Table 4) and IS1326 or IS1326 plus IS1353 (shown on the right) may be found at the positions indicated by the arrows labelled

‘IS’. In4-like class 1 In/Tn include only short remnants of the IRt end of tni402 duplicated in opposite orientations flanking IS6100 (arrowheads show the

relative directions of IR). IS6100-mediated deletions may result in the structure shown to the right, where the sequence beyond the dfrA14 cassette is

interrupted by IRt. (d) ‘Complex’ class 1 In/Tn include ISCR1 and resistance gene(s), typically flanked by partial duplications of the 3 0-CS (see Fig. 6 for

more details). (e) A region that includes the IS440 transposase (the ends of IS440 have not been defined) and the sul3 and mef(B) resistance genes,

rather than the 30-CS, may follow the cassette array. (f) The chrA region is often associated with class 1 In/Tn and the lower diagram shows a transposon

from which this region may be derived. IRchrA is often followed by IRt-IS6100 and the mph(A) region (see Fig. 10). Parts (b)–(f) were drawn using

sequences from the GenBank accession numbers listed in Table 4.



Dow


ic.oup.com/fem


While a number of complete Tn402-like transposons

carrying intI1 and attI1 have now been identified, the most

commonly encountered structures in available sequences are

‘clinical’ or ‘sul1-type’ class 1 integrons. These were derived

from a Tn402-like transposon that included qacE as the final

cassette by the incorporation of the sul1 (formerly sulI)

sulphonamide resistance gene, truncation of qacE and

loss of part of tni402 (Stokes et al., 2006; Gillings et al.,

2008) (Fig. 5c). The original ‘structural’ definition of a class

1 integron included all of the Tn402-like transposon from

IRi to IRt, if the latter was present, while the current

‘functional’ definition of an integron includes only the

minimal integron components intI and attI, which are

sufficient to specify the class. The first definition is useful

when annotating MRR sequences, as it indicates the extent

of ‘mobile unit’ that can potentially be transposed and the

term ‘class 1 In/Tn’ will be used to refer to these structures in

the remainder of this review.

Linking of genes conferring resistance to antiseptics and

to an early class of antibiotics (sulphonamides) to different

cassette-encoded resistance mechanisms was clearly a ‘win-

ner’ event, despite the fact that it resulted in defective

transposon derivatives that are no longer able to transpose

themselves. However, as predicted (Kholodii et al., 1995;

Brown et al., 1996; Partridge et al., 2002a), the movement of

such transposons with intact IRi and IRt catalysed by Tni

proteins provided in trans has now been demonstrated, with

RecA-mediated recombination resolving cointegrates

formed in the absence of the res site (Petrovski & Stanisich,

2010). Coupled with the res site-hunter characteristics of

Tn5053-family elements, this has allowed the spread of class

1 In/Tn and the resistance genes they carry as ‘passengers’ on

Tn21-like transposons (see section on Tn21-subgroup trans-

posons carrying class 1 In/Tn).

Class 1 In/Tn structures

In ‘clinical’ class 1 In/Tn two conserved segments (CS) with

defined sequences flank the cassette array, also known as the

variable region. The 50-CS starts at IRi and includes intI1

and a Pc promoter responsible for the expression of cassette

genes (see Jove et al., 2010 for a recent summary of

Pc variants). The 50-CS ends with the sequence AAACAAAG

within the core site of attI1 (see Partridge et al., 2009) and

the adjacent T corresponds to the start of the first cassette

of the array (or position 1 of the 30-CS if the integron is

‘empty’). The final cassette is followed by the 30-CS,

with position 1 defined as the first T of the sequence

TTAGAT, corresponding to the start of the remnant qacE

cassette. The truncated qacED1 gene overlaps with sul1

and two ORFs of unknown function (orf5 and orf6) are

present in the longest examples of the 30-CS. The 30-CS may

be followed by certain IS or may directly abut various

extents of the truncated tni402 region, which ends with IRt

(see Table 4 for examples).

The first few class 1 In/Tns to be characterized were given

integron numbers (Stokes & Hall, 1989) intended to specify

the entire structure from IRi to IRt (if the latter was

present), including defined extents of the 30-CS and tni402

and different IS (Table 4). ‘Integron’ numbers are now

commonly used to refer only to cassette arrays (a list is

available from the Annotation page of INTEGRALL;

Table 5), but in most cases, simply stating the cassettes in

the array is more helpful. Some early integron numbers,

however, remain useful for referring to structures that

persist in currently available sequences (Table 4).

In0 and In2 contain the same extents of the 30-CS and

tni402, while In5 has a longer version of 30-CS and less of

tni402 (Fig. 5c), and either no IS, IS1326 alone or both IS1326

and IS1353 may be associated with both of these types of

class 1 In/Tn (Table 4). In4 includes a partially duplicated

IS6100 element flanked by inverted 123 and 152-bp frag-

ments of the end of the tni402 region that both include IRt

(Partridge et al., 2001a) and a similar structure without the

IS6100 duplication is found in several class 1 In/Tn (Fig. 5c).

Variants lacking part or all of the 30-CS (Fig. 5c; Table 4) are

also found, presumably resulting from IS6100-mediated

deletions into the 30-CS or cassettes, for example the dfrA14

cassette is often followed by a sequence interrupted by

IS6100 (Partridge et al., 2001b). So-called ‘complex’ class 1

Table 4. Different class 1 In/Tn structures

In 30-CS tni402 IS Example

Tn402-like – �1-4733 – U67194

In0 1-2025 2056-4733 IS1326 U49101

In2 1-2025 2056-4733 IS1326, IS1353 AF071413

pB8w 1-2021 2056-4733 – AJ863570

In70z 1-2022 2060-4733 – AJ278515

pSN254 1-2384 2056-4733 IS1326, IS1353 CP000604

In5 1-2384 2495-4733 IS1326 U38230

In31‰ 1-2384 2495-4733 – AJ223604

In4 1-2239 4733-4611 IS6100 U12338

4582-4733

ISCR1z 1-1313 variable variable L06418

sul3 – not present IS440 FJ196385

chrA 1-1593 not present IS6100 AB366440

�Positions 1-4733 of tni402 correspond to 34376-39108 of R751 in

U67194.4.wCA at the junction between the 30-CS and tni402 belongs to neither

segment, but could be a remnant of IS1326.zAT at the junction between the 30-CS and tni402 could belong to either

segment and position numbers include them in both.‰GC at the junction between the 30-CS and tni402 could belong to either

segment and position numbers include them in both.z‘Complex’ class 1 In/Tn with ISCR1 and associated resistance genes

generally have a second partial copy of the 30-CS that may be followed

by a region matching one of the typical class 1 In/Tn structures.


832 S.R. Partridge

Dow


ic.oup.com/fem


In/Tn carry ISCR1 and resistance genes that are not part of

cassettes, usually between partial duplications of the 30-CS

(see section on ISCR elements and ‘complex’ class 1 In/Tn).

Structures in which related cassette arrays are followed by

a region that includes a transposase gene (usually annotated

as IS440, although the boundaries of the IS have not been

identified), sul3 (formerly sulIII; sulphonamide resistance)

and the mef(B) macrolide efflux gene (Liu et al., 2009),

rather than the 30-CS, are increasingly being reported (see

Partridge et al., 2009 for examples).

The conserved nature of the 50-CS and 30-CS flanking

cassette arrays means that entire cassette arrays can be

exchanged between class 1 In/Tn by recombination in both

of these regions (see Fig. 2d; Partridge et al., 2002a, b),

explaining the occurrence of common cassette arrays in class

1 In/Tn with different structures or in different locations.

Recombination may also occur between related cassettes

common to different arrays to create hybrid cassettes

(e.g. Gestal et al., 2005).

The chrA region

A region that includes a gene potentially encoding chromate

resistance (chrA) and an ORF (usually annotated as orf98 or

padR) has now been identified in several MRR, usually

adjacent to the 30-CS of class 1 In/Tn (Fig. 5f). The

boundary between this chrA region and the 30-CS is defined

by a Tn21-like 38-bp IR (designated IRchrA here; Table 4).

The entire region is 86% identical to part of a Tn21-like

transposon found in pCNB1 (EF079106), an IncP1-b plas-

mid from Comamonas (Ma et al., 2007), suggesting that a

related transposon may be the origin of this fragment and it

is interesting that IRt adjacent to IS6100 lies close to the

presumed res site (Fig. 5f). The chrA region is usually

followed by IRt-IS6100 and a region designated mph(A)

here (see section on Macrolide phosphotransferase regions).

ISCR elements and ‘complex’ class 1 In/Tn

Unusual class 1 integrons containing a ‘common region’

between duplications of the 30-CS were identified in the

1990s (Stokes et al., 1993). The name was later shortened to

CR1 when two related regions, designated CR2 and CR3,

were identified (Partridge & Hall, 2003a). When it became

apparent that these regions are related to IS91-like elements,

they were renamed ISCR (Toleman et al., 2006b). Over 20

different ISCR elements have now been identified and

related elements can be grouped into families, with differ-

ences in the G1C content between families suggesting

different origins.

IS91 (Mendiola et al., 1994; Garcillan-Barcia et al., 2002)

and the related elements IS801 (Richter et al., 1998) and

IS1294 (Tavakoli et al., 2000) are unusual in that they

transpose by a rolling circle mechanism. The identification

of these elements in different locations and/or transposition

experiments enabled their ends to be defined and 4-bp target

sequences to be identified (Mendiola & de la Cruz, 1989;

Tavakoli et al., 2000; Garcillan-Barcia et al., 2002). terIS

upstream of the rolling circle replicase gene and oriIS

downstream are conserved between these elements and each

includes short inversely repeated sequences (Garcillan-Bar-

cia et al., 2002). Replication proceeds from oriIS through

the IS, ending at terIS, and can generate insertions or

free circular intermediates (Garcillan-Barcia et al., 2002)

(Fig. 6a). IS91-like elements can capture genes when replica-

tion proceeds past terIS into the adjacent region (Fig. 6b),

which occurs in about 1–10% of transposition events

(Tavakoli et al., 2000; Garcillan-Barcia et al., 2002) and ISCR

elements presumably capture adjacent genes in the same way

(Toleman et al., 2006b).

Simple insertions of ISCR elements have not yet been seen

and regions containing these elements can be quite complex,

including multiple ISCR copies, some of which are trun-

cated, duplications of other regions and multiple resistance

genes. The oriIS ends of ISCR1, ISCR2 and ISCR3 (Table 3)

and other ISCR have been identified from boundaries with

regions carrying different resistance genes found down-

stream of rcr and from similarity to each other and to oriIS

of IS91, IS801 and IS129 (Partridge & Hall, 2003a; Toleman

et al., 2006b). However, as successive aberrant transposition

events may allow ISCR to acquire multiple segments adja-

cent to terIS (Fig. 6d), it can be difficult to identify the

original ends of these elements and unravel the events that

created the structures containing them, unless the origin and

boundaries of each segment can be identified.

ISCR2 has been found associated with a limited number

of resistance genes (Table 1; Partridge & Hall, 2003a; Tole-

man et al., 2006b) and several different sequences have been

found upstream of the rcr gene of ISCR2, allowing a terIS to

be proposed (Table 3). Regions including ISCR2 have

mainly been identified on IncA/C plasmids and their

relatives, the SXT ICE (Wozniak et al., 2009). These regions

seem to be related and often consist of complete or partial

copies of ISCR2 separating regions containing different

resistance genes. The generation of these structures may rely

on direct insertion or homologous recombination between

copies of ISCR2. Fragments of IS91 with an oriIS end can

move if replicase is provided by an intact copy of the

element (Schlor et al., 2000; Garcillan-Barcia et al., 2002)

and similar events could potentially explain some structures

carrying ISCR2. Defined fragments of ISCR2 are also found

on small IncQ plasmids or in a common multicomponent

structure (see section on Tn5393 and modules containing

fragments of this transposon).

ISCR1 has only ever been found adjacent to position 1313

of the 30-CS of class 1 In/Tn and this boundary has been

used to define the end of the element. This end does not



Dow


ic.oup.com/fem


include typical terIS features and it has been suggested that

ISCR1 may be a truncated version of an element that

inserted adjacent to the 30-CS and then was fused to this

region by a deletion (Toleman et al., 2006b). However, the

2154-bp region from the boundary with the 30-CS to the end

of oriIS is about 300–650 bp longer than related elements

(IS91, 1830 bp; IS801, 1512 bp; IS1294, 1688 bp; ISCR2 from

terIS in Table 3, 1847 bp). Thus, it is possible that the

element defined as ISCR1 had already acquired region(s)

before being inserted into the 30-CS, with selection pressures

(b)(a) oriISterIS

RCR

(d)

sul2ISCR2

ISCR2(c)

+

(e)

(g)

(h)

ISCR3-likeISCR1

3'-CS

floR3

(i)(f)

CAISCR1CAbl

CA

dfrA3b

catA2a

rmtD214B14

sul1 tetA(G)

14rmtD1 groELΔ

14Δ

CA

CA

ant(4')-IIb6 6Δ CAISCR1CA

ISCR1CA

qnrA1CA ISCR1

blaDHA-1 ampR

1 kb

cmlA9

Fig. 6. Possible outcomes for events involving ISCR elements. Most elements are represented as in earlier figures. (a) An IS91-like or an ISCR element

undergoes simple rolling circle replication (dotted line with arrow), creating a circular intermediate. (b) After insertion into a new location, a subsequent

round of rolling circle replication continues through terIS and into the adjacent region, capturing part of it. (c) Some ISCR2-sul2 structures could be the

result of an insertion of this type of structure, but the sul2 gene is found at the oriIS end. (d) Subsequent rounds of rolling circle replication capture

additional regions. (e) The circular intermediate is rescued by recombination with one of the captured regions, so that duplications of this region flank

ISCR and the other captured regions. (f) Examples of ISCR1 in class 1 In/Tn, where recombination in the 30-CS (acquired in an early capture event) has

resulted in partial duplications of this region flanking the ISCR1-resistance gene region. The black box represents a region associated with different

resistance genes, which could have been captured separately in an early event or as part of a resistance gene region. (g) A circular intermediate with one

captured region is rescued by recombination with a related, but not identical, ISCR (shaded), forming hybrid elements. (h) A circular molecule created by

recombination between related ISCR is inserted by recombination with another related ISCR (different shading), creating mosaic structures. (i) Several

elements closely related to ISCR3 are hybrids or mosaics (ISCR3 is shown as the ancestor here). They share the same immediate boundary (red ovals) with

a groEL region related to those of Xanthomonas spp., but differences in these regions further from ISCR (different shading) could indicate additional

recombination between related groEL regions. cmlA9 is 89% identical to floR and rmtD2 is 98% identical to rmtD1 (represented by different shading).

Capture of segments of the 50-CS presumably allowed insertion into class 1 In/Tn in a manner similar to ISCR1 in the 30-CS. The sequences and

information used to draw the diagrams were from the following GenBank accession numbers: ISCR2-sul2, AB277723; ISCR1-catA2, L06822; ISCR1-

dfrA3b, AY162283; ISCR1-qnrA1/dfrA3b, AY878717; ISCR3-tetA(G)/floR (SGI1), AF261825; ISCR6-ant(4 0)-IIb (Tn6061), GQ388247; ISCR14-rmtD1,

DQ914960; ISCR14-rmtD2, HQ401565.


834 S.R. Partridge

Dow


ic.oup.com/fem


and sampling bias potentially explaining why the same

structure has always been seen. In either case, the association

of ISCR1 with the 30-CS created a ‘winner’ combination that

is able to capture different resistance genes (Table 1) and

insert them into any class 1 In/Tn with a 30-CS and that can

potentially mobilize different parts of the class 1 In/Tn that

lies upstream (Toleman et al., 2006b).

In class 1 In/Tn with ISCR1, the acquired resistance genes

lie adjacent to the oriIS end of ISCR1. This is explained by a

model that requires a combination of rolling circle transpo-

sition and homologous recombination (Toleman et al.,

2006b). Replication from oriIS through ISCR1 and into the

30-CS would create a circular molecule that contains part of

the 30-CS (represented by Fig. 6b). This could insert adjacent

to a resistance gene and another round of rolling circle

replication with a different sequence acting as terIS would

create a circular molecule containing ISCR1, part of the 30-

CS and an adjacent captured region (represented by Fig. 6d).

Additional rounds of the same process could add further

regions containing resistance genes. The rescue of circular

intermediates by homologous recombination with the 30-CS

of a class 1 In/Tn would result in the observed structures, in

which partial duplications of the 30-CS flank the ISCR1-

resistance gene(s) region (Fig. 6e). Several examples of class 1

In/Tn include ISCR1 associated with more than one resis-

tance gene (e.g. Fig. 6f). Different extents of the class 1 In/Tn

adjacent to ISCR1 could also be captured, allowing recom-

bination in the 50-CS or cassette array, or recombination

with an ISCR1 element already in a class 1 In/Tn could yield

a variety of structures (see Toleman et al., 2006b for

examples). Once an ISCR1-resistance gene combination has

been placed in a class 1 In/Tn, it could also move to other

class 1 In/Tn as a circular molecule generated by homo-

logous recombination between the flanking duplicated 30-

CS (see Fig. 2b; Partridge & Hall, 2003a).

A number of elements 75–95% identical to ISCR3 have

been identified (Toleman & Walsh, 2008). ISCR3 itself has

been found associated with several different resistance genes,

while generally only one or two examples of other ISCR3-

like elements are currently available in GenBank, each

associated with a particular resistance gene (Table 1). A

region related to the groEL gene of Xanthomonas spp. is

found adjacent to the presumed terIS end of ISCR3 and

some related elements, suggesting that an ancestor inserted

adjacent to groEL and picked up part of this gene (Toleman

& Walsh, 2008). Examination of alignments of ISCR ele-

ments with the same boundary with groEL as ISCR3 itself

reveals an uneven distribution of nucleotide differences,

suggesting that some are hybrid or mosaic structures.

Complete and partial duplications of these elements are

associated with several resistance genes (Fig. 6i) and rescue

of circular transposition intermediates (represented in Fig.

6g) and other events (Fig. 6h) involving recombination

between related rather than identical elements could gen-

erate these structures. Additional recombination between

different, but related groES-groEL regions (Toleman &

Walsh, 2008) may explain differences in groEL sequences

further from the ISCR element (Fig. 6i).

Tn21-subgroup transposons carrying class 1 In/Tn

Class 1 In/Tn have been found inserted into several different

Tn21-like transposons (summarized in Petrova et al., 2011).

Tn21 itself (Liebert et al., 1999) consists of a backbone

closely related to Tn5060 (Kholodii et al., 2003) that

includes a transposition region (tnp21) and a mercury

resistance region (mer21). A 782-bp region that includes the

urf2M gene separates the res site from the merD gene

(Liebert et al., 1999; Partridge et al., 2001a) and In2 is

inserted into this region, with DR (TCCAT) flanking IRi and

IRt (Fig. 7a).

Several class 1 In/Tn in Pseudomonas aeruginosa are

inserted into a transposon related to Tn5051, which has

only been partially sequenced, but appears to be a hybrid of

the mer region of Tn501 (Brown et al., 1985) and a different

tnp region (Mindlin et al., 2001) created by recombination

in the res site. Tn501 has orf2, equivalent to urf2M, between

the res site and merD and in six examples in GenBank a class

1 In/Tn carrying a blaIMP-13, blaVIM-1, blaVIM-2 or blaGES-1

gene cassette is inserted into the same position in this region

(Fig. 7a). Single examples of class 1 In/Tn inserted at two

other positions, both in the res site, have also been identified

(Fig. 7a).

Tn1696 (Partridge et al., 2001a), Tn6005 (Labbate et al.,

2008) and two other known transposons are based on a

backbone closely related to Tn5036 (Yurieva et al., 1997)

with class 1 In/Tn in different positions, indicating inde-

pendent insertion events. Similarly, in Tn1403 (Stokes et al.,

2007), Tn5045 (Petrova et al., 2011), Tn6060 (Roy Chowdh-

ury et al., 2009) and Tn6001 (Tseng et al., 2007), class 1 In/

Tn are inserted into different positions in a backbone related

to Tn1013 (Haines et al., 2007), which does not have a mer

operon. These transposons lack the urf2M/orf2 region found

in Tn21 and Tn501 and the class 1 In/Tn are inserted into

the res site, which would be expected to prevent res-

mediated resolution of cointegrates (Liebert et al., 1999;

Partridge et al., 2001a). This may help to explain why

transposons with both tnp1696 and mer1696 are not that

common in available sequences (Cain et al., 2010), with

these regions often forming hybrids, for example of Tn21

and Tn1696 (Partridge & Hall, 2004; Novais et al., 2010),

that presumably arose by homologous recombination be-

tween shared class 1 In/Tn components.

The insertion of the class 1 In/Tn outside the res site

of Tn21 seems to have created a ‘winner’ combination



Dow


ic.oup.com/fem


that could explain the number of variants of this trans-

poson found in available sequences (Liebert et al., 1999).

Tn21 may also have an advantage in that it includes an

ORF (tnpM), consisting of part of urf2M, proposed to

encode a protein that enhances transposition (Hyde & Tu,

1985), as shown recently for an equivalent protein (TniM)

from a Tn5036-family transposon (Petrovski et al., 2011).

Tn1696 and other transposons that lack an equivalent of the

Tn5060urf2 merD E A C P T R

IRmer(a)

tnpA tnpR

IRtnpTCCAT

from Tn501

IRmer

GATTT CTATT

Tn5051tnpA tnpR orf2 merD E A P T R

GAGTC

IRtnp IRmer

Tn5036

CATGG TTTGC TCGTTTn1696 Tn6005

IRtnp IRmcp

(b) In/TnTCAAG

tnpA tnpR merD E A C P T R

orfA B C DTn1013

tnpA tnpR

IRtnp IRorfCAGTT GGCGC ATGTG

Tn1403Tn6060 Tn5045 Tn6001

Tn1721tetA(A) tnpAtnpA� tnpRtetR(A) mcp

IRtnp

pecM

Tn1722

tnpA tnpR

IRtnp IRTEM

Tn2

(c)

TGAATTU

1 kb

blaTEM-1a

blaTEM-1b

tnpA tnpR

IRtnp IRTEM

aacA4 aadA1 oxa9Tn1331

Tn4401ablaKPC tnpA tnpR

IRtnpIRKPC

IS Kpn7IS Kpn6

(d)

IRΔ

Fig. 7. Tn3-family transposons commonly found in MRR. Genes are shown as in earlier figures. res sites are indicated by small black boxes and IR are

represented by vertical bars, with the end corresponding to the transposase gene labelled IRtnp and the other IR given a name specific to the transposon.

(a) Tn21-subfamily transposons with class 1 In/Tn. The names of the backbone transposons are given on the left. Tn21 consists of a backbone related to

Tn5060 (4 nt differences) with In2 inserted at the position indicated by the vertical arrow, flanked by the DR shown. For other backbones, different

insertion sites of class 1 In/Tn are shown by vertical arrows and the sequences of the DR created and the names of the resultant transposons, if assigned,

are given. (b) Tn1721. The region corresponding to Tn1722 is marked. Vertical arrows indicate the insertion positions of the ISEcp1-blaCTX-M-9-group

transposition unit (TU) or a class 1 In/Tn in the res site, with the DR sequences shown. (c) Tn3-subfamily transposons. Gene cassettes in Tn1331 are

shown as in Fig. 5 and a partial attC site is only present between the aadA1 and oxa9 cassettes. (d) Tn4401. The triangle below Tn4401 indicates the

position at which 100 extra bases are inserted into Tn4401b compared with Tn4401a. The narrow vertical bar labelled IRD represents the IR of the

original transposon truncated by ISKpn7. Filled circles of the same colour indicate DR flanking the two different IS. The sequences and information used

to draw the diagrams were from the following GenBank accession numbers: Tn5060, AJ551280; Tn21, AF071413; Tn5051, Y17719 plus Tn501 from

Z00027 (the region shown by dashed lines has not been sequenced); DR = GATTT, AJ969233; DR = CTATT, AJ634050; DR = GAGTC, AJ515707; Tn5036,

Y09025; Tn1696, U12338; Tn6005, EU591509; DR = TCGTT, AJ746361; Tn1013, AM261760; Tn1403, AF313472; Tn6060, GQ161847; Tn5045,

FN821089; Tn6001, EF138817; Tn1721, X61367; class 1 In/Tn in Tn1721, GQ396666; ISEcp1-blaCTX-M-14 in Tn1721, AF458080; Tn2, AY123253;

Tn1331, AF479774; Tn4401, EU176011.


836 S.R. Partridge

Dow


ic.oup.com/fem


urf2M region would not be expected to produce such a

protein.

The closely related IS4321 and IS5075 and their minor

variants, which belong to the same family as IS1111-attC

elements, target the 38-bp IR of Tn21-subfamily transpo-

sons, but have not yet been found in the Tn3-subfamily.

These IS do not create DR and are unusual in that their ends

do not correspond to their IR and require careful annotation

(Table 3; Partridge & Hall, 2003b). IS4321-like elements

have always been found inserted into the same position

(Table 3) with the IRL end towards the middle of the

transposon and presumably prevents further TnpA-

mediated transposition.

Tn1721

Tn1721 (Allmeier et al., 1992) is a Tn21-like transposon with

an unusual structure that includes three 38-bp IR and a

partial duplication of the tnpA gene (Fig. 7b). One end

consists of tnpA, tnpR, a res site and an ORF encoding a

protein related to methyl-accepting chemotaxis proteins

(mcp in Fig. 7b and originally called orfI) flanked by 38-bp

IR (Table 3). This structure is also known as Tn1722 and can

move independently (Grinsted et al., 1990). The other end

of Tn1721 includes the tetA(A) tetracycline resistance gene

and a regulatory gene tetR(A) gene. Tn1721 may have

evolved by internal deletion of a composite transposon

consisting of two copies of Tn1722 flanking the tet(A) region

(Allmeier et al., 1992; Grindley, 2002).

Complete copies of Tn1721 are rare in sequences cur-

rently available in GenBank, but different fragments of this

transposon are often found, including adjacent to the rep

region of several IncPa plasmids. There is one example of a

class 1 In/Tn inserted into the res site of Tn1721 (Fig. 7b)

and several res-type hybrids of tnp1721/tnp21 with a class 1 In/

Tn inserted at the usual Tn21 location, for example in

pAPEC-O2-R (AY214164). A 4.8-kb ISEcp1 transposition

unit containing different blaCTX-M-9-like variants and IS903

(e.g. AF458080; Poirel et al., 2003) or a truncated version (e.g.

HM440049; Zong et al., 2011) is found inserted into the same

position in Tn1721/Tn1722 in several plasmids (Fig. 7b).

Tn1, Tn2, Tn3 and relatives carrying blaTEM genes

Nearly 200 TEM b-lactamases, including extended-spec-

trum (ESBL), inhibitor resistant (IRT) and combination

(CMT) types, have been identified (http://www.lahey.org/

Studies/). The first examples, TEM-1 and TEM-2, differ by a

Gln to Lys substitution at amino acid 39 (Ambler number-

ing; Ambler et al., 1991) due to a single base change. These

and all other TEM b-lactamases are encoded by minor

variants of the same gene, with a single amino acid

difference sufficient for assignment of a new number.

blaTEM-1 variants with different combinations of silent

mutations at characteristic positions have also been identi-

fied (‘frameworks’, distinguished by letters e.g. blaTEM-1a,

blaTEM-1b; see Supporting Information, Fig. S1). The posi-

tions are numbered using a scheme that includes 208 nt

upstream of the start codon (Sutcliffe, 1978), as changes in

this region yield promoters of different strengths (P3, Pa/Pb,

P4, P5; Lartigue et al., 2002). Leflon-Guibout et al. (2000)

proposed that the framework and the promoter variant

present should also be specified for all blaTEM genes identi-

fied, for example blaTEM-33f (P4).

The closely related transposons identified as the carriers

of blaTEM genes were originally collectively designated TnA

(Hedges & Jacob, 1974), but were later distinguished as Tn1,

Tn2 Tn3, Tn801, etc. depending on the blaTEM variant

present and the plasmid they were derived from. Detailed

analysis of the sequences of Tn1 (blaTEM-2), Tn2 (blaTEM-1b)

and Tn3 (blaTEM-1a) indicated that most of the differences

between them were confined to short regions flanking the res

site, suggesting that they were generated by a combination of

site-specific and homologous recombination between an-

cestral transposons (Partridge & Hall, 2005). Analysis of

complete or almost complete sequences of transposons

carrying blaTEM genes now available in GenBank (Bailey

et al., 2011) suggests that they still fall into the three groups

represented by Tn1, Tn2 and Tn3.

Tn1 and Tn801 were the names given to transposons

carrying blaTEM-2 from a group of closely related IncP1aplasmids (RP1, RP4, R68 and RK2). Tn1 from the compiled

sequence representing this group of plasmids (L27758,

BN000925; Pansegrau et al., 1994) has 7 nt differences out-

side the blaTEM gene/promoter region from Tn1 derived

from various other plasmids and from Tn801 transposed

from a derivative of RP1 (Burland et al., 1998; Brinkley et al.,

2006). These transposons all carry genes based on the 1f

framework, although the gene from Tn1R7K was named

blaTEM-1c (Revilla et al., 2008), but some encode TEM-2 or

other variants (Bailey et al., 2011). An association between

Tn1-like transposons carrying various blaTEM-2 derivatives

and tnp1696 has been noted (Novais et al., 2010).

Tn2, the transposon from RSF1030 defined as carrying

blaTEM-1b, was originally only partially sequenced (X54607;

Chen & Clowes, 1987), but part of the complete sequence of

a transposon initially called Tn2� (AY123253.3; Partridge &

Hall, 2005) is identical to this region. Many examples of a

complete or a partial transposon carrying blaTEM-1b or

derivatives in GenBank are identical or very closely related

to this sequence, suggesting that it can now simply be

referred to as Tn2 (Bailey et al., 2011). The complete

sequences of transposons carrying blaTEM-1c (HM749967,

EU935740) have only six differences from Tn2 outside the

blaTEM gene/promoter region and the name Tn2a has been

suggested (Bailey et al., 2011). Complete and partial copies

of Tn2 and minor variants appear to be much more



Dow


ic.oup.com/fem


http://www.lahey.org/Studies/

http://www.lahey.org/Studies/

common than Tn1 and Tn3 in available sequences, but are

often incorrectly annotated as Tn3 (Bailey et al., 2011). In

several sequences, Tn2 is found inserted into the same

position in mer21 or with a common boundary with one or

the other end of this region (Partridge & Hall, 2004; Novais

et al., 2010) and fragments of Tn2 interrupted by IS26 at

different positions, but with the blaTEM gene intact, are also

common (Bailey et al., 2011).

The first available sequence of Tn3, carrying blaTEM-1a,

transposed from R1 (V00613) (Heffron et al., 1979) includes

a 9-bp duplication not present in the sequence recently

obtained directly from R1 (HM749966) (Bailey et al., 2011).

Tn1331 is a derivative of Tn3 that carries a cassette array

between short duplications (Fig. 7c; Tolmasky & Crosa,

1993).

In addition to the normal transposition process, Tn3- and

Tn21-subfamily transposons that include only one IR can also

move by rare TnpA-dependent, TnpR- and recA-independent

one-ended transposition events (Avila et al., 1984, 1988;

Motsch & Schmitt, 1984; Heritage & Bennett, 1985; Motsch

et al., 1985; Revilla et al., 2008). These produce recombinants

containing a segment of DNA that starts precisely at the IR

and is variable at the other end and usually results in replicon

fusion. Insertion products may even contain the entire donor

plasmid plus a duplication of the IR.

Tn3-like transposons also exhibit transposition immunity

i.e. the presence of one copy of the element in a potential

target molecule significantly reduces the insertion of a

second copy (Grindley, 2002). Thus, if an MRR in-

cludes two copies or fragments of one of these mobile

elements, it is probably unlikely that both were inserted by

direct transposition.

Tn4401 carrying blaKPC genes

The blaKPC gene, encoding a class A b-lactamase capable of

conferring resistance to carbapenems, has recently become a

problem in several parts of the world. This gene is found

flanked by ISKpn6 and ISKpn7 within variants of Tn4401

(Fig. 7d), a Tn3 family transposon with an unusual organi-

zation. The Tn4401 structure may have been generated in a

manner similar to capture of genes by ISEcp1 (Naas et al.,

2008). In this scheme, a transposon containing the tnpA and

tnpR genes of Tn4401 first inserted upstream of blaKPC.

ISKpn6 then inserted upstream of blaKPC and ISKpn7 down-

stream, disrupting one IR of the original transposon, and a

sequence located further downstream of blaKPC was then

used as the second IR in subsequent transposition events.

Tn4401 has been found to be associated with Tn1331 in

several plasmids, including pLRM24 (Rice et al., 2008), p12

and p15 (FJ223605-6; Gootz et al., 2009) and pKpQIL

(GU595196; Leavitt et al., 2010).

Tn5393 and modules containing fragments ofthis transposon

Tn5393 is a Tn3-like transposon that carries the aminogly-

coside phosphotransferase genes strA and strB and is flanked

by 81-bp IR, the outermost 38 bp of which are related to

those of other Tn3-family transposons (Table 3). IS1133 is

inserted in the first example of Tn5393 identified (Chiou &

Jones, 1993), but the ‘original’ transposon without IS1133,

called Tn5393c, has since been identified (Fig. 8a; L’Abee-

Lund & Sørum, 2000). Complete copies of Tn5393-like

transposons and some with insertions and/or deletions are

TAG

1133

TAG

Tn5393IRtnp IRstr(a)

Tn5393c

RSF1010

Tn6029

repA repC strA strB

IRstr

1 kb 26blaTEM-1b

TATAGTTCGAACTATA

strA strB26 26

(b)

(c)

strA strBtnpA tnpR

Fig. 8. Characteristics of Tn5393 and its fragments found in MRR. Most elements are represented as in earlier figures. Dashed lines represent the

RSF1010 plasmid backbone and pale green shapes represent the fragments of ISCR2. (a) Tn5393c (AF262622). In the original Tn5393 (M95402), IS1133

is inserted flanked by 3-bp DR (TAG) that corresponds to the stop codon of tnpR. (b) The combination of sul2, the strAB end of Tn5393 and a fragment

of ISCR2 found in RSF1010 (M28829). (c) Tn6029 (GQ150541). The 8-bp sequences shown adjacent to IRR and IRL of different copies of IS26 are reverse

complements of one another, suggesting that recombination has taken place between these two IS26 elements. Inverting the region between them to

simulate homologous recombination (see Fig. 2a) would yield a configuration in which the internal copy of IS26 is flanked by DR. Removing this IS26 and

one copy of the DR would reunite the strB gene with IRstr of Tn5393.


838 S.R. Partridge

Dow


ic.oup.com/fem


found in genomes, plasmid backbones and other transpo-

sons.

Part of Tn5393 (including strA, strB and IRstr) is found

adjacent to sul2 and a fragment of ISCR2 in the small

(8.7 kb) IncQ plasmid RSF1010 (Fig. 8b; Scholz et al.,

1989). This structure may have been created by the transpo-

sition of Tn5393 into the ISCR2-sul2 structure, followed by a

deletion event (Yau et al., 2010). Related IncQ plasmids

carry similar regions, in some cases with additional resis-

tance genes inserted (Meyer, 2009). A module apparently

derived from RSF1010 (Fig. 8c) is found in several large

MRR and has been designated Tn6029 (Cain et al., 2010). It

is flanked by directly oriented copies of IS26, with a third,

internal, copy of IS26 in the opposite orientation. The 8-bp

sequence adjacent to IRL of the internal IS26 is the reverse

complement of the 8 bp adjacent to IRR of one flanking IS26

(Fig. 8c), indicating that the segment between these ele-

ments has been inverted. Reversing this process and remov-

ing the internal IS26 would regenerate the RSF1010-like

structure.

aac(3)-II genes and regions

aac(3)-II genes were among the most common encoding

aminoglycoside-modifying enzymes identified in early stu-

dies and three types, aac(3)-IIa (X13543), aac(3)-IIb

(M97172) and aac(3)-IIc (X54723), were distinguished

(Shaw et al., 1993). A recent study of human and animal E.

coli isolates suggests that genes of this family are still

common, but identified two different types: aac(3)-IId

(97% identical to aac(3)-IIa; EU022314) and aac(3)-IIe

(96% identical to aac(3)-IIa; EU022315; Ho et al., 2010).

Little context information is available for any of these genes,

but several plasmid and other sequences in GenBank include

genes closely related to either aac(3)-IId or to aac(3)-IIe.

Genes within each group have similar flanking regions, but

are associated with different combinations of mobile ele-

ments (Fig. 9a and b). It would be useful to distinguish

between these groups in annotations and the names aac(3)-

IId and aac(3)-IIe seem appropriate. Another gene, desig-

nated aac(3)-IIf here, is found in several sequences in

GenBank, associated with the ISEcp1-like element IS1247

(e.g. AJ971344; Fig. 9c). It is interesting that the most closely

related gene, aac(3)-IIb (79% identical), is associated with

the related (88% identical) element ISSm2 (van der Ploeg

et al., 1995).

Macrolide phosphotransferase regions

Several regions including mph genes encoding different

macrolide 20-phosphotransferases (�30–40% amino acid

identity) have been found in MRR in Gram-negative bacter-

ia. The mph(A) region (Fig. 10a) includes mph(A) and genes

encoding a protein required for high-level erythromycin

resistance (Noguchi et al., 1995) and a transcriptional

repressor (Noguchi et al., 2000b; Szczepanowski et al.,

2004, 2005), often annotated as mrx and mphR(A), respec-

tively. The mph(A) region is bounded at one end by IS26 and

is often found adjacent to IRt-IS6100 marking the end of the

chrA region (Fig. 5f). Another region flanked by two

different IS encodes proteins about 35–40% identical to

those encoded by the mph(A) region, but the genes are

organized differently (Fig. 10b; Szczepanowski et al., 2007).

The mph gene in this region has been assigned the name

mph(F) by the MLS resistance gene website (Table 5), as its

original name, mph(E), was assigned to another gene.

The gene now designated mph(E), previously called mph

or mph2, plus msr(E), previously called mel or mef(E) and

encoding an ATP-binding cassette transporter, are found in

several MRR (Schluter et al., 2007; Kadlec et al., 2011),

usually flanked by IS26 and a second IS (Fig. 10c). A region

that includes mph(B) and a gene encoding a putative

penicillin-binding protein is inserted into tni402 in several

plasmids (Fig. 10d), apparently flanked by 12-bp DR

(Noguchi et al., 2000a). Examination of the sequence

suggests that the ends of the mph(B) region, including these

DR, correspond to fragments of an ISCR element (about

68% identical to ISCR2).

Annotating, analysing and comparingMRR

The actions of individual mobile elements in concert with

homologous recombination can lead to very complex con-

glomerations of complete and fragmented version of the

components described above with insertions, deletions and

rearrangements. Detailed analysis of these regions and

consistent annotation allows more meaningful comparisons

of different structures and a better understanding of how

they may have arisen and evolved. As MRR components are

highly conserved, it is also important to carefully check

segments of new sequences against existing examples of the

same components to reduce errors and give confidence in

minor, but real, changes that may help to identify epidemio-

logical relationships. The following sections give suggestions

about how to analyse and annotate the sequences of MRR,

illustrated by pIP1206 (AM886293; Perichon et al., 2008),

a plasmid with a complex MRR with multiple inversions

(Fig. 11).

Annotating antibiotic resistance genes

Newly obtained sequence data are usually analysed using

automated annotation programs, which will find potential

ORF, but often only identify the general function of the gene

family (e.g. ‘b-lactamase’; Fig 11a). As resistance genes

found in newly sequenced regions are often identical or

closely related to well-characterized genes, identifying



Dow


ic.oup.com/fem


exactly which resistance genes are present, as shown in Fig.

11b, is important.

Unfortunately, the available nomenclature for antibiotic

resistance genes can be extremely confusing. Different

nomenclature systems exist for some gene families, for

example those encoding aminoglycoside-modifying en-

zymes. In this case, two systems both distinguish genes

encoding N-acetyltransferases (aac), O-adenylyltransferases

(aad or ant) and O-phosphotransferases (aph), but indicate

the site of modification in different ways [e.g. aac(60) or

IRt

6100 26mph(A)

IRt

mph(B) PBP?

6100

mph(F)Pa15

RSB111

CR?

(a)

(b)

(c)

26mph(E) msr(E)

RSB105-1(d)

Fig. 10. Macrolide resistance regions. Various

elements are represented as in earlier figures.

The sequences used to draw the diagrams were

from the following GenBank accession numbers:

(a) mph(A), AJ698325; (b) mph(F), AM260957;

(c) mph(B), CP001232; (d) mph(E), DQ839391.

aac(3)-IIdpCTX-M3, pU302L

blaTEM-1b

(a)Cfr1

IRTEM

2626

26

IRTEM

pSTMDT12_L

pHHV35aac(3)-IIe

Kpn12

Kpn11

Kpn12

pKF3-140*

pK245

(b)

10 Cfr1 26

2610 All 1 nt different fromaac(3)-IId (EU022314)

5 nt differences fromaac(3)-IIe (EU022315)

pC15-1a, pEK516

Kpn12p3521,K. pneumonaie 12836

Tn2#Kpn11

IS 2626

blaTEM-1b

26 Kpn11K. oxytoca C994

3 nt differences fromaac(3)-IIe (EU022315)

3 nt differences fromaac(3)-IIe (EU022315)100% to aacC2/aacC3

(c)

sul1

3'-CS

aacA27 aac(3)-IIf arr6 ere(A)2

AATTAATT

1247pPMDHA1 kb

2626pTN48 IS

Fig. 9. aac(3)-II regions. Various elements are represented as in earlier figures. (a) Contexts of aac(3)-IId-like genes. The asterisk against pKF3-140

indicates that the structure shown is a rearranged version of the sequence in GenBank, created by inverting the region between IS26 elements in

opposite orientations, which yields one IS26 flanked by DR at the position shown by the vertical arrow. (b) Contexts of aac(3)-IIe-like genes. The IS in

pC15-1a, pEK516 and pTN48 has not been named, but is 88% identical to ISKpn11. (c) Context of aac(3)-IIf in an IS1247-mediated transposition unit

flanked by 4-bp DR. The sequences used to draw the diagrams were from the following GenBank accession numbers: pCTX-M3, AF550415;

pSTMDT12_L, AP011958; pKF3-140, FJ876827; pK245, DQ449578; pHHV35, FJ012882; p3521, GU256641; Klebsiella pneumoniae 12836,

EU780013; Klebsiella oxytoca C994, GU189577. pC15-1a, AY458016; pTN48, FQ482074; pPMDHA, AJ971344.


840 S.R. Partridge

Dow


ic.oup.com/fem


(a)

(b)

(c)

(d)

(e)

(f)

Fig. 11. Annotation and analysis of the pIP1206 MRR (AM886293). Various elements are represented as in earlier figures. # indicates that a transposon

is incomplete. Pointed grey boxes represent IS26 and are distinguished by letters in parts (b)–(d). Structures shown in parts (d)–(f) are hypothetical, but

the rearrangements shown here regenerate complete versions of known components. (a) Selected ORFs as identified by a typical automated analysis

program (H, hypothetical protein). (b) Further analysis by searching for IR of common mobile elements (Table 3) and BLASTsearches of separate segments.

Reference to various websites (Table 5) allows the precise annotation of resistance and transposase genes, mobile elements and their fragments. (c)

Marking the sequences of DR length flanking IS26 (8 bp) and IS1 (8 or 9 bp). Only DR of the same sequence (represented by a pair of filled circles of the

same colour) and flanking sequences that are the reverse complements of one another (represented by a filled circle and an open circle of the same

colour) are shown. Sequences are given on the right. These sequences suggest that IS1 has been directly inserted (the DR are 8 bp here) and that two

inversion events have taken place by recombination between IS26 elements in opposite orientations. (d) Inverting the regions between IS26-c and IS26-

d (shown by the short arrowed line) simulates recombination between these elements and yields two copies of IS26 flanked by DR. (e) Inverting the

regions between IS26-a and IS26-e (shown by the long arrowed line) simulates recombination between these elements and yields another copy of IS26

flanked by DR. The events shown in (d) and (e) could have occurred in either order. (f) Removing IS26 elements flanked by DR plus one copy of the 8-bp

repeated sequence reunites fragments of the plasmid backbone, of tnp21 and of the chrA region.

Table 5. Useful websites

Website Reference

bla genes http://www.lahey.org/Studies/ Bush & Jacoby (2010)

qnr genes http://www.lahey.org/qnrStudies/ Jacoby et al. (2008)

tet genes http://faculty.washington.edu/marilynr/ Levy et al. (1999)

MLS resistance genes http://faculty.washington.edu/marilynr/ Roberts et al. (1999)

16s rRNA

methylases

http://www.nih.go.jp/niid/16s_database/index.html Doi et al. (2008)

ARDB http://ardb.cbcb.umd.edu/ Liu & Pop (2009)

ARGO http://www.argodb.org/ Scaria et al. (2005)

Gene cassettes http://www2.chi.unsw.edu.au/rac Partridge et al. (2009)

ACID http://integron.biochem.dal.ca/ACID/phpbb3/ Joss et al. (2009)

INTEGRALL http://integrall.bio.ua.pt/ Moura et al. (2009

XXR http://mobyle.pasteur.fr/cgi-bin/portal.py?form=xxr Rowe-Magnus et al. (2003)

ISfinder http://www-is.biotoul.fr/is.html Siguier et al. (2006)

ISbrowser http://www-genome.biotoul.fr/ISbrowser.php Kichenaradja et al. (2010)

IScan http://www.ieu.uzh.ch/wagner/software/IScan/index.html Wagner et al. (2007)

ISCR elements http://medicine.cf.ac.uk/en/research/research-groups/i3/research/antibacterial-agents/

iscr-elements/

Toleman et al. (2006b)

Tn number registry http://www.ucl.ac.uk/eastman/tn/ Roberts et al. (2008)

ACLAME http://aclame.ulb.ac.be/ Leplae et al. (2010)

Artemis http://www.sanger.ac.uk/resources/software/artemis/ Rutherford et al. (2000)

ACT http://www.sanger.ac.uk/resources/software/act/ Carver et al. (2005)

Mauve http://gel.ahabs.wisc.edu/mauve Darling et al. (2010)



Dow


ic.oup.com/fem


aacA; aac(3) or aacC]. One system uses additional Roman

numerals to distinguish the different phenotypes conferred

(Shaw et al., 1993), while the other does not and is often

used for genes found in gene cassettes (Partridge et al.,

2009). In other cases, older names using Roman numerals

have been replaced by names with Arabic numerals (e.g. sulI,

sulII, sulIII vs. sul1, sul2, sul3 and dfrXVII vs. dfrA17), but

both types of names continue to be used. It is also not

uncommon to find different names/numbers used to in-

dicate the same gene in different locations and, conversely,

the same name/number being used for different genes.

General databases of antibiotic resistance genes (ARDB,

ARGO; Table 5) also use varying nomenclature.

Several groups keep track of and assign names/numbers

to different families of antibiotic resistance genes (Table 5)

and consulting their websites and submitting sequences

before preparing GenBank entries and/or publication en-

ables the correct name to be used or an appropriate name to

be assigned to a novel gene. Recently defined nomenclature

systems generally favour the use of letters for distinguishing

subgroups of genes that belong to the same overall family (e.g.

qnrA, qnrB) and numbers to distinguish more closely related

genes within each subgroup (e.g. qnrA1, qnrA2, qnrB1, qnrB2)

(Jacoby et al., 2008). Different tetracycline resistance operons

include a resistance gene, tetA, a regulatory gene, tetR, and

other associated genes and it important to indicate which type

is present by the use of a letter or a number following the

name, for example tetA(A) (Levy et al., 1999).

In some cases, it is the encoded proteins, rather than the

genes, that are numbered, the most obvious example being

those encoding the various b-lactamase families. Subscript

letters are sometimes used to distinguish slightly different genes

encoding a particular b-lactamase, for example the blaTEM

genes discussed above and different blaCTX-M variants.

Annotating mobile elements and theirfragments

Automated sequence analysis programs generally annotate

full-length transposase genes, but commonly just as a

‘transposase’, ‘integrase/recombinase’ or even just as hy-

pothetical proteins (Fig. 11a; Kichenaradja et al., 2010) and

predicted orfs may cross boundaries between mobile ele-

ments. The IR and/or ends of mobile elements and partial

copies are often not annotated in sequences in GenBank or a

mobile element is given as the same coordinates as the

transposase gene it contains. Determining exactly which

mobile elements are present and their boundaries, as shown

in Fig. 11b, is important to extract the most useful informa-

tion MRR sequences.

The boundaries of complete versions and some fragments

of common mobile elements can rapidly be identified using

sequence analysis software to search for their IR sequences

(Table 3). A number of websites can also assist in annotating

mobile elements (Table 5). ISfinder provides a BLAST search

function that can be used to identify known IS or their

relatives in a sequence, with links to pages that provide

information about each IS, such as IR lengths and se-

quences, DR lengths and other characteristics. Newly iden-

tified IS can also be submitted for the assignment of names/

numbers, while a separate website is dedicated to ISCR

elements. IScan can detect specified IS in genomes and

ISbrowser has been designed to visualize IS locations on

expertly annotated genomes, including plasmids.

Several websites provide information about gene cassettes

and integrons. XXR can be used to identify attC sites, ACID

provides annotations of integrons and tools to detect cassettes

and integrons in novel sequence data, while INTEGRALL is a

collection of data on integrons, including lists of known

cassette arrays. Instructions for identifying cassette boundaries

and attC sites can be found in a recent review, which also lists

all gene cassettes found in mobile resistance integrons, with

suggested nomenclature and references to exemplar sequences

(Partridge et al., 2009). The Repository of Antibiotic-resis-

tance Cassettes (RAC) provides updated lists and sequences

can be submitted for the annotation of gene cassettes (G.

Tsafnat & S.R. Partridge, unpublished data). The transposon

number registry lists recently identified transposons and

assigns numbers to newly identified examples, while ACLAME

is a website dedicated to mobile genetic elements.

Finding evidence of insertions

Identifying sequences of the expected DR length adjacent to

each copy of IS and transposons that create such repeats

(Fig. 11c) can be very helpful in analysing MRR. Matching

sequences of the expected DR length flanking a mobile

element or composite transposon provide direct evidence

of insertion, as in Fig. 11c, where one copy of IS1 has

matching 8-bp flanking sequences. Potential DR that are not

immediately adjacent to the ends of the mobile element, that

overlap with the IR, that differ by a base or two or that are

not the expected length are unlikely to be real evidence of an

insertion. However, mobile elements may occasionally cre-

ate DR of an atypical length for example Tn5393 in pEFER

(CU928144) and the ISEcp1-blaCTX-M-17 transposition unit

in pIP843 (Cao et al., 2002) both appear to be flanked by 6-

bp DR, rather than the expected 5 bp. In the first case, an

uninterrupted version of the flanking sequence is available

to confirm this. Identifying DR flanking terminal fragments

of a mobile element bounding an MRR can also provide

evidence of potential ‘founder’ elements.

Identifying rearrangements

Tools for visualizing sequence comparisons, such as Mauve

and Artemis/ACT (Table 5), may be useful in identifying


842 S.R. Partridge

Dow


ic.oup.com/fem


rearrangements, particularly those involving large segments,

but more detailed analysis may be required to understand

how these may have taken place. The identification of a

sequence of the DR length adjacent to one end of a repeated

element and the reverse complement of this sequence

adjacent to the other end of another copy, as shown in Fig.

2a, suggests inversion by homologous recombination be-

tween these elements. In Fig. 11c, identifying such sequences

suggests two inversions by recombination in IS26, which

could have occurred in either order. Figures 11d and 11e

simulate the effects of reversing these events by inverting the

regions between the relevant copies of IS26. This recreates a

structure in which all three copies of IS26 are flanked by DR,

indicative of insertions. Removing these IS plus one copy of

the DR, as shown in Fig. 11f, yields uninterrupted versions

of other recognizable MRR components or the plasmid

backbone, generating the presumed ancestral structure.

Identifying common boundaries betweenmobile elements

Papers describing MRR often indicate the extents of regions

that match part of one other known MRR sequence,

presumably the first listed in a BLASTN search result. This is

usually not very helpful if the region in question is a

common MRR component or a common module composed

of several components. Searches with short sequences that

overlap the boundaries between mobile elements or other

distinct regions can be used to determine how common

these combinations are in available sequences and suggest

relationships with other MRR.

Examples of MRR structures, evolutionand relationships

Many sequences of complete plasmids and genomic islands

carrying MRR from human clinical samples, animals and

various environments are now available in GenBank. De-

tailed analysis and comparison of these sequences reveals

examples of relationships between MRR in different con-

texts and variations that illustrate the principles outlined in

this review. Some examples from plasmids and chromo-

somes of different species of Enterobacteriaceae from differ-

ent times and locations (see Table 6 for details) are shown in

Fig. 12 and discussed in the following sections. Other

structures, such as SGI variants (see references in Table 1 in

Levings et al., 2008), AbaR variants (see references in Table 1

in Post & Hall, 2009 plus Adams et al., 2010) and the SXT-

like ICE (Garriss et al., 2009), also share components with

these MRR and display similar variations in structure, but

will not be discussed here.

Different levels of mobility

R100 (also called NR1; IncFII), one of the earliest ‘resistance

transfer factors’ identified (Nakaya et al., 1960), carries

Tn2670, also known as the resistance determinant (r-det).

This nested structure consists of a composite transposon

related to Tn9 into which Tn21 is inserted (Fig. 12a). This

Table 6. Details of the sources of MRR shown in Fig. 12

GenBank Plasmid Inc. Size (kb)� Species Sourcew Countryw Yearw References

R100 (NR1) AP000342 FII 94 281 S. flexneri – Japan 1950s Nakaya et al. (1960)

042 FN554766 Chromosome NA E. coli EAEC Human Peru 1983 Chaudhuri et al. (2010)

pAKU_1 AM412236 HI1 212 711 S. Paratyphi Human Pakistan 2002 Holt et al. (2007)

UMN026 CU928163 Chromosome NA E. coli – – – –

T000240 AP011957 Chromosome NA S. Typhimurium Human Japan 2000 Izumiya et al. (2011)

2a (SRL) AF326777 Chromosome NA S. flexneri Primate Japan – Luck et al. (2001)

pRSB107 AJ851089 FII FIA FIB 120 592 uncultured WWTPz Germany – Szczepanowski et al. (2005)

pIP1206 AM886293 FII FIA FIB 168 113 E. coli Human Belgium – Perichon et al. (2008)

pKF3-140 FJ876827 FIIKz FIA FIB 147416 K. pneumoniae Human China 2006 Zhao et al. (2010)

pRMH760 AY123253 A/C‰ partial K. pneumoniae Human Australia 1997 Partridge & Hall (2004)

peH4H FJ621586 A/C 148 105 E. coli Cow USA 2002 Call et al. (2010)

pSN254 CP000604 A/C 176 473 S. Newport – – – Welch et al. (2007)

pAR060302 FJ621588 A/C 166 530 E. coli Cow USA 2002 Call et al. (2010)

pAM04528 FJ621587 A/C 158 213 S. Newport Human USA 1998 Call et al. (2010)

pCTX-M3 AF550415 L/M 89 468 C. freundii Human Poland 1996 Gołebiewski et al. (2007)

pEK499 EU935739 FII FIA 117 536 E. coli Human UK 2001? Woodford et al. (2009)

pTN48 FQ482074 FII FIB 165 657 E. coli Human France 2004 Billard-Pomares et al. (2011)

�NA, not applicable; partial indicates that the entire plasmid has not been sequenced.wDashes indicate that the relevant information could not be found.zSee Villa et al. (2010).‰Presumed to be an IncA/C plasmid from small stretches of available sequence flanking the MRR.



Dow


ic.oup.com/fem


structure illustrates how resistance genes in MRR can have

several levels of mobility as the aadA1a gene cassette could

move independently (either mediated by IntI1 or by homo-

logous recombination in the CS), as part of In2 (if the

necessary Tni proteins are provided), as part of Tn21

(transposition of the entire transposon or one-ended

(a)

(b)

(c)

(d)

(e)

Fig. 12. Illustrative MRR from different plasmids and chromosomes. Various elements are represented as in earlier figures, with additional information

given in keys. Boxes containing letters represent different cassette arrays, as indicated in the key. Various resistance genes names are indicated at their

first occurrence only. DR are shown as paired filled circles of the same colour. An unpaired circle indicates that the same boundary between regions is

also present in another of the structures shown. Asterisks against plasmid/strain names indicate that the structures shown have been rearranged to

emphasize relationships, usually by inverting regions flanked by IS26. Vertical arrows indicate the positions of IS26 elements flanked by DR that have

been removed for ease of comparison. (a) Different levels of mobility illustrated by Tn2670. Curved lines indicate the extent of the cassette array, In2 and

Tn21. (b) Examples of MRR related to Tn2670, illustrating the evolution and spread of an MRR. The region labelled Pa in Escherichia coli 042 represents

part of the IncPa plasmid backbone and the line labelled rep in pAKU_1� is part of the RSF1010 rep region (see Fig. 8b and c). (c) Regions carrying

Tn2670-like MRR and truncated copies of Tn10 (see Fig. 3b). The rearrangements to generate the pIP1206� structure are shown in detail in Fig. 11. (d)

The pRMH760 MRR and related regions found on IncA/C plasmids. ISCR1-dfrA10 is inserted into pRMH760 and ISCR16-aac(3)-VIa into peH4H, pSN254

and pAR060302, in both cases flanked by duplications of the 30-CS (shown by horizontal lines). More detailed diagrams of these regions can be found in

Partridge & Hall (2004) and Hall (2007), respectively. (e) Examples of large complex MRR that include important resistance genes that have emerged

recently. The circular molecule shown below the pTN48 MRR could have been inserted by homologous recombination in IS26. The region in pink

matches regions found in various Gram-positive bacteria. The sequences used to draw the diagrams were from the GenBank accession numbers listed in

Table 6.


844 S.R. Partridge

Dow


ic.oup.com/fem


transposition, TnpR-mediated site specific recombination

or homologous recombination of segments). The whole of

Tn2670 can also move as a composite transposon (Iida et al.,

1981) or as a circle generated by homologous recombination

(Silver et al., 1980).

Evolution and spread of MRR

A number of available MRR sequences include the tnp21

and/or mer21 regions adjacent to parts of Tn9 with the same

boundaries as in Tn2670, but contain different cassette

arrays, insertions of different modules and/or various dele-

tions (Fig. 12b). The three structures shown are from two

different species, from a plasmid and the chromosome and

from at least two locations (Table 6), and illustrate how large

complex MRR may persist, evolve and spread. All are

flanked by directly oriented copies of IS1 and DR and could

have been inserted as composite transposons or as circular

molecules.

Complex structures can indicate relationshipsbetween MRR

The R100 backbone carries Tn10 (see Fig. 3b) in addition to

Tn2670 and in some MRR a Tn2670-related structure abuts

a truncated version of Tn10 (Fig. 12c). One end of this

region in several plasmids is defined by a multi-IS structure

containing IS1 flanked by DR in an IS10 element that abuts

149 bp of the IRR end of IS26, which is followed by a

remnant of an IS4321-like element interrupting a 38-bp IR

(Fig. 12c). This complex structure was presumably only

generated once and MRR containing the entire structure or

truncated versions are likely to be derived from one another.

MRR become more complex, but can alsodegenerate

The MRR of pRMH760 could have been created by the

incorporation of a circular Tn2670-like element into a

Tn1696-like transposon by homologous recombination in

the 30-CS and TnpR-mediated site-specific recombination

between the res sites of Tn21 and another transposon

(Partridge & Hall, 2004). This MRR includes two commonly

encountered structures: Tn2 inserted into mer21 (Novais

et al., 2010) and Tn4352 (Fig. 3c) inserted into tni402. Like

the examples in the previous section, pRMH760 illustrates

how MRR can become very large and complex.

The boundaries of the pRMH760 MRR match those

between the MRR and backbones of several IncA/C plasmids

(Fig. 12d) and the MRR in these plasmids appear to be

derivatives of the pRMH760 MRR structure that have

undergone deletions of progressively larger segments. These

could be explained by the insertion of directly oriented IS26

elements, followed by recombination between them. The IR

of all Tn21-like transposon fragments in these structures

have insertions of IS4321 or IS5075, but differences between

pRMH760 and the others suggest insertion at two different

times.

Complex MRR containing ‘old’ components plusimportant ‘new’ resistance genes

Most of the MRR illustrated in Fig. 12a–d carry mainly ‘old’

resistance genes that apparently emerged some time ago.

The MRR illustrated in Fig. 12e include selections of these

same common MRR components, but also one or more

important resistance genes that have apparently emerged

more recently. The pCTX-M3 MRR, which carries the armA

16S rRNA methylase gene, is bounded by the ends of Tn2

flanked by 5-bp DR. This suggests that Tn2 was first inserted

into the plasmid backbone and underwent multiple inser-

tions of additional components (Gołebiewski et al., 2007).

pCTX-M360, with a very similar backbone and a complete

copy of Tn2 inserted in the same place and flanked by the

same DR, has since been identified (Zhu et al., 2009).

pEK499 carries the blaCTX-M-15 gene, which has become

dominant worldwide, as part of an MRR that includes a

cassette array that is flanked by IS26 elements rather than the

50-CS and 30-CS of class 1 In/Tn. Although the outer ends of

the IS26 are not flanked by DR, it is possible that this cassette

array was originally captured from a class 1 In/Tn as a

composite transposon. The pEK499 MRR is related to the

MRR of pC15-1a, the first blaCTX-M-15 plasmid to be

sequenced (Boyd et al., 2004; see Fig. 13b), but some regions

are missing and pEK499 includes a class 1 In/Tn and other

regions not found on pC15-1a.

The pTN48 MRR includes another important gene,

blaCTX-M-14, as part of an ISEcp1 transposition unit flanked

by DR. An erm(B) gene is also present with ISCR14 in a

region flanked by directly oriented copies of IS26, with

matching 8-bp sequences adjacent to their inner ends. This

suggests that a circular molecule containing one copy of IS26

flanked by DR of this sequence (Fig. 12e), presumably

generated by ISCR14 rolling circle replication, was inserted

by recombination with an IS26 element in a pre-existing

MRR. The region containing erm(B), including the small

fragment beyond IRR of IS26 in the circular molecule, is

closely related to part of several plasmids and transposons

found in Gram-positive bacteria (Brisson-Noel et al., 1988).

Metagenomic sequencing data relating tomultiresistance

Data from several recent studies using metagenomic ap-

proaches to examine resistant isolates and/or plasmids seem

to confirm the dominance of a limited set of resistance

genes, MRR components and combinations of components.

In one study, pooled plasmid DNA from sets (about 100



Dow


ic.oup.com/fem


each) of clinical K. pneumoniae isolated at two different

times was sequenced using Illumina technology. Sequences

were then mapped to three plasmids from a single K.

pneumoniae isolate from the same hospital sequenced by

conventional methods (Zhao et al., 2010). Detailed analysis

of one plasmid (pKF3-140) allows the coverage in a specific

section of the MRR to be directly related to known compo-

nents (Fig. 13a). The regions with the highest coverage in

both sets correspond to IS26 and high coverage of the 50-CS

and 30-CS suggests that ‘clinical’ class 1 In/Tn are also

common. Despite being one of the most frequently reported

cassette arrays (Fig. 12; Partridge et al., 2009) |dfrA17|aadA5|

has a relatively low coverage, but few examples of this array

in GenBank are from K. pneumoniae (o 10) compared with

E. coli (4 75) and dfrA17 is apparently rare in K. pneumo-

niae (Brolund et al., 2010). Coverage of the sul2/strAB region

is apparently higher in the earlier set, while coverage of chrA/

mph(A) is higher in the later set. The right-hand end of the

pKF3-140 MRR sequence shown corresponds to part of the

aac(3)-IId region, but has apparently undergone an IS26-

mediated rearrangement, and ISCfr1, which is not found in

all structures carrying this resistance gene (Fig. 9a), has

lower coverage. Similar results were obtained by mapping

454 pyrosequencing data from mixed resistance plasmid

populations obtained from uncultured organisms in a

wastewater treatment plant to known plasmid sequences

(Szczepanowski et al., 2008).

In another study, fragments conferring resistance to

various antibiotics cloned from two human gut micro-

biomes were sequenced (Sommer et al., 2009). Sequences

(a) 40 000 45 000 50 000 55 000Position

5'IRchrA IRt IR

3'5'

mph(A)

(b)

pC15-1a|aacA4cr|oxa30|aac(3)-IIe

AX iG1 01 GE iG1 01 AM iG1 03

bla TEM-1b

IRTEM

blaCTX-M-15

26 2626Ecp1 26

chrA sul2 strAB

IRt3'

|dfrA17||aadA5|

pKF3-140tetA(A)

Cfr1

sul1 tni402

_ _

PE_iG1_09CF_iG1_01

AX_iG1_04

CA_iG1_11CA_iG1_09AX_iG1_08

SI_iG1_01

GE_iG1_06GE_iG1_04

_ _

SI_iG1_02

AM_iG1_07_ _

AM_iG1_19

Cov

erag

e 600

400

800

200

26 26 26 101 26

str

Fig. 13. Metagenomic analysis of antibiotic resistance genes and plasmids. (a) Mapping of sequencing reads to part of pKF3-140 (adapted from

Supporting information Fig. S1 of Zhao et al., 2010). Klebsiella pneumoniae isolates were divided into two categories: S1, n = 110 from 2002 to 2006

(blue); S2, n = 96 from 2007 to 2008 (pink). Short Illumina sequencing reads from pooled plasmid samples were mapped to pKF3-140. Details of the

components in the corresponding region of pKF3-140 (FJ876827) are shown below, with components represented as in earlier figures and various

regions and IR labelled. Dotted vertical lines identify the boundaries of defined segments. (b) Sequences from culturable isolates identified during

analysis of a human gut microbiome (Sommer et al., 2009) correspond to parts the MRR of pC15-1a (AY458016), shown at the top. Regions identified

in cloned fragments are shown below, from sequences in GenBank accession numbers listed in Table S6 of Sommer et al. (2009) and labelled with the

Gene ID, where two-letter codes indicate the antibiotic used for selection (AX, amoxicillin; CA, carbenicillin; CF, cefdinir; GE, gentamicin; MN,

minocycline; OX, oxytetracycline; PE, penicillin G; PI, piperacillin; SI, sisomicin; TE, tetracycline) and iG1 indicates inserts from cultured isolates from

microbiome 1.


846 S.R. Partridge

Dow


ic.oup.com/fem


identified as transposases corresponded to fragments of

IS26, Tn2, Tn2a, ISEcp1 and Tn1721 and fragments from

one individual included the blaTEM-1b, blaCTX-M-15, aac(60)-

Ib-cr and aac(3)-IIe resistance genes. The presence of

distinctive boundaries between different genetic compo-

nents previously found almost exclusively in related MRR

carrying blaCTX-M-15 (Fig. 13b) suggests that the sequences

are derived from related plasmids. Further mapping of this

type of short read data to common MRR components may

yield additional information.

Concluding remarks

The information provided in this review, particularly in

Figs 11 and 12, illustrates how transferable multiresistance

in Gram-negative bacteria appears to be generated by rare

gene capture events mediated by different mobile genetic

elements, clustering of resistance genes and associated

mobile elements and combinatorial evolution between a

limited number of shared components.

In addition to the actions of individual mobile elements,

homologous recombination is clearly extremely important

in both the movement of resistance genes (e.g. cassette

arrays, ISCR1-associated genes) and the creation and evolu-

tion of MRR. The accumulation of common components in

large regions (see Fig. 12) increases the targets for homo-

logous recombination events. If the mobile element that

captures a resistance gene is one of these components, or

quickly transfers the gene to a region containing such

elements, the emerging gene may able to spread very rapidly

between existing structures. A number of plasmids carrying

the globally successful blaCTX-M-15 gene have now been

sequenced and in most cases this gene seems to be associated

with not only ISEcp1 but also Tn2, a very common MRR

component, in large related MRR, although clearly particu-

lar plasmids and bacterial strains are also very important in

the dissemination of this gene. blaKPC, initially associated

with a ‘new’ transposon, seemed to spread only locally at

first, but is now expanding its range, which may partly

reflect an increasing association with more typical MRR

components. If a captured gene is ‘unlucky’ and does not

become associated with common MRR components, its

spread may be very limited. Like blaCTX-M-15, rmtC is

associated with ISEcp1, but its wider context(s) are not

known and rmtC is rarely identified compared with the

armA and rmtB 16S rRNA gene methylases found in large

complex MRR (see Fig. 12). There are many other examples

of resistance genes that have only been identified very rarely

and that may have emerged only to disappear again.

One mobile element in particular, IS26, seems to be very

important in relation to multiresistance in Gram-negative

bacteria, being found in many different species on plasmids

and the chromosome. As well as being able to form a

number of composite transposons (Fig. 3), recombination

between inverted copies of IS26 also seems to be responsible

for the generation of many different rearrangements in

MRR. Some MRR also include segments corresponding to

the ‘payloads’ of different composite transposons separated

by a single IS26 element, for example the adjacent Tn4352

(Fig. 3c) and Tn6029 (Fig. 8c) regions in pAKU_1 and

pRSB107 (Fig. 12c) and the aac(3)-II and erm(B) regions in

pTN48 (Fig. 12e). Such structures presumably arise by

recombination between IS26 elements flanking different

composite transposons or by incorporation of circular

molecules by homologous recombination (see Fig. 2b) into

an IS26 element that is already part of a composite transpo-

son. While IS26 can insert resistance genes, it can also cause

extensive rearrangements and resistance genes may also be

deleted, for example the aac(3)-IIe region is found in the

pC15-1a MRR (Fig. 13b), but not the related pEK499 MRR

(Fig 12e). Thus, not all of the actions of IS26 may be

beneficial, but the presence of this element in MRR poten-

tially provides great flexibility to create different structures,

some of which are likely to be selected for.

The combination of all of the factors discussed above has

allowed Gram-negative bacteria to resist the actions of

antibiotics and there is no reason to suppose that this will

change as new antibiotics are developed. There are clearly

huge reservoirs of potential antibiotic resistance genes in

various environments and identifying and characterizing

them could identify new mechanisms of resistance that may

inform the development of new antimicrobial agents

(Canton, 2009). However, relatively few resistance genes

appear to dominate in clinically important bacteria and it

is not possible to predict which genes may become mobi-

lized and available to the pathogenic bacteria that cause

infections (Courvalin, 2005, 2008). Predicting which emer-

ging genes are likely to become the most problematic

and which other resistance genes they are likely to become

associated with, which is crucial for the management of

multiantibiotic resistance, may be possible if we had the

right data.

Currently available plasmid and other sequences relating

to multiresistance can at best only provide hints to fully

understanding the processes involved, as we are missing

many informative structures. Sequenced examples of plas-

mids and other regions have generally been selected some-

what randomly, so the available set is likely to be biased, and

sequences are often poorly or incompletely analysed, so that

important information is lost. Large-scale sequencing of

plasmids and/or genomes is becoming more and more

feasible and cost-effective, but examples from different

geographic locations and times need to be carefully and

systematically selected to provide the most useful informa-

tion (O’Brien, 2002). Dealing with nomenclature issues and

developing improved bioinformatic methods tailored to the



Dow


ic.oup.com/fem


characteristics of the complex sequences involved in multi-

resistance in Gram-negative bacteria are also needed to

make best use of these data.

Acknowledgements

I would like to thank Jon Iredell, for interesting discussions,

for encouraging me to think about the bigger picture and for

comments on this manuscript. Working with Ruth Hall for

several years gave me an excellent introduction to this field

and supervising Zhiyong Zong and collaborating with Guy

Tsafnat also contributed to the ideas in this review. Thanks

are also due to the Editor and two reviewers for suggesting

improvements, Marilyn Roberts for help with MLS resis-

tance gene nomenclature, Hatch Stokes for useful discussion

during revision and Andrew Ginn for help with checking the

manuscript. I was partly funded by grant no. 512396 from

the National Health and Medical Research Council of

Australia.

References

Adams MD, Chan ER, Molyneaux ND & Bonomo RA (2010)

Genomewide analysis of divergence of antibiotic resistance

determinants in closely related isolates of Acinetobacter

baumannii. Antimicrob Agents Ch 54: 3569–3577.

Allmeier H, Cresnar B, Greck M & Schmitt R (1992) Complete

nucleotide sequence of Tn1721: gene organization and a novel

gene product with features of a chemotaxis protein. Gene 111:

11–20.

Ambler RP, Coulson AF, Frere JM, Ghuysen JM, Joris B, Forsman

M, Levesque RC, Tiraby G & Waley SG (1991) A standard

numbering scheme for the class A b-lactamases. Biochem J 276:

269–270.

Aubert D, Naas T, Heritier C, Poirel L & Nordmann P (2006)

Functional characterization of IS1999, an IS4 family element

involved in mobilization and expression of b-lactam resistance

genes. J Bacteriol 188: 6506–6514.

Avila P, de la Cruz F, Ward E & Grinsted J (1984) Plasmids

containing one inverted repeat of Tn21 can fuse with other

plasmids in the presence of Tn21 transposase. Mol Gen Genet

195: 288–293.

Avila P, Grinsted J & de la Cruz F (1988) Analysis of the variable

endpoints generated by one-ended transposition of Tn21.

J Bacteriol 170: 1350–1353.

Bae IK, Lee YH, Jeong HJ, Hong SG, Lee SH & Jeong SH (2008) A

novel blaCTX-M-14 gene-harboring complex class 1 integron

with an In4-like backbone structure from a clinical isolate of

Escherichia coli. Diagn Micr Infec Dis 62: 340–342.

Bailey J, Pinyon J, Anantham S & Hall R (2011) Distribution of

the blaTEM gene and blaTEM-containing transposons in

commensal Escherichia coli. J Antimicrob Chemoth 66:

745–751.

Baquero F (2004) From pieces to patterns: evolutionary

engineering in bacterial pathogens. Nat Rev Microbiol 2:

510–518.

Barlow M & Hall BG (2002) Origin and evolution of the AmpC

b-lactamases of Citrobacter freundii. Antimicrob Agents Ch 46:

1190–1198.

Billard-Pomares T, Tenaillon O, Le Nagard H, Rouy Z, Cruveiller

S, Medigue C, Arlet G, Denamur E & Branger C (2011)

Complete nucleotide sequence of plasmid pTN48, encoding

the CTX-M-14 extended-spectrum b-lactamase from an

Escherichia coli O102-ST405 strain. Antimicrob Agents Ch 55:

1270–1273.

Boyd DA, Tyler S, Christianson S et al. (2004) Complete

nucleotide sequence of a 92-kilobase plasmid harbouring the

CTX-M-15 extended-spectrum beta-lactamase involved in an

outbreak in long-term-care facilities in Toronto, Canada.

Antimicrob Agents Ch 48: 3758–3764.

Boyd DA, Shi X, Hu QH, Ng LK, Doublet B, Cloeckaert A &

Mulvey MR (2008) Salmonella genomic island 1 (SGI1),

variant SGI1-I, and new variant SGI1-O in Proteus mirabilis

clinical and food isolates from China. Antimicrob Agents Ch

52: 340–344.

Brinkley C, Burland V, Keller R, Rose DJ, Boutin AT, Klink SA,

Blattner FR & Kaper JB (2006) Nucleotide sequence analysis of

the enteropathogenic Escherichia coli adherence factor plasmid

pMAR7. Infect Immun 74: 5408–5413.

Brisson-Noel A, Arthur M & Courvalin P (1988) Evidence for

natural gene transfer from Gram-positive cocci to Escherichia

coli. J Bacteriol 170: 1739–1745.

Brolund A, Sundqvist M, Kahlmeter G & Grape M (2010)

Molecular characterisation of trimethoprim resistance in

Escherichia coli and Klebsiella pneumoniae during a two year

intervention on trimethoprim use. PLoS One 5: e9233.

Brown HJ, Stokes HW & Hall RM (1996) The integrons In0, In2,

and In5 are defective transposon derivatives. J Bacteriol 178:

4429–4437.

Brown NL, Winnie JN, Fritzinger D & Pridmore RD (1985) The

nucleotide sequence of the tnpA gene completes the sequence

of the Pseudomonas transposon Tn501. Nucleic Acids Res 13:

5657–5669.

Burland V, Shao Y, Perna NT, Plunkett G, Sofia HJ & Blattner FR

(1998) The complete DNA sequence and analysis of the large

virulence plasmid of Escherichia coli O157:H7. Nucleic Acids

Res 26: 4196–4204.

Bush K & Jacoby GA (2010) Updated functional classification of

b-lactamases. Antimicrob Agents Ch 54: 969–976.

Cain AK, Liu X, Djordjevic SP & Hall RM (2010) Transposons

related to Tn1696 in IncHI2 plasmids in multiply antibiotic

resistant Salmonella enterica serovar Typhimurium from

Australian animals. Microb Drug Resist 16: 197–202.

Call DR, Singer RS, Meng D, Broschat SL, Orfe LH, Anderson JM,

Herndon DR, Kappmeyer LS, Daniels JB & Besser TE (2010)

blaCMY-2-positive IncA/C plasmids from Escherichia coli and

Salmonella enterica are a distinct component of a larger lineage

of plasmids. Antimicrob Agents Ch 54: 590–596.


848 S.R. Partridge

Dow


ic.oup.com/fem


Cambray G, Guerout AM & Mazel D (2010) Integrons. Annu Rev

Genet 44: 141–166.

Canton R (2009) Antibiotic resistance genes from the

environment: a perspective through newly identified antibiotic

resistance mechanisms in the clinical setting. Clin Microbiol

Infect 15 (Suppl. 1): 20–25.

Cao V, Lambert T & Courvalin P (2002) ColE1-like plasmid

pIP843 of Klebsiella pneumoniae encoding extended-spectrum

b-lactamase CTX-M-17. Antimicrob Agents Ch 46: 1212–1217.

Carattoli A (2009) Resistance plasmid families in

Enterobacteriaceae. Antimicrob Agents Ch 53: 2227–2238.

Carver TJ, Rutherford KM, Berriman M, Rajandream MA, Barrell

BG & Parkhill J (2005) ACT: the Artemis comparison tool.

Bioinformatics 21: 3422–3423.

Cattoir V, Poirel L, Mazel D, Soussy CJ & Nordmann P (2007)

Vibrio splendidus as the source of plasmid-mediated QnrS-like

quinolone resistance determinants. Antimicrob Agents Ch 51:

2650–2651.

Chandler M & Mahillon J (2002) Insertion sequences revisited.

Mobile DNA II (Craig NL, Craigie R, Gellert M & Lambowitz

AM, eds), pp. 305–366. ASM Press, Washington, DC.

Chaudhuri RR, Sebaihia M, Hobman JL et al. (2010) Complete

genome sequence and comparative metabolic profiling of the

prototypical enteroaggregative Escherichia coli strain 042. PLoS

One 5: e8801.

Chen ST & Clowes RC (1987) Variations between the nucleotide

sequences of Tn1, Tn2, and Tn3 and expression of b-lactamase

in Pseudomonas aeruginosa and Escherichia coli. J Bacteriol 169:

913–916.

Chen YG, Qu TT, Yu YS, Zhou JY & Li LJ (2006) Insertion

sequence ISEcp1-like element connected with a novel aph(200)

allele [aph(200)-Ie] conferring high-level gentamicin resistance

and a novel streptomycin adenylyltransferase gene in

Enterococcus. J Med Microbiol 55: 1521–1525.

Chiou CS & Jones AL (1993) Nucleotide sequence analysis of a

transposon (Tn5393) carrying streptomycin resistance genes

in Erwinia amylovora and other Gram-negative bacteria.

J Bacteriol 175: 732–740.

Clark AJ & Sandler SJ (1994) Homologous genetic

recombination: the pieces begin to fall into place. Crit Rev

Microbiol 20: 125–142.

Collis CM & Hall RM (1992) Gene cassettes from the insert

region of integrons are excised as covalently closed circles. Mol

Microbiol 6: 2875–2885.

Collis CM, Grammaticopoulos G, Briton J, Stokes HW & Hall

RM (1993) Site-specific insertion of gene cassettes into

integrons. Mol Microbiol 9: 41–52.

Corvec S, Caroff N, Espaze E, Giraudeau C, Drugeon H &

Reynaud A (2003) AmpC cephalosporinase hyperproduction

in Acinetobacter baumannii clinical strains. J Antimicrob

Chemoth 52: 629–635.

Corvec S, Poirel L, Naas T, Drugeon H & Nordmann P (2007)

Genetics and expression of the carbapenem-hydrolyzing

oxacillinase gene blaOXA-23 in Acinetobacter baumannii.


Courvalin P (2005) Antimicrobial drug resistance: ‘‘Prediction is

very difficult, especially about the future’’. Emerg Infect Dis 11:

1503–1506.

Courvalin P (2008) Predictable and unpredictable evolution of

antibiotic resistance. J Intern Med 264: 4–16.

Darling AE, Mau B & Perna NT (2010) progressiveMauve:

multiple genome alignment with gene gain, loss and

rearrangement. PLoS One 5: e11147.

D’Costa VM, McGrann KM, Hughes DW & Wright GD (2006)

Sampling the antibiotic resistome. Science 311: 374–377.

Doi Y, Wachino J & Arakawa Y (2008) Nomenclature of plasmid-

mediated 16S rRNA methylases responsible for

panaminoglycoside resistance. Antimicrob Agents Ch 52:

2287–2288.

Doublet B, Boyd D, Mulvey MR & Cloeckaert A (2005) The

Salmonella genomic island 1 is an integrative mobilizable

element. Mol Microbiol 55: 1911–1924.

Doublet B, Golding GR, Mulvey MR & Cloeckaert A (2007)

Potential integration sites of the Salmonella genomic island 1

in Proteus mirabilis and other bacteria. J Antimicrob Chemoth

59: 801–803.

Ford PJ & Avison MB (2004) Evolutionary mapping of the SHV

b-lactamase and evidence for two separate IS26-dependent

blaSHV mobilization events from the Klebsiella pneumoniae

chromosome. J Antimicrob Chemoth 54: 69–75.

Fosse T, Giraud-Morin C, Madinier I & Labia R (2003) Sequence

analysis and biochemical characterisation of chromosomal

CAV-1 (Aeromonas caviae), the parental cephalosporinase of

plasmid-mediated AmpC ‘FOX’ cluster. FEMS Microbiol Lett

222: 93–98.

Francia MV, de la Cruz F & Garcıa Lobo JM (1993) Secondary-

sites for integration mediated by the Tn21 integrase. Mol


Frost LS, Leplae R, Summers AO & Toussaint A (2005) Mobile

genetic elements: the agents of open source evolution. Nat Rev


Garcillan-Barcia M, Bernales I, Mendiola M & De la Cruz F

(2002) IS91 rolling circle transposition. Mobile DNA II (Craig

NL, Craigie R, Gellert M & Lambowitz AM, eds), pp. 891–904.

ASM Press, Washington, DC.

Garriss G, Waldor MK & Burrus V (2009) Mobile antibiotic

resistance encoding elements promote their own diversity.

PLoS Genet 5: e1000775.

Gestal AM, Stokes HW, Partridge SR & Hall RM (2005)

Recombination between the dfrA12-orfF-aadA2 cassette array

and an aadA1 gene cassette creates a hybrid cassette, aadA8b.


Gillings M, Boucher Y, Labbate M, Holmes A, Krishnan S, Holley

M & Stokes HW (2008) The evolution of class 1 integrons and

the rise of antibiotic resistance. J Bacteriol 190: 5095–5100.

Gołebiewski M, Kern-Zdanowicz I, Zienkiewicz M, Adamczyk M,

Zylinska J, Baraniak A, Gniadkowski M, Bardowski J &

Cegłowski P (2007) Complete nucleotide sequence of the pCTX-

M3 plasmid and its involvement in spread of the extended-



Dow


ic.oup.com/fem


spectrum b-lactamase gene blaCTX-M-3. Antimicrob Agents Ch 51:

3789–3795.

Gootz TD, Lescoe MK, Dib-Hajj F, Dougherty BA, He W, Della-

Latta P & Huard RC (2009) Genetic organization of

transposase regions surrounding blaKPC carbapenemase genes

on plasmids from Klebsiella strains isolated in a New York city

hospital. Antimicrob Agents Ch 53: 1998–2004.

Grindley NDF (2002) The movement of Tn3-like elements:

transposition and cointegrate resolution. Mobile DNA II

(Craig NL, Craigie R, Gellert M & Lambowitz AM, eds), pp.

272–302. ASM Press, Washington, DC.

Grinsted J, de la Cruz F & Schmitt R (1990) The Tn21 subgroup

of bacterial transposable elements. Plasmid 2: 163–189.

Haines AS, Jones K, Batt SM, Kosheleva IA & Thomas CM (2007)

Sequence of plasmid pBS228 and reconstruction of the IncP-

1a phylogeny. Plasmid 58: 76–83.

Hall RM (2007) Antibiotic resistance gene cluster of pAPEC-O1-

R. Antimicrob Agents Ch 51: 3461–3462.

Hall RM (2010) Salmonella genomic islands and antibiotic

resistance in Salmonella enterica. Future Microbiol 5:

1525–1538.

Harada S, Ishii Y, Saga T, Tateda K & Yamaguchi K (2010)

Chromosomally encoded blaCMY-1 located on a novel SXT/

R391-related integrating conjugative element in a Proteus

mirabilis clinical isolate. Antimicrob Agents Ch 54: 3545–3550.

Hedges RW & Jacob AE (1974) Transposition of ampicillin

resistance from RP4 to other replicons. Mol Gen Genet 132:

31–40.

Heffron F, McCarthy BJ, Ohtsubo H & Ohtsubo E (1979) DNA

sequence analysis of the transposon Tn3: three genes and three

sites involved in transposition of Tn3. Cell 18: 1153–1163.

Heritage J & Bennett PM (1985) Plasmid fusions mediated by one

end of TnA. J Gen Microbiol 131: 1130–1140.

Ho PL, Wong RC, Lo SW, Chow KH, Wong SS & Que TL (2010)

Genetic identity of aminoglycoside-resistance genes in

Escherichia coli isolates from human and animal sources. J Med


Hochhut B & Waldor MK (1999) Site-specific integration of the

conjugal Vibrio cholerae SXT element into prfC. Mol Microbiol

32: 99–110.

Holt KE, Thomson NR, Wain J et al. (2007) Multidrug-resistant

Salmonella enterica serovar Paratyphi A harbors IncHI1

plasmids similar to those found in serovar Typhi. J Bacteriol

189: 4257–4264.

Humeniuk C, Arlet G, Gautier V, Grimont P, Labia R & Philippon

A (2002) b-lactamases of Kluyvera ascorbata, probable

progenitors of some plasmid-encoded CTX-M types.


Hyde DR & Tu CP (1985) tnpM: a novel regulatory gene that

enhances Tn21 transposition and suppresses cointegrate

resolution. Cell 42: 629–638.

Iida S, Hanni C, Echarti C & Arber W (1981) Is the IS1-flanked r-

determinant of the R plasmid NR1 a transposon? J Gen

Microbiol 126: 413–425.

Iredell JR & Partridge SR (2010) Understanding the shared gene

pool in Gram-negative bacteria. Infectious Disease Informatics

(Sintchenko V, ed), pp. 245–261. Springer, New York.

Izumiya H, Sekizuka T, Nakaya H et al. (2011) Whole-genome

analysis of Salmonella enterica serovar Typhimurium T000240

reveals the acquisition of a genomic island involved in

multidrug resistance via IS1 derivatives on the chromosome.


Jacoby G, Cattoir V, Hooper D, Martınez-Martınez L, Nordmann

P, Pascual A, Poirel L & Wang M (2008) qnr gene

nomenclature. Antimicrob Agents Ch 52: 2297–2299.

Joss MJ, Koenig JE, Labbate M, Polz MF, Gillings MR, Stokes HW,

Doolittle WF & Boucher Y (2009) ACID: annotation of

cassette and integron data. BMC Bioinformatics 10: 118.

Jove T, Da Re S, Denis F, Mazel D & Ploy MC (2010) Inverse

correlation between promoter strength and excision activity in

class 1 integrons. PLoS Genet 6: e1000793.

Kadlec K, Michael GB, Sweeney MT, Brzuszkiewicz E, Liesegang

H, Daniel R, Watts JL & Schwarz S (2011) Molecular basis of

macrolide, triamilide and lincosamide resistance in Pasteurella

multocida from bovine respiratory disease. Antimicrob Agents

Ch 55: 2475–2477.

Kamali-Moghaddam M & Sundstrom L (2000) Transposon

targeting determined by resolvase. FEMS Microbiol Lett 186:

55–59.

Kholodii G, Mindlin S, Petrova M & Minakhina S (2003) Tn5060

from the Siberian permafrost is most closely related to the

ancestor of Tn21 prior to integron acquisition. FEMS

Microbiol Lett 226: 251–255.

Kholodii GY, Mindlin SZ, Bass IA, Yurieva OV, Minakhina SV &

Nikiforov VG (1995) Four genes, two ends, and a res region are

involved in transposition of Tn5053: a paradigm for a novel

family of transposons carrying either a mer operon or an

integron. Mol Microbiol 17: 1189–1200.

Kichenaradja P, Siguier P, Perochon J & Chandler M (2010)

ISbrowser: an extension of ISfinder for visualizing insertion

sequences in prokaryotic genomes. Nucleic Acids Res 38:

D62–D68.

Labbate M, Roy Chowdhury P & Stokes HW (2008) A class 1

integron present in a human commensal has a hybrid

transposition module compared to Tn402: evidence of

interaction with mobile DNA from natural environments.

J Bacteriol 190: 5318–5327.

L’Abee-Lund TM & Sørum H (2000) Functional Tn5393-like

transposon in the R plasmid pRAS2 from the fish pathogen

Aeromonas salmonicida subspecies salmonicida isolated in

Norway. Appl Environ Microb 66: 5533–5535.

Labigne-Roussel A & Courvalin P (1983) IS15, a new insertion

sequence widely spread in R plasmids of Gram-negative

bacteria. Mol Gen Genet 189: 102–112.

Lartigue MF, Leflon-Guibout V, Poirel L, Nordmann P & Nicolas-

Chanoine MH (2002) Promoters P3, Pa/Pb, P4, and P5

upstream from blaTEM genes and their relationship to b-lactam

resistance. Antimicrob Agents Ch 46: 4035–4037.


850 S.R. Partridge

Dow


ic.oup.com/fem


Lartigue MF, Poirel L, Aubert D & Nordmann P (2006) In vitro

analysis of ISEcp1B-mediated mobilization of naturally

occurring b-lactamase gene blaCTX-M of Kluyvera ascorbata.


Lawley TD, Burland V & Taylor DE (2000) Analysis of the

complete nucleotide sequence of the tetracycline-resistance

transposon Tn10. Plasmid 43: 235–239.

Leavitt A, Chmelnitsky I, Carmeli Y & Navon-Venezia S (2010)

Complete nucleotide sequence of KPC-3-encoding plasmid

pKpQIL in the epidemic Klebsiella pneumoniae sequence type

258. Antimicrob Agents Ch 54: 4493–4496.

Leflon-Guibout V, Heym B & Nicolas-Chanoine M (2000)

Updated sequence information and proposed nomenclature

for blaTEM genes and their promoters. Antimicrob Agents Ch

44: 3232–3234.

Leon G & Roy PH (2009) Potential role of group IIC-attC introns

in integron cassette formation. J Bacteriol 191: 6040–6051.

Leplae R, Lima-Mendez G & Toussaint A (2010) ACLAME: a

CLAssification of Mobile genetic Elements, update 2010.

Nucleic Acids Res 38: D57–D61.

Levings RS, Djordjevic SP & Hall RM (2008) SGI2, a relative of

Salmonella genomic island SGI1 with an independent origin.


Levy SB, McMurry LM, Barbosa TM, Burdett V, Courvalin P,

Hillen W, Roberts MC, Rood JI & Taylor DE (1999)

Nomenclature for new tetracycline resistance determinants.


Liebert CA, Hall RM & Summers AO (1999) Transposon Tn21,

flagship of the floating genome. Microbiol Mol Biol R 63:

507–522.

Liu B & Pop M (2009) ARDB–Antibiotic Resistance Genes

Database. Nucleic Acids Res 37: D443–447.

Liu J, Keelan P, Bennett PM & Enne VI (2009) Characterization of

a novel macrolide efflux gene, mef(B), found linked to sul3 in

porcine Escherichia coli. J Antimicrob Chemoth 63: 423–426.

Luck SN, Turner SA, Rajakumar K, Sakellaris H & Adler B (2001)

Ferric dicitrate transport system (Fec) of Shigella flexneri 2a

YSH6000 is encoded on a novel pathogenicity island carrying

multiple antibiotic resistance genes. Infect Immun 69:

6012–6021.

Ma YF, Wu JF, Wang SY, Jiang CY, Zhang Y, Qi SW, Liu L, Zhao

GP & Liu SJ (2007) Nucleotide sequence of plasmid pCNB1

from Comamonas strain CNB-1 reveals novel genetic

organization and evolution for 4-chloronitrobenzene

degradation. Appl Environ Microb 73: 4477–4483.

Martınez JL, Baquero F & Andersson DI (2007) Predicting

antibiotic resistance. Nat Rev Microbiol 5: 958–965.

Martinez JL, Fajardo A, Garmendia L, Hernandez A, Linares JF,

Martınez-Solano L & Sanchez MB (2009) A global view of

antibiotic resistance. FEMS Microbiol Rev 33: 44–65.

Mendiola MV & de la Cruz F (1989) Specificity of insertion of

IS91, an insertion sequence present in a-haemolysin plasmids

of Escherichia coli. Mol Microbiol 3: 979–984.

Mendiola MV, Bernales I & de la Cruz F (1994) Differential roles

of the transposon termini in IS91 transposition. P Natl Acad

Sci USA 91: 1922–1926.

Meyer R (2009) Replication and conjugative mobilization of

broad host-range IncQ plasmids. Plasmid 62: 57–70.

Minakhina S, Kholodii G, Mindlin S, Yurieva O & Nikiforov V

(1999) Tn5053 family transposons are res site hunters sensing

plasmidal res sites occupied by cognate resolvases. Mol

Microbiol 33: 1059–1068.

Mindlin S, Kholodii G, Gorlenko Z, Minakhina S, Minakhin L,

Kalyaeva E, Kopteva A, Petrova M, Yurieva O & Nikiforov V

(2001) Mercury resistance transposons of Gram-negative

environmental bacteria and their classification. Res Microbiol

152: 811–822.

Mollet B, Clerget M, Meyer J & Iida S (1985a) Organization of the

Tn6-related kanamycin resistance transposon Tn2680 carrying

two copies of IS26 and an IS903 variant, IS903.B. J Bacteriol

163: 55–60.

Mollet B, Iida S & Arber W (1985b) Gene organization and target

specificity of the prokaryotic mobile genetic element IS26. Mol

Gen Genet 201: 198–203.

Motsch S & Schmitt R (1984) Replicon fusion mediated by a

single-ended derivative of transposon Tn1721. Mol Gen Genet

195: 281–287.

Motsch S, Schmitt R, Avila P, de la Cruz F, Ward E & Grinsted J

(1985) Junction sequences generated by ‘one-ended

transposition’. Nucleic Acids Res 13: 3335–3342.

Moura A, Soares M, Pereira C, Leitao N, Henriques I & Correia A

(2009) INTEGRALL: a database and search engine for

integrons, integrases and gene cassettes. Bioinformatics 25:

1096–1098.

Naas T, Aubert D, Lambert T & Nordmann P (2006) Complex

genetic structures with repeated elements, a sul-type class 1

integron, and the blaVEB extended-spectrum b-lactamase gene.


Naas T, Cuzon G, Villegas MV, Lartigue MF, Quinn JP &

Nordmann P (2008) Genetic structures at the origin of

acquisition of the b-lactamase blaKPC gene. Antimicrob Agents

Ch 52: 1257–1263.

Nadjar D, Rouveau M, Verdet C, Donay L, Herrmann J, Lagrange

PH, Philippon A & Arlet G (2000) Outbreak of Klebsiella

pneumoniae producing transferable AmpC-type b-lactamase

(ACC-1) originating from Hafnia alvei. FEMS Microbiol Lett

187: 35–40.

Nakaya R, Nakamura A & Murata Y (1960) Resistance transfer

agents in Shigella. Biochem Bioph Res Co 3: 654–659.

Noguchi N, Emura A, Matsuyama H, O’Hara K, Sasatsu M &

Kono M (1995) Nucleotide sequence and characterization of

erythromycin resistance determinant that encodes macrolide

20-phosphotransferase I in Escherichia coli. Antimicrob Agents

Ch 39: 2359–2363.

Noguchi N, Katayama J & Sasatsu M (2000a) A transposon

carrying the gene mphB for macrolide 20-phosphotransferase

II. FEMS Microbiol Lett 192: 175–178.



Dow


ic.oup.com/fem


Noguchi N, Takada K, Katayama J, Emura A & Sasatsu M (2000b)

Regulation of transcription of the mph(A) gene for macrolide

20-phosphotransferase I in Escherichia coli: characterization of

the regulatory gene mphR(A). J Bacteriol 182: 5052–5058.

Novais A, Baquero F, Machado E, Canton R, Peixe L & Coque TM

(2010) International spread and persistence of TEM-24 is

caused by the confluence of highly penetrating

Enterobacteriaceae clones and an IncA/C2 plasmid containing

Tn1696<Tn1 and IS5075-Tn21. Antimicrob Agents Ch 54:

825–834.

O’Brien TF (2002) Emergence, spread, and environmental effect

of antimicrobial resistance: how use of an antimicrobial

anywhere can increase resistance to any antimicrobial

anywhere else. Clin Infect Dis 34: S78–S84.

Oka A, Sugisaki H & Takanami M (1981) Nucleotide sequence of

the kanamycin resistance transposon Tn903. J Mol Biol 147:

217–226.

Olson AB, Silverman M, Boyd DA, McGeer A, Willey BM, Pong-

Porter V, Daneman N & Mulvey MR (2005) Identification of a

progenitor of the CTX-M-9 group of extended-spectrum b-

lactamases from Kluyvera georgiana isolated in Guyana.


Pansegrau W, Lanka E, Barth PT, Figurski DH, Guiney DG, Haas

D, Helinski DR, Schwab H, Stanisich VA & Thomas CM (1994)

Complete nucleotide sequence of Birmingham IncPaplasmids. Compilation and comparative analysis. J Mol Biol

239: 623–663.

Parks AR & Peters JE (2007) Transposon Tn7 is widespread in

diverse bacteria and forms genomic islands. J Bacteriol 189:

2170–2173.

Partridge SR (2007) Genetic environment of ISEcp1 and blaACC-1.


Partridge SR & Hall RM (2003a) In34, a complex In5 family class

1 integron containing orf513 and dfrA10. Antimicrob Agents

Ch 47: 342–349.

Partridge SR & Hall RM (2003b) The IS1111 family members

IS4321 and IS5075 have subterminal inverted repeats and

target the terminal inverted repeats of Tn21 family

transposons. J Bacteriol 185: 6371–6384.

Partridge SR & Hall RM (2004) Complex multiple antibiotic and

mercury resistance region derived from the r-det of NR1

(R100). Antimicrob Agents Ch 48: 4250–4255.

Partridge SR & Hall RM (2005) Evolution of transposons

containing blaTEM genes. Antimicrob Agents Ch 49: 1267–1268.

Partridge SR, Brown HJ, Stokes HW & Hall RM (2001a)

Transposons Tn1696 and Tn21 and their integrons In4 and In2

have independent origins. Antimicrob Agents Ch 45:

1263–1270.

Partridge SR, Recchia GD, Stokes HW & Hall RM (2001b) Family

of class 1 integrons related to In4 from Tn1696. Antimicrob

Agents Ch 45: 3014–3020.

Partridge SR, Brown HJ & Hall RM (2002a) Characterization and

movement of the class 1 integron known as Tn2521 and

Tn1405. Antimicrob Agents Ch 46: 1288–1294.

Partridge SR, Collis CM & Hall RM (2002b) Class 1 integron

containing a new gene cassette, aadA10, associated with

Tn1404 from R151. Antimicrob Agents Ch 46: 2400–2408.

Partridge SR, Tsafnat G, Coiera E & Iredell JR (2009) Gene

cassettes and cassette arrays in mobile resistance integrons.

FEMS Microbiol Rev 33: 757–784.

Perichon B, Bogaerts P, Lambert T, Frangeul L, Courvalin P &

Galimand M (2008) Sequence of conjugative plasmid pIP1206

mediating resistance to aminoglycosides by 16S rRNA

methylation and to hydrophilic fluoroquinolones by efflux.


Petrova M, Gorlenko Z & Mindlin S (2011) Tn5045, a novel

integron-containing antibiotic and chromate resistance

transposon isolated from a permafrost bacterium. Res

Microbiol 162: 337–345.

Petrovski S & Stanisich VA (2010) Tn502 and Tn512 are res site

hunters that provide evidence of resolvase-independent

transposition to random sites. J Bacteriol 192: 1865–1874.

Petrovski S, Blackmore DW, Jackson KL & Stanisich VA (2011)

Mercury(II)-resistance transposons Tn502 and Tn512, from

Pseudomonas clinical strains, are structurally different

members of the Tn5053 family. Plasmid 65: 58–64.

Poirel L & Nordmann P (2006) Genetic structures at the origin of

acquisition and expression of the carbapenem-hydrolyzing

oxacillinase gene blaOXA-58 in Acinetobacter baumannii.


Poirel L, Naas T, Guibert M, Chaibi EB, Labia R & Nordmann P

(1999) Molecular and biochemical characterization of VEB-1,

a novel class A extended-spectrum b-lactamase encoded by an

Escherichia coli integron gene. Antimicrob Agents Ch 43:

573–581.

Poirel L, Kampfer P & Nordmann P (2002) Chromosome-

encoded Ambler class A b-lactamase of Kluyvera georgiana, a

probable progenitor of a subgroup of CTX-M extended-

spectrum b-lactamases. Antimicrob Agents Ch 46: 4038–4040.

Poirel L, Decousser JW & Nordmann P (2003) Insertion sequence

ISEcp1B is involved in expression and mobilization of a blaCTX-M

b-lactamase gene. Antimicrob Agents Ch 47: 2938–2945.

Poirel L, Lartigue MF, Decousser JW & Nordmann P (2005a)

ISEcp1B-mediated transposition of blaCTX-M in Escherichia

coli. Antimicrob Agents Ch 49: 447–450.

Poirel L, Rodriguez-Martinez JM, Mammeri H, Liard A &

Nordmann P (2005b) Origin of plasmid-mediated quinolone

resistance determinant QnrA. Antimicrob Agents Ch 49:

3523–3525.

Poirel L, Mugnier PD, Toleman MA, Walsh TR, Rapoport MJ,

Petroni A & Nordmann P (2009) ISCR2, another vehicle for

blaVEB gene acquisition. Antimicrob Agents Ch 53: 4940–4943.

Post V & Hall RM (2009) AbaR5, a large multiple-antibiotic

resistance region found in Acinetobacter baumannii.


Radstrom P, Skold O, Swedberg G, Flensburg J, Roy PH &

Sundstrom L (1994) Transposon Tn5090 of plasmid R751,

which carries an integron, is related to Tn7, Mu, and the

retroelements. J Bacteriol 176: 3257–3268.


852 S.R. Partridge

Dow


ic.oup.com/fem


Recchia GD & Hall RM (1997) Origins of the mobile gene

cassettes found in integrons. Trends Microbiol 5: 389–394.

Recchia GD, Stokes HW & Hall RM (1994) Characterisation of

specific and secondary recombination sites recognised by the

integron DNA integrase. Nucleic Acids Res 22: 2071–2078.

Revilla C, Garcillan-Barcia MP, Fernandez-Lopez R, Thomson

NR, Sanders M, Cheung M, Thomas CM & de la Cruz F (2008)

Different pathways to acquiring resistance genes illustrated by

the recent evolution of IncW plasmids. Antimicrob Agents Ch

52: 1472–1480.

Rice LB, Carias LL, Hutton RA, Rudin SD, Endimiani A &

Bonomo RA (2008) The KQ element, a complex genetic region

conferring transferable resistance to carbapenems,

aminoglycosides, and fluoroquinolones in Klebsiella

pneumoniae. Antimicrob Agents Ch 52: 3427–3429.

Richter GY, Bjorklof K, Romantschuk M & Mills D (1998)

Insertion specificity and trans-activation of IS801. Mol Gen

Genet 260: 381–387.

Roberts AP, Chandler M, Courvalin P et al. (2008) Revised

nomenclature for transposable genetic elements. Plasmid 60:

167–173.

Roberts MC, Sutcliffe J, Courvalin P, Jensen LB, Rood J & Seppala

H (1999) Nomenclature for macrolide and macrolide-

lincosamide-streptogramin B resistance determinants.


Rodrıguez MM, Power P, Radice M, Vay C, Famiglietti A, Galleni

M, Ayala JA & Gutkind G (2004) Chromosome-encoded

CTX-M-3 from Kluyvera ascorbata: a possible origin of

plasmid-borne CTX-M-1-derived cefotaximases. Antimicrob

Agents Ch 48: 4895–4897.

Rodrıguez MM, Power P, Sader H, Galleni M & Gutkind G (2010)

Novel chromosome-encoded CTX-M-78 b-lactamase from a

Kluyvera georgiana clinical isolate as a putative origin of

CTX-M-25 subgroup. Antimicrob Agents Ch 54: 3070–3071.

Rogowsky P & Schmitt R (1984) Resolution of a hybrid

cointegrate between transposons Tn501 and Tn1721 defines

the recombination site. Mol Gen Genet 193: 162–166.

Rottman M, Benzerara Y, Hanau-Bercot B, Bizet C, Philippon A

& Arlet G (2002) Chromosomal ampC genes in Enterobacter

species other than Enterobacter cloacae, and ancestral

association of the ACT-1 plasmid-encoded cephalosporinase

to Enterobacter asburiae. FEMS Microbiol Lett 210: 87–92.

Rowe-Magnus DA, Guerout AM, Ploncard P, Dychinco B, Davies

J & Mazel D (2001) The evolutionary history of chromosomal

super-integrons provides an ancestry for multiresistant

integrons. P Natl Acad Sci USA 98: 652–657.

Rowe-Magnus DA, Guerout AM, Biskri L, Bouige P & Mazel D

(2003) Comparative analysis of superintegrons: engineering

extensive genetic diversity in the Vibrionaceae. Genome Res 13:

428–442.

Roy Chowdhury P, Merlino J, Labbate M, Cheong EY, Gottlieb T

& Stokes HW (2009) Tn6060, a transposon from a genomic

island in a Pseudomonas aeruginosa clinical isolate that

includes two class 1 integrons. Antimicrob Agents Ch 53:

5294–5296.

Rutherford K, Parkhill J, Crook J, Horsnell T, Rice P, Rajandream

MA & Barrell B (2000) Artemis: sequence visualization and

annotation. Bioinformatics 16: 944–945.

Scaria J, Chandramouli U & Verma SK (2005) Antibiotic

Resistance Genes Online (ARGO): a database on vancomycin

and b-lactam resistance genes. Bioinformation 1: 5–7.

Schlor S, Riedl S, Blaß J & Reidl J (2000) Genetic rearrangements

of the regions adjacent to genes encoding heat-labile

enterotoxins (eltAB) of enterotoxigenic Escherichia coli strains.

Appl Environ Microb 66: 352–358.

Scholz P, Haring V, Wittmann-Liebold B, Ashman K, Bagdasarian

M & Scherzinger E (1989) Complete nucleotide sequence and

gene organization of the broad-host-range plasmid RSF1010.

Gene 75: 271–288.

Schluter A, Szczepanowski R, Kurz N, Schneiker S, Krahn I &

Puhler A (2007) Erythromycin resistance-conferring plasmid

pRSB105, isolated from a sewage treatment plant, harbors a

new macrolide resistance determinant, an integron-containing

Tn402-like element, and a large region of unknown function.

Appl Environ Microb 73: 1952–1960.

Segal H, Garny S & Elisha BG (2005) Is ISABA-1 customized for

Acinetobacter? FEMS Microbiol Lett 243: 425–429.

Shapiro JA & Sporn P (1977) Tn402: a new transposable element

determining trimethoprim resistance that inserts in

bacteriophage lambda. J Bacteriol 129: 1632–1635.

Shaw KJ, Rather PN, Hare RS & Miller GH (1993) Molecular

genetics of aminoglycoside resistance genes and familial

relationships of the aminoglycoside-modifying enzymes.

Microbiol Rev 57: 138–163.

Siguier P, Perochon J, Lestrade L, Mahillon J & Chandler M

(2006) ISfinder: the reference centre for bacterial insertion

sequences. Nucleic Acids Res 34: D32–D36.

Siguier P, Gagnevin L & Chandler M (2009) The new IS1595

family, its relation to IS1 and the frontier between insertion

sequences and transposons. Res Microbiol 160: 232–241.

Silver L, Chandler M, Lane HE & Caro L (1980) Production of

extrachromosomal r-determinant circles from integrated

R100.1: involvement of the E. coli recombination system. Mol

Gen Genet 179: 565–571.

Smillie C, Garcillan-Barcia MP, Francia MV, Rocha EP & de la

Cruz F (2010) Mobility of plasmids. Microbiol Mol Biol R 74:

434–452.

Sommer MO, Dantas G & Church GM (2009) Functional

characterization of the antibiotic resistance reservoir in the

human microflora. Science 325: 1128–1131.

Sota M, Tsuda M, Yano H, Suzuki H, Forney LJ & Top EM (2007)

Region-specific insertion of transposons in combination with

selection for high plasmid transferability and stability accounts

for the structural similarity of IncP-1 plasmids. J Bacteriol 189:

3091–3098.

Stokes HW & Hall RM (1989) A novel family of potentially

mobile DNA elements encoding site-specific gene-integration

functions: integrons. Mol Microbiol 3: 1669–1683.

Stokes HW, Tomaras C, Parsons Y & Hall RM (1993) The partial

30-conserved segment duplications in the integrons In6 from



Dow


ic.oup.com/fem


pSa and In7 from pDGO100 have a common origin. Plasmid

30: 39–50.

Stokes HW, Nesbø CL, Holley M, Bahl MI, Gillings MR &

Boucher Y (2006) Class 1 integrons potentially predating the

association with Tn402-like transposition genes are present in

a sediment microbial community. J Bacteriol 188: 5722–5730.

Stokes HW, Elbourne LD & Hall RM (2007) Tn1403, a multiple-

antibiotic resistance transposon made up of three distinct

transposons. Antimicrob Agents Ch 51: 1827–1829.

Sutcliffe JG (1978) Nucleotide sequence of the ampicillin

resistance gene of Escherichia coli plasmid pBR322. P Natl Acad

Sci USA 75: 3737–3741.

Szczepanowski R, Krahn I, Linke B, Goesmann A, Puhler A &

Schluter A (2004) Antibiotic multiresistance plasmid pRSB101

isolated from a wastewater treatment plant is related to

plasmids residing in phytopathogenic bacteria and carries

eight different resistance determinants including a multidrug

transport system. Microbiology 150: 3613–3630.

Szczepanowski R, Braun S, Riedel V, Schneiker S, Krahn I, Puhler

A & Schluter A (2005) The 120 592 bp IncF plasmid pRSB107

isolated from a sewage-treatment plant encodes nine different

antibiotic-resistance determinants, two iron-acquisition

systems and other putative virulence-associated functions.

Microbiology 151: 1095–1111.

Szczepanowski R, Krahn I, Bohn N, Puhler A & Schluter A (2007)

Novel macrolide resistance module carried by the IncP-1bresistance plasmid pRSB111, isolated from a wastewater

treatment plant. Antimicrob Agents Ch 51: 673–678.

Szczepanowski R, Bekel T, Goesmann A, Krause L, Kromeke H,

Kaiser O, Eichler W, Puhler A & Schluter A (2008) Insight into

the plasmid metagenome of wastewater treatment plant bacteria

showing reduced susceptibility to antimicrobial drugs analysed

by the 454-pyrosequencing technology. J Biotechnol 136: 54–64.

Tavakoli N, Comanducci A, Dodd HM, Lett MC, Albiger B &

Bennett P (2000) IS1294, a DNA element that transposes by

RC transposition. Plasmid 44: 66–84.

Toleman MA &Walsh TR (2008) Evolution of the ISCR3 group of

ISCR elements. Antimicrob Agents Ch 52: 3789–3791.

Toleman MA, Bennett PM & Walsh TR (2006a) Common regions

e.g. orf513 and antibiotic resistance: IS91-like elements

evolving complex class 1 integrons. J Antimicrob Chemoth

58: 1–6.

Toleman MA, Bennett PM & Walsh TR (2006b) ISCR elements:

novel gene-capturing systems of the 21st century? Microbiol

Mol Biol R 70: 296–316.

Tolmasky ME & Crosa JH (1993) Genetic organization of

antibiotic resistance genes (aac(60)-Ib, aadA, and oxa9) in the

multiresistance transposon Tn1331. Plasmid 29: 31–40.

Touchon M, Hoede C, Tenaillon O et al. (2009) Organised

genome dynamics in the Escherichia coli species results in

highly diverse adaptive paths. PLoS Genet 5: e1000344.

Tseng SP, Hsueh PR, Tsai JC & Teng LJ (2007) Tn6001, a

transposon-like element containing the blaVIM-3-harboring

integron In450. Antimicrob Agents Ch 51: 4187–4190.

Turlan C & Chandler M (1995) IS1-mediated intramolecular

rearrangements: formation of excised transposon circles and

replicative deletions. EMBO J 14: 5410–5421.

Turton JF, Ward ME, Woodford N, Kaufmann ME, Pike R,

Livermore DM & Pitt TL (2006) The role of ISAba1 in

expression of OXA carbapenemase genes in Acinetobacter

baumannii. FEMS Microbiol Lett 258: 72–77.

Valverde A, Canton R, Garcillan-Barcia MP, Novais A, Galan JC,

Alvarado A, de la Cruz F, Baquero F & Coque TM (2009)

Spread of blaCTX-M-14 is driven mainly by IncK plasmids

disseminated among Escherichia coli phylogroups A, B1, and D

in Spain. Antimicrob Agents Ch 53: 5204–5212.

van der Ploeg J, Willemsen M, van Hall G & Janssen DB (1995)

Adaptation of Xanthobacter autotrophicus GJ10 to

bromoacetate due to activation and mobilization of the

haloacetate dehalogenase gene by insertion element IS1247.

J Bacteriol 177: 1348–1356.

Verdet C, Arlet G, Barnaud G, Lagrange PH & Philippon A (2000)

A novel integron in Salmonella enterica serovar Enteritidis,

carrying the blaDHA-1 gene and its regulator gene ampR,

originated from Morganella morganii. Antimicrob Agents Ch

44: 222–225.

Verdet C, Gautier V, Chachaty E, Ronco E, Hidri N, Decre D &

Arlet G (2009) Genetic context of plasmid-carried blaCMY-2-

like genes in Enterobacteriaceae. Antimicrob Agents Ch 53:

4002–4006.

Villa L, Garcıa-Fernandez A, Fortini D & Carattoli A (2010)

Replicon sequence typing of IncF plasmids carrying virulence

and resistance determinants. J Antimicrob Chemoth 65:

2518–2529.

Wachino J, Yamane K, Kimura K, Shibata N, Suzuki S, Ike Y &

Arakawa Y (2006) Mode of transposition and expression of

16S rRNA methyltransferase gene rmtC accompanied by

ISEcp1. Antimicrob Agents Ch 50: 3212–3215.

Wagner A, Lewis C & Bichsel M (2007) A survey of bacterial

insertion sequences using IScan. Nucleic Acids Res 35: 5284–5293.

Waldor MK (2010) Mobilizable genomic islands: going mobile

with oriT mimicry. Mol Microbiol 78: 537–540.

Walsh TR (2006) Combinatorial genetic evolution of

multiresistance. Curr Opin Microbiol 9: 476–482.

Welch TJ, Fricke WF, McDermott PF et al. (2007) Multiple

antimicrobial resistance in plague: an emerging public health

risk. PLoS One 2: e309.

Woodford N, Carattoli A, Karisik E, Underwood A, Ellington MJ

& Livermore DM (2009) Complete nucleotide sequences of

plasmids pEK204, pEK499, and pEK516, encoding CTX-M

enzymes in three major Escherichia coli lineages from the

United Kingdom, all belonging to the international O25:H4-

ST131 clone. Antimicrob Agents Ch 53: 4472–4482.

Wozniak RA & Waldor MK (2010) Integrative and conjugative

elements: mosaic mobile genetic elements enabling dynamic

lateral gene flow. Nat Rev Microbiol 8: 552–563.

Wozniak RA, Fouts DE, Spagnoletti M, Colombo MM, Ceccarelli

D, Garriss G, Dery C, Burrus V & Waldor MK (2009)


854 S.R. Partridge

Dow


ic.oup.com/fem


Comparative ICE genomics: insights into the evolution of the

SXT/R391 family of ICEs. PLoS Genet 5: e1000786.

Wrighton CJ & Strike P (1987) A pathway for the evolution of the

plasmid NTP16 involving the novel kanamycin resistance

transposon Tn4352. Plasmid 17: 37–45.

Yau S, Liu X, Djordjevic SP & Hall RM (2010) RSF1010-like

plasmids in Australian Salmonella enterica serovar

Typhimurium and origin of their sul2-strA-strB antibiotic

resistance gene cluster. Microb Drug Resist 16: 249–252.

Yurieva O, Kholodii G, Minakhin L, Gorlenko Z, Kalyaeva E,

Mindlin S & Nikiforov V (1997) Intercontinental spread of

promiscuous mercury-resistance transposons in

environmental bacteria. Mol Microbiol 24: 321–329.

Zhao F, Bai J, Wu J et al. (2010) Sequencing and genetic variation

of multidrug resistance plasmids in Klebsiella pneumoniae.

PLoS One 5: e10141.

Zhu WH, Luo L, Wang JY, Zhuang XH, Zhong L, Liao K, Zeng Y

& Lu YJ (2009) Complete nucleotide sequence of pCTX-M360,

an intermediate plasmid between pEL60 and pCTX-M3, from

a multidrug-resistant Klebsiella pneumoniae strain isolated in

China. Antimicrob Agents Ch 53: 5291–5293.

Zong Z, Partridge SR & Iredell JR (2009) A blaVEB-1 variant,

blaVEB-6, associated with repeated elements in a complex

genetic structure. Antimicrob Agents Ch 53: 1693–1697.

Zong Z, Partridge SR & Iredell JR (2010) ISEcp1-mediated

transposition and homologous recombination can explain the

context of blaCTX-M-62 linked to qnrB2. Antimicrob Agents Ch

54: 3039–3042.

Zong Z, Yu R, Wang X & Lu X (2011) blaCTX-M-65 is carried by a

Tn1722-like element on an IncN conjugative plasmid of ST131

Escherichia coli. J Med Microbiol 60: 435–441.

Supporting Information

Additional Supporting Information may be found in the

online version of this article:

Fig. S1. blaTEM promoters and frameworks.

Please note: Wiley-Blackwell is not responsible for the

content or functionality of any supporting materials sup-

plied by the authors. Any queries (other than missing

material) should be directed to the corresponding author

for the article.



Dow


ic.oup.com/fem


analysis of antibiotic resistance regions in gram-negative

Documents