alternative splicing modulates autoinhibition and sh3 accessibility in the src kinase fyn

MOLECULAR AND CELLULAR BIOLOGY, Dec. 2009, p. 6438–6448 Vol. 29, No. 240270-7306/09/$12.00 doi:10.1128/MCB.00398-09Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Alternative Splicing Modulates Autoinhibition andSH3 Accessibility in the Src Kinase Fyn�†

C. Brignatz,1,2,3 M. P. Paronetto,8 S. Opi,1,2,3 M. Cappellari,8 S. Audebert,1,2,3 V. Feuillet,4,5

G. Bismuth,4,5 S. Roche,6 S. T. Arold,7 C. Sette,8 and Y. Collette1,2,3*INSERM U891, Centre de Recherche en Cancerologie de Marseille, 13009 Marseille, France1; Institut Paoli Calmettes, 13009 Marseille,

France2; Universite de la Mediterranee, 13007 Marseille, France3; INSERM U564, Paris, France Institut Cochin,Universite Paris Descartes, CNRS UMR 8104, Paris, France4; Institut Cochin, Universite Paris Descartes, CNRS UMR 8104,

Paris, France5; Centre National de la Recherche Scientifique UMR5237, University of Montpellier I and II,CRBM, Montpellier, France6; INSERM UMR 554; CNRS UMR 5048, Universite Montpellier I and II,

Centre de Biochimie Structurale, 34090 Montpellier, France7; and University of Tor Vergata,00133 Rome, and Laboratory of Neuroembryology, Fondazione Santa Lucia, 00143 Rome, Italy8

Received 27 March 2009/Returned for modification 29 May 2009/Accepted 23 September 2009

Src family kinases are central regulators of a large number of signaling pathways. To adapt to theidiosyncrasies of different cell types, these kinases may need a fine-tuning of their intrinsic molecular controlmechanisms. Here, we describe on a molecular level how the Fyn kinase uses alternative splicing to adapt todifferent cellular environments. Using structural analysis, site-directed mutagenesis, and functional analysis,we show how the inclusion of either exon 7A or 7B affects the autoinhibition of Fyn and how this changes theSH3-dependent interaction and tyrosine phosphorylation of Sam68, with functional consequences for theSam68-regulated survival of epithelial cells. Our results illustrate a novel mechanism of evolution that maycontribute to the complexity of Src kinase regulation.

The Src family of nonreceptor protein tyrosine kinases com-prises nine members, including Src, Blk, Fgr, Fyn, Hck, Lyn,Lck, Yes, and Yrk. These kinases play crucial roles in a varietyof cellular processes, such as cell cycle control, cell adhesion,cell motility, cell proliferation, and cell differentiation (41).Extensive studies indicate that the complexity of functionalroles of Src kinases derives mainly from their ability to com-municate with a large number of upstream receptors anddownstream effectors, which vary by cell type (31). Given theircritical role, diverse mechanisms of autoregulation haveevolved, and their importance is highlighted by the implicationof elevated Src expression levels and/or activity in epithelialcancers (for a review, see reference 48). The autoregulatorymechanisms depend on the composition and order of variousdomains and on posttranslational modification sites in thelinker segments that connect the domains (35). From the N toC terminus, Src contains a myristoyl group attached to aunique domain, an Src homology 3 (SH3) domain that typicallybinds left-handed polyproline type II sequence motifs, an SH2domain that binds to tyrosine-phosphorylated protein motifs, aprotein-tyrosine kinase domain (SH1), and a C-terminal reg-ulatory segment. Early biochemical studies suggested thatthese domains were critical for keeping Src catalytic activityunder control (4, 23, 39, 40). The validation of the autoinhibi-tory role of these regulatory moieties came from the structuresof Src and Hck kinases (36, 37, 43, 46, 47). The structures

showed how interdomain interactions, stabilized by the bindingof the SH2 domain to the tyrosine-phosphorylated C terminus(pTyr528), lock the molecule in a closed conformation. Theyfurther showed the unanticipated finding that residues in thelinker region between the SH2 domain and the kinase domain,the SH2-kinase linker, make direct contact with the catalyticdomain and adopts a polyproline type II helix conformationthat docks onto the SH3 domain. This intramolecular interac-tion hinders the formation of a salt bridge that is crucial for thekinase activity, thereby eliciting an inhibitory effect. However,these interactions are suboptimal, and other phosphotyrosine-or polyproline-containing sequences can compete favorablywith Src’s own sequences for SH2 or SH3 domain binding (3,25). These binding events lead to the stimulation of Src kinaseactivity by disrupting the intramolecular constraints imposedon the kinase domain. Once released from the repressed state,the autophosphorylation of tyrosine residue Tyr416 (pTyr416)in the activation loop rapidly occurs, resulting in a conforma-tional change that releases a fully active kinase.

Remarkably, recent advances have highlighted the crucialrole of linker regions in establishing the structural and func-tional assembly of multimodular proteins in signal transduc-tion, and Src kinases are influential in our understanding ofthese mechanisms (13). The nine Src family members are verysimilar in terms of sequence identity, with, for example, thestrong conservation of the SH3 binding surface and the coresof the kinase domain (44). Nevertheless, high sequence vari-ability is noted in the SH2-kinase linker segment, except thatthe overall hydrophobicity is conserved. The interactions thatthis linker makes with both the SH3 domain and the back ofthe kinase domain probably result in a high-specificity binding.Indeed, the activities of chimeras in which the SH3 domain ofSrc kinases have been swapped show altered regulation (12, 14,

* Corresponding author. Mailing address: UMR891 INSERM, Cen-tre de Recherche sur le Cancer de Marseille, 27 Boulevard Leï Roure,13009 Marseille, France. Phone: (33) 491 75 84 13. Fax: (33) 491 26 0364. E-mail: [email protected].

† Supplemental material for this article may be found at http://mcb.asm.org/.

� Published ahead of print on 5 October 2009.

6438

16). Furthermore, in contrast to deletion or point mutations inthe SH3 domain, Src mutants in the linker segment or in thelinker-interacting surface on the catalytic domain can trans-form fibroblast, suggesting specific function(s) (14).

Src kinases originated by the duplication and diversificationof the same ancestral gene with an original 10-intron structurebefore the separations of Teleostei from Tetrapoda (6). One ofthe Src-related kinases, Fyn, possesses two kinds of exon 7,exon 7A and exon 7B, essentially encoding for the SH2-kinaselinker segment and the N terminus of the SH1 domain. Thealternative splicing of exon 7A or 7B yields two major Fynisoforms, FynB (exon 7A) and FynT (exon 7B) (7). Exon 7Ashows a different evolutionary pattern from that of the otherparts of the gene, suggesting that it is derived by a recombi-natorial event with another gene (33). The newly capturedexon, encoding FynB, was coopted by the central nervous sys-tem and possibly other tissues, while the ancestral isoform,encoding FynT, is expressed mainly in the hematopoietic sys-tem (7, 32). Whether this diversification process generatedintrinsic biochemical functional novelty in addition to the dif-ferential tissue distribution and related functional divergencecurrently is unknown. Since the alternatively spliced exon thatdistinguishes the two isoforms essentially encodes for the SH2-kinase linker segment, it is possible that it confers distinctregulatory features. Thus, this evolutionary divergence in theSH2-linker segment of FynT and FynB, which maintain iden-tical SH2, SH3, and kinase domains, offers the unique oppor-tunity to explore the specific functions that this linker segmentmay impose on Src kinase function and/or regulation.

Here, we have investigated how exons 7A and 7B affect thefunctional interaction of Fyn with the RNA-binding proteinSam68. Sam68 is known to activate Fyn by binding to its SH3domain and also to serve as a substrate for phosphorylation byFyn. We show that FynT and FynB display a distinct capacityto bind and phosphorylate Sam68. This differential interactionwith a substrate is functionally relevant, because it allows thespecific phosphorylation-mediated regulation of the Sam68-dependent alternative splicing of Bcl-x by FynT and results inthe differential regulation of apoptosis in epithelial cells. Swap-ping experiments identify core residues of the exon 7A- or7B-encoded SH2-kinase linker segment as both required andsufficient to confer this distinct function. In agreement withstructural models, our data show that exon 7B reinforces theautoinhibitory lock that the SH2-linker region imposes ontothe kinase domain and on SH3 domain accessibility. Theseresults uncover a novel specific function that the SH2-kinaselinker segment can play in Src biology and highlight the im-portance of alternative splicing for the acquisition of fine-tuning regulatory functions during evolution.

MATERIALS AND METHODS

Plasmids and constructs. The pXM-fynB, pXM-fynT, pXM-fynB_Y528F, andpXM-fynT_Y528F plasmid constructs were kindly provided by D. Davidson (In-stitut de Recherches Cliniques de Montreal, Quebec, Canada), and the SLM1-green fluorescent protein (GFP) and SLM2-GFP constructs were a kind gift fromS. Stamm (Erlangen, Germany). The FynB�SH3, FynT�SH3, FynB-P251A,FynT-P251A, FynB-like, and FynT-like mutants were generated using a site-directed mutagenesis kit (QuikChange; Stratagene, La Jolla, CA). The cDNAencoding the active Src kinase or Yes was kindly given by M. Marsh and K.Saksela. The cDNA encoding Lck and Hck in pMNC were given by BASFBioresearch Corporation. The cDNA of human Sam68 was subcloned from

pcDNA3-Sam68 (30) into the EcorI-SalI restriction site of pEGFP. The Bcl-xminigene has been described previously (22).

Quantitative PCR. Total cellular RNA was extracted from 106 cells usingTRIzol (Invitrogen) by following the manufacturer’s instructions. RNA concen-trations were determined by spectrophotometry. Reverse transcription-PCR(RT-PCR) was performed using equal amount of RNA and with Applied Bio-systems reagents (Foster City, CA). The ABI Prism 7700 Sequence DetectionSystem (Applied Biosystems, Foster City, CA) was used for quantitative PCRanalysis. Amplification conditions, according to the protocol specified by AppliedBiosystems, were 2 �l template DNA, 1 �l Power SYBR green PCR master mix(Applied Biosystems), and 125 ng of each primer (FynT, FynB, or 3,6-glyceral-dehyde-3-phosphate dehydrogenase [GAPDH]), for a total reaction volume of25 �l. The TaqMan cycling conditions were 2 min at 50°C, 10 min at 95°C, and40 cycles of 15 s at 95°C, followed by 1 min at 60°C. The sequences of the forwardprimer used were GCCGCCTAGTAGTTCCCTGT for FynB and AGATGCTTGGGAAGTTGCAC for FynT. The sequence of the reverse primer used wasthe same for FynB and FynT (CTTCATGATCTGCGCTTCCT). RT-PCR prod-ucts were mixed with DNA loading buffer (20 mM EDTA, 5 �M Tris-acetate-EDTA, 50% glycerol, and 0.002% bromophenol blue dye), electrophoresed in2% agarose gels, and visualized by staining with ethidium bromide. A DNA sizemarker was run in parallel. To compare expression levels of FynB and FynT amongthe cell lines, the results are express as �CT, where �CT � CT(FynB or FynT) �CT(GAPDH), and the �CT(FynB)/�CT(FynT) and �CT(FynT)/�CT(FynB) ratios werecalculated.

Mass spectrometry. NuPAGE protein gels were stained with imperial blue(Pierce). Fyn proteins were cut from the gel and digested with trypsin (sequenc-ing grade; Promega). Peptides were analyzed by mass spectrometry using amatrix-assisted laser desorption ionization–time of flight (MALDI-TOF) instru-ment (Ultraflex, Bruker Daltonics Inc., Bremen, Germany) with reflector andpositive modes, an ion acceleration of 25 keV, a 5-Hz laser frequency, and adelay extraction of 110 ns. Six hundred shots were accumulated for each spec-trum. Spectra were recalibrated using internal trypsin monoprotonated monoiso-topic sizes 842.509, 1045.564, 2211.104, and 2283.180. Raw data were processedusing Flex Analysis and Biotool software (Bruker Daltonics Inc.). Proteinsearches were achieved using the Mascot search engine against the MSDBdatabase (Matrix Science Ltd., London, United Kingdom) for unambiguous Fynprotein identification.

Cell culture and transfection. HEK293 cells were cultured in Dulbecco’smodified Eagle’s medium (DMEM; Invitrogen) containing glutamine and anti-biotics (penicillin and streptomycin), supplemented with 10% decomplementedfetal bovine serum (FBS) (BioWhittaker Cambrex Bioscience), at 37°C in ahumidified 5% CO2 atmosphere. Transient transfection in HEK293 cells wasperformed using Lipofectamine Plus reagent (Gibco) or JetPEI (Polyplus-trans-fection) according to the manufacturer’s instructions. At 48 h after transfection,cells were collected and subjected to biochemical analysis.

Jurkat cells were cultured in RPMI medium supplemented with 10% FBS. Theday before transfection, cells were plated at 500,000/ml. For each experimentalpoint, 4 � 106 cells were resuspended in 100 �l of Optimem (Invitrogen) with 6�g of total plasmidic DNA and electroporated using the Amaxa X001 program.

Western blot analysis and immunoprecipitation. For protein extraction,HEK293 cells were resuspended in lysis buffer (300 mM NaCl, 40 mM HEPES,1 mM dithiothreitol, 0.1 mM NaVO4, 1 mM NaF, protease inhibitor cocktail[Sigma-Aldrich], and 6 mM octyl �-D-glucopyranoside) supplemented with 1%Triton X-100. The extracts were centrifuged for 10 min at 12,000 � g at 4°C, andthe supernatants were collected and used for Western blotting and immunopre-cipitation experiments. Cells extracts or immunoprecipitated proteins were di-luted in sodium dodecyl sulfate (SDS) sample buffer and boiled for 5 min.Proteins were separated on SDS–7.5% polyacrylamide gel electrophoresis (SDS–7.5% PAGE) gels and transferred onto nitrocellulose for Western blot analysis.For immunoprecipitation, cell lysates (500 �g) were incubated for 2 h at 4°C with5 mg of protein A-Sepharose beads (Amersham Pharmacia Biotech) previouslyincubated overnight at 4°C with the appropriate antibody. After five washes usinglysis buffer, immune complexes were analyzed by Western blotting.

Kinase assay. In vivo kinase activity was assessed by tyrosine-phosphorylatedprotein content by Western blotting using the anti-phosphotyrosine 4G10 anti-body from total cell lysates. Protein expression was assessed by Western blottingusing Fyn (sc-16; Santa Cruz Biotechnology), Abl (sc-56887; Santa Cruz Bio-technology), c-Kit (sc-168; Santa Cruz Biotechnology), Tec (sc-25427; SantaCruz Biotechnology), Ret (sc-80325; Santa Cruz Biotechnology), Sam68 (sc-333;Santa Cruz Biotechnology), �-tubulin (T 5168; Sigma), Shc (2432; Cell SignalingTechnology), and phospholipase C-�1(1249) (sc-81; Santa Cruz Biotechnology),followed by incubation with peroxidase-labeled goat anti-mouse or goat anti-

VOL. 29, 2009 ALTERNATIVE SPLICING MODULATES Fyn AUTOINHIBITION 6439

rabbit antiserum antibodies and enhanced chemiluminescence detection (ECL;Amersham Pharmacia Biotech).

For the in vitro kinase assay, HEK293 cells were transfected with PXM139plasmid constructs encoding FynB or FynT. Cell lysis was performed usingradioimmunoprecipitation assay (RIPA) buffer (25 mM HEPES, pH 7.4, 150mM NaCl, 10 mM EDTA, 1 mM EGTA, 5 mM NaF, 5 mM iodoacetamide, 1%Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS, 1 mM dithiothreitol, 1 mMsodium orthovanadate). Cells extracts were immunoprecipitated with the Fynrabbit polyclonal antibody and incubated with 0, 2, or 30 �M of a p85-derivedproline-rich peptide for 15 min at 30°C. An in vitro kinase assay was performedin kinase buffer containing 50 mM dithiothreitol, 100 mM HEPES, pH 7.2, 20mM MgCl2, 20 mM Mn2, 250 �g/ml enolase (rabbit muscle; Sigma), and 2 �MATP containing 2 �Ci [�-32P]ATP for 15 min at 30°C. The reaction was termi-nated by the addition of loading buffer, and the samples were analyzed bySDS-PAGE followed by autoradiography and Fyn Western blotting.

Homology models. Initial homology models of FynT and FynB were createdusing the Swiss-Model server (http://swissmodel.expasy.org/ [1]) with the c-Srcstructure (PDB entry 1FMK [47]) as the template. Models were manually ad-justed (using Coot [11]) and subjected to structure idealization (Refmac [27]).Final models showed verify3D scores (21) that are similar to those of the exper-imental Src structure (Src, 0.304; FynT, 0.288; FynB, 0.288).

RNA extraction and splicing assay. Total RNA was extracted from transfectedHEK293 cells using TRIzol reagent (Invitrogen) according to the manufacturer’sinstructions. RNA was resuspended in RNase-free water (Sigma-Aldrich) andimmediately frozen at �80°C for further analysis. RT-PCR analyses were per-formed as previously described (28). Briefly, the Bcl-x minigene (0.5 �g) wastransfected in HEK293 cells with 0.25 �g of either GFP or GFP-Sam68 alone orin combination with 0.25 �g of FynT or FynB. Cells were harvested 20 h aftertransfection and processed for RT-PCR. Densitometric analyses are shown be-low the images in the figures as mean values of the Bcl-xs/Bcl-xL ratios.

For the splicing assay of Jurkat cells, cells were collected 24 h later to extractRNA and proteins by standard methods. For the RT-PCR, 1 �g of RNA previ-ously treated with RNase-free DNase (Ambion) was used. PCR was performedwith 10% of the RT-PCR product and 40 cycles of amplification (94°C for 4 min,then 94°C for 30 s, and then 40 cycles of 50°C for 30 s and 72°C for 30 s, followedby 72°C for 7 min).

Caspase 3 staining. HEK293 cells were cotransfected with GFP or GFP-Sam68, together with pXM, pXMFynB, or pXMFynT (1:1 ratio), using Lipo-fectamine reagent. The cells were fixed 30 h after transfections using 4% para-formaldehyde. Cells were permeabilized with 0.1% Triton X-100 for 7 min andthen incubated for 1 h in 0.5% bovine serum albumin. Cells were washed threetimes with phosphate-buffered saline (PBS) and incubated for 2 h at roomtemperature with caspase 3 antibody (1/500; Sigma), followed by 1 h of incuba-tion with cy3-conjugated anti-mouse immunoglobulin G (Alexa). After washes,slides were mounted with mowiol reagent (Calbiochem) and analyzed by fluo-rescent microscopy using a Zeiss microscope. The number of cells positive foractive caspase 3 among the GFP-positive cells was counted.

RESULTS

FynB and FynT differ in their abilities to interact with andphosphorylate the RNA-binding protein Sam68. While fyntranscription appears to be ubiquitous, FynB protein previ-ously had been described only in the brain (7). Previous workin our laboratory (32) suggested that FynB is transcribed andtranslated in epithelial cells. To confirm this initial observation,we first performed quantitative RT-PCR on human mammaryepithelial primary (HMEP) cells using FynT-, FynB-, andGAPDH-specific primer pairs. The PCR products obtainedafter 40 cycles of amplification using an ABI Prism 7700 Se-quence Detection System were run on agarose gels (Fig. 1A)and the CT values were determined, showing the presence ofboth FynT and FynB transcripts, with a 2:1 FynB-to-FynT ratio(Fig. 1B). These results were extended and confirmed in 12breast cancer-derived carcinoma cell lines, showing a similartwofold FynB-to-FynT ratio, except in the HeLa and MBA-MB231 cells, where FynB and FynT transcripts are equallypresent (Fig. 1C). In the Jurkat human T-cell line, an opposite

sevenfold FynT-to-FynB ratio was observed (Fig. 1C). Thetranslation of FynB transcripts in HMEP and HeLa cells wasdemonstrated by Fyn protein immunoprecipitation using anFyn rabbit polyclonal antibody followed by immunoblottingusing a specific anti-FynB isoform rabbit polyclonal antibody(32). The FynB protein was detected in both HMEP- andHeLa-derived cell lysates but not from Jurkat-derived cell ly-sates (Fig. 1D). Although these results show the presence ofthe FynB isoform in normal and transformed epithelial cells,the cotranslation of FynT is not excluded. Polyclonal anti-Fynprecipitates thus were resolved by SDS-PAGE, followed bytryptic digestion and MALDI-TOF spectrometry. Indeed, tryp-tic digestion generates a p1976 FynB peptide that was detectednot only in mouse brain-derived cell lysates but also in HeLa-,HEK293-, and MDA-MB321-derived cell lysates, but it wasnot detected in mouse thymus-derived cell lysates (Fig. 1E).Conversely, the tryptic digestion of FynT generates a p1948peptide that can be detected in mouse thymus cell-derived celllysates but not in epithelial cell-derived cell lysates (Fig. 1E),strongly indicating that the FynB isoform is the only detectabletranslated Fyn isoform in epithelial cells.

To analyze FynB and FynT activity in mammalian epithelialcells, HEK293 human kidney cells were transfected with ex-pression vectors encoding various FynT and FynB alleles. Inaddition to wild-type FynT and FynB, mutant forms weretested that included a Tyr-to-Phe alteration of the C-terminalregulatory Tyr528 residue (FynT/B_Y528F), a complete dele-tion of the SH3 domain (FynB/T�SH3), and a Pro-to-Alaalteration of the SH2-kinase linker Pro251 residue (FynT/B_P251A) (Fig. 2A). Although the transient expression of bothFynT and FynB was associated with strong autophosphoryla-tion, only FynT caused a strong tyrosine phosphorylation of aprotein, with an apparent molecular mass of more than 62 kDa(Fig. 2B), that was identified as Sam68 by specific immunopre-cipitation (Fig. 2C). Moreover, FynT phosphorylated Sam68more efficiently than FynB in Jurkat lymphoid T cells (see Fig.S1A in the supplemental material). The different ability tophosphorylate Sam68 did not depend on the subcellular local-ization of FynB and FynT, because they both showed a markedplasma membrane staining (see Fig. S2 in the supplementalmaterial). The transient expression of FynT_Y528F andFynT_P251A caused the strong phosphorylation of additionalcellular proteins and further increased Sam68 phosphorylationcompared to that of wild-type FynT, which correlated withincreased Sam68 coimmunoprecipitation. In contrast, whereasthe expression of FynT�SH3 caused the phosphorylation ofseveral cellular proteins, it failed to induce Sam68 phosphory-lation, indicating the requirement of the SH3 domain forSam68 interaction and subsequent tyrosine phosphorylation.The expression of FynB_Y528F and FynB�SH3 induced onlya modest, if any, phosphorylation of cellular proteins, and itfailed to induce Sam68 phosphorylation, whereas FynB_P251Acaused a low but detectable phosphorylation of Sam68. Again,the ability to phosphorylate Sam68 correlated with the inter-action of Fyn proteins with Sam68, as demonstrated by coim-munoprecipitation experiments (Fig. 2C). Hence, introducingmutations within the FynB and FynT regulatory C terminusand SH2-kinase linker segments does not activate the twokinases to the same extent.

We next determined whether the lack of Sam68 phosphory-

6440 BRIGNATZ ET AL. MOL. CELL. BIOL.

lation by FynB could be compensated for by altering the FynB-to-Sam68 ratio of expression. Indeed, the transient coexpres-sion of increasing doses of a GFP-Sam68 construct showedthat FynB could achieve GFP-Sam68 phosphorylation, but itdid so much less efficiently than FynT (Fig. 2D). Similarly,increasing the expression of FynB partially compensated forGFP-Sam68 phosphorylation (Fig. 2E). These experimentsshow that the differential phosphorylation of Sam68 by Fynisoforms is due to the more efficient interaction of FynT withSam68, and that the intrinsic failure of FynB to interact withand to phosphorylate Sam68 can be compensated for by in-creasing the intracellular concentration of either FynB orSam68. To verify the specificity of Sam68 phosphorylation byFynT, we tested additional tyrosine kinases. The transient ex-pression of other receptors (RET and c-Kit) and nonreceptortyrosine kinases (Abl and Tec), as well as other Src familymembers (Src, Lck, Hck, and Yes), evidenced the predominantpreference for Sam68 tyrosine phosphorylation by FynT (Fig.3A and B). However, the overexpression of the GFP-Sam68

construct revealed that Src also can phosphorylate GFP-Sam68under less stringent conditions (see Fig. S3 in the supplementalmaterial).

Since the Sam68-like protein SLM-1 can serve as a Fynsubstrate and is found primarily in the brain, in contrast tothe widely expressed Sam68 and Sam68-related SLM-2 pro-tein (38), we next analyzed the ability of FynT and FynB tophosphorylate SLM-1 and SLM-2. Similarly to Sam68, thecoexpression of GFP–SLM-1 and, to a lesser extent, GFP–SLM-2 constructs showed preferential tyrosine phosphory-lation upon coexpression with FynT compared to that ofFynB (see Fig. S4 in the supplemental material), suggestingthat this differential phosphorylation activity is intrinsic tothe Fyn isoforms. The activities of the two Fyn isoformswere studied with other known Fyn substrates. Westernblotting experiments revealed the preferential tyrosinephosphorylation of Shc (Fig. 3C) and phospholipase C-�(Fig. 3D) in FynT-transfected cells compared to that ofFynB-transfected cells, indicating that the differential activ-

FIG. 1. Fyn expression in epithelial cells. (A) Analysis of FynB, FynT, and GAPDH mRNAs in HMEP cells by quantitative RT-PCR. PCRproducts obtained after 40 cycles were analyzed on a 2% agarose gel followed by ethidium bromide staining and photography. (B) The CT valuesfrom samples obtained from experiments depicted in panel A were determined, and after normalization to results for GAPDH mRNA, FynB/FynT(B/T) and FynT/FynB (T/B) ratios were calculated and plotted. (C) The FynB/FynT and FynT/FynB mRNA ratios were determined as describedfor panel B in the indicated epithelial cancer cell lines (HME, HBL100, MDA-MB134, MDA-MB231, BRCA, SUM149, HEK293, HeLa,MCF10A, BT474, T47D, and MCF7) as well as in a leukemia cell line (JA16). (D) Using polyclonal anti-Fyn rabbit antibodies, the Fyn proteinwas immunoprecipitated (IP) from HEK293 cells transfected with empty vector or with FynB-encoding plasmid constructs or from HMEP, HeLa,and JA16 cell lines, followed by SDS-PAGE and anti-FynB and anti-Fyn immunoblotting, as indicated. Ig, immunoglobulin. (E) Fyn protein wasimmunoprecipitated from the indicated tissues and cell lines using polyclonal anti-Fyn rabbit antibodies, separated on SDS-PAGE, and charac-terized by MALDI-TOF mass spectrometry after tryptic digestion. The specific p1948 FynT (218A-233K) and p1976 FynB (218A-233R) peptidesdiffering only by the last amino acid are framed blue and pink, respectively.


ities of the two Fyn isoforms is not restricted to Sam68-related proteins. To test this hypothesis further, anti-Fynimmunoprecipitates were analyzed by antiphosphotyrosineWestern blotting. While specific tyrosine-phosphorylatedbinding proteins were detected in Fyn immunoprecipitatesobtained from FynT- but not from FynB-transfected cells,others seemed to be similarly coimmunoprecipitated withboth Fyn isoforms, suggesting that the differential activitiesof the two Fyn isoforms is not absolute (Fig. 3E).

SH2-kinase linker-mediated autoinhibition is more efficientfor FynB than FynT. To determine whether the differences inthe activities of FynB and FynT were due to differential auto-inhibition regulatory mechanisms, the immunoblotting of invivo-phosphorylated FynT and FynB was performed. An op-posite anti-pTyr416-to-anti-pTyr527 reactivity was found, sug-gesting the distinct steady-state autoinhibition of these iso-forms. Remarkably, FynB displayed a higher phosphorylationof the inhibitory Y528 residue and a lower phosphorylation ofthe activating Y416 residue (Fig. 4A). This result is compatiblewith a close inactive conformation of the FynB kinase. We next

modeled FynT and FynB based on the crystallographic struc-ture of c-Src (47). Given the 78% sequence identity betweenFynT and c-Src within the sequence region included in thestructure (SH2, SH3, kinase domain, and tail fragment), thehomology modeling of FynT is straightforward, and the resultsderived are expected to yield valuable insights (Fig. 4B). Inparticular, key regulatory contacts (such as the interaction be-tween L256 from the SH2-kinase linker region and the kinasedomain) are preserved in the FynT homology model. P251,which appears important for reinforcing the polyproline type IIconformation of the SH2-kinase linker, also is found in FynT.FynB was modeled on FynT using the sequence alignmentdepicted in Fig. 4C, which preserves the positions of P251 andL256. All residue substitutions in FynT and FynB are compat-ible with a compact inactive kinase conformation where theSH2-kinase linker is sandwiched between the SH3 domain andkinase domain.

The contact surface between the SH2-kinase linker regionand the rest of the molecule was significantly larger in theFynB model structure (1,110 Å2) than in FynT (880 Å2) or

FIG. 2. FynB- and FynT-induced tyrosine phosphorylation pattern. (A) Schematic diagram of the Fyn constructs. The red star indicates theY528F mutation, the black star indicates the P251A mutation in SH2-kinase linker, and the Fyn�SH3 construct was obtained by deleting the SH3domain sequences. (B) HEK293 cells were transfected with plasmid constructs encoding FynB, FynB_Y528F, FynT, FynT_Y528F, FynB�SH3,FynT�SH3, FynB-P251A, or FynT-P251A. After 48 h of expression, cell extracts were prepared and analyzed by Western blotting for tyrosinephosphorylation (pY blot), Sam68 (Sam68 blot), and tubulin (tubulin blot) expression. (C) The extracts used for panel B were immunoprecipitated(IP) using Fyn antibodies, followed by Sam68 and Fyn immunoblotting. (D) HEK293 cells were transfected with increasing amounts of GFP-Sam68or empty (�) plasmid constructs (0, 0.2, 0.6, 1.8, or 2.6 ng) and cotransfected with FynB or FynT (0.2 ng), as indicated. Whole-cell lysates wereanalyzed by Western blotting as described for panel B. (E) HEK293 cells were transfected with increasing amounts of FynB, FynT, or empty (�)plasmid constructs (0, 0.2, 0.6, 1.8, or 2.6 ng) and cotransfected with GFP-Sam68 (0.2 ng). Whole-cell lysates were analyzed by Western blottingas described for panel B. Band intensities were quantified using Image J, and the phospho-Sam68/Sam68 ratios are presented.


c-Src (960 Å2). A larger buried surface area is indicative of astronger interaction, especially considering the overall similar-ity of the structures. Thus, the differences in buried surfacearea support the hypothesis that the inactive (closed) confor-mation is more stable in FynB than in FynT. Indeed, as shownin Fig. 4B and C, the amino acid sequence of the SH2-kinaselinker of FynB appears to offer more in terms of hydrophobicinteractions [M250(T)3Y91/Y137; L253(T)3Y137, Y93,P134, W119; and V263(A)3L256, W290, I266(V); residues inparentheses correspond to equivalent residues of FynT] andpolar/ionic interactions [K248(S)3Y91OH, R252(Q)3E343,and backbone oxygens of H323 and L326; S257(A)3D100;and R2593D99]. Hence, the model suggests that the FynBSH2-kinase linker sequence favors a closed autoinhibited con-formation that is less prone to competition with other SH3-binding sequences and to catalytic activation.

To test this model, FynT/B_P251A, FynT/B_L256V, orFynT/B_P251A-L256V plasmid construct was transfected in293 human kidney cells, followed by the anti-pTyr416 immu-noblotting of cell extracts. As shown in Fig. 5A, each of theFynB_P251A- and FynB_L256V-transfected cells displayed in-creased anti-pTyr416 reactivity compared to that of wild-typeFynB-transfected cells, which is in agreement with a repressivecontribution of these SH2-kinase linker sequence residues tothe FynB compact inactive kinase conformation. Direct in vitrostudies were conducted to analyze the catalytic activity of iso-lated FynT and FynB using various concentrations of apolyproline-containing peptide to compete for the SH3-depen-dent close autoinhibited conformation. FynT and FynB wereimmunoprecipitated from transfected cells using Fyn poly-clonal antibodies and were included in an in vitro kinase assayin the presence of various concentrations of a polyproline-containing peptide. As shown in Fig. 5B, the addition of 1 �M

of the polyproline-containing peptide upregulated the FynT-dependent phosphorylation of enolase, which was added as anexogenous substrate in the kinase assay, whereas 30 �M of thesame peptide was required to increase the FynB-dependentphosphorylation of enolase.

Core SH2-kinase linker residues are responsible for thedifferential regulation of Sam68 by FynT and FynB. The SH2-kinase linker segment makes contacts with both the SH3 do-main and the back of the kinase domains, which are identicalin FynB and FynT. We therefore swapped the minimal coreSH2-kinase linker sequences containing the more divergenthydrophobic- and electrostatic-contributing residues in FynBand FynT to generate FynT-like and FynB-like constructs (Fig.6A). In contrast to FynB, the transient expression of FynT-like,the FynB construct containing the core FynT SH2-kinaselinker sequences, induced strong cellular protein tyrosinephosphorylation in 293 human kidney cells, including the phos-phorylation of Sam68 (Fig. 6B). This correlated with Sam68coimmunoprecipitation (Fig. 6C). Conversely, the expressionof FynB-like, the FynT construct containing the core FynBSH2-kinase linker sequences, failed to induce Sam68 tyrosinephosphorylation, which correlated with the lack of Sam68 co-immunoprecipitation and thus paralleled the lack of FynBactivity.

We next asked whether the differential regulation ofSam68 by the Fyn isoforms resulted in biologically relevanteffects. Sam68 is an RNA-binding protein involved in alter-native splicing. We have shown recently that Sam68 affectsthe alternative splicing of the Bcl-x pre-mRNA and thattyrosine phosphorylation by FynT favored the antiapoptoticBcl-xL splice site selection (28). Thus, we tested the effect ofwild-type and mutant Fyn isoforms on this function ofSam68. The transient expression of GFP-Sam68 in 293 hu-

FIG. 3. Specificity of the differential FynB and FynT phosphorylation activities. (A) HEK293 cells were transfected with plasmid constructsencoding Abl, c-Kit, FynT, Tec, and Ret tyrosine kinases. After 48 h of expression, cell extracts were analyzed by Western blotting for tyrosinephosphorylation (pY blot) and for the expression of each corresponding kinase, as indicated. (B) HEK293 cells were transfected with plasmidconstructs encoding FynB, FynT, Src, Lck, Yes, and Hck Src kinases. After 48 h of expression, cells extracts were analyzed by Western blottingfor tyrosine phosphorylation (pY blot) and Sam68 expression (Sam68 blot). (C) HEK293 cells were transfected with plasmid constructs encodingFynB and FynT. After 48 h of expression, cells extracts were analyzed by anti-phospho-Shc (TYR239/240), anti-Fyn, and anti-Shc Western blotting,as indicated. (D) HEK293 cells were transfected with plasmid constructs encoding FynB and FynT, followed by phospholipase C-�1 immuno-precipitation (IP) and antiphosphotyrosine (pY blot), anti-Fyn, and anti-phospholipase C-�1 Western blotting, as indicated. Total cell extracts alsowere analyzed for Fyn expression (lower panel). (E) HEK293 cells were transfected with plasmid constructs encoding FynB and FynT. Cell extractswere immunoprecipitated using Fyn antibody, followed by antiphosphotyrosine (pY blot) and anti-Fyn Western blotting. An asterisk indicateproteins that were phosphorylated on tyrosine residues in both FynB- and FynT-transfected cells; a plus sign indicate proteins that werephosphorylated on tyrosine residues in FynT-transfected cells but not in FynB-transfected cells.


man kidney cells caused an up to threefold increase in theBcl-xs/Bcl-xL ratio at the mRNA level, which was opposed byFynT and FynT-like but not by FynB and FynB-like coex-pression (Fig. 6D). Similar results also were obtained whenthese Fyn isoforms were expressed in Jurkat T cells, a cel-lular context in which high FynT activity normally is present(see Fig. S1C in the supplemental material). Taken to-gether, these results show that the FynT SH2-kinase linkercore residues are required and sufficient to allow interactionwith Sam68, to induce its phosphorylation, and to regulateits splicing activity. In contrast, the corresponding FynBSH2-kinase linker core residues are sufficient to precludesuch interactions with Sam68.

Differential regulation of Sam68-dependent Bcl-x mRNAsplicing by Fyn isoforms correlates with differential inductionof apoptosis. We next investigated the physiological conse-quences of the differential interactions of FynB and FynT withSam68. As previously reported (28), the transient expression ofGFP-Sam68 induced apoptosis in HEK293 kidney cells, asdetermined by the cleavage of caspase 3 and nuclear fragmen-tation (Fig. 7). This correlated with a threefold increase in theBcl-xs/Bcl-xL ratio at the mRNA level (Fig. 6D). Remarkably,we found that the coexpression of FynT, but not FynB, reducedSam68-dependent cell apoptosis (Fig. 7), and that its effectcorrelated with the negative regulation of the Bcl-xs/Bcl-xL

ratio in these cells (Fig. 6D). Taken together, these results

FIG. 4. Evidence for FynB autoinhibition that is distinct from FynT autoinhibition. (A) COS7 cells were transfected with plasmid constructsencoding FynB or FynT. Cell extracts were immunoprecipitated using Fyn rabbit polyclonal antibodies, followed by immunoblotting using specificanti-Src-pTyr416 antibody (upper panel), and anti-Src-pTyr527 (lower panel) antibodies. The position of phosphorylated-Fyn (P-Fyn) andimmunoglobulin heavy chains (Ig) are indicated. WCL, whole-cell lysate. (B) Initial homology models of FynT and FynB were created using theSwiss-Model server and the c-Src structure (PDB entry 1FMK [47]) as a template. Models were manually adjusted and subjected to structureidealization. Final models show verify 3D scores that are similar to those of the experimental Src structure. The SH2-kinase linker is shown in cyanfor FynT (left panel) and in blue for FynB (right panel). The SH3 domain is shown in green on the left side of the SH2-kinase linker, and SH1domain is shown in magenta on the right side. (C) The fyn gene exon 7 sequences from different species coding for FynB and FynT proteins werealigned using ClustalW (Blosum 30 matrix). The alignment shows that the FynB linker contains more charged residues (red) and hydrophobicresidues (green) than the FynT linker. The SH2 domain limit is known with the crystal of the SH2 domain of Fyn (2, 26). The SH1 domain limitis fixed based on the known Src structure (8).


show that FynT and FynB differentially regulate Sam68-depen-dent Bcl-x splicing and cell apoptosis.

DISCUSSION

During evolution, the acquisition of an additional seventhexon by the fyn gene allowed the tissue-specific translation ofthe distinct FynT and FynB isoforms. The present study illus-trates how this evolutionary acquisition also yielded novelfunctions and proposes a novel mechanism for the evolution ofSrc kinases in vertebrates.

Given the implication of Src kinases in physiology and pa-thology, a wealth of studies has focused on understanding themechanisms of their regulation and activation. The role of theSH2-kinase linker segment in Src regulation was revealed bythe crystal structures of Src and Hck and by site-directed mu-tagenesis (14, 37, 47). In particular, this work illustrated therole of specific residues in kinase function. The importance ofthe intramolecular inhibitory interactions of the SH2-kinaselinker region was further highlighted by Lerner and Smithgall(17). They showed that the interaction of this linker segmentwith the SH3 domain constitutes an independent mode of Hckkinase regulation and suggested that different mechanisms ofSrc kinase activation generate distinct output signals. However,the docking of the SH2-kinase linker onto both the SH3 andkinase domain is so specific that the swapping of the corre-sponding domains between Src family members or mutationsintroduced in the SH2-kinase linker or in the SH2-kinase linker-interacting surface on the catalytic domain were shown toinduce altered regulation and/or activity (14, 16). This is con-sistent with the high variability in sequence and length of theSH2-kinase linker sequences, with the exception of criticalregulatory residues such as Pro251 or Leu256 (44).

In the present work we have compared two naturally occur-ring isoforms of the Src-related kinase Fyn that differ only inthe SH2-kinase linker region. These isoforms arise from the

alternative splicing of exons 7A and 7B and are differentiallyexpressed in cells and tissues (7, 32). The acquisition of anadditional seventh exon in a vertebrate ancestor, as was sug-gested for exon 7A (33), thus provides a physiological modelsystem to study the functional implications of SH2-kinaselinker sequence divergence on Src function. By analyzing theFynT and FynB isoforms, we show here that the strength ornature of the SH2-kinase linker intramolecular interactionscan determine specific functional protein-protein interactionswith biological and possibly pathological consequences.

Exon 7 encodes the six C-terminal residues of the SH2domain, the 24- to 27-amino-acid SH2-kinase linker segment,and the 22 N-terminal kinase domain residues. Thus, the dif-ferential interaction with and regulation of Sam68 activity byFynB and FynT could result from any of these exon 7-encodedsubregions. However, several elements point to the essentialcontribution of the SH2-kinase linker segment. First, this is themost divergent fyn exon 7-encoded subregion, both in lengthand amino acid composition, with residues essentially provid-ing hydrophobic and polar/ionic interactions in FynB but notFynT isoforms (Fig. 4). Second, a single alteration of Pro251 toAla in the SH2-kinase linker segment is sufficient to allowFynB to interact with and phosphorylate Sam68 (Fig. 2). Third,the swapping of these core FynT SH2-kinase linker amino acidresidues to FynB is sufficient to confer a FynT-like phenotypeand vice versa (Fig. 6), indicating that this linker subregion isboth necessary and sufficient to account for the differentialinteraction with and regulation of Sam68 signaling by FynBand FynT.

Davidson et al. provided initial evidence that constitutivelyactive FynBY_528F could not substitute for FynT_Y528F toenhance the responsiveness of a mouse T-cell line to antigenicstimulation (9). They attributed the distinct biological impactto the N-terminal portion of their kinase domain (10). How-ever, the subdivision of the SH2-kinase linker segment fromthe kinase domain in their study preceded the structural as-

FIG. 5. Role of the SH2-SH1 linker on FynB and FynT kinase activities. (A) HEK293 cells were transfected with plasmid constructs encodingFynB, FynT, FynB-Y528F, FynT-Y528F, FynB-P251A, FynT-P251A, FynB-L256V, FynT-L256V, FynB-P251A-L256V, and FynT-P251A-L256V.Total cell extracts were analyzed by anti-phospho-SrcTyr416, anti-phospho-SrcTyr527, and anti-Fyn Western blotting, as indicated. (B) HEK293cells were transfected with plasmid constructs encoding FynB or FynT. After 48 h of expression, cells were lysed in RIPA buffer and cell extractswere immunoprecipitated using Fyn rabbit polyclonal antibodies. Immunoprecipitates (IP) were incubated with 0, 2, or 30 �M of the p85-derivedproline-rich peptide for 15 min at 30°C, followed by an in vitro kinase assay in kinase assay buffer containing enolase and 2 �Ci [�-32P]ATP for15 min at 30°C. The reaction was terminated by adding SDS-PAGE loading buffer. Samples were analyzed by SDS-PAGE followed byautoradiography (upper panel) and Fyn immunoblotting (middle panel). The positions of phosphorylated Fyn (p-Fyn) and the phosphorylatedenolase (p-Enolase) are indicated by arrows. Densitometric analyses are shown in the lower panel and were obtained with Image J software.Phosphorylated enolase signals were normalized to total Fyn levels. Results are presented as percent increases of normalized phosphorylatedenolase levels.


signment of the SH2 linker on which our homology modelswere based (47). Herein, we present data showing that theacquisition of a seventh exon by the ancestor fyn gene wasassociated with diversification not only at the level of tissue

distribution but also at the functional level, hence generat-ing regulatory divergence/novelty. Remarkably, the alterna-tive splicing of exon 7 allows a different interaction andregulation of the RNA-binding protein Sam68 by Fyn iso-

FIG. 6. Core SH2-kinase linker residues are both required and sufficient to confer FynB Sam68 phosphorylation that is different from that ofFynT. (A) The exon 7 sequences are shown in pink for FynB and in blue for FynT. Conserved residues are shown in black. The FynB-like constructwas obtained by swapping the FynB SH2-kinase linker core residues as defined in the legend to Fig. 4C (pink boxed residues) in the FynT backbone(represented by a blue line). The FynT-like construct was obtained by swapping the FynT SH2-kinase linker core residues as defined in the legendto Fig. 4C (blue boxed residues) in the FynB backbone (represented by a pink line). (B) HEK293 cells were transfected with plasmid constructsencoding FynB, FynT, FynT-like, or FynB-like. After 48 h of expression, cell extracts were analyzed by Western blotting for tyrosine phospho-rylation (pY blot) and for Sam68 (Sam68 blot), Fyn (Fyn blot), and tubulin (tubulin blot) expression. (C) The extracts used for panel B wereimmunoprecipitated using Fyn antibodies, followed by Sam68 and Fyn immunoblotting. (D) Splicing assay of the Bcl-x minigene (0.5 �g) inHEK293 cells transfected with 0.25 �g of either GFP or GFP-Sam68 alone or in combination with 0.25 �g of FynT or FynB plasmid constructs.Cells were harvested 20 h after transfection and processed for RT-PCR (upper panel). Densitometric analyses are shown in the lower panel asmean values of the Bcl-xs/Bcl-xL ratio.

FIG. 7. Differential regulation of Sam68-dependent Bcl-x mRNA splicing by FynB and FynT correlates with differential induction of apoptosis.(A) HEK293 cells were transfected with GFP or GFP-Sam68 and cotransfected with FynB or FynT plasmid construct (1:1 ratio) usingLipofectamine reagent. Cells were fixed and permeabilized 30 h after transfection, followed by immunofluorescence using anti-activated (cleaved)caspase 3. Cells positive for active caspase 3 among the GFP-positive cells were counted. Results are the means standard deviations from threeindependent experiments. ctrl, control.


forms. Since Sam68 plays a role in prostate and breast can-cer (5, 34) and its activity is modulated by tyrosine phos-phorylation in cancer cells (19, 20, 29), this differentialregulation by the Fyn isoforms might play pathological rolesin the course of neoplastic transformation (Fig. 8).

Genome-wide analyses indicate that main systemic functionsidentifiable among alternatively spliced genes are neuronal andimmune specific (15, 45). While such studies have identifiedmany new splice forms, only careful, specific experiments cantest whether these forms have any function. For example, abrain-specific alternative splice form of CDC42 replaces exonV with exon VI. Although both exons encode virtually thesame amino acid sequence, the brain-specific form removestwo lysine residues that are required for an important bindingsite to coatomer complex in the endoplasmic reticulum and tocargo receptors in the Golgi apparatus (45). Our findings dem-onstrate that the alternative splicing of exons 7A and 7B conferto Fyn a distinct capability to interact with Sam68 in differentcellular settings, depending on which Fyn isoform is translated.We also provide evidence that this differential interaction re-sults in the specific regulation of Sam68-dependent Bcl-XmRNA alternative splicing and cell apoptosis by FynT. Thus,the acquisition of exon 7A during evolution uncouples FynBfrom the regulation of apoptosis in epithelial cells, and it mightallow this isoform to be engaged in signaling pathways differentfrom those involving FynT. Additional biochemical data alsoevidenced distinct the ubiquitination and protein stability ofFynB compared to those of FynT, and specific tyrosine-phos-phorylated binding partners were detected by Fyn coimmuno-precipitation followed by anti-phosphotyrosine immunoblot-ting, the identification of which currently is being investigated.

Taken together, these data illustrate how Src kinases haveevolved through exon capture and alternative splicing, yieldingdistinct functions in the central nervous system and the im-mune system. Functional cell type-dependent specification byalternative splicing also was described for the focal adhesionkinase (FAK) (42). In FAK, the N-terminal FERM domaindocks onto the kinase domain and, in doing so, suppresses itscatalytic activity (18). Thus, the FERM domain allows theautoregulation of FAK in a way that is very reminiscent of theregulation of Src kinases by the SH3-SH2 regulatory fragment.Alternative splicing in neuronal cells produces an FAK isoform

in which the FERM-kinase linker is altered, leading to a dif-ferent autophosphorylation mechanism. Following autophos-phorylation, the FERM-kinase linker of FAK binds to andactivates the Src kinases Src and Fyn (24). Thus, alternativesplicing might affect several components of the same signalingpathway. On a cellular level, this mechanism may allow theeasy fine-tuning of molecular building blocks to suit cellularcharacteristics.

ACKNOWLEDGMENTS

We thank J. P. Borg and members of the J. P. Borg and S. Rocheteams, particularly C. Benistant, for great help and support. We thankC. Dumas for providing initial homology models and for stimulatingdiscussions about the impact of alternative splicing for Fyn. Massspectrometry studies were performed at the CRCM/U891 INSERMProteomic Platform, with the great help of E. Baudelet.

The work in the laboratory of Y.C. was supported by grants fromINSERM, Agence Nationale de Recherche sur le SIDA et les hepa-tites virales, and Association Nationale de Recherche contre le Can-cer. C.B. was supported by a fellowship from the ARC. The work in thelaboratory of C.S. was supported by grants from the AssociazioneItaliana Ricerca sul Cancro, the Istituto Superiore della Sanita (ISSProject n.527/B/3A/5), and the Association for International CancerResearch.

REFERENCES

1. Arnold, K., L. Bordoli, J. Kopp, and T. Schwede. 2006. The SWISS-MODELworkspace: a web-based environment for protein structure homology mod-elling. Bioinformatics 22:195–201.

2. Arold, S. T., T. S. Ulmer, T. D. Mulhern, J. M. Werner, J. E. Ladbury, I. D.Campbell, and M. E. Noble. 2001. The role of the Src homology 3-Srchomology 2 interface in the regulation of Src kinases. J. Biol. Chem. 276:17199–17205.

3. Briggs, S. D., M. Sharkey, M. Stevenson, and T. E. Smithgall. 1997. SH3-mediated Hck tyrosine kinase activation and fibroblast transformation by theNef protein of HIV-1. J. Biol. Chem. 272:17899–17902.

4. Brown, M. T., and J. A. Cooper. 1996. Regulation, substrates and functionsof src. Biochim. Biophys. Acta 1287:121–149.

5. Busa, R., M. P. Paronetto, D. Farini, E. Pierantozzi, F. Botti, D. F. Angelini,F. Attisani, G. Vespasiani, and C. Sette. 2007. The RNA-binding proteinSam68 contributes to proliferation and survival of human prostate cancercells. Oncogene 26:4372–4382.

6. Cetkovic, H., V. A. Grebenjuk, W. E. Muller, and V. Gamulin. 2004. Srcproteins/src genes: from sponges to mammals. Gene 342:251–261.

7. Cooke, M. P., and R. M. Perlmutter. 1989. Expression of a novel form of thefyn proto-oncogene in hematopoietic cells. New Biol. 1:66–74.

8. Cowan-Jacob, S. W., G. Fendrich, P. W. Manley, W. Jahnke, D. Fabbro, J.Liebetanz, and T. Meyer. 2005. The crystal structure of a c-Src complex in anactive conformation suggests possible steps in c-Src activation. Structure13:861–871.

9. Davidson, D., L. M. Chow, M. Fournel, and A. Veillette. 1992. Differential

FIG. 8. Distinct SH3 domain ligand interaction and phosphorylation by FynB and FynT. FynB is shown in pink and FynT in blue. The tablessummarize the differential FynB and FynT conformation and activation by SH3 ligands (green).


regulation of T cell antigen responsiveness by isoforms of the src-relatedtyrosine protein kinase p59fyn. J. Exp. Med. 175:1483–1492.

10. Davidson, D., J. Viallet, and A. Veillette. 1994. Unique catalytic propertiesdictate the enhanced function of p59fynT, the hemopoietic cell-specific iso-form of the Fyn tyrosine protein kinase, in T cells. Mol. Cell. Biol. 14:4554–4564.

11. Emsley, P., and K. Cowtan. 2004. Coot: model-building tools for moleculargraphics. Acta Crystallogr. D. Biol. Crystallogr. 60:2126–2132.

12. Erpel, T., G. Superti-Furga, and S. A. Courtneidge. 1995. Mutational anal-ysis of the Src SH3 domain: the same residues of the ligand binding surfaceare important for intra- and intermolecular interactions. EMBO J. 14:963–975.

13. Gokhale, R. S., and C. Khosla. 2000. Role of linkers in communicationbetween protein modules. Curr. Opin. Chem. Biol. 4:22–27.

14. Gonfloni, S., J. C. Williams, K. Hattula, A. Weijland, R. K. Wierenga, and G.Superti-Furga. 1997. The role of the linker between the SH2 domain andcatalytic domain in the regulation and function of Src. EMBO J. 16:7261–7271.

15. Grabowski, P. J., and D. L. Black. 2001. Alternative RNA splicing in thenervous system. Prog. Neurobiol. 65:289–308.

16. Kashishian, A., A. MacAuley, and J. A. Cooper. 1990. Properties of tripartitechimeras between Src and Lck. Oncogene 5:1463–1470.

17. Lerner, E. C., and T. E. Smithgall. 2002. SH3-dependent stimulation ofSrc-family kinase autophosphorylation without tail release from the SH2domain in vivo. Nat. Struct. Biol. 9:365–369.

18. Lietha, D., X. Cai, D. F. Ceccarelli, Y. Li, M. D. Schaller, and M. J. Eck.2007. Structural basis for the autoinhibition of focal adhesion kinase. Cell129:1177–1187.

19. Lukong, K. E., D. Larocque, A. L. Tyner, and S. Richard. 2005. Tyrosinephosphorylation of sam68 by breast tumor kinase regulates intranuclearlocalization and cell cycle progression. J. Biol. Chem. 280:38639–38647.

20. Lukong, K. E., and S. Richard. 2007. Targeting the RNA-binding proteinSam68 as a treatment for cancer? Future Oncol. 3:539–544.

21. Luthy, R., J. U. Bowie, and D. Eisenberg. 1992. Assessment of proteinmodels with three-dimensional profiles. Nature 356:83–85.

22. Massiello, A., A. Salas, R. L. Pinkerman, P. Roddy, J. R. Roesser, and C. E.Chalfant. 2004. Identification of two RNA cis-elements that function toregulate the 5� splice site selection of Bcl-x pre-mRNA in response toceramide. J. Biol. Chem. 279:15799–15804.

23. Matsuda, M., B. J. Mayer, Y. Fukui, and H. Hanafusa. 1990. Binding oftransforming protein, P47gag-crk, to a broad range of phosphotyrosine-containing proteins. Science 248:1537–1539.

24. Mitra, S. K., and D. D. Schlaepfer. 2006. Integrin-regulated FAK-Src sig-naling in normal and cancer cells. Curr. Opin. Cell Biol. 18:516–523.

25. Moarefi, I., M. LaFevre-Bernt, F. Sicheri, M. Huse, C. Lee, J. Kuriyan, andW. T. Miller. 1997. Activation of the Src-family tyrosine kinase Hck by SH3domain displacement. Nature 385:650–654.

26. Mulhern, T. D., G. L. Shaw, C. J. Morton, A. J. Day, and I. D. Campbell.1997. The SH2 domain from the tyrosine kinase Fyn in complex with aphosphotyrosyl peptide reveals insights into domain stability and bindingspecificity. Structure 5:1313–1323.

27. Murshudov, G. N., A. A. Vagin, and E. J. Dodson. 1997. Refinement ofmacromolecular structures by the maximum-likelihood method. Acta Crys-tallogr. D. Biol. Crystallogr. 53:240–255.

28. Paronetto, M. P., T. Achsel, A. Massiello, C. E. Chalfant, and C. Sette. 2007.The RNA-binding protein Sam68 modulates the alternative splicing of Bcl-x.J. Cell Biol. 176:929–939.

29. Paronetto, M. P., D. Farini, I. Sammarco, G. Maturo, G. Vespasiani, R.Geremia, P. Rossi, and C. Sette. 2004. Expression of a truncated form of thec-Kit tyrosine kinase receptor and activation of Src kinase in human prostaticcancer. Am. J. Pathol. 164:1243–1251.

30. Paronetto, M. P., J. P. Venables, D. J. Elliott, R. Geremia, P. Rossi, and C.Sette. 2003. Tr-kit promotes the formation of a multimolecular complexcomposed by Fyn, PLC�1 and Sam68. Oncogene 22:8707–8715.

31. Parsons, S. J., and J. T. Parsons. 2004. Src family kinases, key regulators ofsignal transduction. Oncogene 23:7906–7909.

32. Picard, C., J. Gabert, D. Olive, and Y. Collette. 2004. Altered splicing inhematological malignancies reveals a tissue-specific translational block of theSrc-family tyrosine kinase fyn brain isoform expression. Leukemia 9:9.

33. Picard, C., A. Gilles, P. Pontarotti, D. Olive, and Y. Collette. 2002. Cuttingedge: recruitment of the ancestral fyn gene during emergence of the adaptiveimmune system. J. Immunol. 168:2595–2598.

34. Richard, S., G. Vogel, M. E. Huot, T. Guo, W. J. Muller, and K. E. Lukong.2008. Sam68 haploinsufficiency delays onset of mammary tumorigenesis andmetastasis. Oncogene 27:548–556.

35. Roskoski, R., Jr. 2004. Src protein-tyrosine kinase structure and regulation.Biochem. Biophys. Res. Commun. 324:1155–1164.

36. Schindler, T., F. Sicheri, A. Pico, A. Gazit, A. Levitzki, and J. Kuriyan. 1999.Crystal structure of Hck in complex with a Src family-selective tyrosinekinase inhibitor. Mol. Cell 3:639–648.

37. Sicheri, F., I. Moarefi, and J. Kuriyan. 1997. Crystal structure of the Srcfamily tyrosine kinase Hck. Nature 385:602–609.

38. Stoss, O., T. Novoyatleva, M. Gencheva, M. Olbrich, N. Benderska, and S.Stamm. 2004. p59(fyn)-mediated phosphorylation regulates the activity ofthe tissue-specific splicing factor rSLM-1. Mol. Cell Neurosci. 27:8–21.

39. Superti-Furga, G., and S. A. Courtneidge. 1995. Structure-function relation-ships in Src family and related protein tyrosine kinases. Bioessays 17:321–330.

40. Superti-Furga, G., S. Fumagalli, M. Koegl, S. A. Courtneidge, and G.Draetta. 1993. Csk inhibition of c-Src activity requires both the SH2 and SH3domains of Src. EMBO J. 12:2625–2634.

41. Thomas, S. M., and J. S. Brugge. 1997. Cellular functions regulated by Srcfamily kinases. Annu. Rev. Cell Dev. Biol. 13:513–609.

42. Toutant, M., J. M. Studler, F. Burgaya, A. Costa, P. Ezan, M. Gelman, andJ. A. Girault. 2000. Autophosphorylation of Tyr397 and its phosphorylationby Src-family kinases are altered in focal-adhesion-kinase neuronal isoforms.Biochem. J. 348:119–128.

43. Williams, J. C., A. Weijland, S. Gonfloni, A. Thompson, S. A. Courtneidge,G. Superti-Furga, and R. K. Wierenga. 1997. The 2.35 A crystal structure ofthe inactivated form of chicken Src: a dynamic molecule with multiple reg-ulatory interactions. J. Mol. Biol. 274:757–775.

44. Williams, J. C., R. K. Wierenga, and M. Saraste. 1998. Insights into Srckinase functions: structural comparisons. Trends Biochem. Sci. 23:179–184.

45. Xu, Q., B. Modrek, and C. Lee. 2002. Genome-wide detection of tissue-specific alternative splicing in the human transcriptome. Nucleic Acids Res.30:3754–3766.

46. Xu, W., A. Doshi, M. Lei, M. J. Eck, and S. C. Harrison. 1999. Crystalstructures of c-Src reveal features of its autoinhibitory mechanism. Mol. Cell3:629–638.

47. Xu, W., S. C. Harrison, and M. J. Eck. 1997. Three-dimensional structure ofthe tyrosine kinase c-Src. Nature 385:595–602.

48. Yeatman, T. J. 2004. A renaissance for SRC. Nat. Rev. Cancer 4:470–480.


alternative splicing modulates autoinhibition and sh3 accessibility in the src kinase fyn

Documents