a genetic selection method for expression products that induce apoptosis in adherent mammalian cell...

Apoptosis 2003; 8: 209–219C© 2003 Kluwer Academic Publishers

A genetic selection method for expression productsthat induce apoptosis in adherent mammalian cell lines

R. Sandrock, W. Wheatley, E. Drees, M. Lualhati, A. Kamb and G. Caponigro

Deltagen Proteomics, Inc., 615 Arapeen Dr., Salt Lake City, UT 84108

The process of apoptosis is carefully controlled in cells,and different cell types display different sensitivities topro-apoptotic stimuli. The prospect of exploiting such dif-ferences for treatment of diseases such as cancer, vianovel therapeutic agents, is extremely attractive. There-fore, genetic selections for novel expression productsthat kill cells may have considerable value. However, suchselections are difficult to devise and perform becausethe selected cells do not grow. We developed a selec-tion scheme designed to enrich for genetic agents thatkill cells. The selection is based on detachment of apop-totic cultured mammalian cells from adherent monolay-ers. We characterized the properties of these detachedcells (floating cells), and various aspects of the selectionprocess. This selection method is potentially applicableto many mammalian cell lines.

Keywords: apoptosis; detachment; floating cells; genetic;selection; transdominant.

Introduction

The ability to regulate cell death offers interesting ther-apeutic possibilities. For example, agents that induce se-lective lethality in cancer cells could lead to novel formsof anti-tumor therapy.1 Therefore, it is useful to con-sider methods that facilitate identification of apoptosis-promoting agents with the hope that some may proveto act specifically in tumor cells. Genetic screens and se-lections, because of their relatively unbiased search formolecules that underlie defined phenotypes, should be anespecially powerful route to identify novel, functionallyvalidated genes. Indeed, much of the molecular informa-tion about apoptosis has come from genetic studies, espe-cially in the nematode C. elegans.2

Apoptosis in mammalian cells shares many featureswith invertebrates and several of the genes that control celldeath in non-mammalian organisms also participate inmammalian apoptosis.3,4 However, the process in mam-malian cells is more complex and subject to cell-type

Correspondence to: G. Caponigro, Deltagen Proteomics, Inc.,615 Arapeen Dr., Salt Lake City, UT 84108. Tel: (801) 303-0300;Fax: (801) 303-0333; e-mail: [email protected]

variation. Genetic analysis of somatic cells has beenhelpful, but has been hampered by the difficulty of per-forming selections for mammalian cell mutants that spon-taneously induce cell death. Such mutants are, of course,destined to die, and their recovery and use to identifymutant loci that trigger death pose considerable techni-cal problems.

Transdominant genetics, a form of genetics in whichpeptides, protein fragments, or RNAs are expressed withincells, provides a partial solution because the “mutations”act in trans and are controlled from engineered expressionvectors.5 In principle, the lethal agents could be retrievedfor study from the mortally damaged cells if they couldbe selected early enough, before cellular macromoleculeslike DNA were destroyed. The success of such selectionsdepends in part on the background; for example, the frac-tion of cells in the culture that die spontaneously. Toachieve sufficient enrichments, it is critical that the back-ground be low compared to the recovery rate of cytotoxicclones.6

We devised a type of en masse genetic selection that facil-itates enrichment for transdominant agents that kill cells.The selection scheme is based on the observation that dy-ing cells in an adherent population detach and float offthe substratum.7,8 This property provides a mechanismfor enrichment of dead or dying cells, and the expressionvector DNA they harbor. For many human cell lines, thebackground percentage of floating cells is low, and recov-ery of DNA from dying cells is efficient. Furthermore, us-ing a detached cell enrichment scheme, individual clonesthat encode cell-death promoting transdominant agentswere isolated from a large and diverse cDNA library.

Materials and methods

Cell lines and growth conditions

Different cells used in this study were grown in the foll-owing media. HT29 -McCoy’s 5A (Gibco) supplementedwith 10% Fetal Bovine Serum (FBS, Gibco) and 2 mM L-glutamine (Gibco), BT549 and Hs578T—Dulbecco’s Mo-dified Eagle’s Medium, (DMEM, Gibco), supplemented

Apoptosis · Vol 8 · No 2 · 2003 209

R. Sandrock et al.

with 10% FBS, 2 mM L-glutamine, 1 mM sodium pyru-vate (Gibco), 5 ug/ml insulin, HCT15 and Hs294T—DMEM supplemented with 10% FBS, 2 mM L-glutamineand 1 mM sodium pyruvate, SW620—DMEM supple-mented with 10% FBS and 2 mM L-glutamine, WM35—80% KBM (Bio Whittaker), 20% L15 (Gibco) supple-mented with 2% FBS, 2 mM CaCl2 and 5 ug/ml insulinand grown in flasks/dishes coated with gelatin, T47D—DMEM supplemented with 10% FBS, 2 mM L-glutamineand 5ug/ml insulin, COLO205 and DLD1—RPMI (Gibco)supplemented with 2 mM L-glutamine and 10% FBS,LnCAP—RPMI supplemented with 2 mM L-glutamine,10% FBS, 1 mM sodium pyruvate, 1.5 g/L sodium bicar-bonate, 10 mM HEPES, and 4.5 g/L glucose, PC3—F12K(Gibco) supplemented with 10% FBS, 1.5 g/L sodiumbicarbonate and 2 mN L-glutamine. All cell lines weregrown in a humidified CO2 incubator at 37◦C.

Floating cell percentage determinations

Cells used to determine floating cell percentages inFigure 4 were cultured in 10 cm plates and were seededat 200,000 cells per plate except for HCT15, which wereseeded at a density of 500,000/plate. The percentage ofcells in the detached fraction was determined in the foll-owing manner. Detached cells were first isolated by re-moving media from plates, concentrating cells by cen-trifugation for 10 min at 200× g, resuspending cells in asmall volume of media (∼200 ul) and counting cells us-ing a hemacytometer. Adherent cells were removed fromplates by incubation in a PBS/trypsin mixture for 5–10 min at 37◦C, suspended in ∼10 ml of media, andcounted using a hemacytometer. Percent floating cellswere determined as (# of floating cells/# of floating cells+ # of adherent cells)× 100. Floating cell percentagesshown in Table 1 were generated from HT29 cells grownin 12 well plates (Falcon) and seeded at a density of 40,000cells/well. One day after seeding cells were exposed toretroviral supernatants encoding the seven constructs de-noted in Table 1 for 24 h. after which supernatants wereremoved via a media change. Cell numbers were deter-mined as described above.

Packaging and transduction of retrovirus

Retroviral packaging and transduction were performedas described by Burns.9 Purified retroviral plasmid DNAwas introduced into 293 gp cells (gift from Inder Verma)by calcium phosphate tranduction. Briefly, 5 × 106 cellsof the packaging cell line (293 gp) were seeded into agelatin coated 15 cm dish and the following day the me-dia was replaced with 22.5 ml of DMEM supplementedwith 10% FBS and L-glutamine. 900 ul of dH20 con-taining ∼23 ug of retroviral construct encoding plas-

Table 1. Percentage of detached cells in transduced HT29 cells

Clone Encoded producta % Detached cellsb

pVT1567 dGFP 1

Bid dGFP-161 aa Bid 55

B072H04 dGFP-106 aa ORF 51

E110D06 dGFP-2 aa peptide 38

B158E01 dGFP-269 aa ORF 19

E125A10 dGFP-76 aa peptide 4

B0040G12 dGFP-15 aa peptide 1

B0049A08 dGFP-9 aa peptide 1

Clone: clone name.aIndicates the number of amino acids encoded by the randomcDNA that are expressed as a fusion protein with the dGFP scaf-fold. The designation “ORF” indicates that the amino acids fusedto the dGFP scaffold derive from a predicted open reading frameand “peptide” indicates that the amino acids are not predicted tobe part of an open reading frame.bThe percentage cells found in the non-adherent fraction.

mid and ∼23 ug of envelope expression plasmid(pCMV-VSV.G) were mixed with 225 ul of CaCl2 (2.5 M)then 1125 ul of 2x BBS (50 mM, BES (N,N-bis(2-hydro-xyethyl)-2-aminoethane-sulfonic acid), 280 mM NaCl,1.5 mM Na2HPO4, pH 6.95) was added drop wise andthe final solution allowed to incubate at room tempera-ture for 5–10 mins. This mixture was then added to the293 gp cells drop wise and incubated at 37◦C (3% CO2)

for 16–24 h. The medium was then replaced and the cellswere allowed to incubate for an additional 48–72 h at37◦C, at which time, the media now containing the viralparticles was collected, filtered through a 0.45 µ filter andfrozen at −80◦C. Target cells were transduced with viralsupernatants at 50% vol/vol of retroviral supernatant tomedia with the addition of polybrene at a final concen-tration of 4 µg/ml Media on the cells were changed after24 h.

Plasmid and library constructions

The vectors used in Figure 5 were either pVT34010 whichencodes the eGFP protein (-Bid) or pVT751 whichis identical to pVT340 except that the C-terminal161 amino acids (aa) of the BID protein11 are fused to theC-terminus of the eGFP protein (Bid). The library used forthe first cycle of the detached cell enrichment scheme con-sisted of oligo d(T) primed cDNA fragments derived fromfetal brain tissue cloned as EcoRI/XhoI fragments intopVT340. These cDNA fragments were expressed as fu-sion proteins with the eGFP scaffold. The starting libraryhad a complexity of ∼3 × 106 individual clones. Thebase vector used for the floating cell percentages deter-mined in Table 1 was pVT1567 that differs in two respectsfrom pVT340. First, the eGFP protein encoded within

210 Apoptosis · Vol 8 · No 2 · 2003

Genetic selection method for expression products

the vector was rendered non-fluorescent by alteration oftyrosine 66 to a phenylalanine (termed dGFP). Second, theCMV promoter used to drive expression of the dGFP pro-tein was replaced with the HIV2 promoter.10 All clonesshown in this experiment (including Bid) were expressedas fusion proteins with the dGFP scaffold.

Flow cytometry methods

Analysis of cells in population 1 (pop1) and population2 (pop2), cells stained with AnnexinV-Fluos, propidiumiodide (PI), and Apo 2.7 was carried out on a Coulteranalyzer (EPICS XL-MCL, EXPO software, Build 320,excitation 488 nM argon laser, emission FL1 = 525BP+/−10 nm, FL2 = 575BP, run at 15 milliwatts). Sort-ing of defined numbers of PI+ and PI− cells directlyinto microfuge tubes containing lysis buffer was carriedout on a Coulter Sorter (EPICS elite ESP, EXPO software,excitation 488 nM argon laser emission PMT2 at 525BP,PMT3 at 575BP, run at 15 milliwatts).

PI, AnnexinV and Apo 2.7 staining of cells

PI: Cells were collected, suspended in 1 ml of mediumsupplemented with 2 ul of PI (0.2 mg/ml), allowed totake up dye for ∼5 min and analyzed by FACS. Annex-inV: 1 × 105 HT29 cells/well were seeded into 6–wellplates (Greiner), cultured for 24 h, incubated with 40%retroviral supernatant for 24 h, washed with PBS andcultured in fresh medium for an additional 48 h. Foll-owing culturing, floating and adherent cells were col-lected and counted as described above. Cells were thenstained with Annexin-V-Fluos (Roche) as per the manu-facture’s instruction. Briefly, cells were concentrated bylow speed centrifugation (200× g for 5 min), washedwith PBS, resuspended in annexinV staining buffer (ASB,10 mM HEPES pH 7.4, 140 mM NaCl, 5 mMCaCl) supp-lemented with 20 ul of Annexin-V-Fluos at a concentra-tion of ∼1 × 106 cells/200 ul of ASB and incubatedfor 15 min at room temperature. Following incubation800 ul of ASB was added to each 200 ul reaction andthe cells subjected to FACS analysis. Apo 2.7:1 × 106

WM35 cells were seeded into a 10 cm plate and grown ineither the absence or presence of 15 ug/ml cis-platinum(CsPt, Sigma). Cells were grown in medium +/− CsPtfor 22 h and floater and adherent cell populations har-vested as previously described. Cells were stained withApo 2.7 by pelleting ∼0.5× 106 cells at 200× g in sil-iconized glass tubes, removing the supernatant and per-meabilizing the cells by resuspending them in 100 ul ofcold digitonin (100 ug/ml) in PBS supplemented with2.5% fetal calf serum (PFBS) and incubating cells for20 min on ice. Following incubation, cells were pelleted

by gentle centrifugation, resuspended in 900 ul of PFBSsupplemented with 10 ul of Apo 2.7 antibody conjugatedto PC5 (R-phycoerythrin linked to cyanin 5.1, Coulter)and gently vortexed for 15 min in the dark. After vor-texing cells were pelleted by gentle centrifugation andwashed with PFBS two times, pelleted a final time andresuspended in 1 ml of PFBS and subjected to FACSanalysis.

PI pulse/chase

PC3 cells were grown in a T-75 flask (Greiner) to 70%confluence, the medium was then removed, cells rinsedwith PBS, and incubated in medium supplemented with2 ug/ml PI for 30 min at 37◦C. Following incubation themedium containing PI was replaced with fresh mediumand the presence of PI+, adherent, cells was confirmed bylight microscopy. Cells were cultured for 24 h followingstaining after which floater and adherent cell populationswere isolated and analyzed by FACS.

PCR of DNA from dead cells

HT29 cells were stably transduced with retroviral parti-cles derived from pVT313. pVT313 is identical topLNCX2 (Clontech), which contains the neomycin resis-tance gene under the transcriptional control of the retrovi-ral LTR, except that the eGFP gene has been added underthe transcriptional control of the CMV promoter. Cellswere incubated with retroviral-containing supernatant for24 h, washed in PBS and cultured in fresh medium for 48 hafter which they were grown in medium supplementedwith 200 ug/ml of neomycin (Gibco). After 10 days ofgrowth in neomycin-supplemented medium the popula-tion of stably transduced cells were trypsinized and frozenfor later use. For PCR of the GFP insert from PI+ andPI− cells, 3 × 105 neomycin-selected cells were seededinto T-25 flasks (Greiner) and grown for two days in 5 mlof medium supplemented with neomycin. Floating cellswere then isolated, stained with PI, and PI+ and PI−cells sorted directly into 50 ul of PCR/lysis buffer (PCRbuffer (Perkin Elmer), 0.5% tween-20, 0.5% triton X-100 and 2 mM MgCl2). Two sets each of 100, 1000 and5000 cells, respectively, were sorted from each cell popu-lation. Following sorting, cell/lysis buffer mixtures wereincubated at 60◦C for 2 h with 3U of proteinase K (Sigma),incubated at 95◦C for 10 min to inactivate the proteinaseK and subjected to 30 cycles of PCR in 100 ul volumesusing primers oVT131 (gaccttcggcgtccagtgcttcag) andoVT179 (agctagcttgccaaacctaca). Experiments in whichapoptosis was induced were performed as previously de-scribed except that media was supplemented with 0.2 mMsulindac sulfide (Biomolecular Research).


R. Sandrock et al.

Cycling methodology

On Day 0, 26 T-175 flasks (Greiner) were seeded with2.2× 106 HT-29 cells per flask. On Day 1, cells in18 flasks were transduced with cDNA-based viral su-pernatants and 4 flasks were transduced with pVT340-based (transduction control) viral supernatants at 50%vol/vol of supernatant to media with the addition of poly-brene at a final concentration of 4 µg/ml. The remaining4 flasks were utilized as a “no transduction” control. OnDay 2, media on the cells were changed. On Day 3, mediawere collected and pooled from 16 flasks in which cellswere transduced with the cDNA library supernatants.Cells were concentrated by centrifugation at 1,000× gfor 5 min, resuspended in 500 µl of PBS and countedby haemacytometer. Fresh medium was added back tothe flasks and flasks returned to the incubator. GenomicDNA was isolated from detached cells as described be-low. The same protocol was utilized for 2 “cDNA” flasks,2 “pVT340” flasks, and 2 “mock control” flasks. In ad-dition, adherent cells from these flasks were trypsinized,concentrated and counted. Percent floating cells was de-termined as (# of floating cells/# of floating cells + # ofadherent cells)× 100. On Day 5, the same floating pop-ulation protocol as above was utilized for all flasks andcells were trypsinized to determine percent floating cells.Genomic DNA was isolated from the floating cell pop-ulations of Days 3 and 5 using a Qiagen genomic DNAisolation kit. cDNA inserts were PCR-amplified from ge-nomic DNA using oVT800 (5′-gccgccgggatcactctc-3′ )and oVT1211 (5′-gctagcttgccaaacctacaggtgggg-3′ ) andHiFi Taq polymerase (Life Technologies). PCR reactionswere cleaned with a Qiagen PCR Purification kit. PCR-amplified DNAs were digested with EcoRI and XhoI,run onto an agarose gel, and fragments ranging from400–3,000 nt were isolated using a Qiagen Gel Extractionkit. DNA was subcloned back into pVT340 and cyclingparameters were reinitiated.

Examination of toxic effects of conditioned media

Three different cultures of∼6× 106 HT29 cells grown inT-75 flasks were transduced for 24 h with supernatant har-boring retroviral particles derived from either pVT751,which expresses an eGFP-BID fusion protein, pVT340which expresses only eGFP, or the sublibrary of randomfragments of cDNA expressed as fusion proteins from theC-terminus of eGFP in pVT340 obtained following sevenrounds of the detachment/enrichment protocol. After 24 hof exposure to retroviral supernatants, the media contain-ing retroviral particles were replaced with fresh media andthe media changed again after 3 days of growth. Mediawere then collected from all three cultures after 5 days,filter sterilized and used to culture three new flasks of

∼6 × 106 HT29 cells. Following 5 days of growth inthis cultured media, floating cell percentages for all threecultures were determined.

Results

Percentage of cells found in the detachedfraction in various human cell lines

We first surveyed a wide variety of human adherent lines todetermine their background percentage of floating cells.Cells were seeded in flasks at approximately 10% con-fluence and allowed to grow two days. After applyinga gentle rolling motion to the flasks, the growth mediawere collected and floating cells concentrated by gentlecentrifugation and counted (see Methods). This cell pop-ulation was stained with the membrane impermeant dyepropidium iodide (PI) and examined by flow cytometry(12; Figure 1). Total cell numbers were estimated by coll-ection of the remaining adherent cells and counting usinga hemacytometer. The results of this study suggested thatthough most cell lines have a low percentage of cells inthe detached fraction, in the vicinity of 1% of the totalcell population, a few lines have either very low or veryhigh numbers of floating cells. For example, ∼30% ofthe Colo205 cells were found in the detached fraction,while fewer than 0.1% of T47D cells were found in thispopulation. Experiments designed to test the influenceof growth substratum (e.g., gelatin, poly-L-lysine, vit-ronectin) on the number of floating cells revealed in mostcases only modest effects (not shown). In addition, mostlines were not strongly affected by normal retroviral trans-duction procedures. Following transduction, percentagesof floating cells remained similar to non-transduced cul-tures (not shown). This result suggested that the float-ing cell selection procedure is compatible with retroviralexpression technologies. Taken together, the human cellline studies of floating cells support the view that manylines have background percentages of floating cells suffi-ciently low to permit enrichment of pro-apoptotic geneticagents.

Background floating and dead cells

To explore the properties of spontaneously arising float-ing cells, we used flow cytometry to examine detachedand adherent fractions collected from several human celltypes, including lines derived from melanoma (WM35),breast (HS578T) and colon (HCT15, BT549 HT29). Us-ing measurements of forward scatter (FS) and side scatter(SS), known to correlate with cell viability (our unpub-lished data), we gated the populations based on the FS-SS values into Pop1 (viable cells) and Pop2 (dead/dying



Figure 1. Percentage of cells found in the detached fraction in various human cell lines. “Floating PI+” means percent of floating cellsthat are positively stained with propidium iodide. The percentages of floating cells for the Colo205, BT549, and LnCap cell lines are 30,11, and 12%, respectively.

Figure 2. Characteristics of background floating cells in human cell lines. All cells were assayed two days post-plating, except HT29(4 days). Debris was removed from the analysis by gating. (A) Human cancer lines stratified by attachment state and Pop1/2. (B)Human lines stratified by attachment state and PI+. All data from PI+ groups (as opposed to Pop2 PI+) are from ungated populationsexcept HT29 which is derived from Pop1-gated cells. In both panels cells lines are shown below their adherent (Adh.) and floating (Flo.)populations.

cells, 13; Figure 2A). Though the percentages of Pop1 andPop2 cells in the cultures varied considerably, in every casethere was a higher percentage of Pop1 cells in the adherentfraction than in the detached fraction. Conversely, therewere higher percentages of Pop2 cells in the floating cellpopulations. This result suggested that floating cell pop-ulations were significantly enriched for dead/dying cellscompared to the adherent fractions. Consistent with thisview, a similar analysis using PI staining revealed that the

Pop2 fraction is invariably enriched for PI+ cells, as ex-pected if this population contains more dead/dying cells(Figure 2B).

To address the question of whether or not cells beginto die on the culture plate and then detach (as opposed todetaching and then dying), we examined a human prostatecell line, PC3. These cells were stained in situ as theygrew on the plate with PI.12 Microscopic inspection of thestained monolayer revealed approximately 0.2% PI+ cells


R. Sandrock et al.

Figure 3. Pulse/chase of PI-stained cells. Gated populationis PI+. RFU, relative fluorescence units. (A) Adherent cells.(B) Floating cells.

(not shown). After 24 h of growth, floating and adherentpopulations were collected from the culture. Examinationof these fractions by flow cytometry showed that 0.1% ofadherent cells were PI+, a percentage indistinguishablefrom the instrument background (Figure 3). In contrast,nearly a quarter of the detached cell population was PI+,a value about 3-fold lower than the PI+ fraction detectedin PC3 floating cells stained with PI after harvest (notshown). We concluded from this pulse/chase experimentthat PC3 dead/dying cells attached to the plate chase intothe floating population. These results also suggest thatcells, in addition to detaching following entrance into amembrane permeant state, may detach in an earlier dyingstate, prior to membrane permeability.

We next explored the relationship between the per-centage of detached cells and days in culture. Because thecells were plated at a subconfluent density, this study alsorevealed a connection between the frequency of floatingcells and cell density for several cell lines. Six lines repre-senting melanoma, colon, and prostate cancers were tested(Figure 4). In general, the percentage of floating cells re-mained fairly constant throughout the time period tested.One line, BT549 (colon carcinoma), had high and variablepercentages of floating cells, suggesting that it may notbe suitable for genetic selections based on a floating cell

phenotype. Another line, WM35 (melanoma), had lowpercentages at low density, but when the cells reached con-fluence at day 7, the percentage of detached cells jumpedto nearly 6%. For such lines, it is essential to exercisecaution with respect to cell density during the selectionprocess.

Detachment induced by pro-apoptotic stimuli

A variety of treatments cause adherent cells to enter apop-totic pathways and detach from plastic surfaces.8,14,15

For several of the cell lines studied here, supra-thresholddoses of puromycin, cis-platinum (CsPt), and withdrawalof serum produced dramatic increases in the numbers offloating cells (not shown). Some treatments such as ad-ministration of sodium azide, however, killed cells with-out producing increased numbers of floating cells (notshown).

We examined the relationship between induced apop-tosis, detachment, and various apoptotic markers aftersubjecting cells to pro-apoptotic stimuli. In one exper-iment, CsPt was administered to cultured WM35 cellsand, after 22 h, the cells were separated into detachedand adherent fractions. These two populations, as well asthe untreated adherent WM35 cells, were stained withanti-Apo 2.7 antibody, a fluorescent reagent that recog-nizes an epitope exposed on mitochondrial membranes inapoptotic cells.16 The stained cells were examined by flowcytometry to measure the mean fluorescence of the popu-lations (Figure 5A). The adherent fraction of CsPt-treatedcells displayed a modest shift in mean fluorescence com-pared to untreated cells. However, the floating cell popu-lation was dramatically shifted along the fluorescence axisin the bright direction. This result demonstrated thatCsPt-induced apoptosis results in a large percentage ofdetached cells that react with anti Apo 2.7 antibody.

In another experiment, we examined a second markerfor apoptosis, annexinV, in the HT29 colon carcinomaline.8 AnnexinV binds a phosphatidyl serine epitope thatis normally resident on the inner membrane leaflet ofhealthy cells. In apoptotic cells, this epitope is exposedon the outer surface of cells due to membrane reorganiza-tion.17,18 Instead of CsPt, we used expression of the pro-apoptotic protein Bid to stimulate cell death.11 HT29cells were transduced with a retroviral expression vector-encoding a eGFP-Bid fusion protein and, after two days,adherent and detached fractions were collected. Mock-transduced cells were also separated into adherent andfloating populations. The various cell populations werestained with fluorescent annexinV and examined by flowcytometry (Figure 5B). About 90% of floating cells andnearly 70% of adherent cells from the Bid-transducedpopulation were annexinV+ (Figure 5B). In contrast,30% of adherent mock-transduced cells were annexinV+.



Figure 4. (A) Percentages of cells found in the detached fraction in human lines as a function of days in culture. (B) Growth curves ofhuman cell lines in culture.

This latter number, though considerably lower than forfloating cells, is higher than the number observed nor-mally with PI stain, perhaps due to either the effect oftrypsin (used in preparation of the adherent cell frac-tion) on phosphatidyl serine accessibility or on effects oftrypsinization on cell viability. In support of this ideawe have observed significant increases in the percent-age of PI+ cells in adherent cell populations if cellswere stained following trypsinization as opposed to ifcells were stained prior to trypsinization (not shown).Mock-transduced floating cells had a 70% annexinV+frequency, about 2-fold higher than PI+ cells in similarexperiments using PI (Figures 2, 5B).

DNA recovery from dead/dying cells

One of the hallmarks of apoptosis is the generation offragmented genomic DNA, eventually accumulating atapproximately 170 bp, the average inter-nucleosomal

spacing.19 Because we sought to recover specific retrovirus-borne inserts intact from detached cells, we tested whetheror not PCR could be used to amplify integrated con-structs from genomic DNA of floating cells. A retrovirusbearing a selectable marker and the gene for A. victoriaegreen fluorescent protein (eGFP) was stably transducedinto HT29 cells. These cells were cultured for two days atwhich time floating cells were collected, and stained withPI. 100–5000 cells from both the P1+ and PI− cellpopulations were sorted directly into PCR/lysis buffer byFACS (see Methods, Figure 6). When the various sam-ples were used as templates for PCR, a GFP fragment of∼550 base pairs amplified with nearly equal efficiencyfrom the PI+ and PI− cells (Figure 6). Similar resultswere obtained when floating cells were collected followingtreatment with sulindac sulfide a compound that triggersapoptosis in these cells (not shown). These experimentsindicated that detached, dead/dying cells retained suffi-cient amounts of intact DNA for amplification of shortsequences by PCR.


R. Sandrock et al.

Figure 5. Correlation between detachment induced by pro-apoptotic agents and apoptotic markers. (A) WM35 cells treated with CsPtand stained with anti-Apo 2.7 anitbody. (B) HT29 cells expressing the pro-apoptotic protein Bid and stained with AnnexinV-Fluos.

Isolation of cell-lethal clones using a detachedcell enrichment scheme

We used a detached cell/DNA cycling methodology inorder to enrich for clones that caused cell death in HT29cells. The process consisted of transducing HT29 cellswith a retroviral-based library of random cDNA clones,expressed as carboxy-terminal fusions with the green flu-orescent protein (GFP), and harvesting detached cells ondays 3 and 5 following transduction. Retroviral insertswere then isolated by PCR from genomic DNA obtainedfrom the detached cells, and subcloned back into the retro-viral vector. This process was repeated seven times, withthe sublibrary obtained from each cycle serving as inputinto naı̈ve HT29 cells for the next cyscle (see Methods).The percentage of floating cells measured for HT29 cellstransduced with a sublibrary obtained following cycle 7was 8% compared to∼1% for cells transduced with eitherthe retroviral vector expressing GFP alone or the originallibrary (not shown).

The observed increase in the percentage of detachedcells suggested that we successfully enriched the libraryfor clones that cause a floating cell phenotype. To

investigate this possibility, we sequenced roughly1300 clones from the cycle 7 library and looked for clonesthat were present in multiple copies. Of the 1300 clones,roughly 20% were represented only one time, whereas 87different clones were represented 2 or more times in thesublibrary. The most abundant clone, representing 16% ofthe total sequences, encoded the C-terminal 161 aa of thepro-apoptotic protein Bid.11 In contrast, Bid-encoding se-quences were not observed when 96 library clones from thestarting (non-cycled) library were analyzed. These resultsstrongly suggest that the detachment/selection schemeeffectively enriched for clones capable of conferring a cell-death phenotype.

To investigate this possibility further, we selected 6clones in addition to Bid that were present in multiplecopies and examined their behavior in the detached cellassay. HT29 cells were transduced with supernatants en-coding either Bid, one of the six clones or the controlexpression vector (pVT1567). After five days the percent-age of detached cells induced by each clone were deter-mined (see Methods). As shown in Table 1, five of theseven experimental clones (including Bid) caused an in-crease in the percentage of cells found in the detached



Figure 6. PCR amplification of DNA from dead/dying cells. ThePI+ and PI− designations indicate which populations cells weresorted from (shown in the histogram on top). Numbers (e.g., 1000)refer to the number of cells sorted directly into PCR/lysis buffer.

cell fraction as compared to cells transduced with the basevector. The percentage of detached cells varied from as fewas 4% (E125A10) to as many as 55% (Bid). These resultsproved that the detached cell selection scheme could beused effectively to enrich for clones capable of conferringa floating cell phenotype.

Cell-autonomous behavior of Bid

For en masse genetic selections in cultured cells, it is es-sential that agents act in a cell-autonomous manner. Forinstance, it is possible that expression of a pro-apoptoticmolecule in specific cells may cause neighboring cells todetach from the plate. Such behavior might cause an in-crease in the background percentage of floating cells, dele-terious to the enrichment process. We tested the effect ofexpression of Bid on the percentage of floating cells of non-transduced cells. To accomplish this goal, HT29 cells werefirst transduced with retroviral constructs expressing oneof three clones, the truncated Bid protein obtained in theselection described above, the mixture of library clonesobtained following the seventh cycle of selection, andpVT340 alone. After five days, the filter-sterilized, condi-tioned media from these three cultures were collected andapplied to freshly seeded, non-transduced, HT29 cells andthe percentage of cells in the detached cell fraction mon-itored. After five days, no significant increases in the per-centage of floating cells were detected in the cells grown

Table 2. Cell-autonomous behavior of Bid

Cell line Conditioned media source % Detached cells

HT29 pVT340 1.0

HT29 Bid 1.6

HT29 Library clones 1.2

in Bid-conditioned media as compared to vector controls(Table 2).

We also investigated the ability of Bid-expressing cellsto dislodge non-expressing neighbors. Fluorescent Bid-expressing cells grown together with non-expressors pro-duced a high proportion of fluorescent floating cells,whereas the non-fluorescent bystanders did not increasein the floating cell population significantly (not shown).Thus, Bid expression increased the number of detachedcells in a cell-autonomous fashion.

Discussion

Certain cancer cell lines are more sensitive to killing bysome agents. This differential sensitivity is the basis foraction of many chemotherapeutics and fosters hope thatmanipulation of apoptosis pathways may lead to improve-ments in cancer treatment. For example, comparison ofP53+ and P53− cell lines suggests that this locus con-trols at least part of the apoptotic response to DNA-damaging agents, a genetic feature that may be manip-ulated in therapeutic settings.20 The efficacy of certainclasses of cancer drugs against specific tumor types canbe ascribed to preferential activation of apoptosis path-ways in those cells. The search for the trigger moleculesthat control the activation process is, therefore, of primeinterest.

Genetics provides one of the most powerful means fordiscovery of novel molecules and mechanisms that un-derlie a physiological process such as apoptosis. In thecontext of mammalian cells, transdominant genetics, amethodology that incorporates expression libraries thatencode RNAs, peptides, or protein fragments, is espe-cially useful.21 The use of expression libraries mitigatescertain difficulties associated with somatic cell geneticssuch as diploidy, poor phenotypic discrimination, and re-covery of active genetic agents. However, as in all geneticexperiments, the success of transdominant genetics is lim-ited by the quality of the selection.

The most common type of single-cell genetic selec-tion involves positive selection for growth of rare variantsamong a background of cells that either die or fail to grow.Positive selections are relatively easy to perform, and sev-eral groups have executed such screens to isolate agentsthat interfere with cell death.22−26

But negative selection for cytostatic or cytotoxic clonesposes a much greater obstacle. Some groups have


R. Sandrock et al.

developed or adapted selections based on incorporation ofsuicide substrates such as BrdU or dilution of membrane-trapped dyes to select for cytostatic transdominantagents.27,28 However, selection for cytotoxic agents is evenmore difficult, because the agents reside in cells doomedto die. Grimm and Leder isolated pro-apoptotic clonesfrom an expression library by screening pools of clonesfor apoptotic activity using microscopic examination ofcultured cells.29 In addition, a plasmid-rescue scheme forlethal mutants has been proposed.30 But to our knowl-edge, no large-scale negative selection process for pro-apoptotic transdominant clones has been reported.

We sought to devise a negative selection scheme that re-lies on detachment of apoptotic cells from adherent mono-layers. Many, though not all, tissue culture cells growas adherent monolayers. In particular, cell lines derivedfrom solid tumors, as well as primary cells of epithelial orendothelial origin, generally grow in culture as adherentlines. Previous work has established a correlation betweendetachment and apoptosis.7,8 In a careful study of apop-tosis in HT29 cells, Clarke et al. showed that the fractionof non-adherent cells increases after treatment with a pro-apoptotic reagent. These floating cells also contain a highpercentage of annexinV+ cells. The authors propose a ki-netic model in which apoptotic HT29 cells detach fromthe substratum shortly after becoming annexinV+, butbefore extensive DNA fragmentation. Our results, for ex-ample in PC3 cells, are consistent with this model.

In most lines, the floating cell population contained acomponent of viable, non-apoptotic cells. In no case didwe observe complete PI, annexinV, or anti-Apo 2.7 stain-ing. These results could reflect the kinetics of the apop-totic process. However, in several lines that we tested, aproportion (as much as half) of the spontaneous floatingcells grew when replated (not shown). Therefore, a per-centage of floating cells are not irreversibly committedto die. These contaminating live cells comprise part ofthe background in a genetic selection, but will likely beindistinguishable from dead/dying floating cells in theircontribution to background.

Experiments performed on a variety of human cell lines,most of which are derived from tumors, support the viewthat the floating-cell selection method is applicable tomany cell lines. The background percentages of float-ing cells, the separation based on phenotype, the cell-autonomous nature of the phenotype, and the recoveryof DNA demonstrate that the floating-cell-based schemehas characteristics suited to genetic selection for pro-apoptotic clones from diverse expression libraries. Indeedby performing a selection for pro-apoptotic cDNA clonesbased on the floating cell enrichment methodology de-scribed herein, we were able to increase the abundance ofcDNA clones in the library that caused cells to detach fromthe surface of the plate (as judged by an increase in thepercentage of detached cells from 1 to 8%). Importantly,

the most abundant of the clones in the enriched library en-coded a fragment of the apoptosis-inducing protein Bid,thereby validating the use of a floating cell phenotype asa good surrogate for cell death. Lastly, we were able toidentify an additional five clones that conferred a floatingcell phenotype when expressed in HT29 cells from thecycle 7 library. Further analysis of this library may yieldadditional pro-apoptotic molecules.

Conclusion

We have described a genetic selection method based ondetached cells that is robust, with low background levelsof floating cells that remain roughly constant for mostlines under a variety of cell densities. The procedure istechnically simple, and scales up well to large cell numbersgrown in T175 flasks. Dying cells, at least for many linesexamined, detach from the substratum as one step in theapoptotic process and can be collected before their DNA issufficiently damaged to prevent amplification. Thus, theexpression vector inserts can be recovered before the cellsbecome debris. Use of a detached cell enrichment schemeallowed for the identification of several clones from anexpression library, one of which encoded a fragment ofthe pro-apoptotic protein Bid, that caused an increase inthe percentage of floating cells when expressed in cells.Lastly, apoptotic cells, at least those induced by Bid, donot produce non-cell-autonomous factors that increase thenumber of cells in the floating-cell fraction by dislodgingneighbors. Together, these results suggest that the floatingcell selection strategy provides a workable solution to theproblem of negative selections in mammalian cells for celllethal molecules.

Acknowledgments

We acknowledge contributions of S. Sung and K.McCormack to the work presented here. We are also grate-ful to C. Gaglio for help with flow cytometry.

References

1. Evans GI, Vousdan KH. Proliferation, cell cycle and apoptosisin cancer. Nature 2001; 17: 411(6835): 342–348.

2. Metzstein MM, Stanfield GM, Horvitz HR. Genetics of pro-grammed cell death in C. elegans: Past, present and future.Trends Genet 1998; 14(10): 410–416.

3. Luzi L, Confalonieri S, Di Fiore PP, Pelicci PG. Evolution ofShc functions from nematode to human. Curr Opin Genet Dev2000; 10(6): 668–674.

4. Wiens M, Krasko A, Muller CI, Muller WE. Molecular evo-lution of apoptotic pathways: Cloning of key domains fromsponges (Bcl-2 homology domains and death domains) andtheir phylogenetic relationships. J Mol Evol 2000; 50(6): 520–531.



5. Kamb A, Caponigro G. Peptide inhibitors expressed in vivoCurr Opin Chem Biol 2001; 5(1): 74–77.

6. Sandrock R, Karpilow J, Richards B, et al. Enrichment duringtransdominant genetic experiments using a flow sorter. Cytom-etry 2001; 45: 87–95.

7. Clarke RG, Lund EK, Latham P, Pinder AC, Johnson IT. Effectof eicosapentaenoic acid on the proliferation and incidence ofapoptosis in the colorectal cell line HT29. Lipids 1999; 34(12):1287–1295.

8. Clarke RG, Lund EK, Johnson IT, Pinder AC. Apoptosis can bedetected in attached colonic adenocarcinoma HT29 cells usingannexin V binding, but not by TUNEL assay or sub-G0 DNAcontent. Cytometry 2000; 39(2): 141–150.

9. Burns JC, Friedmann T, Driever W, Burrascano M, Yee JK.Vesicular stomatitis virus G glycoprotein pseudotyped retrovi-ral vectors: Concentration to very high titer and efficient genetransfer into mammalian and nonmammalian cells. Proc NatlAcad Sci USA 1993; 90: 8033–8037.

10. Sandrock RW, Peterson I, Evans C, Wheatley W, Kamb A. En-hanced expression of exogenous genes from retroviruses usingHIV2/Tat. Journal of Biotechnology 2002; 97: 41–50.

11. Wang K, Yin XM, Chao DT, Milliman CL, Korsmeyer SJ.BID: A novel BH3 domain-only death agonist. Genes Dev 1996;10(22): 2859–2869.

12. Zamai L, Canonico B, Luchetti F, et al. Supravital exposure topropidium iodide identifies apoptosis on adherent cells. Cytom-etry 2001; 44(1): 57–64.

13. Shapiro H. Practical Flow Cytometry, 2nd ed. A.R. Liss; 1988.14. Hsu SL, Cheng CC, Shi YR, Chiang CW. Proteolysis of integrin

alpha5 and beta1 subunits involved in retinoic acid-inducedapoptosis in human hepatoma Hep3B cells. Cancer Lett 2001;167(2): 193–204.

15. Iguchi K, Hirano K, Hamatake M, Ishida R. Phosphatidylser-ine induces apoptosis in adherent cells. Apoptosis 2001; 6(4):263–268.

16. Koester SK, Roth P, Mikulka WR, Schlossman SF, Zhang C,Bolton WE. Monitoring early cellular responses in apoptosis isaided by the mitochondrial membrane protein-specific mono-clonal antibody APO2.7. Cytometry 1997; 29(4): 306–312.

17. Koopman G, Reutelingsperger CP, Kuijten GA, Keehnen RM,Pals ST, van Oers MH. Annexin V for flow cytometric detec-tion of phosphatidylserine expression on B cells undergoingapoptosis. Blood 1994; 84(5): 1415–1420.

18. Vermes I, Haanen C, Steffens-Nakken H, Reutelingsperger C.A novel assay for apoptosis. Flow cytometric detection of phos-phatidylserine expression on early apoptotic cells using fluo-rescein labelled AnnexinV. J Immunol Methods 1995; 184(1):39–51.

19. Eastman A. Assays for DNA fragmentation, endonucleases, andintracellular pH and Ca2+ associated with apoptosis. MethodsCell Biol 1995; 46: 41–55.

20. Brown JM, Wouters BG. Apoptosis, p53, and tumor cell sensi-tivity to anticancer agents. Cancer Res 1999; 59(7): 1391–1399.

21. Kamb A, Teng DH. Transdominant genetics, peptide in-hibitors and drug targets. Curr Opin Mol Ther 2000; 2(6): 662–669.

22. Gudkov AV, Zelnick CR, Kazarov AR, Thimmapaya R, SuttleDP, Beck WT, Roninson IB. Isolation of genetic suppressorelements, inducing resistance to topoisomerase II-interactivecytotoxic drugs, from human topoisomerase II cDNA. ProcNatl Acad Sci USA 1993; 90: 3231–3235.

23. Gallagher WM, Cairney M, Schott B, Roninson IB, Brown R.Identification of p53 genetic suppressor elements which conferresistance to cisplatin. Oncogene 1997; 14: 185–193.

24. Bovolenta C, Testolin L, Benussi L, Lievens PM, Liboi E. Posi-tive selection of apoptosis-resistant cells correlates with activa-tion of dominant-negative STAT5. J Biol Chem 1998; 273(33):20779–20784.

25. Hitoshi Y, Lorens J, Kitada SI, et al. Toso, a cell surface, specificregulator of Fas-induced apoptosis in T cells. Immunity 1998;8(4): 461–471.

26. Xu X, Leo C, Jang Y, et al. Dominant effector genetics inmammalian cells. Nat Genet 2001; 27(1): 23–29.

27. Maines JZ, Sunnarborg A, Rogers LM, Mandavilli A,Spielmann R, Boyd FT. Positive selection of growth-inhibitorygenes. Cell Growth Differ 1995; 6(6): 665–671.

28. Pestov DG, Grzeszkiewicz TM, Lau LF. Isolation of growthsuppressors from a cDNA expression library. Oncogene 1998;17(24): 3187–3197.

29. Grimm S, Leder P. An apoptosis-inducing isoform of neu diff-erentiation factor (NDF) identified using a novel screen fordominant, apoptosis-inducing genes. J Exp Med 1997; 185(6):1137–1142.

30. Simons AH, Dafni N, Dotan I, Oron Y, Canaani D. Geneticsynthetic lethality screen at the single gene level in culturedhuman cells. Nucleic Acids Res 2001 Oct 15; 29(20): E100.


a genetic selection method for expression products that induce apoptosis in adherent mammalian cell...

Documents