dna- replication chapter 9, section 2 & 3 regular biology
TRANSCRIPT
DNA- ReplicationDNA- Replication
Chapter 9, Section 2 & 3Chapter 9, Section 2 & 3Regular BiologyRegular Biology
ObjectivesObjectives
Describe structure of DNADescribe structure of DNAExplain importance of DNAExplain importance of DNAUnderstand why living things need to Understand why living things need to
make copies of DNAmake copies of DNADescribe how copies of DNA are madeDescribe how copies of DNA are madeExplain what happens if a mutation occurs Explain what happens if a mutation occurs
in replicationin replication
Structure of DNAStructure of DNA
Double helixDouble helix Made of 2 strands of Made of 2 strands of
nucleotidesnucleotides1.1. Phosphate Phosphate
2.2. Sugar (deoxyribose)Sugar (deoxyribose)
3.3. Nitrogen BaseNitrogen Base Adenine (“A”) Adenine (“A”)
Thymine (“T”)Thymine (“T”) Cytosine (“C”)Cytosine (“C”) Guanine (“G”)Guanine (“G”)
Deoxyribose Nucleic Acid
Nucleotide
About DNA About DNA
Sugar & Phosphate Sugar & Phosphate make up the sidesmake up the sides
In the middle of DNAIn the middle of DNA Adenine pairs with Adenine pairs with
Thymine (A-T)Thymine (A-T) Cytosine pairs with Cytosine pairs with
Guanine (C-G)Guanine (C-G)
Practice: Practice: TATGGAGAGTCTATGGAGAGTCATACCTCTCAGATACCTCTCAG
Complementary base pairs
More PracticeMore Practice
1. GTATTCAGGA1. GTATTCAGGA
2. TAACAGA2. TAACAGA
3. GATTACA3. GATTACA
CATAAGTCCT
ATTGTCT
CTAATGT
Names to Know, pg 196Names to Know, pg 196
Chargaff- (1949) A Chargaff- (1949) A pairs with T. G pairs pairs with T. G pairs with Cwith C
Mrs. Franklin- (1952) Mrs. Franklin- (1952) X-ray pictures of DNAX-ray pictures of DNA
Watson & Crick- Watson & Crick- (1953) DNA is double (1953) DNA is double helixhelix
Prokaryote DNA is:Prokaryote DNA is:
Prokaryote DNA is Prokaryote DNA is circularcircular
Has 2 replication Has 2 replication forksforks
Replication occurs in Replication occurs in opposite directions opposite directions around the circle until around the circle until they meetthey meet
Can replicate in 1 Can replicate in 1 hour or lesshour or less
Eukaryote DNA is: Eukaryote DNA is:
Eukaryote DNA is double stranded Eukaryote DNA is double stranded Compacted in chromosomesCompacted in chromosomes Each chromosome can have Each chromosome can have
about 100 replication forks about 100 replication forks Each “new” DNA strand is about Each “new” DNA strand is about
100,000 nucleotides long.100,000 nucleotides long. The DNA in your body would The DNA in your body would
wrap around the Earth about 1.5 times!wrap around the Earth about 1.5 times! Takes about 8 hours to replicate Takes about 8 hours to replicate
human chromosomes in Interphasehuman chromosomes in Interphase
Prokaryote vs EukaryoteProkaryote vs Eukaryote
Make a Venn DiagramMake a Venn Diagram
Prokaryote vs Eukaryote DNA
• Occurs during Interphase• S (synthesis) phase
• Occurs whenever is needed
Replication-Replication-
Happens in the nucleusHappens in the nucleusWhere?
When?
What?
Making more DNAMaking more DNA
Important for Mitosis and MeiosisImportant for Mitosis and MeiosisMitosis- new cells for growth & repairMitosis- new cells for growth & repairMeiosis- new cells for sperm & eggMeiosis- new cells for sperm & egg
Important for making more copies Important for making more copies of a protein, enzyme, etcof a protein, enzyme, etc
Replication- Making more DNA Replication- Making more DNA
Why?
Replication- making more DNAReplication- making more DNA
1.1. Two strands separate, forming Two strands separate, forming replication forkreplication fork
2.2. DNA polymerase (an enzyme) brings DNA polymerase (an enzyme) brings bases to make “new” strandsbases to make “new” strands
500/sec in bacteria, 50/sec in humans….WOW!500/sec in bacteria, 50/sec in humans….WOW!
3.3. Half of DNA strand is “old” and half is Half of DNA strand is “old” and half is “new”“new”
4.4. Result: two strands of DNA form that are Result: two strands of DNA form that are identical to the original moleculeidentical to the original molecule
But what if there’s a mistake?But what if there’s a mistake?
Types of MutationsTypes of MutationsFrameshiftFrameshift- (the new part of DNA shifts to be - (the new part of DNA shifts to be
longer or shorter than it should be)longer or shorter than it should be)DeletionDeletion
Correct base is deletedCorrect base is deleted
InsertionInsertion Incorrect Base is addedIncorrect Base is added
Point mutationPoint mutation (base pair substitution) (base pair substitution)Wrong base pair is stuck in the place of anotherWrong base pair is stuck in the place of another
Build-in Mutation ReducersBuild-in Mutation Reducers Replication has “proof-readers” to help Replication has “proof-readers” to help
reduce errorsreduce errors DNA polymeraseDNA polymerase Chaperone proteinsChaperone proteins
These proteins and enzymes reduce These proteins and enzymes reduce errors to about 1 error for every 1 billion errors to about 1 error for every 1 billion nucleotides. nucleotides.
But what if a mutation DOES But what if a mutation DOES happen?happen?
DNA RNA ProteinDNA RNA Protein
Discussion!
(Genes) (Enzyme)
Genetic Technology- Genetic Technology- Terms to KnowTerms to Know
Genetic engineering-Genetic engineering- Recombinant DNA-Recombinant DNA- DNA made from 2 or DNA made from 2 or
more organismsmore organismsVectorVector- What gets the gene into the cell- What gets the gene into the cell
Usually a virus, yeast, or plasmidUsually a virus, yeast, or plasmidPlasmidPlasmid- circular bits of DNA- circular bits of DNARestriction enzymes-Restriction enzymes- proteins which cut proteins which cut
the DNA at specific pointsthe DNA at specific points
New TechnologyNew Technology Human Genome Project-Human Genome Project- mapping entire human genome mapping entire human genome
sequence. Finished in 2003.sequence. Finished in 2003.
CloningCloning- process used to creating identical copy of - process used to creating identical copy of organismorganism
Polymerase Chain Reaction (PCR)-Polymerase Chain Reaction (PCR)- process that makes process that makes more DNAmore DNA
DNA Fingerprinting-DNA Fingerprinting- use gel electrophoresis to separate use gel electrophoresis to separate DNA of different lengthsDNA of different lengths
Genetic Engineering InformationGenetic Engineering Information
Gel ElectrophoresisGel Electrophoresis Uses electric charges Uses electric charges
within gel within gel DNA is negative, thus DNA is negative, thus
travels to positive endtravels to positive end Separates molecules Separates molecules
by sizeby size
http://learn.genetics.utah.edu/units/biotech/
More New TechnologyMore New Technology
Genetically Modified Foods-Genetically Modified Foods- genetically genetically selecting certain traits for crop selecting certain traits for crop improvementimprovement
Transgenic Animals-Transgenic Animals- Animals that have Animals that have other DNA in their cell. Used to make other DNA in their cell. Used to make proteins, medicine, etc.proteins, medicine, etc.
Gene Therapy-Gene Therapy- insert genes into organism insert genes into organism to help stop or prevent disease to help stop or prevent disease
Remember…Remember…
“There is no gene for Human Spirit!”