DNA- ReplicationDNA- Replication

Chapter 9, Section 2 & 3Chapter 9, Section 2 & 3Regular BiologyRegular Biology

ObjectivesObjectives

Describe structure of DNADescribe structure of DNAExplain importance of DNAExplain importance of DNAUnderstand why living things need to Understand why living things need to

make copies of DNAmake copies of DNADescribe how copies of DNA are madeDescribe how copies of DNA are madeExplain what happens if a mutation occurs Explain what happens if a mutation occurs

in replicationin replication

Structure of DNAStructure of DNA

Double helixDouble helix Made of 2 strands of Made of 2 strands of

nucleotidesnucleotides1.1. Phosphate Phosphate

2.2. Sugar (deoxyribose)Sugar (deoxyribose)

3.3. Nitrogen BaseNitrogen Base Adenine (“A”) Adenine (“A”)

Thymine (“T”)Thymine (“T”) Cytosine (“C”)Cytosine (“C”) Guanine (“G”)Guanine (“G”)

Deoxyribose Nucleic Acid

Nucleotide

About DNA About DNA

Sugar & Phosphate Sugar & Phosphate make up the sidesmake up the sides

In the middle of DNAIn the middle of DNA Adenine pairs with Adenine pairs with

Thymine (A-T)Thymine (A-T) Cytosine pairs with Cytosine pairs with

Guanine (C-G)Guanine (C-G)

Practice: Practice: TATGGAGAGTCTATGGAGAGTCATACCTCTCAGATACCTCTCAG

Complementary base pairs

More PracticeMore Practice

1. GTATTCAGGA1. GTATTCAGGA

2. TAACAGA2. TAACAGA

3. GATTACA3. GATTACA

CATAAGTCCT

ATTGTCT

CTAATGT

Names to Know, pg 196Names to Know, pg 196

Chargaff- (1949) A Chargaff- (1949) A pairs with T. G pairs pairs with T. G pairs with Cwith C

Mrs. Franklin- (1952) Mrs. Franklin- (1952) X-ray pictures of DNAX-ray pictures of DNA

Watson & Crick- Watson & Crick- (1953) DNA is double (1953) DNA is double helixhelix

Prokaryote DNA is:Prokaryote DNA is:

Prokaryote DNA is Prokaryote DNA is circularcircular

Has 2 replication Has 2 replication forksforks

Replication occurs in Replication occurs in opposite directions opposite directions around the circle until around the circle until they meetthey meet

Can replicate in 1 Can replicate in 1 hour or lesshour or less

Eukaryote DNA is: Eukaryote DNA is:

Eukaryote DNA is double stranded Eukaryote DNA is double stranded Compacted in chromosomesCompacted in chromosomes Each chromosome can have Each chromosome can have

about 100 replication forks about 100 replication forks Each “new” DNA strand is about Each “new” DNA strand is about

100,000 nucleotides long.100,000 nucleotides long. The DNA in your body would The DNA in your body would

wrap around the Earth about 1.5 times!wrap around the Earth about 1.5 times! Takes about 8 hours to replicate Takes about 8 hours to replicate

human chromosomes in Interphasehuman chromosomes in Interphase

Prokaryote vs EukaryoteProkaryote vs Eukaryote

Make a Venn DiagramMake a Venn Diagram

Prokaryote vs Eukaryote DNA

• Occurs during Interphase• S (synthesis) phase

• Occurs whenever is needed

Replication-Replication-

Happens in the nucleusHappens in the nucleusWhere?

When?

What?

Making more DNAMaking more DNA

Important for Mitosis and MeiosisImportant for Mitosis and MeiosisMitosis- new cells for growth & repairMitosis- new cells for growth & repairMeiosis- new cells for sperm & eggMeiosis- new cells for sperm & egg

Important for making more copies Important for making more copies of a protein, enzyme, etcof a protein, enzyme, etc

Replication- Making more DNA Replication- Making more DNA

Why?

Replication- making more DNAReplication- making more DNA

1.1. Two strands separate, forming Two strands separate, forming replication forkreplication fork

2.2. DNA polymerase (an enzyme) brings DNA polymerase (an enzyme) brings bases to make “new” strandsbases to make “new” strands

500/sec in bacteria, 50/sec in humans….WOW!500/sec in bacteria, 50/sec in humans….WOW!

3.3. Half of DNA strand is “old” and half is Half of DNA strand is “old” and half is “new”“new”

4.4. Result: two strands of DNA form that are Result: two strands of DNA form that are identical to the original moleculeidentical to the original molecule

But what if there’s a mistake?But what if there’s a mistake?

Types of MutationsTypes of MutationsFrameshiftFrameshift- (the new part of DNA shifts to be - (the new part of DNA shifts to be

longer or shorter than it should be)longer or shorter than it should be)DeletionDeletion

Correct base is deletedCorrect base is deleted

InsertionInsertion Incorrect Base is addedIncorrect Base is added

Point mutationPoint mutation (base pair substitution) (base pair substitution)Wrong base pair is stuck in the place of anotherWrong base pair is stuck in the place of another

Build-in Mutation ReducersBuild-in Mutation Reducers Replication has “proof-readers” to help Replication has “proof-readers” to help

reduce errorsreduce errors DNA polymeraseDNA polymerase Chaperone proteinsChaperone proteins

These proteins and enzymes reduce These proteins and enzymes reduce errors to about 1 error for every 1 billion errors to about 1 error for every 1 billion nucleotides. nucleotides.

But what if a mutation DOES But what if a mutation DOES happen?happen?

DNA RNA ProteinDNA RNA Protein

Discussion!

(Genes) (Enzyme)

Genetic Technology- Genetic Technology- Terms to KnowTerms to Know

Genetic engineering-Genetic engineering- Recombinant DNA-Recombinant DNA- DNA made from 2 or DNA made from 2 or

more organismsmore organismsVectorVector- What gets the gene into the cell- What gets the gene into the cell

Usually a virus, yeast, or plasmidUsually a virus, yeast, or plasmidPlasmidPlasmid- circular bits of DNA- circular bits of DNARestriction enzymes-Restriction enzymes- proteins which cut proteins which cut

the DNA at specific pointsthe DNA at specific points

New TechnologyNew Technology Human Genome Project-Human Genome Project- mapping entire human genome mapping entire human genome

sequence. Finished in 2003.sequence. Finished in 2003.

CloningCloning- process used to creating identical copy of - process used to creating identical copy of organismorganism

Polymerase Chain Reaction (PCR)-Polymerase Chain Reaction (PCR)- process that makes process that makes more DNAmore DNA

DNA Fingerprinting-DNA Fingerprinting- use gel electrophoresis to separate use gel electrophoresis to separate DNA of different lengthsDNA of different lengths

Genetic Engineering InformationGenetic Engineering Information

Gel ElectrophoresisGel Electrophoresis Uses electric charges Uses electric charges

within gel within gel DNA is negative, thus DNA is negative, thus

travels to positive endtravels to positive end Separates molecules Separates molecules

by sizeby size

http://learn.genetics.utah.edu/units/biotech/

More New TechnologyMore New Technology

Genetically Modified Foods-Genetically Modified Foods- genetically genetically selecting certain traits for crop selecting certain traits for crop improvementimprovement

Transgenic Animals-Transgenic Animals- Animals that have Animals that have other DNA in their cell. Used to make other DNA in their cell. Used to make proteins, medicine, etc.proteins, medicine, etc.

Gene Therapy-Gene Therapy- insert genes into organism insert genes into organism to help stop or prevent disease to help stop or prevent disease

Remember…Remember…

“There is no gene for Human Spirit!”