dna fingerprinting

DNA Fingerprinting

Presented by,Dr. Md. Mohiuddin MasumResident, MS AnatomyPAY2B6

Guided by,Prof. Dr. Shahara Khatun

Define DNA fingerprint and DNA fingerprinting

Explain some terms related to DNA fingerprinting

Describe the method of collection and preservation of biological samples

Describe the uses of DNA fingerprinting

Describe the types of DNA fingerprinting

Describe the steps of DNA fingerprinting

Objectives

A small set of DNA variationthat is very likely to be different

in all unrelated individuals,thereby being as unique to individuals

as are fingerprint

DNA Fingerprint

A method used to identify an individual from a sample of DNA

by looking at unique patternsin their DNA sequence

DNA Fingerprinting

www.yourgenome.org

Also known as,

DNA Fingerprinting

DNA profilingDNA testingDNA typingGenetic fingerprinting

The beginning

Reference sample

https://quizlet.com/chapter-2-the-crime-scene-definitions/

Terms related to DNA fingerprinting


Polymorphism

http://groups.molbiosci.northwestern.edu//DNA_polymorphism


DNA Polymorphism

http://groups.molbiosci.northwestern.edu//DNA_polymorphism

Single nucleotide polymorphism (SNP)

Minisatellite or variable number of tandem repeat (VNTR)

Microsatellite or short tandem repeat (STR)


Junk DNA

Proteomics & Genomics/Dr. Vikash Kumar Dubey

95%


Tandem repeat

www.bio.miami.edu/dana/dox/vntr.html


Tandem repeat


Minisatellite or VNTR

AGTTCGCGTGAAGTTCGCGTGAAGTTCGCGTGA

https://en.wikipedia.org/wiki/Variable_number_tandem_repeat


Microsatellite or STR

ATGCCATGCCATGCCATGCCATGCC

https://en.wikipedia.org/wiki/Microsatellite


Restriction endonuclease

Escheria coli EcoRI5’ GAATTC 3 ’3’ CTTAAG 5 ’

5’ G AATTC 3 ’3’ CTTAA G 5 ’

https://en.wikipedia.org/wiki/Restriction_enzyme

BloodSalivaSemenTissue from personal itemFrom stored sampleHair follicle

Sources of DNA evidence

Sources of DNA evidence

Collection & preservation of biological samples

Forensic science

Paternity and maternity determination

Personal identification

Use of DNA fingerprinting

We all are different!

Rayhan’s DNA

Zobayer’s DNA

DNA fingerprinting overview

So…. How do we tell people apartjust by their DNA anyways?


The DNA gets cut up by special scissors


The scissors can only cut the same colour


All of the cut up pieces of DNAare different sizes


A special machine sorts the DNA by size


Our DNA has different sizes of piecesso it makes a different pattern when it’s all cut up


Rayhan’s DNA Zobayer’s DNA


Rayhan’s DNA Zobayer’s DNA

Restriction fragment length polymorphism (RFLP)

Polymerase chain reaction amplification of short tandem repeat (PCR/STR)

Types of DNA fingerprinting

RFLP Types of DNA fingerprinting

DNA extraction

Restriction digestion

Electrophoresis

Transfer of DNA to membrane

Hybridization of DNA

X-ray

Southern blotting

Types of DNA fingerprinting: RPLP

PCR/SRT Types of DNA fingerprinting

Multiplex PCR


13 CODIS core STR lociwith chromosomal position



Restriction fragment length polymorphism (RFLP)

Polymerase chain reaction amplification of short tandem

repeats (PCR/SRT)

More sample needed Less sample needed

Fresh DNA sample needed Fresh DNA sample not always mandatory

No chance of amplification of contamination

Chance amplification of contamination

Require more time Require less time

Analysis is costly Analysis is cheaper than RFLP

Single cell DNA fingerprint

DNA database

http://www.investigativegenetics.com/content/4/1/22

1995National DNA Database

(NDNAD)

6 millions

Combined DNA Index System (CODIS)

10 millions

National DNA Database 16 millions

Future of DNA fingerprinting

goo.gl/4Gqgfb

dna fingerprinting

Education