dna bytes summary creative technology nights - 16 february ... · dna bytes summary – creative...

85
DNA Bytes summary Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some -- dark hair? Why some of us have blue eyes and some -- brown or green? It is all in our DNA and genes that it contains! In the "DNA Bytes" session, we are going to talk about what DNA is, where to find it and, most importantly, DNA's sequence. One of the problems with getting DNA's sequence is that it only comes in short pieces instead of one long sequence. Think of it as a book where all the words get moved around and now you need to reconstruct the book's text to read the story. Similarly, scientists have to stitch DNA pieces together like a big puzzle before they can study our genes. We will discuss different strategies for stitching DNA sequence -- a process called genome assembly -- and how computer scientists helped figure out ways to do it quickly and unambiguously.

Upload: others

Post on 14-Jun-2020

2 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

DNA Bytes summary – Creative Technology Nights - 16 February 2015

Why do some people have blonde hair and some -- dark hair? Why some of us have blue

eyes and some -- brown or green? It is all in our DNA and genes that it contains! In the

"DNA Bytes" session, we are going to talk about what DNA is, where to find it and, most

importantly, DNA's sequence.

One of the problems with getting DNA's sequence is that it only comes in short pieces

instead of one long sequence. Think of it as a book where all the words get moved around

and now you need to reconstruct the book's text to read the story. Similarly, scientists

have to stitch DNA pieces together like a big puzzle before they can study our genes.

We will discuss different strategies for stitching DNA sequence -- a process called

genome assembly -- and how computer scientists helped figure out ways to do it quickly

and unambiguously.

Page 2: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

DNA Bytes!

By Darya F. & Shalyn G. for TechNights Feb 16, 2015

No actual biting will take place.

Page 3: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

Who has blue eyes?

Page 4: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

Who has blue eyes?• Why do we have different color eyes?

Page 5: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

Who has blue eyes?• Why do we have different color eyes?

• Why do we have different hair?

Page 6: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

Who has blue eyes?• Why do we have different color eyes?

• Why do we have different hair?

• It’s in the genes in our DNA!

Page 7: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

What is DNA?

Page 8: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

What is DNA?• A very long molecule that

carries our genetic information

Page 9: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

What is DNA?• A very long molecule that

carries our genetic information

• Where is it?

Page 10: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

What is DNA?• A very long molecule that

carries our genetic information

• Where is it?

Page 11: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

What is DNA?• A very long molecule that

carries our genetic information

• Where is it? cell nucleus

Page 12: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

What is DNA?• A very long molecule that

carries our genetic information

• Where is it?

• How long is it?

cell nucleus

Page 13: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

What is DNA?• A very long molecule that

carries our genetic information

• Where is it?

• How long is it? ~2m (6.5 ft)

cell nucleus

Page 14: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

What is DNA?• A very long molecule that

carries our genetic information

• Where is it?

• How long is it?

• How does it look?

~2m (6.5 ft)

cell nucleus

Page 15: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

(zoom in)

(coiled tightly in the nucleus)

What is DNA?• A very long molecule that

carries our genetic information

• Where is it?

• How long is it?

• How does it look?

~2m (6.5 ft)

cell nucleus

Page 16: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

DNA structure

Page 17: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

DNA structureWhat is this structure called?

Page 18: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

DNA structureDouble helix

What is this structure called?

Page 19: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

DNA structureDouble helix

What is this structure called?What is connecting helices?

Page 20: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

DNA structureDouble helixBases What is this structure called?

What is connecting helices?

Page 21: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

DNA structureDouble helixBases What is this structure called?

What are the different bases?

What is connecting helices?

Page 22: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

DNA structureDouble helixBases

ACGT

What is this structure called?

What are the different bases?

What is connecting helices?

Page 23: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

DNA structureDouble helixBases

denineytosineuaninehiamine

ACGT

What is this structure called?

What are the different bases?

What is connecting helices?

Page 24: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

DNA structureDouble helixBases

denineytosineuaninehiamine

ACGT

What is this structure called?

What are the different bases?

What is connecting helices?

Any patterns?

Page 25: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

DNA structureDouble helixBases

denineytosineuaninehiamine

ACGT

C G

T A

What is this structure called?

What are the different bases?

What is connecting helices?

Any patterns?

Page 26: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

DNA structureDouble helixBases

denineytosineuaninehiamine

ACGT

GTA

CACC

CAGT

C G

T A

What is this structure called?

What are the different bases?

What is connecting helices?

Any patterns?

Page 27: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

DNA structureDouble helixBases

denineytosineuaninehiamine

ACGT

GTA

CACC

CAGT

DNA sequence

C G

T A

What is this structure called?

What are the different bases?

What is connecting helices?

Any patterns?

Page 28: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

How can we get DNA sequence?

Page 29: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

How can we get DNA sequence?Many copies of the same

DNA

Shear each DNA strand, randomly breaking it into many small pieces:

original

+lots of cool biology & chemistry & physics…

slide courtesy of C. Kingsford

Page 30: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

How can we get DNA sequence?Many copies of the same

DNA

Shear each DNA strand, randomly breaking it into many small pieces:

original

+lots of cool biology & chemistry & physics…

slide courtesy of C. Kingsford

Page 31: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

How can we get DNA bases?

ACGTTTC

ACGGATC

TGGTTTC

ACGTCGCACGTATC

CGGTACT

ACGTTTC

ACGGATC

TGGTTTC

ACGTCGCACGTATC

CGGTACT

ACGTTTC

ACGGATC

TGGTTTC

ACGTTGC

ACGTATC

CGGTACT

This process is called genome sequencing

sequencer

random order

DNA pieces

more cool biology, chemistry,

and physics!!!

READS

Page 32: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

We can only read ~ 100 characters at a time from a random place:

Activity 1 — Alice in Wonderland

miss me very much to-night

hope they’ll remember her saucer of milk

down. There was nothing with me! There are no mice to-night, I should think! I hope they’ll

a bat, and that’s very like

There are no mice in the air, I’m afraiddown here with me! I’m afraid, but you might catch a bat,

Alice soon began

down, down.

slide courtesy of C. Kingsford

Page 33: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

What did you get?

Page 34: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

What did you get?Down, down, down. There was nothing else to do, so Alice soon began talking again. `Dinah'll miss me very much to-night, I should think! I hope they'll remember her saucer of milk at tea-time. Dinah my dear! I wish you were down here with me! There are no mice in the air, I'm afraid, but you might catch a bat, and that's very like a mouse, you know. But do cats eat bats, I wonder?

Page 35: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

What did you get?Down, down, down. There was nothing else to do, so Alice soon began talking again. `Dinah'll miss me very much to-night, I should think! I hope they'll remember her saucer of milk at tea-time. Dinah my dear! I wish you were down here with me! There are no mice in the air, I'm afraid, but you might catch a bat, and that's very like a mouse, you know. But do cats eat bats, I wonder?

Now try it with DNA bases :)

Page 36: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

What did you get?Down, down, down. There was nothing else to do, so Alice soon began talking again. `Dinah'll miss me very much to-night, I should think! I hope they'll remember her saucer of milk at tea-time. Dinah my dear! I wish you were down here with me! There are no mice in the air, I'm afraid, but you might catch a bat, and that's very like a mouse, you know. But do cats eat bats, I wonder?

Now try it with DNA bases :)

Activity 2

Page 37: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

What did you get?

Page 38: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

What did you get?

13 5 11 2 10 1 6 9 8 4 3 7 12 14 15

Page 39: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

What did you get?

13 5 11 2 10 1 6 9 8 4 3 7 12 14 15

easy/hard?:) :(

Page 40: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

What did you get?

13 5 11 2 10 1 6 9 8 4 3 7 12 14 15

This process is called genome assembly

easy/hard?:) :(

Page 41: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

What is the mechanism?

Page 42: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

What is the mechanism?Shortest Common Superstring

acggta gtactacctacttag

Page 43: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

What is the mechanism?Shortest Common Superstring

acggtagtactac ctacttag

Page 44: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

What is the mechanism?Shortest Common Superstring

acggtagtactac

ctacttag

Page 45: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

What is the mechanism?Shortest Common Superstring

acggtagtactac

ctacttagacggtactacttag

Page 46: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

acgt cgta taccBut what if…

What is the mechanism?Shortest Common Superstring

acggtagtactac

ctacttagacggtactacttag

Page 47: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

acgt cgta taccBut what if…

What is the mechanism?Shortest Common Superstring

acggtagtactac

ctacttagacggtactacttag

acgtacc OR acgtcgtacc

Page 48: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

acgt cgta taccBut what if…

What is the mechanism?Shortest Common Superstring

acggtagtactac

ctacttagacggtactacttag

Human genome: 3 billion bases

Reads: 30-100 bases

One run: hundreds of millions of reads

Will take too long

What can we do?

acgtacc OR acgtcgtacc

Page 49: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

Another way: De Bruijn graphaagaca

Page 50: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

Another way: De Bruijn graphaagacaaag

gacaga

aca

Page 51: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

Another way: De Bruijn graphaagacaaag

gacaga

aca

aag

Page 52: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

Another way: De Bruijn graphaagacaaag

gacaga

aca

aag aga

Page 53: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

Another way: De Bruijn graphaagacaaag

gacaga

aca

aag aga gac

Page 54: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

Another way: De Bruijn graphaagacaaag

gacaga

aca

aag aga acagac

Page 55: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

Another way: De Bruijn graphaagacaaag

gacaga

aca

aag aga acagac

gacaagc

Page 56: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

Another way: De Bruijn graphaagacaaag

gacaga

aca

aag aga acagac

gacaagcgac

caaaca

aagagc

Page 57: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

Another way: De Bruijn graphaagacaaag

gacaga

aca

aag aga acagac

gacaagcgac

caaaca

aagagc

Page 58: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

Another way: De Bruijn graphaagacaaag

gacaga

aca

aag aga acagac caa

gacaagcgac

caaaca

aagagc

Page 59: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

Another way: De Bruijn graphaagacaaag

gacaga

aca

aag aga acagac caa

gacaagcgac

caaaca

aagagc

Page 60: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

Another way: De Bruijn graphaagacaaag

gacaga

aca

aag aga acagac caa

agc

gacaagcgac

caaaca

aagagc

Page 61: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

Another way: De Bruijn graphaagacaaag

gacaga

aca

aag aga acagac caa

agc

gacaagc

de Bruijn graph

gac

caaaca

aagagc

Page 62: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

Another way: De Bruijn graphaagacaaag

gacaga

aca

aag aga acagac caa

agc

gacaagc

de Bruijn graph

gac

caaaca

aagagc

To recover DNA: make a trail that follows as many arrows as possible

Where should you start? Eulerian path(much faster) (repeats - OK)

Page 63: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

Another way: De Bruijn graphaagacaaag

gacaga

aca

aag aga acagac caa

agc

gacaagc

Activity 3 and 4

de Bruijn graph

gac

caaaca

aagagc

To recover DNA: make a trail that follows as many arrows as possible

Where should you start? Eulerian path(much faster) (repeats - OK)

Page 64: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

Activity 3

Page 65: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

What did you get?

tagacgaacgtacggtagg

tag aga gac acg cga gaa aac

cgt

gta taccgg

ggt

agg

Page 66: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

Activity 4

Page 67: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

What did you get?

aca gag gcc cac aac atc ggc cac ctc g

Page 68: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

What would make assembly easier?

Page 69: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

What would make assembly easier?• More overlapping reads

Page 70: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

What would make assembly easier?• More overlapping reads

Page 71: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

What would make assembly easier?• More overlapping reads

Page 72: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

What would make assembly easier?• More overlapping reads

• Longer reads — PacBio sequencing w/ 1000s of nucleotides

Page 73: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

What would make assembly easier?• More overlapping reads

• Longer reads — PacBio sequencing w/ 1000s of nucleotides

Page 74: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

What would make assembly easier?• More overlapping reads

• Longer reads — PacBio sequencing w/ 1000s of nucleotides

• Having something to compare against — reference genome

agaacgtgagagtgcgctacctc…

gaacgtgaga

Page 75: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

What would make assembly easier?• More overlapping reads

• Longer reads — PacBio sequencing w/ 1000s of nucleotides

• Having something to compare against — reference genome

agaacgtgagagtgcgctacctc…gaacgtgaga

Page 76: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

What would make assembly easier?• More overlapping reads

• Longer reads — PacBio sequencing w/ 1000s of nucleotides

• Having something to compare against — reference genome

honey bee

baker’s yeast

Page 77: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

What can DNA tell?

Diseases

Resistance to colds

Short distance runner

Resistance to malaria

Page 78: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

Other things• The longest genome?

• The shortest genome?

• How much does your DNA overlap w/ your neighbor’s?

• And with a mouse?..

• Explore the genes at UCSD Genome Browser

• Check out full assembled genomes at NIH

Page 79: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

Other things• The longest genome?

• The shortest genome?

• How much does your DNA overlap w/ your neighbor’s?

• And with a mouse?..

• Explore the genes at UCSD Genome Browser

• Check out full assembled genomes at NIH

Amoeba dubia, over 200x larger

Page 80: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

Other things• The longest genome?

• The shortest genome?

• How much does your DNA overlap w/ your neighbor’s?

• And with a mouse?..

• Explore the genes at UCSD Genome Browser

• Check out full assembled genomes at NIH

Amoeba dubia, over 200x larger

Candidatus Carsonella ruddii

Page 81: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

Other things• The longest genome?

• The shortest genome?

• How much does your DNA overlap w/ your neighbor’s?

• And with a mouse?..

• Explore the genes at UCSD Genome Browser

• Check out full assembled genomes at NIH

Amoeba dubia, over 200x larger

Candidatus Carsonella ruddii

99.5% similar!

Page 82: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

Other things• The longest genome?

• The shortest genome?

• How much does your DNA overlap w/ your neighbor’s?

• And with a mouse?..

• Explore the genes at UCSD Genome Browser

• Check out full assembled genomes at NIH

Amoeba dubia, over 200x larger

Candidatus Carsonella ruddii

99.5% similar!~92% similar!

Page 83: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

1 Activity

Recover original text.

Dinah my dear! I wish you were

miss me very much to-night

hope they’ll remember her saucer of milk

down. There was nothing with me! There are no mice to-night, I should think! I hope they’ll

a bat, and that’s very like

There are no mice in the air, I’m afraiddown here with me! I’m afraid, but you might catch a bat,

milk at tea-time. Dinah you were down

I wonder.” very like, a mouse, you know. But

began talking again. “Dinah’ll miss me very

There was nothing else to do, so Alice

Alice soon began

But do cats eat bats, I wonder?”

Down, down

down, down.

Figure 1: Activity 1

2 Activity

Recover original DNA string from the DNA reads in your packets.

aagacaagcataacgggaaactatgcaaacta

acgggaaactatgcaaactaagaggggtagccccattacatttggg

tacatttgggtaaatgtaacattgctggctggatcctggg

tgctggctggatcctgggaaatccagagtgtgaatcactctcca

tcactctccacagcaagctcatggtcctacattgtggaaa

attgtggaaacatctagttcagacaatggaacgtgttacc

gttacccaggagatttcatcgattatgaggagctaagagagcaattgagct

gagatttcatcgattatgaggagctaagagagcaattgagctcagtgt

agctcagtgtcatcatttgaaaggtttgagatattcccca

atattccccaagacaagttcatggcccaatcatgactcga

tcatgactcgaacaaaggtgtaacggcagcatgtcctcat

atgtcctcatgctggagcaaaaggcttctacaaaaatttaatatggctagtatggctagttaaaaaaggaaattcatacccaaagctcagca

aaaggaaattcatacccaaagctcagcaaatcctacattaatgataaa

atcctacattaatgataaagggaaagaagtcctcgtgctatggggcattc

Figure 2: Activity 2: Recover DNA string from DNA reads

1

Page 84: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

3 Activity

Draw a de Bruijn graph for string TAGACGAACGTACGGTAGG below.

2

Page 85: DNA Bytes summary Creative Technology Nights - 16 February ... · DNA Bytes summary – Creative Technology Nights - 16 February 2015 Why do some people have blonde hair and some

4 Activity

Find a string that generated this graph: for this, use every edge exactly once.Hint: try to figure out which word is the start word and which word must be the last

word.

aca

caa aaccag aga gag

agg

ggc

gccccc

cca

cac

acc

cct

ctc

catatc

tcg

cgg

Figure 3: Activity 4

3