dna barcoding of panax species

Abstract!

Ginsengs (Panax, Araliaceae) are among theplants best known for their medicinal properties.Many ginseng species are endangered due toover-exploitation of natural resources – a situa-tion difficult to remedy while there are no reli-able, practical methods for species identification.We screened eleven candidate DNA barcoding locito establish an accurate and effective Panax spe-cies identification system, both for commercialand conservation purposes. We used 95 ginsengsamples, representing all the species in the genus.We found considerable differences in the perfor-mance of the potential barcoding regions. The se-quencing of atpF-atpH was unsuccessful due to

poly-N structures. The rbcL, rpoB, and rpoC1 re-gions were found to be mostly invariable, withonly four to eight variable sites. Using matK,psbK‑I, psbM-trnD, rps16 and nad1, we couldidentify four to six out of eight considerably diver-gent species but only one to five out of nineteenclusters within the P. bipinnatifidus species group.psbA-trnH and ITS were the most variable loci,working very well both in species and clusteridentifications. We demonstrated that the combi-nation of psbA-trnH and ITS is sufficient for iden-tifying all the species and clusters in the genus.

Supporting information available online athttp://www.thieme-connect.de/ejournals/toc/plantamedica

DNA Barcoding of Panax Species

Authors Yunjuan Zuo1,3, Zhongjian Chen2, Katsuhiko Kondo4, Tsuneo Funamoto5, Jun Wen1,6, Shiliang Zhou1

Affiliations The affiliations are listed at the end of the article

Key wordsl" DNA barcodingl" Panaxl" Araliaceael" ginsengl" locus evaluation

received March 8, 2010revised June 18, 2010accepted June 30, 2010

BibliographyDOI http://dx.doi.org/10.1055/s-0030-1250166Published online August 27,2010Planta Med 2011; 77: 182–187© Georg Thieme Verlag KGStuttgart · New York ·ISSN 0032‑0943

CorrespondenceProf. Dr. Jun Wen (Authorresponsible for plant material)Department of BotanyUnited StatesNational HerbariumNational Museumof Natural HistoryMRC-166Smithsonian InstitutionWashington, DC 20013-7012USAPhone: + 12026334881Fax: + [email protected]

CorrespondenceProf. Dr. Shiliang Zhou (Authorresponsible forDNAbarcoding)State Key Laboratoryof Systematic andEvolutionary BotanyInstitute of BotanyThe Chinese Academyof Sciences100093 BeijingPeopleʼs Republic of ChinaPhone: + 861062836503Fax: + [email protected]

182

Zuo Y et al. DNA Barcoding of… Pla

Original Papers

Introduction!

A large proportion of the populations of orientalcountries relies on medicinal plants for theirwell-being. Medicinal plants are the basis of tradi-tional herbal medicine; in Western medicine theyserve as the source of many kinds of drugs [1].Ginsengs (Panax Linn., Araliaceae) are among thebest known herbal medicines. Three species inthe genus are commercially cultivated: P. ginsengC.A. Meyer (ginseng), P. quinquefolius Linn. (Amer-ican ginseng) and P. notoginseng (Burkill) F.H.Chen ex C.Y. Wu et K M. Feng (Sanqi). Panax gin-seng and P. quinquefolius are often used as a tonic,a stimulant, and for fatigue-resisting effects; P. no-toginseng is considered to be a remedy for pre-venting bleeding and recovering from injury. Thepart of P. notoginseng normally used for medicinalpurposes is readily recognizable by its character-istic, nearly round shape, but it is not easy to dis-tinguish ginseng (P. ginseng C.A. Meyer) fromAmerican ginseng by the morphology of the me-dicinal parts alone. This might open the way tofraud if the prices of the two medicines differ sig-

nta Med 2011; 77: 182–187

nificantly. A reliable method of distinguishingthem is necessary to solve possible disputes.Despite the widespread availability of the culti-vated ginsengs, some people prefer to use non-cultivated plants from one of the congeners. Theybelieve that thewild ones are more effective, eventhough they have no knowledge of the differencesin the plantsʼ chemical composition. The illegaltrade inwild ginsengs has caused a drastic declinein wild populations and some of the species arenow endangered [2,3]. The usual measures tostop the population destruction are not very ef-fective because the authorities do not knowwhich species is in danger of extinction. Identifi-cation of ginsengs is expert-dependent – it is dif-ficult for non-taxonomists to understand the var-iation within species and the divergence amongspecies. Therefore, new techniques, suitable fornonexpert use, are urgently needed – not onlyfor the ginseng group but also for other medicinalplant species.Various techniques are in use, or have been tried,for the purpose of species identification. Metabol-ic chemicals resolved by high-performance liquid

Table 1 Sampling information of populations and species of Panax.

Taxon Population Locality Voucher

(PE)

Sample

size

P. bipinnatifidus Seem. species group

China: Henan, Luanchuan Y1 (PE) 1

China: Hubei, Shennongjia Wen5502 (US) 2

China: Hunan, Xinning X1 (PE) 2

China: Jiangxi, Yanshan Wen5543 (US) 3

China: Shannxi, Taibai WY06259 (US) 2

China: Sichuan, Maoxian C2.A (PE) 2

China: Sichuan, Muli Tibet1778 (US) 1

China: Sichuan, Jiuzhaigou C1.A (PE) 2

China: Sichuan, Omei Wen5002 (US) 3

China: Sichuan, Omei Wen5020 (US) 1

China: Xizang, Gongbujiangda Wen9152 (US) 1

183Original Papers

chromatography [4], molecular markers, such as random ampli-fied polymorphic DNA (RAPD) and microsatellite markers, havebeen tried on P. ginseng [5,6]. However, the techniques used sofar have suffered from low efficiency, low reproducibility and(or) low reliability. Species identification based on DNA se-quences (DNA barcoding) is a method of high efficiency, reprodu-cibility and reliability, but might show low resolution. In this pa-per, we evaluate the methodʼs resolution in Panax species, usingsome of the highly recommended plant DNA barcoding loci, withspecial emphasis on the clusters of a group of species formed re-cently through evolutionary radiation over vast geographicalareas. We intend to address the following two questions: (i) howwell do the eleven candidate DNA barcodes perform in Panax;and (ii) whether or not the DNA barcoding method is applicableto very closely related species.

China: Xizang, Lynchi Z2 (PE) 3

China: Xizang, Lynchi Z1 (PE) 5

China: Xizang, Nyalam Tibet772 (US) 2

China: Yunnan, Deqin Tibet1451 (US) 1

China: Yunnan, Lijiang D8 (PE) 2

China: Yunnan, Ninglang WY06820 (PE) 2

China: Yunnan, Shuifu WY06903 (PE) 3

China: Yunnan, Tengchong Wen5694 (US) 1



China: Yunnan,Wenshan No. speciemen 1

China: Yunnan,Wenshan Wen5638 (US) 1

China: Yunnan, Xianggerila WY06680 (PE) 1

China: Yunnan, Gongshan GLGSBS33673 (KUN) 3

China: Yunnan, Gongshan Wen5075 (US) 4

China: Yunnan, Lijiang Wen5728 (US) 1

Nepal: Bagdwar Wen4942 (US) 1

Nepal: Dagchu Wen4913 (US) 12

Nepal: Kinjia Wen4908 (US) 1

Thailand: ChiangMai Wen7371 (US) 1

Vietnam: Lamdong WuSGVietnam (KUN) 2

Vietnam: Quang Nam Vietnam1 (US) 1

P. ginseng C.A. Mey.

China: Jilin, Fusong Zhou001 (PE) 2

P. japonicus C.A. Mey.

Japan: Gifu Prefecture J5 (PE) 3

Japan: Shizuoka Prefecture J2 (PE) 1

Japan: Tottori Prefecture J1 (PE) 1

Japan: Toyama Prefecture J3 (PE) 2

Japan: Toyama Prefecture J4 (PE) 2

P. notoginseng (Burkill) Chen ex

China: Yunnan,Wenshan D7 (PE) 3

P. pseudoginseng N.Wallich

Nepal: Gotehola Wen4900 (US) 2

P. quinquefolius Linn.

China: Jilin, Fusong Wen5420 (US) 1

USA: Virginia, Giles County Wen6243 (US) 1

P. stipuleanatus Tsai & Feng

China: Yunnan, Maguan D1 (PE) 1

Vietnam: Quang Nam Vietnam4 (US) 3

P. trifolius Linn.

USA: Maryland,Baltimore County

Wen10099 (US) 2

KUN =Herbarium of Kunming Institute of Botany; PE = National Herbarium of China;

and US = the United States National Herbarium

Material and Methods!

The genus Panax and sampling strategyThe ginseng genus (Panax) has seven well-divergent species anda group of not well-defined species (evolutionary lineages) rep-resented by P. bipinnatifidus Seem. (P. bipinnatifidus speciesgroup). No wild populations of P. notoginseng have been foundso far, and wild populations of P. ginseng are extremely rare,while Panax stipuleanatusH.T. Tsai & K.M. Feng and P. pseudogin-seng Wallich are very rare and seriously endangered. The taxon-omy of the genus was formally examined byWen (2001), and thephylogenetic relationships of the eight species were evaluatedseveral times [7–9].In this study, all eight species of Panax were sampled, with spe-cial emphasis on the P. bipinnatifidus species group. The culti-vated species (P. ginseng and P. notoginseng), the rare and endan-gered Asian species (P. stipuleanatus and P. pseudoginseng) andthe North American species (P. quinquefolius and P. trifolius Linn.)were represented by few samples, because they are geneticallyuniform and have been well-studied already [2,10]. Panax trifo-lius was treated as a functional outgroup when rooting was nec-essary, because this species has been shown to be the basal-mostspecies of the genus [8]. Panax bipinnatifidus species group issparsely distributed over a large area spreading from the Hima-layas to the western coast of the Pacific Ocean, and is well rep-resented in 33 populations found in those areas. All the speciesexamined in our study were represented by at least two individ-uals, and voucher specimens were carefully identified by JunWen (l" Table 1).

Selection of candidate barcoding loci by pilot screeningNine candidate barcoding loci of chloroplast genome (atpF-atpH,psbA-trnH, psbK-psbI, psbM-trnD, matK, rps16, rpoB, rpoC1, andrbcL), the internal transcribed spacer (ITS) of ribosomal nucleargene proposed in previous studies [11–13] and a mitochondriallocus nad1 were evaluated in a pilot study with 24 populationsrepresenting all the eight species. Loci which can be directly se-quenced from PCR products and possess a reasonable number ofvariable sites were considered for further screening in all 95samples (for Genbank number of sequences see Supporting In-formation).

Zuo Y et al. DNA Barcoding of… Planta Med 2011; 77: 182–187

Table 2 Comparisons of the success rate of PCR amplification and DNA fragment sequencing of eleven loci in Panax.

Locus Primer forward Primer reverse N1 P (%) N2 S (%)

atpF-atpH ACTCGCACACACTCCCTTTCC GCTTTTATGGAAGCTTTAACAAT 24 87.5 21 0

matK CGATCTATTCATTCAATATTTC GTTCTAGCACAAGAAAGTCG 95 100 95 100

psbA-trnH GTTATGCATGAACGTAATGCTC CGCGCATGGTGGATTCACAAATC 95 100 95 100

psbK-psbI TTAGCCTTTGTTTGGCAAG AGAGTTTGAGAGTAAGCAT 95 100 95 100

psbM-trnD GCGGTAGGAACTAGAATAAATAG GGGATTGTAGTTCAATTGGT 95 100 95 100

rbcL ATGTCACCACAAACAGAGACTAAAGC CTTCTGCTACAAATAAGAATCGATCTC 24 100 24 100

rpoB ATGCAACGTCAAGCAGTTCC GATCCCAGCATCACAATTCC 24 83.3 23 100

rpoC1 GTGGATACACTTCTTGATAATGG CCATAAGCATATCTTGAGTTGG 24 87.5 21 100

rps16 GTGGTAGAAAGCAACGTGCGACTT TGCGGATCGAACATCAATTGCAAC 95 100 95 100

nad1 GCATTACGATCTGCAGCTCA GGAGCTCGATTAGTTTCTGC 95 72.6 69 100

nad1a GCATTACGATCTGCAGCTCA GGCGACTGGAGTGCTTTCATC* 22 100 22 100

nad1b GCGTGGCAGCTGGTATAGATG* GGAGCTCGATTAGTTTCTGC 21 100 21 100

ITS GTTTCTTTTCCTCCGCT AGGAGAAGTCGTAACAAG 95 100 95 100

N1: number of samples amplified by PCR; N2: number of samples sequenced; P: PCR success; S: sequencing success (> 500).* Primers designed in this study

Table 3 Variability of ten loci screened in Panax.

Locus Ni L Ps Vs Pi Hn Hd Indel

No % No %

matK 95 818 24 2.93 37 4.52 0.00324 14 0.715 0

psbA-trnH 95 465 28 6.02 41 8.82 0.01105 28 0.915 6

psbK-psbI 95 414 22 5.31 27 6.52 0.00641 16 0.720 6

psbM-trnD 95 1199 28 2.34 54 4.5 0.00360 28 0.888 12

rbcL 24 647 3 0.46 8 1.24 0.00310 7 0.727 0

rpoB 24 492 2 0.41 5 1.02 0.00201 6 0.458 0

rpoC1 24 559 1 0.18 4 0.72 0.00126 4 0.32 0

rps16 95 848 25 2.95 34 4.01 0.00398 20 0.852 9

nad1 95 1506 19 1.26 23 1.53 0.00205 21 0.848 3*

ITS 95 629 90 14.31 140 22.26 0.02140 39 0.961 7

Ni: number of samples tested; L: aligned length; Ps: parsimony-informative sites; Vs: variable sites; Pi: nucleotide diversity; Hn: number of haplotypes; Hd: haplotype diversity; * an

indel more than 200bp

184 Original Papers

DNA isolation, PCR amplification andsequencing proceduresFresh leaf material was dried in silica gel. Genomic DNA was ex-tracted from the dried leaves using QIAGEN DNeasy kits. Poly-merase chain reaction (PCR) was conducted using routine labora-tory protocols (the primers are shown in l" Table 2). The DNAfragments were amplified using 30 cycles at 94°C for 40 s, 51°Cfor 45 s and 72°C for 1.5min. PCR products were cleaned usingPEG8000. The DNA fragments were sequenced in ABI3730xlDNA Analyzer following the manufacturerʼs instruction. The se-quences were edited using Sequencher 4.7 (Gene Code), alignedby ClustalX 2.0.5 alignment tool [14] and manually adjusted us-ing Se-Al 2.0 application [15].

Data analysisDNA polymorphisms were examined using DNAsp softwarepackage, v5 [16]. Genetic relationships among species were mea-sured using the Kimura 2-parameter model of base substitution[17], which is generally accepted as the best model for species-level analysis with low distances [18]. The neighbor-joiningmethod was employed to create graphical representations usingPAUP* program, version 4.0b10 [19]. To test the discriminatorypower of the candidate barcodes within the P. bipinnatifidus spe-cies group, we compared them using four dendrogram buildingmethods (neighbor-joining, unweighted pair group method witharithmetic mean, Neighbornet and taxonDNA). A network cre-


ated by Splitstree version 4.10 [20] based on the combined dataset served as a framework of comparison. The populations weregrouped into clusters according to the genetic relationshipshown in the network.

Supporting informationGenbank accession numbers of ten DNA barcoding loci of Panaxspecies are available as Supporting Information.

Results!

Most of the potential barcode regions can be amplified and se-quenced easily using the universal primers (l" Table 2). A highrate (100%) of amplification success was achieved with psbA-trnH, psbK-psbI, psbM-trnD, matK, rps16, rbcL and ITS. The re-gions of atpF-atpH, rpoB and rpoC1 were relatively difficult toamplify for the ginsengs. Furthermore, amplification of nadl wasparticularly difficult; it had a PCR success rate of 72.6%. This ratewas enhanced by adding the specific internal primers and ampli-fying two fragments instead of one. Sequencing the region ofatpF-atpH failed due to several poly-N stretches. The relativelylow success rates of sequencing rpoB and rpoC1 were caused byunspecific or weak amplification in several samples.Significant differences in sequence variability were observedamong the ten candidate loci we were able to examine (l" Ta-

Fig. 1 A neighbor-joining tree showing the phylogenetic relationship ofeight species in Panax based on the combination dataset of ITS, nad1, matK,psbA-trnH, psbK-psbI, psbM-trnD and rps16.

Fig. 2 Network relationship among the clusters(lineages) within Panax bipinnatifidus species group.The network was constructed using the Neighbor-netmethod implemented in the program Splitstree.The white smoke ones represent populations ofeastern edges of the Tibetan Plateau. The light-grayones are samples from the Hengduan Mountains.The gray ones are populations from Central Chinaaround the Qinling-Dabashan Mountains. The whiteones diverged earlier and represent south Asianpopulations.

Table 4 Barcoding power of the single locus of > 10 variable sites in Panaxusing the NJ method. Total number of species 8. The Panax bipinnatifidus spe-cies group was regarded as a single species at species level.

Locus Species level Species level

with BS ≥ 70

Within Panax

bipinnatifidus

species group

matK 4 (50.0%) 4 (50.0%) 2 (10.51%)

psbA-trnH 4 (50.0%) 4 (50.0%) 8 (42.11%)

psbK-psbI 6 (75.0%) 3 (37.5%) 3 (15.79%)

psbM-trnD 6 (75.0%) 5 (62.5%) 4 (21.05%)

rps16 4 (50.0%) 3 (37.5%) 5 (26.32%)

nad1 5 (62.5%) 3 (37.5%) 1 (5.26%)

ITS 7 (87.5%) 7 (87.5%) 16 (84.21%)

185Original Papers

ble 3). ITS exhibited the highest sequence variability with thehighest value of nucleotide diversity (Pi). Among the eightchloroplast loci, psbA-trnH was the most variable locus, fol-lowed by psbK-psbI, rps16, psbM-trnD, and matK (in descend-ing order of Pi). rbcL, rpoB and rpoC1 were the least variableloci, having four to eight variable sites. The mitochondrialnad1 had 23 variable sites but its Pi value was the smallest.The identification power of the seven loci with more than eightvariable sites was tested using eight well-divergent species and19 clusters within the P. bipinnatifidus species group. A phyloge-netic tree (l" Fig. 1) and a network (l" Fig. 2), based on the com-bined dataset, were constructed as a reference framework. The

results (l" Table 4) showed that the ITS region identified sevenof the eight species. Both psbK-psbI and psbM-trnD distinguishedsix species, but only three or five of these were supported if acondition of bootstrap value > 70% was imposed on the branchesof the neighbor-joining trees [21]. Within the P. bipinnatifidusspecies group, ITS distinguished sixteen of the species and psbA-trnH identified eight.Three tree-building methods and one direct sequence compari-son method were assessed to test their identification powerswithin the P. bipinnatifidus species group. The neighbor-joining(NJ), unweighted pair group method with arithmetic mean (UP-GMA) and Neighbornet methods coincided very well when single


Fig. 3 Comparisons of the identification power ofcandidate barcoding loci for the Panax bipinnatifidusspecies group based on different clustering meth-ods. A Single locus; B combined data set of thetwo most variable loci; C sequential addition of thechloroplast loci from high to low identificationpowers.

186 Original Papers

locus was considered (l" Fig. 3A). Minor differences were ob-served among the three methods when combined data were an-alyzed. The Neighbornet showed the highest power for resolvingthe clusters of P. bipinnatifidus species group (l" Figs. 3B,C). Tax-onDNA, a direct sequence comparison approach, is the least sen-sitive method with both the single locus data and the combineddata (l" Figs. 3B,C).

Discussion!

DNA barcoding, still a relatively new technique, is well on its wayto being accepted as a global standard for the purpose of speciesidentification. However, a great deal of effort is still needed be-fore DNA barcoding of plants can be considered sufficiently reli-able for widespread practical application. Above all, a consensuson the strategy for barcode development should be reached assoon as possible.The suitability of single standard barcodes for use in all plantsshould be established by examining pooled data from the exist-ing species-level case studies. It is important that both well-di-vergent and not so well-divergent species are taken into account.Screening of the candidate barcodes should be done over a widerange of plants, new promising barcodes proposed and analyzed,and a summary of their suitability presented to the scientificcommunity. It has to be kept in mind that DNA barcoding is likelyto fail when only a subset of species in a genus is considered, evenif this is done just for a specific purpose such as medicinal plantsidentification.The identification of medicinal species such as ginsengs (Panax)is of considerable practical importance. Panax genus seems to bean ideal plant group to test the feasibility of DNA barcoding andto single out many of the problems the plant DNA barcodes de-velopment may face in the near future. The genus has both thewell-divergent species among which the phylogenetic relation-ships have been firmly established as a reference system, andpoorly resolvable clusters within which new species might bediscovered. Using this genus as a model, the validity of the bar-coding methods and resolution of candidate barcoding loci canbe assessed comprehensively.


The small number of well-divergent species in Panax makes iteasier to test the universality of primers and the discriminatorypower of candidate barcodes. Although rbcL and matK have beenrecommended as the plant barcodes by the CBOL Plant WorkingGroup [22], we find that rbcL, as well as rpoB and rpoC1, show lit-tle variability in Panax (l" Table 3). These loci need to be eval-uated using well-sampled groups of both remotely and closely re-lated species. While assessing the candidate loci for their adop-tion as barcodes, we have to be aware that the conclusions drawnfrom the screening of sparsely sampled and remotely relatedspecies could be very misleading. For example, it was concludeda long time ago that rbcL is of very limited value below the familylevel [23]. In this study, we find that rbcL is the least variable lo-cus among the suggested chloroplast regions.The non-coding spacers in the chloroplast genome, such as psbA-trnH, psbK-psbI and psbM-trnD, provide more information andare usually more powerful in species identification than codingregions. However, the discriminatory power of many markersvaries for different taxonomic categories. For instance, the mostvariable locus, psbA-trnH, works well within the P. bipinnatifidusspecies group but not as well as less variable psbK-psbI and psbM-trnD at the well-divergent species level in Panax (l" Table 4). Thiskind of selective applicability of loci suggests that the universal-ity of DNA barcodes should not be assumed to be valid for alltaxonomic levels. Looking for a universal barcode at the familylevel could be a practical strategy to follow; however, each familyalso can have its own barcode assigned [24].Because of the selective applicability of loci at various taxonomicranks, the resolution can be increased by using combinations ofbarcoding loci suitable for the same taxonomic rank. For exam-ple, the combination of psbM-trnD and psbK-psbI has the best dis-criminatory power at the species level, and the combination ofITS and psbA-trnH achieves the highest cluster resolution. How-ever, a combination of loci of different suitability will not neces-sarily improve their discriminatory power.The promise that DNA barcoding holds for the future of taxono-my can be fulfilled, provided that the groups under examinationare thoroughly sampled and taxonomically well understood [25].The technique has been applied successfully in many organisms,tree peonies being one example [24]. Some problems have beenencountered in the barcoding of wild potatoes, primarily due to

187Original Papers

the complexity of their biological behavior, both at organism andgenome levels, such as polyploidization, a possible recent speciesdivergence, etc. [26]. Similar biological complexities, leading tocontroversial species boundaries, have also been observed inPanax. The rapid evolutionary radiations of the P. bipinnatifidusspecies group have resulted in polytomies of the gene trees [8].Under such circumstances, obtaining a clear and reliable taxo-nomic circumscription of half-formed species is unlikely,although such species are sometimes morphologically recogniz-able. If the half-formed species are spatially structured, the geo-graphical and ecological information could be taken into consid-eration. More powerful clustering methods, such as Neighbornetimplemented in Splitstree, should be used for grouping the pop-ulations into lineages. DNA barcoding is thus applicable in thissituation. In this study, 33 populations were grouped into nine-teen clusters, using the combined dataset (l" Fig. 2). Differentclusters occupy isolated geographical territories and differslightly in morphology. Eight clusters are identifiable using themost variable chloroplast locus psbA-trnH, and sixteen are distin-guishable by ITS. All clusters can be distinguished by using thecombination of psbA-trnH and ITS data (l" Fig. 3). In other words,DNA barcoding of non-well-divergent “species” is possible if thebarcoding technique is made sufficiently sensitive by using anappropriate approach.The quality of a particular herbal medicine depends not only onthe species, but also on the provenance of such species and theparts of the plant chosen for medicinal purposes [27]. With theadvent of DNA barcoding, the identification of the genuine me-dicinal plants of high quality, with known provenance, is morelikely to be achieved. Finally, the expensive imitations with infe-rior medicinal properties could be eliminated from the herbalmedicine markets.

Acknowledgements!

We thank Lei Xie and the anonymous reviewers for their criticalcomments on the manuscript. This study was partially supportedby the following grants: 2007CB411602, KSCX2-YW-N-0807,NSFC 30370154, 2005DKA21401, National Bioresource Project IIof the Japanese Ministry of Education, Culture, Sports, Scienceand Technology, and the John D. and Catherine T. MacArthurFoundation.

Affiliations1 State Key Laboratory of Systematic and Evolutionary Botany,Institute of Botany, the Chinese Academy of Sciences, Beijing, P.R. China

2 Wenshan Institute of Sanqi Research, Wenshan, Yunnan, P.R. China3 Graduate School of the Chinese Academy of Sciences, Beijing, P.R. China4 Laboratory of Plant Genetics and Breeding Science,Department of Agriculture, Tokyo University of Agriculture, Atsugi City, Japan

5 Biological Institute, Fundamental Education and Research Centerof Pharmaceutical Sciences, Showa Pharmaceutical University, Tokyo, Japan

6 Department of Botany, United States National Herbarium, National Museumof Natural History, MRC-166, Smithsonian Institution, Washington, DC, USA

References1 Sucher NJ, Carles MC. Genome-based approaches to the authenticationof medicinal plants. Planta Med 2008; 74: 603–623

2 Koren OG, Potenko VV, Zhuravlev YN. Inheritance and variation of allo-zymes in Panax ginseng C.A. Meyer (Araliaceae). Int J Plant Sci 2003;164: 189–195

3 Cruse-Sanders JM, Hamrick JL. Genetic diversity in harvested and pro-tected populations of wild American ginseng, Panax quinquefolius L.(Araliaceae). Am J Bot 2004; 91: 540–548

4 Chan TWD, But PPH, Cheng SW, Kwok IMY, Lau FW, Xu HX. Differentia-tion and authentication of Panax ginseng, Panax quinquefolius and gin-seng products by the use of HPLC/MS. Anal Chem 2000; 72: 1281–1287

5 Ngan F, Shaw P, But P, Wang J. Molecular authentication of Panax spe-cies. Phytochemistry 1999; 50: 787–791

6 Hon CC, Chow YC, Zeng FY, Leung FCC. Genetic authentication of ginsengand other traditional Chinese medicine. Acta Pharmacol Sin 2003; 24:841–846

7 Wen J. Species diversity, nomenclature, phylogeny, biogeography, andclassification of the ginseng genus (Panax L., Araliaceae). In: Punja ZK,editor. Utilization of biotechnological, genetic and cultural approachesfor North American and Asian Ginseng improvement. Proceedings ofthe International GinsengWorkshop. Vancouver: Simon Fraser Univer-sity Press; 2001: 67–88

8 Wen J, Zimmer EA. Phylogeny and biogeography of Panax L (the ginsenggenus, Araliaceae): inferences from ITS sequences of nuclear ribosomalDNA. Mol Phylogenet Evol 1996; 6: 167–177

9 Zhu S, Fushimi H, Cai SQ, Komatsu K. Phylogenetic relationship in thegenus Panax: inferred from chloroplast trnK gene and nuclear 18SrRNA gene sequences. Planta Med 2003; 69: 647–653

10 Zhou SL, Xiong GM, Li ZY, Wen J. Loss of genetic diversity of domesti-cated Panax notoginseng F H Chen as evidenced by ITS sequence andAFLP polymorphism: a comparative studywith P. stipuleanatusH T Tsaiet K M Feng. J Integr Plant Biol 2005; 47: 107–115

11 Kress WJ, Erickson DL. A two-locus global DNA barcode for land plants:the coding rbcL gene complements the non-coding trnH-psbA spacerregion. PLoS One, advance online publication 6 June 2007; DOI:10.1371/journal.pone.0000508

12 Chase MW, Cowan RS, Hollingsworth PM, van den Berg C, Madriñán S,Petersen G, Seberg O, Jørgsensen T, Cameron KM, Carine M, Pedersen N,Hedderson TAJ, Conrad F, Salazar GA, Richardson JE, Hollingsworth ML,Barraclough TG, Kelly L, WilkinsonM. A proposal for a standardised pro-tocol to barcode all land plants. Taxon 2007; 56: 295–299

13 Lee HL, Yi DK, Kim JS, Kim KJ. Development of plant DNA barcodingmarkers from the variable noncoding regions of chloroplast genome.Second International Barcode of Life Conference, Taipei; 2007

14 Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. TheCLUSTAL_X windows interface: flexible strategies for multiple se-quence alignment aided by quality analysis tools. Nucleic Acids Res1997; 25: 4876–4882

15 Rambaut A. Se-Al sequences alignment editor (version 2.0a11). Avail-able at http://tree.bio.ed.ac.uk/software/seal/via the Internet. AccessedJuly 24, 2008

16 Librado P, Roza J. DnaSP v5: a software for comprehensive analysis ofDNA polymorphism data. Bioinformatics 2009; 25: 1451–1452

17 Kimura M. A simple method for estimating evolutionary rate of basesubstitutions through comparative studies of nucleotide sequences.J Mol Evol 1980; 16: 111–120

18 Hebert PDN, Cywinska A, Ball SL, deWaard JR. Biological identificationsthrough DNA barcodes. Proc R Soc Lond B Biol Sci 2003; 270: 313–322

19 Swofford DL. PAUP*: phylogenetic analysis using parsimony (*and othermethods), version 4.0 beta version. Massachusetts: Sinauer Associates;2003

20 Huson DH, Bryant D. Application of phylogenetic networks in evolu-tionary studies. Mol Biol Evol 2006; 23: 254–267

21 Fazekas AJ, Burgess KS, Kesanakurti PR, Graham SW, Newmaster SG,Husband BC, Percy DM, Hajibabaei M, Barrett SCH. Multiple multilocusDNA barcodes from the plastid genome discriminate plant speciesequally well. PLoS one, advance online publication 30 July 2008; DOI:10.1371/journal.pone.0002802

22 CBOL Plant Working Group. A DNA barcode for land plants. Proc NatlAcad Sci USA 2009; 106: 12794–12797

23 Zurawski G, Clegg MT. Rbcl sequence data and phylogenetic reconstruc-tion in seed plants – foreword. Ann Mo Bot Gard 1993; 80: 523–525

24 Zhang JM, Wang JX, Xia T, Zhou SL. DNA barcoding: species delimitationin tree peonies. Sci China Ser C 2009; 52: 568–578

25 Meyer CP, Paulay G. DNA barcoding: error rates based on comprehen-sive sampling. PLoS Biol 2005; 3: 2229–2238

26 Spooner DM. DNA barcoding will frequently fail in complicated groups:an example in wild potatoes. Am J Bot 2009; 96: 1177–1189

27 Li, TSC, Mazza G, Cottrell AC, Gao L. Ginsenosides in roots and leaves ofAmerican ginseng. J Agric Food Chem 1996; 44: 717–720


dna barcoding of panax species

Documents