diversity and distributions, (diversity distrib.) tracking...
TRANSCRIPT
![Page 1: Diversity and Distributions, (Diversity Distrib.) Tracking ...qub.ac.uk/bb-old/provan/pdf/2007g.pdf · Diversity and Distributions, (Diversity Distrib ... samples of the highly invasive](https://reader033.vdocuments.mx/reader033/viewer/2022051720/5a78ad827f8b9a1f128e942b/html5/thumbnails/1.jpg)
© 2007 The Authors DOI: 10.1111/j.1472-4642.2007.00420.xJournal compilation © 2007 Blackwell Publishing Ltd www.blackwellpublishing.com/ddi
1
Diversity and Distributions, (Diversity Distrib.)
(2007)
BIODIVERSITYRESEARCH
ABSTRACT
With the advent of ‘ancient DNA’ studies on preserved material of extant and extinctspecies, museums and herbaria now represent an important although still underutilizedresource in molecular ecology. The ability to obtain sequence data from archivedspecimens can reveal the recent history of cryptic species and introductions. We haveanalysed extant and herbarium samples of the highly invasive green alga
Codiumfragile
, many over 100 years old, to identify cryptic accessions of the invasive strainknown as
C. fragile
ssp.
tomentosoides
, which can be identified by a unique haplotype.Molecular characterization of specimens previously identified as native in variousregions shows that the invasive
tomentosoides
strain has been colonizing new habitatsacross the world for longer than records indicate, in some cases nearly 100 yearsbefore it was noticed. It can now be found in the ranges of all the other nativehaplotypes detected, several of which correspond to recognized subspecies. Withinregions in the southern hemisphere there was a greater diversity of haplotypesthan in the northern hemisphere, probably as a result of dispersal by the AntarcticCircumpolar Current. The findings of this study highlight the importance ofherbaria in preserving contemporaneous records of invasions as they occur,especially when invasive taxa are cryptic.
Keywords
Biological invasions, invasive species,
Codium fragile
, herbarium samples,
cryptic taxa.
INTRODUCTION
In an age when global travel has become an integral part of our
everyday lives, the spread of invasive species has become so
extensive that the ecological impacts of such invasions represent
a major threat to global biodiversity. The introduction of non-
native species can radically alter existing ecosystems and is now
ranked second only to habitat destruction in terms of potential
ecological catastrophe (Wilcove
et al
., 1998; Gurevitch & Padilla,
2004). Competitive exclusion of and/or hybridization with
native taxa can often result in an overall decrease in diversity and
seriously compromise the ability of the original population(s) to
adapt to new selective pressures, thus increasing the chance of
extinction (reviewed in Booth
et al
., 2007). Marine invasions
represent a particularly serious problem, with around 10
thousand species being transported daily in the ballast water of
ships across the globe (Carlton, 1999; Bax
et al
., 2001). In recent
years, there has been a series of high-profile cases of the spread of
invasive marine species including the green seaweed
Caulerpa
taxifolia
(Jousson
et al
., 2000) and invertebrates such as the
moon jellyfish
Aurelia
(Dawson
et al
., 2005), the tropical brittlestar
Ophiactis savignyi
(Roy & Sponer, 2002), and the Atlantic comb
jelly
Mnemiopsis leidyi
, which devastated the Black Sea and Azov
Sea anchovy industries (Shiganova
et al
., 2001).
Codium fragile
(Suringar) Hariot ssp.
tomentosoides
(van
Goor) Silva is a green alga that has spread rapidly throughout
the globe from its native range in Japan and the North Pacific
(Trowbridge, 1998, 2001) and is considered a significant ecosystem
engineer (Schmidt & Scheibling, 2007). Morphologically distinct
populations have been recognized in various parts of the world
and have sometimes been accorded subspecific status as ssp.
atlanticum
, ssp.
californicum
, ssp.
capense
, ssp.
novae-zelandiae
,
ssp.
scandinavicum
, and ssp.
tasmanicum
. To date, however, there
has been much debate concerning how many distinct subspecies
actually exist and which among these has invasive tendencies
(Goff
et al
., 1992; Trowbridge, 1998; González & Santelices,
School of Biological Sciences, The Queen’s
University of Belfast, 97 Lisburn Road,
Belfast BT9 7BL, Northern Ireland
*Correspondence: Dr Jim Provan, School of Biological Sciences, The Queen’s University of Belfast, 97 Lisburn Road, Belfast BT9 7BL, Northern Ireland. Tel.: +44 28 90972280; Fax: +44 28 90335877; E-mail: [email protected]
Blackwell Publishing Ltd
Tracking biological invasions in space and time: elucidating the invasive history of the green alga
Codium fragile
using old DNA
Jim Provan*, David Booth, Nicola P. Todd, Gemma E. Beatty and
Christine A. Maggs
![Page 2: Diversity and Distributions, (Diversity Distrib.) Tracking ...qub.ac.uk/bb-old/provan/pdf/2007g.pdf · Diversity and Distributions, (Diversity Distrib ... samples of the highly invasive](https://reader033.vdocuments.mx/reader033/viewer/2022051720/5a78ad827f8b9a1f128e942b/html5/thumbnails/2.jpg)
J. Provan
et al.
© 2007 The Authors
2
Diversity and Distributions
, Journal compilation © 2007 Blackwell Publishing Ltd
2004). Silva (1957) noted that there were morphological
intermediates between subspecies, and that the species could be
conceived as a complex assemblage of populations. Differentiation
between subspecies has traditionally been based on utricle
morphology, particularly the microstructure of terminal mucrons
at utricle apices (Silva, 1957; Fig. 1), but this does not provide
an unambiguous diagnostic character since intrasubspecific
variation in utricle morphology within a subspecies has been
correlated with ecological conditions in some cases (Trowbridge,
1996) and is observed even within individuals (Fig. 1). The invasive
nature of ssp.
tomentosoides
is without question and it is currently
recognized as one of the most invasive seaweeds (Nyberg &
Wallentinus, 2005). It was first recorded in Europe
c.
1900 in
Holland (Silva, 1955) and was reported as having reached the east
coast of North America just over 50 years later (Bouck & Morgan,
1957). More recently, it was recorded in Australasia in 1975
(Dromgoole, 1975), South Africa in 1999 (Begin & Scheibling,
2003), and South America in 2001 (González & Santelices, 2004).
Molecular genetic analysis of widely distributed populations of
ssp.
tomentosoides
has allowed a more detailed examination of its
invasive history and suggests that there were at least two major
episodes in the spread of the subspecies in Europe and the
North Atlantic, with separate introductions from Japan into the
Mediterranean and the Atlantic (Provan
et al
., 2005).
Molecular genetic approaches have provided novel insights
into the processes and mechanisms of algal invasions. Since
the spread of invasive species in the marine environment
frequently occurs on a global scale, it is not always possible to
track accurately the spread of these organisms and genetic
data have frequently highlighted the occurrence of cryptic
introductions within a species (Provan
et al
., 2005; Voisin
et al
., 2005; Uwai
et al
., 2006) as well as the occurrence of
cryptic taxa (McIvor
et al
., 2001; Andreakis
et al
., 2007).
One emerging feature of these studies is that repeated
introductions or introductions from genetically diverse source
populations can give rise to wide gene pools in the invasive
range of these species, rather than the presumed founder
effects generally associated with such introductions (e.g.
Voisin
et al
., 2005).
The establishment of polymerase chain reaction (PCR)-based
techniques in population genetic and phylogenetic analyses has
seen an increase in the use of museum and herbarium samples to
provide complementary information on the evolutionary history
of a wide range of animal and plant taxa (Pääbo, 1989; Soltis
et al
., 1992; Savolainen
et al
., 1995; Gugerli
et al
., 2005; Leonard
et al
., 2005). Despite the difficulties associated with working with
herbarium material such as degradation of DNA and the use of
inhibitory compounds as preservatives (Coradin & Giannasi, 1980),
several studies have successfully utilized preserved plant and
fungal samples to obtain information on historical levels of
genetic diversity or to clarify ambiguous taxonomic classification
(e.g. Maunder
et al
., 1999; De Castro & Menale, 2004; Inderbitzin
et al
., 2004). Algal herbarium material has less often been
investigated, however. The most significant studies to date, all
involving red algae, are the taxonomic clarification based on
ITS1 sequence of several members of the Gigartinaceae (Hughey
et al
., 2001, 2002) and the Ceramiales (Gabrielsen
et al
., 2003;
Skage
et al
., 2005), and the elucidation of the
rbcL-rbcS
spacer
sequence from a herbarium sample of
Porphyra lucasii
(Farr
et al
.,
2003).
In the present study, in order to assess any historical evidence
for invasive tendencies, we sequenced type material of all three
putative invasive subspecies (ssp.
tomentosoides
, ssp.
atlanticum
,
and ssp.
scandinavicum
). We also sequenced freshly collected
Figure 1 Scanning electron micrographs of a single individual of Codium fragile ssp. tomentosoides showing variation in morphological features reported to be ‘diagnostic’ of particular subspecies. (a) External view of a cylindrical branch, composed of a single giant cell with numerous utricles (swollen filament tips). (b) Section through tip reveals internal construction. Core of interwoven filaments is surrounded by utricles that vary in shape from constricted (arrow; diagnostic of this subspecies; Burrows, 1991) to cylindrical (arrowhead). (c) Utricle tips with prolonged points diagnostic of C. fragile ssp. tomentosoides. (d) Utricle tips with short points typical of C. fragile ssp. atlanticum. (e) Utricle tips without points resemble the European native species Codium tomentosum (Burrows, 1991). Material was collected in Ireland (Fanad, Donegal, January 2006), fixed and prepared using the protocol of Berger et al. (2003), and imaged with a FEI Quanta 200 Environmental SEM (FEI, Eindhoven, the Netherlands).
![Page 3: Diversity and Distributions, (Diversity Distrib.) Tracking ...qub.ac.uk/bb-old/provan/pdf/2007g.pdf · Diversity and Distributions, (Diversity Distrib ... samples of the highly invasive](https://reader033.vdocuments.mx/reader033/viewer/2022051720/5a78ad827f8b9a1f128e942b/html5/thumbnails/3.jpg)
Genetic analysis of
Codium fragile
herbarium samples
© 2007 The Authors
Diversity and Distributions
, Journal compilation © 2007 Blackwell Publishing Ltd
3
material from the geographical areas where each recognized
subspecies is found, i.e. South Africa (ssp.
capense
), northern
Europe (ssp.
atlanticum
), Norway (ssp.
scandinavicum
), New
Zealand (ssp.
novae-zelandiae
), Tasmania (ssp.
tasmanicum
),
and the north-east Pacific (ssp.
californicum
) as well as Mexico,
which has no recognized subspecies. We also analysed herbarium
samples of
Codium fragile
from throughout its range to obtain a
chronology of invasions, particularly to determine whether
cryptic invasions that pre-date their first recorded observations
may have taken place.
METHODS
Sampling and DNA isolation
Fresh material was collected from the regions indicated in Table 1
and preserved in silica gel. These samples were identified based
on morphology and geographical origin. For example, for
samples collected within Europe,
C. fragile
with long pointed
mucrons in at least part of the thallus (Fig. 1c) was identified as
ssp.
tomentosoides
. Thalli with shorter, blunt mucrons (Fig. 1d)
were attributed to ssp.
atlanticum
following Silva (1957). DNA
was extracted using the Qiagen DNeasy® Plant Mini Kit
(QIAGEN, West Sussex, UK) according to manufacturer’s instruc-
tions. Material was also obtained from museum herbarium
samples (see Table 3 for details). A 5–10 mm section was
removed from each sample and DNA extracted as described
above in a separate lab where no previous
Codium
work had
been carried out to guard against false positive results from DNA
contamination. Negative controls (with no target DNA) were
used routinely. DNA was quantified visually on 1% agarose gels
stained with ethidium bromide and subsequently diluted to a
concentration of 50 ng/mL.
PCR amplification and sequencing
The marker analysed in this study was the
rpl
16-
rps
3 region of
the plastid genome amplified using the universal primers of
Provan
et al
. (2004). For herbarium samples, since the entire
c.
450 bp product could not be amplified consistently in a single
reaction using degraded DNA as a template, three overlapping
pairs of primers were designed to amplify the first
c.
360 bp of the
region (Table 2; Fig. 2). PCR was carried out on a MWG Primus
thermal cycler using the following parameters: initial denaturation
at 94
°
C for 3 min followed by 35 cycles (40 cycles for herbarium
samples) of denaturation at 94
°
C for 1 min, annealing at
50
°
C for 1 min, extension at 72
°
C for 1 min, and a final
extension at 72
°
C for 5 min. PCR was carried out in a total
volume of 25
µ
L containing 100 ng genomic DNA, 20 pmol of
forward primer, 20 pmol of reverse primer, 1
×
PCR buffer
(5 m
Tris-HCl [pH 9.1], 1.6 m
[NH
4
]
2
SO
4
, 15
µ
g/mL BSA),
200
µ
dNTPs, 2.5 m
MgCl
2
and 1.0 U
Taq
polymerase
(Genetix, Hampshire, UK). Ten microlitre PCR product was
resolved on 2% agarose gels, visualized by ethidium bromide
staining, and the remaining 15
µ
L was sequenced commercially
(Macrogen, Seoul, South Korea). Sequences were concatenated
Table 1 Extant Codium fragile samples sequenced for the rpl16-rps3 region of the plastid genome in this study, listed by subspecies if definite morphological identification was possible, otherwise by geographical area. Note that three samples were analysed from Muizenberg, South Africa, giving a total number of samples N = 19.
Subspecies or geographical area Source Collector and date Sample code
ssp. atlanticum (A.D. Cotton)
P.C. Silva
Ballintoy, Co. Antrim, Ireland C. A. Maggs (8 Aug 2004) CAT/BT/01
Dooey, Co. Donegal, Ireland J. Kelly (7 Sep 2004) CAT/DD/01
ssp. tomentosoides Van Goor Sagami Bay, Honshu, Japan C. D. Trowbridge (1 Dec 2002) CF/SB/01
Wrightsville Beach, North Carolina, USA C. A. Maggs (13 Apr 2002) CF/NC/01
Fanad, Co. Donegal, Ireland C. A. Maggs (28 Apr 2002) CF/DO/01
Broad Haven, Pembrokeshire, Wales C. A. Maggs (26 Apr 2002) CF/BH/01
Lake Grevelingen, Bruinisse, the Netherlands H. Stegenga (9 May 2002) CF/NL2/01
Vidiago, Asturias, Spain J. Rico (15 Jul 2003) CF/VD1/01
Thau Lagoon, France M. Verlaque (6 Jun 2002) CF/TL1/01
Izola Bay, Slovenia C. Batelli (4 Dec 2002) CF/SL/01
Caldera Bay, Chile J. Correa (25 Sep 2003) CF/CH/01
Northeast Pacific Seal Rock, Oregon, USA C. D. Trowbridge (29 Mar 2000) CF/SR/01
South Africa Muizenberg, Cape Province,
South Africa (3 samples)
R. Anderson (13 Feb 2006)
New Zealand Frank Kitts Lagoon, Wellington,
New Zealand
W. Nelson (22 Oct 2003) GenBank
EF107887
Tasmania Low Head Reserve, Bass Strait,
Tasmania, Australia
E. McQualter (19 Sep 2005) McQualter
#2078
Mexico Punta Eugenia, Baja California, Mexico R. Riosmena-Rodriguez (21 Aug 2004) DB2018
Scandinavia Trondheim, Norway S. Bruns (Jun 2004) CF/NW/01
![Page 4: Diversity and Distributions, (Diversity Distrib.) Tracking ...qub.ac.uk/bb-old/provan/pdf/2007g.pdf · Diversity and Distributions, (Diversity Distrib ... samples of the highly invasive](https://reader033.vdocuments.mx/reader033/viewer/2022051720/5a78ad827f8b9a1f128e942b/html5/thumbnails/4.jpg)
J. Provan
et al.
© 2007 The Authors
4
Diversity and Distributions
, Journal compilation © 2007 Blackwell Publishing Ltd
and aligned using the
program in the
software package. All unique sequences were confirmed by
re-extraction and re-amplification. Representative samples
(around 20%, largely randomly chosen but including all putative
subspecies) were also amplified in two separate laboratories
including one where no previous
Codium
work had been carried
out and sequenced.
Phylogenetic analysis
After the removal of length-polymorphisms at two hypervariable
microsatellite regions (positions 223–230 and 232–249;
Fig. 2), the alignment was used to reconstruct the evolutionary
relationships between sequences using the maximum parsi-
mony method implemented in the
* software package
(Swofford, 2002). Heuristic searches were performed with 1000
random-addition replicates and tree-bisection-reconnection
(TBR) branch swapping. The closely related species
Codium
tomentosum
and
C. decorticatum
(Verbruggen
et al
., 2007) were
used as outgroups.
RESULTS
Codium fragile
: invasive and native (or non-invasive) haplotypes
The complete results of the molecular identification of
herbarium samples and extant material are shown in Tables 3
and 4. In the alignment of all sequences, a total of five sub-
stitutions was found in the
c.
360 bp
rpl
16-
rps
3 region
sequenced. The utility and robustness of this region of the
plastid genome in delineating taxonomic boundaries within
the genus
Codium
has previously been demonstrated (Verbruggen
et al
., 2007). Length polymorphisms at two microsatellite
repeats (positions 223–230 [(A)
5–8
] and 232–249 [(TA)
7–9
];
Fig. 2) were subsequently removed from the analysis since the
high mutation rates associated with microsatellites can
obscure phylogenetic relationships as evidenced by the absence
of any general correlation between repeat lengths and
taxonomy/geography within our samples. Combining the data
from the five substitutions provided 10 haplotypes (Table 4;
Fig. 3). Multiple sequenced individuals of ssp.
atlanticum and
ssp. tomentosoides displayed no intrasubspecific variation but
had distinct haplotypes. Only herbarium material was
available for ssp. scandinavicum but both samples tested,
including the holotype, were identical to ssp. tomentosoides,
as was a fresh sample of C. fragile from Norway. Two further
haplotypes were associated with groups of herbarium spec-
imens but not found in extant samples. One of these (South
Africa [2]) was found in samples NHM54, NHM55, and
NHM56 (all originally identified as ssp. capense) as well as a
further sample from South Africa identified as C. tomentosum
and sample NHM61 from Cape Horn, South America. This
suggests that material previously attributed to ssp. capense
includes several haplotypes. Similarly, a haplotype shared by
Table 2 Primers used to amplify the rpl16-rps3 region of the plastid genome from Codium fragile herbarium samples.
Primer Sequence
Expected
product (bp)
UCP61F CCMGAHCCCATHCGDGTTTC 155
UCP61R GCCTTTGGTAATTTTGCATT
UCP62F AATGCAAAATTACCAAAGGC 104
UCP62R CTCATGCTCCAACCAAAA
UCP63F TTTTTTGGTTGGAGCATGAG 152
UCP63R TATTGATTATTGTTGTCGAACA
Figure 2 rpl16-rps3 region amplified by the three pairs of primers given in Table 2. Primer annealing sites are shown in bold. Microsatellite repeat regions are shown in italics. Not shown – primer binding region for UCP61F, which was trimmed from the final alignment.
![Page 5: Diversity and Distributions, (Diversity Distrib.) Tracking ...qub.ac.uk/bb-old/provan/pdf/2007g.pdf · Diversity and Distributions, (Diversity Distrib ... samples of the highly invasive](https://reader033.vdocuments.mx/reader033/viewer/2022051720/5a78ad827f8b9a1f128e942b/html5/thumbnails/5.jpg)
Genetic analysis of Codium fragile herbarium samples
© 2007 The AuthorsDiversity and Distributions, Journal compilation © 2007 Blackwell Publishing Ltd 5
Table 3 Codium fragile herbarium samples analysed in this study*. Subspecies atlanticum and tomentosoides samples are grouped by region (Europe, North America, South Africa, Pacific), by countries within regions, then by date of collection.
Haplotype† Code‡ Source Collector Year Original identification
ssp. atlanticum NHM16 Swanage, England E Batters 1894 ssp. atlanticum
UMF83 Malin Head, Ireland JA Mahoney 1863 ssp. atlanticum
NHM17 Larne, Northern Ireland CA Johnson 1865 ssp. atlanticum
NHM100 Clare Island, Ireland AD Cotton 1911 ssp. atlanticum (type)
UMF3047 Sandeel Bay, Co. Down, Ireland O Morton 1972 ssp. atlanticum
NHM60 Cape of Good Hope, South Africa Brand 1774 C. fragile
ssp. tomentosoides NHM21 Ronaldsay, Orkney, Scotland TS Traill 1891 ssp. atlanticum
NHM31 Loch Druidibeg, South Uist, Scotland R Watling 1967 ssp. tomentosoides
NHM19 Bressay, Shetland, Scotland I Tittley 1973 ssp. atlanticum
NHM20 Tyninghame, Firth of Forth, Scotland I Tittley 1981 ssp. atlanticum
NHM27 Ilfracombe, Devon, England Mrs Griffiths 1853 C. tomentosum
NHM16 Swanage, England E Batters 1894 ssp. atlanticum
NHM18 Bantham, Devon, England MA Wilson 1952 ssp. atlanticum
NHM26 Kimmeridge, Dorset, England CI Dickinson 1954 ssp. tomentosoides
NHM13 Dorset, England JFM Cannon 1960 ssp. atlanticum
NHM33 Lulworth Cove, Dorset, England Miss Embrey 1964 ssp. tomentosoides
NHM34 Bembridge, Isle of Wight, England LF Bowden 1966 ssp. tomentosoides
NHM35 Pagham Harbour, Sussex, England I Tittley 1967 ssp. tomentosoides
NHM36 Rottingdean, Sussex, England I Tittley 1967 ssp. tomentosoides
NHM32 Portscatho, Cornwall, England CEL Hepton 1978 ssp. tomentosoides
UMF79 Tory Island, Co. Donegal, Ireland GG Hyndman 1845 ssp. atlanticum
NHM17 Larne, Northern Ireland CA Johnson 1865 ssp. atlanticum
UMF82 Downings Bay, Ireland JA Mahoney 1886 ssp. atlanticum
UMF87 Portrush, Co. Antrim, Ireland S Wear 1915 ssp. atlanticum
UMF90 Carnalea, Co. Down, Ireland MPH Kertland 1946 ssp. atlanticum
NHM29 Lamb’s Head, Co. Kerry, Ireland AHG Alston 1952 ssp. tomentosoides
NHM28 Co. Galway, Ireland PR Bell 1965 ssp. tomentosoides
UMF3038 Co. Cork, Ireland O Morton 1967 ssp. tomentosoides
UMF3039 Fanore, Co. Clare, Ireland O Morton 1969 ssp. tomentosoides
UMF85 Co. Kerry, Ireland O Morton 1972 ssp. atlanticum
NHM30 The Dorn, Strangford, Co. Down, Ireland O Morton 1976 ssp. tomentosoides
NHM25 St Malo, France JA Monk 1970 ssp. atlanticum
NHM40 Cherbourg Peninsula, HerQuelmoulin, France LM Irvine 1980 ssp. tomentosoides
SFX1 Santec, Brittany, France J Cabioch & D Garbary 1990 ssp. atlanticum
AH Den Helder, Netherlands TJ Stamps 1909 ssp. tomentosoides (neotype)
NHM1 Sas van Goes, Zeeland, Netherlands H Stegenga 1975 C. fragile
NHM39 Zuid Beveland, Oosterschelde, Netherlands I Tittley 1980 ssp. tomentosoides
NHM42 Zuid Beveland, Zeeland, Netherlands P van Reine 1980 ssp. tomentosoides
UC1 Hirsholmene, Denmark S Lund 1940 ssp. scandinavicum
UC2 Hirsholmene, Denmark S Lund 1940 ssp. scandinavicum (type)
NHM38 Nyssum Bredning, Denmark I Tittley, John & Johnson 1985 ssp. tomentosoides
NHM41 Sylt, Germany I Tittley 1978 ssp. tomentosoides
NHM6 Cadaques, Northeast Spain KM Drew 1954 C. fragile
NHM22 Flores, Azores I Tittley & A Neto 1994 ssp. atlanticum
NHM23 Santa Cruz, Azores I Tittley & A Neto 1995 ssp. atlanticum
NHM24 Santa Cruz, Azores I Tittley & A Neto 1995 ssp. atlanticum
SFX3 Prince Edward Island, Canada D Garbary 1999 ssp. atlanticum
SFX5 Blue Rocks, Nova Scotia, Canada D Garbary 1999 C. fragile
SFX2 Prince Edward Island, Canada D Garbary 2001 ssp. atlanticum
NHM43 Melkbosch, South Africa GF Papenfuss 1937 ssp. capense (type)
NHM7 Enoshima, Japan K Okamura Pre-1901 C. fragile
NHM8 Nagasaki, Japan J Matsumura Pre-1910 C. fragile
NHM53 Enoshima, Japan J Matsumara 1910 ssp. tomentosoides
NHM2 Mikuni, North Japan VM Grubb 1927 C. fragile
![Page 6: Diversity and Distributions, (Diversity Distrib.) Tracking ...qub.ac.uk/bb-old/provan/pdf/2007g.pdf · Diversity and Distributions, (Diversity Distrib ... samples of the highly invasive](https://reader033.vdocuments.mx/reader033/viewer/2022051720/5a78ad827f8b9a1f128e942b/html5/thumbnails/6.jpg)
J. Provan et al.
© 2007 The Authors6 Diversity and Distributions, Journal compilation © 2007 Blackwell Publishing Ltd
ssp. tomentosoides NHM4 Kanagawa Reef, Honshu, Japan J Tanaka 1985 C. fragile
NHM3 St Helen’s Point, Tasmania, Australia EL Rice 1985 C. fragile
NHM37 West Lakes, Adelaide, Australia Womersley & Chinnock 2002 ssp. tomentosoides
NHM46 Stewart Island, New Zealand LM Jones 1935 ssp. novae-zelandiae
Northeast Pacific NHM51 Bird Rock, California, USA D Kapraun 1980 C. fragile
SFX4 Neah Bay, Washington, USA RF Scagel 1955 C. fragile
SFX9 Iceberg point, Washington State, USA CB Hubbard 2000 ssp. californicum
South Africa [1] NHM44 Olifantbosch, South Africa YM Chamberlain 1956 ssp. capense
South Africa [2] NHM54 Strandfontein, South Africa GF Papenfuss 1936 ssp. capense
NHM55 Langebaan, South Africa GF Papenfuss 1938 ssp. capense
NHM56 Kommetje, South Africa F Simons 1956 ssp. capense
NHM59 Cape of Good Hope, South Africa Dickie 1884 C. tomentosum
NHM61 Cape Horn, South America Unknown 1842 C. fragile
New Zealand [1] NHM45 Falkland Islands, South Atlantic Unknown 1910 ssp. novae-zelandiae
New Zealand [2] NHM50 Falkland Islands, South Atlantic RW Rudmose-Brown 1849 ssp. novae-zelandiae
NHM57 St James, Cape Town, South Africa Graves 1956 ssp. capense
NHM58 Bay of Islands, New Zealand Unknown 1841 ssp. novae-zelandiae
Tasmania NHM47 Cape Grim, Australia F Perrin 1949 ssp. tasmanicum
NHM52 Port Phillip Heads, Melbourne, Australia J Bracebridge-Wilson 1890 C. fragile
NHM62 Falkland Islands, South Atlantic Unknown 1910 ssp. tasmanicum
UMF4122 Tasmania, Australia Unknown 1963 ssp. tasmanicum
China NHM5 Pei-tai-ho, North China VM Grubb 1926 C. fragile
*Entries in bold represent misidentified samples which pre-date the first records of ssp. tomentosoides in that region (See also Fig. 3).
†We use the subspecies name for haplotypes where we have sequenced type material, otherwise haplotypes are named for the region corresponding
to the original subspecific designation of the majority of the specimens exhibiting that particular haplotype (e.g. New Zealand for samples originally
identified as ssp. novae-zelandiae).
‡NHM, Natural History Museum Herbarium; UM, Ulster Museum Herbarium, Belfast; UC, University of California Herbarium, Berkeley; SFX, St
Francis Xavier University, Nova Scotia; AH, Amsterdam Herbarium. NHM numbers are our own, as NHM specimens are generally not numbered.
Haplotype† Code‡ Source Collector Year Original identification
Table 3 continued
samples NHM50 and NHM 58 (both originally identified as
ssp. novae-zelandiae) and sample NHM57 (originally ssp.
capense) probably represents a second New Zealand haplotype.
Two unassigned samples from Australia (NHM 52 and
UMF4122) and sample NHM62 from the Falkland Islands
exhibited the Tasmania haplotype. Finally, an extant sample
from Mexico displayed a unique haplotype, as did a herbarium
sample from China (NHM5).
Haplotype /
subspecies
Nucleotide
NE NH
GenBank
accession number50 104 134 164 228
ssp. atlanticum T T T G A 2 6 EU045559
ssp. tomentosoides G C C A T 9 53 EU045560
ssp. scandinavicum G C C A T 0 0 EU045560
Northeast Pacific T C C A A 1 3 EU045561
South Africa [1] T C T G A 3 1 EU045562
South Africa [2] T T C A A 0 5 EU045563
New Zealand [1] T C C G A 1 1 EU045564
New Zealand [2] T T C G A 0 3 EU045565
Tasmania T C C G T 1 4 EU045566
Mexico T C C A T 1 0 EU045567
China G C C G A 0 1 EU045568
NE, number of extant samples sequenced; NH, number of herbarium samples sequenced.
Table 4 Haplotypes detected in Codium fragile samples with identifications.
![Page 7: Diversity and Distributions, (Diversity Distrib.) Tracking ...qub.ac.uk/bb-old/provan/pdf/2007g.pdf · Diversity and Distributions, (Diversity Distrib ... samples of the highly invasive](https://reader033.vdocuments.mx/reader033/viewer/2022051720/5a78ad827f8b9a1f128e942b/html5/thumbnails/7.jpg)
Genetic analysis of Codium fragile herbarium samples
© 2007 The AuthorsDiversity and Distributions, Journal compilation © 2007 Blackwell Publishing Ltd 7
Figure 3 Parsimony tree showing relationships between haplotypes representing extant (bold) and herbarium samples.
![Page 8: Diversity and Distributions, (Diversity Distrib.) Tracking ...qub.ac.uk/bb-old/provan/pdf/2007g.pdf · Diversity and Distributions, (Diversity Distrib ... samples of the highly invasive](https://reader033.vdocuments.mx/reader033/viewer/2022051720/5a78ad827f8b9a1f128e942b/html5/thumbnails/8.jpg)
J. Provan et al.
© 2007 The Authors8 Diversity and Distributions, Journal compilation © 2007 Blackwell Publishing Ltd
Invasive history of C. fragile ssp. tomentosoides based on herbarium samples
Sixteen of the 21 samples described as C. fragile ssp. atlanticum
were actually the invasive tomentosoides strain that had been
misidentified (Table 3). Likewise, one of the six specimens
identified as ssp. capense (the type specimen) and one of the four
ssp. novae-zelandiae samples were also the tomentosoides strain.
In all cases, the cryptic tomentosoides accessions identified by
sequencing the rpl16-rps3 region pre-date the first record of the
invasive haplotype in the ranges of the native subspecies (Fig. 4).
Of the northern hemisphere unknown samples, the majority
were tomentosoides with the exception of the three of the four
North American samples (NHM51, SFX4, SFX9) which displayed
the north-east Pacific haplotype (Table 3). Sample NHM3 from
Australia, originally identified simply as C. fragile, was also
tomentosoides. All herbarium samples designated as ssp. tomen-
tosoides were correctly identified (Table 3).
DISCUSSION
One of the key issues in tracking the spread of invasive species is
the accurate identification of cryptic taxa. Recent molecular
genetic studies on a range of marine organisms have revealed
many cryptic introductions within species, e.g. in the crustacean
genera Carcinus (Geller et al., 1997) and Limnomysis and Paramysis
(Audzijonyte et al., 2006), the ascidian Clavelina lepadiformis
(Turon et al., 2003), the gastropod Ocinebrellus inornatus (Martel
et al., 2004), and the seaweed Undaria pinnatifida (Voisin et al.,
2005). They have also demonstrated the existence of previously
unidentified cryptic sibling species or subspecies, e.g. in the red
seaweeds Polysiphonia harveyi (McIvor et al., 2001) and Asparagopsis
spp. (Andreakis et al., 2007), the fish Atherinomorous lacunosus
(Bucciarelli et al., 2002), and the jellyfish genera Cassiopea
(Holland et al., 2004) and Aurelia (Dawson et al., 2005). The
broad picture emerging from such studies is that the numbers of
species or taxonomic units involved in bioinvasions have been
underestimated, a crucial factor when identifying putative
management units for potential control or remediation.
There has been much debate surrounding subspecific status
within Codium fragile, both in terms of numbers of possible
subspecies and their invasive tendencies. In his report on ssp.
scandinavicum, Silva (1957) highlighted the ‘great complexity of
the variation pattern encountered’ in mucronate Codium species.
We can now extend this perceptive comment to genetic data.
We have likewise found assemblages that are genetically homo-
geneous, i.e. composed of a single haplotype, particularly in the
northern hemisphere, and others that are heterogeneous,
Figure 4 ‘Timelines’ showing where earliest record of ssp. tomentosoides in various regions (left of scale) was predated by earliest herbarium sample identified as ssp. tomentosoides in that region (right of scale). N/A – no herbarium material predating initial record of introduction analysed.
![Page 9: Diversity and Distributions, (Diversity Distrib.) Tracking ...qub.ac.uk/bb-old/provan/pdf/2007g.pdf · Diversity and Distributions, (Diversity Distrib ... samples of the highly invasive](https://reader033.vdocuments.mx/reader033/viewer/2022051720/5a78ad827f8b9a1f128e942b/html5/thumbnails/9.jpg)
Genetic analysis of Codium fragile herbarium samples
© 2007 The AuthorsDiversity and Distributions, Journal compilation © 2007 Blackwell Publishing Ltd 9
especially in South Africa. Consequently, we use the subspecies
name for haplotypes where we have sequenced type material
(ssp. atlanticum and ssp. tomentosoides), otherwise haplotypes
are named for the region corresponding to the original subspecific
designation of the majority of the specimens exhibiting that
particular haplotype (e.g. New Zealand for samples originally
identified as ssp. novae-zelandiae).
A comparison of haplotype distribution in the northern and
southern hemispheres suggests a higher degree of endemism in
the northern hemisphere. The five ssp. atlanticum samples
identified were restricted to the British Isles, with both putative
samples of ssp. atlanticum from Prince Edward Island, Canada
(Hubbard & Garbary, 2002), being misidentified ssp. tomentosoides.
Likewise, the three native samples from the Pacific coast of North
America shared a single haplotype. The southern hemisphere
haplotypes, on the other hand, exhibited a wider geographical
distribution: one New Zealand haplotype was found in the
Falkland Islands, South Atlantic (sample NHM45, identified
morphologically by Paul Silva as ssp. novae-zelandiae) while the
other was associated with a South African sample (NHM57).
Similarly, one of the South African haplotypes was found in a
sample from Cape Horn, South America, which had not been
assigned to a particular subspecies. The Tasmania haplotype was
also recovered from an unassigned sample from the Falkland
Islands (NHM 62). This distribution is consistent with the
circulation patterns associated with the Antarctic Circumpolar
Current, which connects the three major ocean basins (Atlantic,
Pacific, and Indian) of the southern hemisphere (Stramma &
England, 1999), and reflects patterns observed in both invertebrates
(Zinsmeister & Feldman, 1984) and other seaweeds (Hommersand,
1986).
The results from both this study and a previous study into the
invasive history of ssp. tomentosoides (Provan et al., 2005) suggest
that ssp. tomentosoides is the only invasive form among the
recognized subspecies of C. fragile and shows very little genetic
variation. This invasive strain has previously been referred to as
C. fragile ssp. tomentosoides, and includes the type of this subspecies.
The correct nomenclature, however, following the International
Code for Botanical Nomenclature (Greuter et al., 2000) is
Codium fragile ssp. fragile. To avoid confusion and because the
name ssp. tomentosoides has been widely used, we here refer to
this is the invasive tomentosoides strain of C. fragile. Trowbridge
(1998) listed subspecies atlanticum and scandinavicum as invasive
taxa but, to date, all samples analysed from Scandinavia were
identified as the tomentosoides strain and we found no evidence of
ssp. atlanticum anywhere other than in the north-east Atlantic
(but see below concerning sample NHM60). Silva (1955) originally
suggested that ssp. atlanticum was an alien in Europe but later
considered that it might be of northern European origin (Silva,
1957); although Trowbridge applied the criteria for identifying
invasive species outlined by Chapman & Carlton (1991),
Boudouresque (1994) and Ribera & Boudouresque (1995), ssp.
atlanticum met them only partially (Trowbridge, 1998). The
main criterion applied was conspicuousness but Cotton (1912)
has highlighted that although it seemed unlikely that ssp. atlanticum
had been overlooked in the British Isles, it had been at least since
1839 due to its morphological similarity to C. tomentosum.
The results reported here suggest that ssp. scandinavicum is a
phenotype of the invasive tomentosoides strain. The invasive
tomentosoides strain, on the other hand, has become almost
ubiquitous in its distribution and is found sympatrically with
most native haplotypes/subspecies. Indeed, most groups of
samples attributed to each subspecies contained mistakenly
identified cryptic accessions of tomentosoides. The ssp. atlanticum
haplotype identified in a South African sample (NHM60) differs
from one of the South African haplotypes by a single substitution
and is most likely an example of homoplasy (although the
possibility of a technical or cataloguing artefact is acknowledged),
rather than reflecting any invasive tendencies.
A major consequence of such difficulties in identifying cryptic
taxa is that the initial colonization events by invasive species
frequently go unnoticed. The analysis of herbarium samples of
Codium fragile has confirmed that the spread of the invasive
strain of C. fragile largely pre-dates records of its first appearance
throughout the globe. According to Silva (1955), the earliest
record of ssp. tomentosoides in the British Isles was from the
River Yealm estuary at Steer Point, South Devon, in 1939. A
dichotomously branching sample from the Ulster Museum
herbarium (UMF79) collected from County Donegal in 1845
and identified as ssp. atlanticum, however, was actually found to
be tomentosoides, suggesting that the invasive strain had reached
Britain at least 90 years before it was first recorded. Likewise, a
sample from Ronaldsay, Scotland, dating from 1891 collected by
Traill and identified by Silva as ssp. atlanticum was also in reality
tomentosoides. The majority (16 of 21) of herbarium samples
identified as ssp. atlanticum were actually revealed to be tomen-
tosoides, including three from Ireland which pre-date its first
recorded appearance in 1941 (Silva, 1955; Parkes, 1975). This
discrepancy can be attributed to the wide morphological
variation in the invasive strain (Fig. 1). Records of the occurrence
of ssp. atlanticum in Ireland date from the start of the 19th
century, long before the first records of ssp. tomentosoides, and
this, coupled with reports of competitive exclusion of ssp.
atlanticum by ssp. tomentosoides, would appear to be consistent
with the native status of ssp. atlanticum (Cotton, 1912; Parkes, 1975).
Although sample numbers for herbarium material from both
South Africa and Australasia were smaller than in ssp. atlanticum,
cryptic accessions of tomentosoides were also found. Samples
were found from both areas that pre-dated the original reports of
the appearance of ssp. tomentosoides in that region. One sample
(NHM46) from New Zealand, collected in 1935 and identified as
ssp. novae-zelandiae, and another (NHM43) from South Africa,
collected in 1937 and identified as ssp. capense, both represented
samples of the invasive strain despite being collected 40 and
62 years before its first record in Australasia and South Africa,
respectively.
The present study has highlighted the value of herbarium
samples for shedding new light on the past invasive history of
introduced algal species. Herbarium specimens are rarely collected
on the rigorous basis required for the experimental design generally
associated with population genetic studies, however. Instead,
herbarium collections tend to comprise groups of samples
![Page 10: Diversity and Distributions, (Diversity Distrib.) Tracking ...qub.ac.uk/bb-old/provan/pdf/2007g.pdf · Diversity and Distributions, (Diversity Distrib ... samples of the highly invasive](https://reader033.vdocuments.mx/reader033/viewer/2022051720/5a78ad827f8b9a1f128e942b/html5/thumbnails/10.jpg)
J. Provan et al.
© 2007 The Authors10 Diversity and Distributions, Journal compilation © 2007 Blackwell Publishing Ltd
representing specific periods of time (usually the active collecting
lifetime of the individual responsible) and specific regions. There
are, however, notable exceptions to this: a study into the invasive
history of the weed Phragmites australis utilized 62 herbarium
samples covering the majority of the USA and was able to track
the spread of introduced haplotypes before and after 1910
(Saltonstall, 2002). In a taxonomic sense, though, the ability to
identify putative cryptic species and/or subspecies will prove
extremely informative in many cases, particularly in clarifying
the early events of bioinvasions as demonstrated in a study using
museum samples of the mussel genus Mytilus that clarified
cryptic species diversity in 100-year-old samples (Geller, 1999).
Such recent advances in the molecular genetic analysis of
museum and herbarium specimens mean that they now represent
a real and still largely untapped resource for reconstructing the
evolutionary and biogeographical history of a variety of extant,
as well as extinct, taxa.
ACKNOWLEDGEMENTS
The authors would like to thank the curators of the herbaria at
the Natural History Museum, London, the Amsterdam Herbarium
and the Ulster Museum and David Garbary, St Francis Xavier
University, for allowing us access to samples. We are particularly
grateful to Paul Silva for providing type material from the
University of California at Berkeley herbarium and for helpful
discussions on nomenclature of Codium fragile. Freshly collected
samples were kindly provided by Cynthia Trowbridge, Wendy
Nelson, Emily McQualter, Svenja Bruns, Rob Anderson, and
Rafael Riosmena-Rodriguez. We warmly thank Dave McCall,
Aquatic Sciences, Department of Agriculture and Rural Develop-
ment, Northern Ireland, for providing the SEM images. This
research was funded by the Esmée Fairbairn Foundation and
under the EU Framework V project ALIENS.
REFERENCES
Andreakis, N., Procaccini, G., Maggs, C.A. & Kooistra, W.H.C.F.
(2007) Phylogeography of the invasive seaweed Asparagopsis
(Bonnemaisoniales, Rhodophyta) reveals cryptic diversity.
Molecular Ecology, 16, 2285–2300.
Audzijonyte, A., Daneliya, M.E. & Vainola, R. (2006) Comparative
phylogeography of Ponto-Caspian mysid crustaceans: isolation
and exchange among dynamic inland sea basins. Molecular
Ecology, 15, 2969–2984.
Bax, N., Carlton, J.T., Mathews-Amos, A., Haedrich, R.L.,
Howarth, F.G., Purcell, J.E., Rieser, A. & Gray, A. (2001) The
control of biological invasions in the world’s oceans. Conserva-
tion Biology, 15, 1234–1246.
Begin, C. & Scheibling, R.E. (2003) Growth and survival of the
invasive green alga Codium fragile subsp. tomentosoides in tide
pools on a rocky shore in Nova Scotia. Botanica Marina, 46,
404–412.
Berger, S., Fettweiss, U., Gleissberg, S., Liddle, L.B., Richter, U.,
Sawitzky, H. & Zuccarello, G.C. (2003) 18S rDNA phylogeny
and evolution of cap development in Polyphysaceae (formerly
Acetabulariaceae; Dasycladales, Chlorophyta). Phycologia, 42,
506–561.
Booth, D., Provan, J. & Maggs, C.A. (2007) Molecular approaches
to the study of invasive seaweeds. Botanica Marina, in press.
Bouck, G.B. & Morgan, E. (1957) The occurrence of Codium in
Long Island waters. Journal of the Torrey Botanical Society, 84,
384–387.
Boudouresque, C.F. (1994) Les espèces introduites dans les eaux
côtières d’Europe et de Méditerranée: etat de la question et
consequences. Introduced species in European coastal waters
(ed. by C.F. Boudouresque), pp. 8–27. European Commission,
Luxembourg.
Bucciarelli, G., Golani, D. & Bernardi, G. (2002) Genetic cryptic
species as biological invaders: the case of a Lessepsian fish
migrant, the hardyhead silverside Atherinomorus lacunosus.
Journal of Experimental Marine Biology and Ecology, 273,
143–149.
Burrows, E. (1991) Seaweeds of the British Isles, Vol. 2 Chlorophyta.
Natural History Museum, London.
Carlton, J.T. (1999) The scale and ecological consequences of
biological invasions in the World’s oceans. Invasive species
and biodiversity management (ed. by O.T. Sandlund, P.J. Schei
and A. Viken), pp. 195–212. Kluwer Academic Publishers,
the Netherlands.
Chapman, J.W. & Carlton, J.T. (1991) A test of criteria for intro-
duced species: the global invasion by the isopod Synidotea
laevidorsalis (Miers, 1881). Journal of Crustacean Biology, 11,
386–400.
Coradin, L. & Giannasi, D.L. (1980) The effect of chemical pres-
ervations on plant collections to be used in chemotaxonomic
studies. Taxon, 29, 33–40.
Cotton, A.D. (1912) Clare island survey: marine algae part 15.
Proceedings of the Royal Irish Academy B, 31, 1–178.
Dawson, M.N., Gupta, A.S. & England, M.H. (2005) Coupled
biophysical global ocean model and molecular genetic analyses
identify multiple introductions of cryptogenic species.
Proceedings of the National Academy of Sciences USA, 102,
11968–11973.
De Castro, O. & Menale, B. (2004) PCR amplification of Michele
Tenore’s historical specimens and facility to utilize an alternative
approach to resolve taxonomic problems. Taxon, 53, 147–
151.
Dromgoole, F.I. (1975) Occurrence of Codium fragile subspecies
tomentosoides in New Zealand waters. New Zealand Journal of
Marine and Freshwater Research, 9, 257–264.
Farr, T.J., Nelson, W.A. & Broom, J.E.S. (2003) A challenge to the
taxonomy of Porphyra. Australia: the New Zealand red alga
Porphyra rakiura (Bangiales, Rhodophyta) occurs in southern
Australia, and is distinct from P. lucasii. Australian Systematic
Botany, 16, 569–575.
Gabrielsen, T.M., Brochmann, C. & Rueness, J. (2003) Phylogeny
and interfertility of North Atlantic populations of ‘Ceramium
strictum’ (Ceramiales, Rhodophyta): how many species?
European Journal of Phycology, 38, 1–13.
Geller, J.B. (1999) Decline of a native mussel masked by sibling
species invasion. Conservation Biology, 13, 661–664.
![Page 11: Diversity and Distributions, (Diversity Distrib.) Tracking ...qub.ac.uk/bb-old/provan/pdf/2007g.pdf · Diversity and Distributions, (Diversity Distrib ... samples of the highly invasive](https://reader033.vdocuments.mx/reader033/viewer/2022051720/5a78ad827f8b9a1f128e942b/html5/thumbnails/11.jpg)
Genetic analysis of Codium fragile herbarium samples
© 2007 The AuthorsDiversity and Distributions, Journal compilation © 2007 Blackwell Publishing Ltd 11
Geller, J.B., Walton, E.D., Grosholz, E.D. & Ruiz, G.M. (1997)
Cryptic invasions of the crab Carcinus detected by molecular
phylogeography. Molecular Ecology, 6, 901–906.
Goff, L.J., Liddle, L., Silva, P.C., Voytek, M. & Coleman, A. (1992)
Tracing species invasion in Codium, a siphonous green alga,
using molecular tools. American Journal of Botany, 79,
1279–1285.
González, A. & Santelices, B. (2004) A dichotomous species
of Codium (Bryopsidales, Chlorophyta) is colonizing
northern Chile. Revista de Chilena de Historia Natural, 77,
293–304.
Greuter, W., McNeill, J., Barrie, F.R. et al. (2000) International
code of botanical nomenclature (Saint Louis Code). Regnum
Vegetabile, 138, 1–474.
Gugerli, F., Parducci, L. & Petit, R.J. (2005) Ancient plant DNA:
review and prospects. New Phytologist, 166, 409–418.
Gurevitch, J. & Padilla, D.K. (2004) Are invasive species a
major cause of extinctions? Trends in Ecology & Evolution, 19,
470–474.
Holland, B.S., Dawson, M.N., Crow, G.L. & Hofmann, D.K.
(2004) Global phylogeography of Cassiopea (Scyphozoa:
Rhizostomeae): molecular evidence for cryptic species and
multiple invasions of the Hawaiian Islands. Marine Biology,
145, 1119–1128.
Hommersand, M.H. (1986) The biogeography of the South
African marine red algae. Botanica Marina, 29, 257–270.
Hubbard, C.G. & Garbary, D.J. (2002) Morphological variation
of Codium fragile (Chlorophyta) in eastern Canada. Botanica
Marina, 45, 476–485.
Hughey, J.R., Silva, P.C. & Hommersand, M.H. (2001) Solving
taxonomic and nomenclatural problems in Pacific Gigartinaceae
(Rhodophyta) using DNA from type material. Journal of
Phycology, 37, 1091–1109.
Hughey, J.R., Silva, P.C. & Hommersand, M.H. (2002) ITS1
sequences of type specimens of Gigartina and Sarcothalia
and their significance for the classification of South African
Gigartinaceae (Gigartinales, Rhodophyta). European Journal of
Phycology, 37, 209–216.
Inderbitzin, P., Lim, S.R., Volkmann-Kohlmeyer, B., Kohlmeyer,
J. & Berbee, M.L. (2004) The phylogenetic position of
Spathulospora based on DNA sequences from dried herbarium
material. Mycological Research, 108, 737–748.
Jousson, O., Pawlowski, J., Zaninetti, L., Zechman, F.W., Dini, F.,
Di Guiseppe, G., Woodfield, R., Millar, A. & Meinesz, A.
(2000) Invasive alga reaches California – The alga has been
identified that threatens to smother Californian coastal
ecosystems. Nature, 408, 157–158.
Leonard, J.A., Vila, C. & Wayne, R.K. (2005) Legacy lost: genetic
variability and population size of extirpated US grey wolves
(Canis lupus). Molecular Ecology, 14, 9–18.
Martel, C., Viard, F., Bourguet, D. & Garcia-Meunier, P. (2004)
Invasion by the marine gastropod Ocinebrellus inornatus.
France I. Scenario for the source of introduction. Journal of
Experimental Marine Biology and Ecology, 305, 155–170.
Maunder, M., Culham, A., Bordeu, A., Allainguillaume, J. &
Wilkinson, M. (1999) Genetic diversity and pedigree for
Sophora toromiro (Leguminosae): a tree extinct in the wild.
Molecular Ecology, 8, 725–738.
McIvor, L., Maggs, C.A., Provan, J. & Stanhope, M.J. (2001) rbcL
sequences reveal multiple cryptic introductions of the Japanese
red alga Polysiphonia harveyi. Molecular Ecology, 10, 911–919.
Nyberg, C.D. & Wallentinus, I. (2005) Can species traits be used
to predict marine macroalgal introductions? Biological Invasions,
7, 265–279.
Pääbo, S. (1989) Ancient DNA: extraction, characterization,
molecular cloning and enzymatic amplification. Proceedings of
the National Academy of Sciences USA, 86, 1939–1943.
Parkes, H.M. (1975) Records of Codium species in Ireland. Pro-
ceedings of the Royal Irish Academy B, 75, 125–134.
Provan, J., Murphy, S. & Maggs, C.A. (2004) Universal plastid
primers for Chlorophyta and Rhodophyta. European Journal of
Phycology, 39, 43–50.
Provan, J. & Murphy, S. & Maggs, C.A. (2005) Tracking the inva-
sive history of the green alga Codium fragile subsp. tomen-
tosoides. Molecular Ecology, 14, 189–194.
Ribera, M.A. & Boudouresque, C.F. (1995) Introduced marine
plants, with special reference to macroalgae: mechanisms and
impact. Progress in Phycology Research, 11, 187–286.
Roy, M.S. & Sponer, R. (2002) Evidence of a human-mediated
invasion of the tropical western Atlantic by the ‘world’s most
common brittlestar’. Proceedings of the Royal Society of London
Series B, Biological Sciences, 269, 1017–1023.
Saltonstall, K. (2002) Cryptic invasion by a non-native genotype
of the common reed Phragmites australis into North
America. Proceedings of the National Academy of Sciences USA,
99, 2445–2449.
Savolainen, V., Cuénoud, P., Spichiger, R., Martinez, M.D.,
Crévecouer, M. & Manen, J.F. (1995) The use of herbarium
specimens in DNA phylogenetics: evaluation and improvement.
Plant Systematics and Evolution, 197, 87–98.
Schmidt, A.L. & Scheibling, R.E. (2007) Effects of native and
invasive macroalgal canopies on composition and abundance
of mobile benthic macrofauna and turf-forming algae.
Journal of Experimental Marine Biology and Ecology, 341,
110–130.
Shiganova, T.A., Mirzoyan, Z.A., Studenikina, E.A., Volovik, S.P.,
Siokou-Frangou, I., Zervoudaki, S., Christou, E.D., Skirta, A.Y.
& Dumont, H.J. (2001) Population development of the
invader ctenophore Mnemiopsis leidyi in the Black Sea and in
other seas of the Mediterranean basin. Marine Biology, 139,
431–445.
Silva, P.C. (1955) The dichotomous species of Codium in Britain.
Journal of the Marine Biology Association UK, 34, 565–577.
Silva, P.C. (1957) Codium in Scandinavian waters. Svensk Botanisk
Tidskrift, 51, 117–134.
Skage, M., Gabrielsen, T.M. & Rueness, J. (2005) A molecular
approach to investigate the phylogenetic basis of three widely
used species groups in the red algal genus Ceramium (Ceramiales,
Rhodophyta). Phycologia, 44, 353–360.
Soltis, P.S., Soltis, D.E. & Smiley, C.J. (1992) An rbcL sequence
from a Miocene Taxodium (bald cypress). Proceedings of the
National Academy of Sciences USA, 89, 449–451.
![Page 12: Diversity and Distributions, (Diversity Distrib.) Tracking ...qub.ac.uk/bb-old/provan/pdf/2007g.pdf · Diversity and Distributions, (Diversity Distrib ... samples of the highly invasive](https://reader033.vdocuments.mx/reader033/viewer/2022051720/5a78ad827f8b9a1f128e942b/html5/thumbnails/12.jpg)
J. Provan et al.
© 2007 The Authors12 Diversity and Distributions, Journal compilation © 2007 Blackwell Publishing Ltd
Stramma, L. & England, M. (1999) On the water masses and
mean circulation of the South Atlantic Ocean. Journal of
Geophysical Research, 104, 20863–20883.
Swofford, D.L. (2002) P*: phylogenetic analysis using
parsimony (* and other methods), Version 4. Sinauer Associ-
ates, Sunderland, MA.
Trowbridge, C.D. (1996) Introduced versus native subspecies of
Codium fragile: how distinctive is the invasive subspecies
tomentosoides? Marine Biology, 126, 193–204.
Trowbridge, C.D. (1998) Ecology of the green macroalga Codium
fragile (Suringar) Hariot: invasive and non-invasive subspecies.
Oceanography and Marine Biology, 36, 1–64.
Trowbridge, C.D. (2001) Coexistence of introduced and native
congeneric algae: Codium fragile and C. tomentosum on Irish
rocky shores. Journal of the Marine Biology Association UK, 81,
931–937.
Turon, X., Tarjuelo, I., Duran, S. & Pascual, M. (2003) Character-
ising invasion processes with genetic data: an Atlantic clade of
Clavelina lepadiformis (Ascidiacea) introduced into Mediterra-
nean harbours. Hydrobiologia, 503, 29–35.
Uwai, S.Y., Nelson, W., Neill, K., Wang, W.D., Aguilar-Rosas,
L.E., Boo, S.M., Kitayama, T. & Kawa, H. (2006) Genetic diver-
sity in Undaria pinnatifida (Laminariales, Phaeophyceae)
deduced from mitochondria genes origins and succession of
introduced populations. Phycologia, 45, 687–695.
Verbruggen, H., Leliaert, F., Maggs, C.A., Shimada, S., Schils, T.,
Provan, J., Booth, D., Murphy, S., de Clerck, O., Coppejeans,
E., Littler, D.S. & Littler, M.M. (2007) Species boundaries and
phylogenetic relationships within the green algal genus
Codium (Bryopsidales) based on plastid DNA sequences.
Molecular Phylogenetics and Evolution, 44, 240–254.
Voisin, M., Engel, C.R. & Viard, F. (2005) Differential shuf-
fling of native genetic diversity across introduced regions
in a brown alga: aquaculture vs. maritime traffic effects.
Proceedings of the National Academy of Sciences USA, 102,
5432–5437.
Wilcove, D.S., Rothstein, D., Dubow, J., Phillips, A. & Losos, E.
(1998) Quantifying threats to imperilled species in the United
States. Bioscience, 48, 607–615.
Zinsmeister, W.J. & Feldmann, R.M. (1984) Cenozoic high-
latitude heterochroneity of Southern Hemisphere marine
faunas. Science, 224, 281–283.