disclaimers-space.snu.ac.kr/bitstream/10371/166570/1/000000159704.pdf · 2020. 5. 18. · ninj...
TRANSCRIPT
저 시-비 리- 경 지 2.0 한민
는 아래 조건 르는 경 에 한하여 게
l 저 물 복제, 포, 전송, 전시, 공연 송할 수 습니다.
다 과 같 조건 라야 합니다:
l 하는, 저 물 나 포 경 , 저 물에 적 된 허락조건 명확하게 나타내어야 합니다.
l 저 터 허가를 면 러한 조건들 적 되지 않습니다.
저 에 른 리는 내 에 하여 향 지 않습니다.
것 허락규약(Legal Code) 해하 쉽게 약한 것 니다.
Disclaimer
저 시. 하는 원저 를 시하여야 합니다.
비 리. 하는 저 물 리 목적 할 수 없습니다.
경 지. 하는 저 물 개 , 형 또는 가공할 수 없습니다.
공학석사 학위논문
The Effect of Transcriptional
Activators via a Blue Light-Inducible
CRISPR-Cas9 System
청색 광유도 유전자 교정 시스템에서의
전사인자 활성체의 영향
2020 년 2 월
서울대학교 대학원
협동과정 바이오엔지니어링 과정
Ninj Byambasuren
1
ABSTRACT
The Effect of Transcriptional
Activators via a Blue Light-Inducible
CRISPR-Cas9 System
Ninj Byambasuren
Interdisciplinary Program in Bioengineering
The Graduate School of Engineering
Seoul National University
Increasing interest in genetic engineering has warranted the need for highly dynamic
control of gene upregulation, which has resulted in improvements to the conventional
CRISPR activation system (CRISPRa). One of these improvements, the light-inducible
CRISPR activation system (LICAS) utilizes light-inducible heterodimers CIBN and
CRY2FL fused to catalytically deactivated Cas9 (dCas9) and a transcriptional activator
VP64. LICAS dynamically regulates endogenous gene expression in the presence of
blue light. Recently, researchers developed the tripartite transcriptional activator VPR
(VP64-p65-Rta), which showed higher levels of transcriptional gene activation than
VP64 when utilized for the conventional CRISPRa system. However, VPR’s activation
levels for LICAS are yet to be determined. Therefore, in this study, we investigated
2
VPR and VP64 in CRISPRa and LICAS to compare their gene activation levels. First,
we investigated dCas9-VPR and dCas9-VP64 in CRISPRa by targeting the Interleukin
1 Receptor Antagonist (IL1RN) gene. We confirmed previous studies contending that
VPR induced higher gene activation than VP64 for IL1RN. In LICAS, when we
compared VPR with VP64 by fusing each transcriptional activator to a full-length
cryptochrome (CRY2FL), higher gene activation was observed via CRY2FL-VP64.
Nevertheless, we demonstrated that our novel CRY2FL-VPR construct succeeded in
activating the IL1RN in LICAS. However, its activation efficiency was relatively weak
compared to CRY2FL-VP64. Despite this fact, we proved that VPR activator domains
can be fused to CRY2FL without deactivating its ability to complex and function with
sgRNAs in human cells. With further investigation, the CRY2FL-VPR design may
propel improvements to dynamic endogenous gene activation methods for genetic
research and therapy.
Keywords: CRISPR-Cas9, CRISPR-mediated activation system (CRISPRa), a
light-inducible CRISPR activation system (LICAS), VPR, VP64, CRY2FL-CIBN,
optogenetics
Student Number: 2018-24978
3
Table of Contents
ABSTRACT ................................................................................................................... 1
Table of Contents ............................................................................................................ 3
Chapter 1. Overview of CRISPR ................................................................................... 4
1.1 Improvements to the CRISPR-Cas9 System ................................................. 4
1.2 CRISPR-mediated Activation and Types of Transcriptional Activators ....... 6
1.3 Development of a Light Inducible CRISPRa System ................................... 7
Chapter 2. Developing a light-inducible CRISPR activation system utilizing CRY2FL-
VPR ................................................................................................................................ 9
1. Introduction .................................................................................................... 9
2. Materials and Methods ................................................................................... 12
2.1 Cell Culture ......................................................................................... 12
2.2 Transfection ........................................................................................ 12
2.3 Plasmid Construction and Quantity .................................................... 12
2.4 Endogenous gene targets and sgRNA design ..................................... 13
2.5 Quantitative real-time PCR analysis .................................................. 13
2.6 Blue light construction and illumination ............................................ 14
2.7 Statistical analysis ............................................................................... 14
3 Results ............................................................................................................. 15
3.1 Construction of endogenous gene activation system based on the
dCAS9 system. .............................................................................................. 15
3.2 Endogenous gene activation via dCas9-VPR and dCas9-VP64 in
CRISPRa. ....................................................................................................... 16
3.3 Design of light-inducible CRISPRa system (LICAS) based on
CRY2FL-VPR and CIBN-dCas9-CIBN ....................................................... 16
3.4 Activation of an exogenous eGFP reporter by CRY2FL-VPR. ......... 17
3.5 Comparison of CRY2FL-VPR to CRY2FL-VP64 in LICAS. ........... 18
4. Discussion ...................................................................................................... 18
Figures and Tables ................................................................................................. 22
References .................................................................................................................... 30
4
Chapter 1. Overview of CRISPR
1.1 Improvements to the CRISPR-Cas9 System
Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) are a
family of DNA sequences that work as a bacteriophage defense mechanism in bacteria
and archaea [1]. The CRISPR and CRISPR associated (Cas) proteins serve together as
a form of genetic memory that help the bacterial cell detect and destroy harmful viral
invaders [2]. Cas proteins are a useful tool for molecular testing due to their ability to
specifically target DNA sequences. The CRISPR system and Cas proteins form the
foundation for the development of CRISPR based genome editing tools, such as
CRISPR-Cas9 [3]. Compared to other Cas proteins, Cas9 is most commonly used
because it is the first-identified and best-characterized single-protein CRISPR activator
[5]. There are two main components of the CRISPR-Cas9 system: a single guide RNA
(sgRNA) that identifies a protospacer adjacent motif (PAM) sequence and immediately
follows the targeted DNA sequence and the Cas9 protein which produces double-strand
breaks (DSBs) at the target site that are later repaired by cellular mechanisms [4, 5].
In 2013, researchers repurposed Cas9 to target DNA without cleaving it, termed
nuclease-deactivated Cas9 or dead Cas9 (dCas9) [5]. Cas9 has two catalytic domains
(HNH and RuvC) that act together to mediate DNA double-strand breaks (DSBs).
Endonuclease activity is removed through a single point mutation in either of these
domains, which results in a nickase enzyme that only cleaves one side of the target site.
Mutations in both domains (D10A and H840A for SpCas9) result in complete loss of
DNA cleavage activity [4]. By modifying Cas9 into dCas9, researchers now have the
5
ability to regulate gene expression, perform epigenetic manipulation, and CRISPR
imaging [8, 10-12] (Fig.1).
The CRISPR activation system (CRISPRa) utilizes dCas9 fused to
transcriptional activator domains (e.g. VP64, P65, Rta5) to upregulate gene expression
[6]. Conventional approaches introduce exogenous genes into cells to promote targeted
gene expression (e.g. plasmid with a CMV promoter, DOX inducible gene activation,
artificial transcription factors) [7, 8]. However, for the first time, CRISPRa allowed for
overexpression of genes in their endogenous context and enabled targeted
transcriptional activation [9]. Yet, to precisely control gene expression, highly dynamic
and inducible control of CRISPR-dCas9 was sought after [10]. Researchers have
developed systems that enable precise control and inducibility of CRISPR-dCas9
through the utilization of diverse tools: small molecules [11], ligands [12], a split-Cas9
[13], and chemicals (e.g. doxycycline-inducible sgRNA) [8]. However, these methods
have several adverse effects because their byproducts diffuse freely and have
unintended effects, making it difficult to achieve highly inducible genome editing
without drawbacks [14]. A solution for these limitations may be a light-inducible system.
A light inducible system has high spatiotemporal resolution and is noninvasive
compared to other inducible methods [15].
Therefore, in 2015, the blue light-inducible CRISPR-Cas9 activation system
(LICAS) was developed to achieve repeatable and reversible control of endogenous
gene expression [10]. LICAS induces gene activation by utilizing blue light-dependent
dimerization proteins: a full-length cryptochrome (CRY2FL) and its binding protein
(CIBN) from Arabidopsis thaliana. CRY2FL was fused to the transcriptional activator
domain VP64 resulting in a CRY2FL-VP64 construct. CIBN was fused to the N- and
C-terminus of dCas9 resulting in a CIBN-dCas9-CIBN construct. In the presence of
6
blue light, CRY2FL binds to CIBN, which recruits and transports CRY2FL-VP64 to the
target locus and initiates gene expression [16]. The single-domain transcriptional
activator VP64 is an essential component of the currently-used LICA system.
Incidentally, the tripartite activator VPR (VP64-p65-Rta) has shown higher activation
efficiency than VP64 when utilized for the conventional CRISPRa system, the
precursor system to LICAS. In recent literature, when compared to dCas9-VP64,
dCas9-VPR showed ~22 to ~320 fold increased activation of endogenous targets [6].
Hence, in this study, we constructed a novel CRY2FL-VPR plasmid and CIBN-dCas9-
CIBN plasmid to investigate VPR and VP64’s relative efficiencies in LICAS.
1.2 CRISPR-mediated Activation and Types of
Transcriptional Activators
The dCas9-based CRISPR system has been adapted to generate tools called
CRISPRi (CRISPR interference) and CRISPRa (CRISPR activation) [17]. These tools
utilize nuclease-deactivated Cas9 (dCas9) that can't generate DSBs to target genomic
regions, resulting in RNA-directed transcriptional control. In CRISPRa, the dCas9
protein was engineered to be fused to a transcriptional activator (e.g., VPR, VP64) that
can be directed to promoter regions by sgRNAs to upregulate expression of the
endogenous gene target [18]. Examples of these systems are as follows: dCas9 fused to
artificial transcriptional activators (e.g., VP64, P65), dCas9 fused to an activator while
a tagged gRNA recruits other activators (SAM) [19], and a scaffold that recruits
activator peptides (SunTag) [20].
In recent years, to enhance transcriptional activation dCas9 has been fused to
multiple activator domains (VPR) rather than single activator domains (Fig 2. A).
7
Although the fusion of dCas9 to stronger activators results in higher levels of gene
activation, for dynamic control of gene activation, an inducible CRISPR-dCas9 system
is still necessary. Researchers have already developed systems for precise control of
CRISPR-Cas9 using small molecules [21], ligands [12], a split-Cas9 [13], chemicals
(e.g. doxycycline-inducible sgRNA) [8], and optics (e.g. LACE) [10]. However,
some chemicals, small molecules, and ligands have adverse effects because they diffuse
freely and are difficult to rapidly remove, which makes it hard to achieve spatiotemporal
genome editing [22]. Because light has high spatiotemporal resolution and is
noninvasive [23] we focused on a light-inducible CRISPR activation system.
1.3 Development of a Light Inducible CRISPRa System
While chemical-based inducible methods of Cas9 have been widely exploited,
the literature on light-inducible Cas9 methods are few. In contrast to chemicals, light is
a more ideal inducer because of its high spatiotemporal resolution and noninvasiveness
[24]. Researchers have developed several optogenetic transcriptional control systems
for dynamically regulating gene expression with light [23, 25, 26]. Most of these
systems use light-inducible heterodimerizing proteins (light-, oxygen- or voltage-
sensing (LOV) proteins, blue light–utilizing Flavin (BLUF) proteins, a light sensitive
cryptochrome (CRY2) and plant phytochromes (PHY)) from plants [24]. In application,
a heterodimerizing protein is fused to ZFP18 or TALE4 and its binding partner is fused
to a transcriptional activation domain (e.g., VP64). This enables control of any gene in
a reversible and spatiotemporal manner. However, reengineering the ZFP18 or TALE4
DNA-binding domain to target new sequences is difficult due to their complex
molecular structure [10]. To address these limitations, researchers adapted the CRISPR-
8
Cas9 activator system for optogenetic inducibility. A light-activated CRISPR/Cas9
effector (LACE) system was developed in 2015 to induce the transcription of
endogenous genes in the presence of blue light [27]. The light inducible
heterodimerizing proteins cryptochrome (CRY2) and the calcium- and integrin-binding
protein (CIB1) are fused to the transactivation domains, VP64 and dCas9, respectively.
Upon blue light irradiation, CRYFL2 and CIB1 heterodimerize and the transcriptional
activator, VP64, is recruited to the target locus activating gene expression. Therefore,
blue light can be used to spatiotemporally activate the CRISPR/Cas9 system and induce
gene activation.
9
Chapter 2.
Developing a light-inducible CRISPR
activation system utilizing CRY2FL-VPR
1. Introduction
Gene regulation has played a significant role in the development of cell and
tissue engineering [15]. Evolutionary factors such as homeostasis, environmental
adaptation, morphogenesis, disease regulation, and others are all maintained and
modified by gene regulation. Although genetic information is vital to cell development,
not every gene is actively produced. Genetic information has relatively high noise and
cells dynamically respond to environmental stimuli and cell events to meet the cell’s
needs. For example, in eukaryotes, cell to cell differences are a result of the expression
of different, specific genes. Further observation of gene functions in cellular processes
supports the need for approaches that enable spatial, temporal, and precise modulation
of gene expression. Simply put, gene editing itself is not enough for therapeutic or
engineering advancement. Dynamic regulation of gene expression is essential.
However, each dynamic gene regulation system has its drawbacks.
Regulatable transgene systems providing easily controlled, conditional stimulation or
repression of gene expression have already been developed for eukaryotes and are
crucial tools in biomedical research. Most of these systems depend on the
administration of either exogenous chemicals or heat shock. Despite the overall success
of the many of those systems, the potential for problems, like toxic, unintended, or
pleiotropic effects of the inducing chemical or treatment, can impose limitations on their
use. Therefore, highly specific noninvasive methods of gene regulation are still being
10
developed. Furthermore, the ability to manipulate the expression of endogenous genes,
as opposed to exogenous genes, has wide-ranging applications in medicine and applied
biology. With the advancement of dCas9 based tools, CRISPR-based editing has gained
interest in the genetic engineering field [18]. The development of CRISPRa enables the
upregulation of endogenous target genes without introducing exogenous genes into
cells [20]. Conventional approaches introduce exogenous genes into cells to enhance
specific gene expression (e.g. plasmid with a CMV promoter, DOX inducible gene
activation, artificial transcription factors) [13-15]. Other previously developed methods
upregulate gene expression through the addition of exogenous cDNAs into cells [19].
However, for the first time, CRISPRa allowed for the overexpression of genes in their
endogenous context and enabled targeted transcriptional activation [16] (Fig. 2A).
Furthermore, combining CRISPRa with optogenetics provides inducible and repeatable
control of gene activation [21].
Therefore, we chose to further develop a promoter system that can be induced,
rapidly and reversibly, by short pulses of light to specifically manipulate the expression
of endogenous genes known as the light inducible CRISPR activation system (LICAS)
(Fig. 2 B). With LICAS, we precisely control gene expression through highly dynamic
and inducible control of CRISPR-dCas9. Similarly, researchers have developed systems
that enable precise control and inducibility of CRISPR-dCas9 through the utilization of
diverse tools: small molecules [14], ligands [19], a split-Cas9 [20], chemicals (e.g.
doxycycline-inducible sgRNA) [21], and optics (e.g. LACE) [13]. However, some of
these chemicals, small molecules, and ligands have adverse effects because they diffuse
freely and are difficult to remove, as such it is difficult to achieve highly inducible
genome editing without drawbacks [22, 23]. A solution for these limitations can be
found in LICAS because it has high spatiotemporal resolution and is noninvasive
11
compared to other inducible methods [24]. LICAS is especially useful for dynamic
control of groups of genes and has potential applications in the clinical field of gene
therapy [22].
LICAS facilitates dynamic control of endogenous expression genes and may
be clinically applied to induce cell differentiation. The LICAS system activates genes
in the presence of gene-specific guide RNAs (gRNAs) and blue light. The system is
based on the plant proteins CRY2FL and CIBN from Arabidopsis thaliana that
heterodimerize in response to blue light. In LICAS, a full-length CRY2 is fused to the
transcriptional activator VP64 and an CIBN is fused to the N- and C-terminus of the
nuclease-deficient Cas9 (CIBN-dCas9-CIBN). In the presence of blue light, CRY2FL
binds to CIBN, which transports the CRY2FL-VPR complex to the gene target and
starts transcription.
In our study, light-dependent activation of the IL1RN and eGFP genes were
achieved by LICAS. We chose IL1RN our target gene because it is the most commonly
targeted gene in CRISPR editing due to its high levels of activation. Furthermore, the
IL1RN can be efficiently targeted with minimal risk of off-target Cas9 binding
elsewhere in the genome. The demand for a dynamic, noninvasive, efficient
endogenous gene regulation system is still an ongoing process and CRISPRa systems
provide a potential solution. Our choice to enhance LICAS was made to meet this
demand. We believe that our novel construction of CRY2FL-VPR and our efficiency
comparison of VPR and VP64 in LICAS both contribute to achieving a more holistic
and powerful gene activation system in the future.
12
2. Materials and Methods
2.1 Cell Culture
HEK-293T cell line cultured on 0.1% gelatin-coated culture dishes was purchased from
ATCC and maintained in a growth medium which consists of high glucose D-
MEM(Corning®) containing 10% FBS(Corning®), 1% Penicillin and
Streptomycin(Gibco™), and 1% Gibco® GlutaMAX™ supplement.
2.2 Transfection
For transfection, HEK293T cells at a density of 1.8×105 cells per well were grown
overnight in a 24-well plate and transfected with Neon Electroporation the next day
according to the manufacturer’s protocol. For CRISPRa cell line, 0.8M cells were
resuspended in 120ul resuspension buffer each containing 2ug of dCas9-VPR, dCas9-
VP64, and 2ug total sgRNA plasmids. For LICAS cell line, cells were transfected with
2ug of CRY2FL-VP64, CRY2FL-VPR, CIBN-dCas9-CIBN and sgRNAs plasmids.
The electroporation condition was optimized and the condition parameters are shown
in Table 1.
2.3 Plasmid Construction and Quantity
All plasmids described in this study: CIBN-dCas9-CIBN, dCas9-VPR, CRY2FL-VP64,
and empty backbone were obtained from Addgene (plasmid 60553, 99373, 60554, and
73311). The plasmid amounts for CIBN-dCas9-CIBN : CRY2FL-VP64 : minimal
eGFP reporter : sgRNA were 500ng : 500ng : 250ng : 500ng in a 24 well-plate with a
seeding density of 20,000 cells per well. For LICAS, the CRY2FL-VPR and CIBN-
13
dCas9-CIBN plasmids were cloned by Gibson Assembly. The eGFP reporter construct
was referenced from Addgene (plasmid 60718) and contains eight repeats of the
sequence 5′-AAAGGTCGAGAAACTGCAAA-3′ upstream of a minimal CMV
promoter and the gene encodeng eGFP [14].
2.4 Endogenous gene targets and sgRNA design
Several online tools (e.g., CRISPR Design or CHOPCHOP) were used to detect PAM
sequences and list possible sRNA sequences for IL1RN’s target region. We constructed
four sgRNAs for the IL1RN and their sequences are listed in the results section. The
sgRNA targeting promoter region of the eGFP reporter gene was 5’-
AAAGGTCGAGAAACTGGAA-3’. Four gRNAs were used together based on the
previous observation that multiple gRNAs are necessary to robustly activate gene
expression with constitutive dCas9-VP64 [a light].
2.5 Quantitative real-time PCR analysis
For quantitative real-time PCR analysis (qRT-PCR), cells were illuminated for 2 days
and the total RNA was extracted with 200ul of the TRIzol™ reagent (Invitrogen). 1ug
of total RNA was converted to cDNA in 20ul reaction volumes by cDNA samples that
were diluted by 5x and 3ul of the diluted cDNA (30ng or 6ng) was deposited in each
well of a 96-well Reaction Plate (Applied Biosystems). The qRT-PCR analysis was
performed with custom primers that are listed in Table 2. To detect target cDNA
amounts, SYBR Green with low ROX (Enzynomics) served as fluorescence signals.
Relative mRNA expression was determined by ΔΔCt method with glyceraldehyde 3-
phosphate dehydrogenase (GAPDH) as an endogenous control. Reactions were run on
a StepOnePlus Real-Time PCR System (Applied Biosystems).
14
2.6 Blue light construction and illumination
Cells were illuminated using a custom-built 4 × 6 blue LED array (~16 mW/cm2) with
450 nm, 48 lumens at 700 mA (Fig. 3). The blue light irritation (mW) was controlled
by the Ardiuno computer system and pulsed at an interval of 15 seconds. The current
was regulated using a BuckPuck AC Driver [14]. The LED array was held 20.32cm
above the incubator shelf with illumination facing downward such that the cells were
illuminated from the top of the dish. Because the plasmid construct contained an
enhanced fluorescence marker of green fluorescent protein (eGFP), after the irritation
period, cells in culture were visualized under a fluorescence microscope. Its area was
measured by ImageJ (NIH) analysis.
2.7 Statistical analysis
Data are shown as mean ± s.e.d. qRT-PCR data combined triplicates from one
independent experiment. Differentiation experiments were replicated in two
independent experiments with triplicate samples. Two-tailed Students t-test was
performed to explain whether two groups are from the same population or not with
statistical significance (P values). Statistical and graphical analysis was performed with
Prism (GraphPad) software. Asterisks were used to indicate statistical significance
between the two groups. P-values of less than 0.05 were considered significant (*P <
0.05, **P < 0.01, ***P < 0.001).
15
3 Results
3.1 Construction of endogenous gene activation system based
on the dCAS9 system.
Endogenous gene activation with the CRISPRa system requires either the
transcriptional activator VP64 or VPR, a catalytically deactivated Cas9 (dCas9), and
sgRNAs. In prior research, a SP-dCas9 fused with VP64-p65-Rta (VPR) or VP64 has
been constructed and utilized to activate endogenous genes. For this prior system, SP-
dCas9 is fused to VPR or VP64 at its C-terminus through the Gateway Cloning method.
In our study, we assayed the activity of both dCas9-VPR and dCas9-VP64 for their
inducible activation of the IL1RN endogenous gene in HEK293T cells. First, we
referenced the pcDNA-dCas9-VP64 (Plasmid #47107) and SP-dCas9-VPR (Plasmid
#63798) plasmids from Addgene. Then, we selected IL1RN-specific sgRNA targets
used in previous studies. We constructed these sgRNAs to localize dCas9-VPR and
dCas-VP64 to the promoter region of IL1RN. For IL1RN endogenous gene activation,
we utilized the genomic sequence of IL1RN (ENSG00000136689) and selected binding
regions for sgRNAs that were between 1 and 300bp upstream of the transcriptional start
site (TSS). Genome data was obtained from Ensembl Genome Browser.
We assayed the efficiency of dCas9-VPR mediated gene activation of endogenous
IL1RN by transfecting dCas9-VPR64 or dCas9-VPR and sgRNAs targeting IL1RN into
human embryonic kidney (HEK293T) cells.
16
3.2 Endogenous gene activation via dCas9-VPR and dCas9-
VP64 in CRISPRa.
To induce endogenous gene activation via dCas9-VPR and dCas9-VP64 in CRISPRa,
we transfected the HEK-293T cells with the necessary plasmid (500 ng) and sgRNAs
(500 ng). HEK293T cells at 70-80% confluency were transfected with Neon
Electroporation and seeded into a well of a 24-well plate. After a 48hr incubation, the
cells were harvested and relative mRNA levels were quantified by qRT-PCR. The
application of dCas9-VPR compared to dCas9-VP64 resulted in increased expression
of the target gene IL1RN while using CRISPRa (Fig. 4 A). For endogenous activation
of IL1RN, when compared to the dCas9-VP64 activator, dCas9-VPR activated the gene
by a ~1000-fold increase. Through this, we confirmed that the dCas9 system activates
endogenous gene targets and dCas9-VPR has higher induced gene activation than
dCas9-VP64. Schematically, four different sgRNAs recruit dCas9-VPR to the promoter
region of IL1RN as shown in Figure 4 B. The black boxes of the intron-exon map
indicate the coding exons while the white boxes indicate the non-coding exons.
Distances between sgRNAs and exon boxes indicate the sequence length between them.
3.3 Design of light-inducible CRISPRa system (LICAS)
based on CRY2FL-VPR and CIBN-dCas9-CIBN
In recent years, dynamic control of systems via light activation has grown in popularity
and been improved. For the first time, we constructed CRY2FL-VPR and CIBN-dCas9-
CIBN plasmids to optically control gene expression and cellular behavior in an
17
inducible and repeatable manner. For LICAS, the heterodimerization protein CRY2FL
and CIBN were fused to dCas9 and VPR to achieve endogenous gene upregulation
under the stimulus of blue light. The CRY2FL-VPR and CIBN-dCas9-CIBN plasmids
were cloned using Gibson Assembly.
VPR was digested with SacII and BstEII to remove the dCpf1 sequence and amplified
by PCR (Fig. 5). Additionally, it was assembled into a pcDNA3.1 vector containing
CRY2FL-VP64. The CRY2FL-VPR plasmid clone was digested with EcoRI and the
digested DNA was subjected to agarose gel electrophoresis to separate the cloned
fragments from the plasmid vector DNA (Fig. 6).
The CIBN-dCas9-CIBN plasmid was cloned by digesting pcDNA3.1-dCas9-VPR with
XbaI and AscI and using Gibson Assembly to insert the PCR-amplified CIBN gene and
create pcDNA3.1-dCas9-CIBN.
3.4 Activation of an exogenous eGFP reporter by CRY2FL-
VPR.
To validate the functionality of the CRY2FL-VPR plasmid in LICAS, we targeted an
exogenous eGFP reporter plasmid (Fig. 7 A) to obtain a visual and quantitative result.
We found that CRY2-VPR modestly activated gene expression of eGFP under blue light
illumination. However, contrary to our expectations, CRY2FL-VP64 produced higher
gene expression of eGFP and IL1RN than CRY2FL-VPR (Fig. 7 B). We believe this
discrepancy can be explained by the much larger molecular size of VPR when
compared to VP64.
18
3.5 Comparison of CRY2FL-VPR to CRY2FL-VP64 in
LICAS.
After confirming the functionality of the cloned CRY2FL-VPR constructs in the
exogenous gene expression system, its gene activation levels were tested in the
endogenous gene expression system by targeting IL1RN in HEK293T cells (Fig. 8 A).
To validate the functionality of CRY2FL-VPR, HEK293T cells were seeded at ~80%
confluency on a 12-well plate one day before transfection. After 24 hours of transfection,
cells were illuminated with blue light for 48 hours and then harvested and analyzed for
qRT-PCR. Our results indicated that when compared to CRY2FL-VPR, CRY2FL-VP64
induced IL1RN gene activation by an increase of ~22-fold. (Fig. 8 B). This result shows
that the stand-alone efficiency of an activator does not necessarily lead to an
enhancement of LICAS. Possible explanations are further explored in the discussion
section.
4. Discussion
Cells dynamically respond to cellular events and signals from their surroundings and
adapt according to cellular needs. Therefore, to control gene expression in a time-wise
and situational manner, researchers are using inducible gene activation systems to
upregulate gene expression and change the behavior of specific cells [28]. The recently
developed light inducible CRISPR activation system allows for time dependent and
endogenous expression of genes and is seen as a powerful, potential tool to advance
gene engineering.
Native gene regulation is highly dynamic, as transcription levels of genes can change
19
during cell differentiation and across cell types. Over the last several decades,
researchers have assembled inducible tools that enable control of gene expression
through the introduction of exogenous plasmids into cells [29]. This method has been
effective but notably, can have toxic adverse effects [30]. This factor renders
spatiotemporal control of genes through exogenous activation a non-ideal method for
humans. Gene regulation tools must be safe and simple to have clinical viability.
Furthermore, tools themselves should not interfere with non-targeted endogenous genes
or affect normal cellular signal systems.
Therefore, we chose to improve a light-inducible system. A light-inducible system is
relatively noninvasive and inducible [31]; the desired effect can be precisely controlled
through the use of a blue light source. Compared with other inducible methods, a light-
inducible method has shown to be more convenient and easier to manipulate [32]. Blue
light is used to control the interaction of light-inducible proteins; proteins that have been
previously exploited in genome engineering [10]. To construct LICAS, we first adapted
a light-inducible Cryptochrome 2 (CRY2FL) and its CIBN partner protein (both derived
from Arabidopsis thaliana) to bind to each other in response to 470nm blue light. When
blue light is absent, CRY2FL and CIBN proteins exist in a separated state, with the
CRISPRa system nonfunctional; when blue light is on, they form a heterodimer and the
activator domain (in our case VPR or VP64) successfully binds to the promoter region
to initiate gene activation.
We constructed CRY2FL-VPR through Gibson Assembly and examined VPR and
VP64’s working efficiencies in CRISPRa and LICAS. In CRISPRa, VPR is directly
fused to dCas9 and showed ~1000-fold higher activation of IL1RN than VP64. However,
in LICAS, after being fused to CRY2FL and forming CRY2FL-VPR, IL1RN activation
by VPR was lower than VP64 by a factor of ~22-fold. We affirm that our construction
20
of CRY2FL-VPR enabled light-inducible transcriptional activation of exogenous and
endogenous gene targets. However, compared to CRY2FL-VP64, CRY2FL-VPR’s
activation efficiency was modest for LICAS. We found that, in order to improve LICAS,
the stand-alone efficiency of VPR was not enough or did not amend the bottleneck of
the system. Our result demonstrated that although tripartite transcriptional activator
VPR is significantly more efficient than single domain transcriptional activator VP64
in the conventional CRISPRa system, this result was not reproduced in LICAS. We
believe external factors, such as transcriptional activator size and its interaction with the
fused heterodimers CRY2FIL and CIBN, adversely affected the LICAS’ efficiency. We
attend that this discrepancy can be explained by the much larger molecular size of VPR
when compared with VP64 [23]. Based on our observation and results, we surmise that
because the efficiency of a transcriptional activator is heavily influenced by its
molecular characteristics, such as molecular size, being fused to a functionally mobile
heterodimerizing protein CRY2FL negatively affected VPR’s ability to induce gene
activation [21, 24, 33, 34]. Due to CRY2FL-VPR and CRY2FL-VP64 having highly
mobile molecular interactions in LICAS, CRY2FL-VPR’s large size may have slowed
its binding interaction with CIBN-dCas9-CIBN. Compared with dCas9-VPR and
dCas9-VP64’s less mobile molecular interaction in CRISPRa, CRY2FL-VPR and
CRY2FL-VP64 must move and bind efficiently in LICAS. VPR is 7 times larger
(~1077bp or 38.5kDa) than VP64 (~150bp or 5,5kD). Therefore, this discrepancy
possibly inhibited CRY2FL-CIBN heterodimerization that is required for the
functioning of LICAS.
We believe that gene activation efficiency of LICAS may still be increased through 1)
the improvement of fusion design between CRY2FL and VPR and 2) better construction
of the blue light illumination system. Researchers should first consider investigating the
21
modification of the CRY2FL-CIBN heterodimers with their truncated versions.
Truncated versions of these proteins were previously found to promote robust light-
dependent interaction; generally reducing the length of DNA or decreasing the bulk size
of proteins can help them interact more efficiently [21]. Researchers modified the full-
length CRY2FL into a shorter version CRY2PHR (residues 1–498 of CRY2) and found
improved expression over the full-length CRY2 [21]. Therefore, we suggest
improvements to the overall LICAS system by using truncated versions of the
heterodimerizing proteins or reducing the size of the components (smaller
transcriptional activator) that promotes the CRISPR-dcas9 interaction.
In conclusion, highly precise regulation of gene activation using LICAS will enable
researchers to investigate the causal role of gene regulation in diverse processes
including cell development and disease treatment. This investigation can be heavily
used in applied biology and has potential to contribute to clinical gene therapy. We
demonstrate that the CRY2FL-VPR system establishes an alternative method of
optogenetic control for endogenous gene activation.
22
Figures and Tables
Figure 1. Major application areas of CRISPR-Cas9 based technologies beyond genome
editing. (AdliMazhar, 2018)
Figure 2. Schematic view of the programmable CRISPR-dCas9-based transcriptional
activator systems. (A) The tripartite transcriptional activator VPR in CRISPRa system.
23
(B) The tripartite transcriptional activator VPR in a light-inducible CRISPR activation
system (LICAS). After blue light illumination, heterodimers interact with each other
and transport VPR to the target gene’s promoter site and intiates transcription.
Figure 3. Construction of LICAS – blue light LED circuit establishment.
24
A
B
Figure 4. Comparison of dCas9-VP64 and dCas9-VPR in a CRISPRa system to
activate endogenous genes. (A) Table of nucleotide sequence for IL1RN and consequent
sgRNA design. (B) IL1RN. NT: no transfection. Data shown is combined triplicate
qRT-PCR results (error bars indicate the s.e.m.). Analysis done by two-tailed students
t-test, p-values of less than 0.05 were considered significant (ns = no significance, * =
p-value < 0.05, *** = p-value < 0.001).
25
Figure 5. Design and construction of a cloning vector CRY2FL-VPR through Gibson
Assembly.
26
Figure 6. A visualization of restriction fragments CRY2FL-VPR separated by gel
electrophoresis.
27
Figure 7. Exogenous eGFP expression in LICAS. (A) Construction design of
exogenous eGFP reporter with minimal CMV promoter and eight repeats of sgRNA
targeting upstream sites of eGFP (B) Cells processed by LICAS were either incubated in
the dark (Dark) or illuminated (Light) for 24 hours. Cells were transfected with the eGFP
reporter and an empty plasmid as a negative control. When the blue light is illuminated,
the eGFP gene was activated by the dimerization of CRY2FL-VP64 and CRY2FL-VPR
with CIBN-dCas9-CIBN.
28
A
B
Figure 8. Activation of IL1RN via LICAS. (A) Overall experimental flow of LICAS.
(B) Gene expression of LICAS and CRISPRa system with respect to VP64 and VPR
effector.
29
Table 1. Optimization result of electroporation
Electroporation parameters
Pulse
voltage
(V)
Pulse
with
(ms)
Pulse
number
Cell
density
(cells/ml)
Transfection
efficiency Viability Tip type
1100 2 2 1× 105 80% 80% 100 µl
Table 2. Sequence of the primers used for qRT-PCR.
Gene of
interest
Primers
Forward Reverse
IL1RN GGAATCCATGGAGGGAAGAT TGTTCTCGCTCAGGTCAGTG
30
References 1. Loureiro, A. and G.J. da Silva, CRISPR-Cas: Converting A Bacterial Defence
Mechanism into A State-of-the-Art Genetic Manipulation Tool. Antibiotics
(Basel), 2019. 8(1).
2. Barrangou, R., The roles of CRISPR-Cas systems in adaptive immunity and
beyond. Curr Opin Immunol, 2015. 32: p. 36-41.
3. Ran, F.A., et al., Genome engineering using the CRISPR-Cas9 system. Nature
Protocols, 2013. 8(11): p. 2281-2308.
4. Jinek, M., et al., A Programmable Dual-RNA–Guided DNA Endonuclease in
Adaptive Bacterial Immunity. Science, 2012. 337(6096): p. 816-821.
5. Bolotin, A., et al., Clustered regularly interspaced short palindrome repeats
(CRISPRs) have spacers of extrachromosomal origin. Microbiology, 2005.
151(8): p. 2551-2561.
6. Chavez, A., et al., Highly efficient Cas9-mediated transcriptional
programming. Nat Methods, 2015. 12(4): p. 326-8.
7. Kinoshita, A., et al., Regulation of CMV promoter-driven exogenous gene
expression with doxorubicin in genetically modified cells. Journal of Pharmacy
and Pharmacology, 2008. 60(12): p. 1659-1665.
8. Das, A.T., L. Tenenbaum, and B. Berkhout, Tet-On Systems For Doxycycline-
inducible Gene Expression. Current gene therapy, 2016. 16(3): p. 156-167.
9. Xu, X., et al., Gene activation by a CRISPR-assisted trans enhancer. eLife,
2019. 8: p. e45973.
10. Polstein, L.R. and C.A. Gersbach, A light-inducible CRISPR-Cas9 system for
control of endogenous gene activation. Nat Chem Biol, 2015. 11(3): p. 198-
200.
11. <artificial transcription factors (ATFs).pdf>.
12. Kundert, K., et al., Controlling CRISPR-Cas9 with ligand-activated and
ligand-deactivated sgRNAs. Nature Communications, 2019. 10(1): p. 2127.
13. Zetsche, B., S.E. Volz, and F. Zhang, A split-Cas9 architecture for inducible
genome editing and transcription modulation. Nature Biotechnology, 2015.
33(2): p. 139-142.
14. Nihongaki, Y., et al., Photoactivatable CRISPR-Cas9 for optogenetic genome
editing. Nature Biotechnology, 2015. 33(7): p. 755-760.
15. Konermann, S., et al., Optical control of mammalian endogenous transcription
and epigenetic states. Nature, 2013. 500(7463): p. 472-476.
16. Mansouri, M., T. Strittmatter, and M. Fussenegger, Light-Controlled
Mammalian Cells and Their Therapeutic Applications in Synthetic Biology.
Advanced Science, 2019. 6(1): p. 1800952.
17. Lin, W.-R., et al., Challenges and opportunity of recent genome editing and
multi-omics in cyanobacteria and microalgae for biorefinery. Bioresource
Technology, 2019. 291: p. 121932.
18. La Russa, M.F. and L.S. Qi, The New State of the Art: Cas9 for Gene Activation
and Repression. Molecular and cellular biology, 2015. 35(22): p. 3800-3809.
19. Zhang, Y., et al., CRISPR/gRNA-directed synergistic activation mediator (SAM)
induces specific, persistent and robust reactivation of the HIV-1 latent
reservoirs. Sci Rep, 2015. 5: p. 16277.
20. Tanenbaum, Marvin E., et al., A Protein-Tagging System for Signal
Amplification in Gene Expression and Fluorescence Imaging. Cell, 2014.
31
159(3): p. 635-646.
21. Taslimi, A., et al., Optimized second-generation CRY2-CIB dimerizers and
photoactivatable Cre recombinase. Nature chemical biology, 2016. 12(6): p.
425-430.
22. Gangopadhyay, S.A., et al., Precision Control of CRISPR-Cas9 Using Small
Molecules and Light. Biochemistry, 2019. 58(4): p. 234-244.
23. Jayaraman, P., et al., Blue light-mediated transcriptional activation and
repression of gene expression in bacteria. Nucleic Acids Res, 2016. 44(14): p.
6994-7005.
24. Liu, H., et al., Photoexcited CRY2 Interacts with CIB1 to Regulate
Transcription and Floral Initiation in <em>Arabidopsis</em>. 2008.
322(5907): p. 1535-1539.
25. Kennedy, M.J., et al., Rapid blue-light-mediated induction of protein
interactions in living cells. Nature methods, 2010. 7(12): p. 973-975.
26. Kawano, F., et al., Engineered pairs of distinct photoswitches for optogenetic
control of cellular proteins. Nature Communications, 2015. 6(1): p. 6256.
27. Shimizu-Sato, S., et al., A light-switchable gene promoter system. Nature
Biotechnology, 2002. 20(10): p. 1041-1044.
28. Dominguez, A.A., W.A. Lim, and L.S. Qi, Beyond editing: repurposing
CRISPR-Cas9 for precision genome regulation and interrogation. Nat Rev
Mol Cell Biol, 2016. 17(1): p. 5-15.
29. Adli, M., The CRISPR tool kit for genome editing and beyond. Nature
Communications, 2018. 9(1): p. 1911.
30. Qi, F., et al., A Synthetic Light-switchable System based on CRISPR Cas13a
Regulates the Expression of LncRNA MALAT1 and Affects the Malignant
Phenotype of Bladder Cancer Cells. International journal of biological sciences,
2019. 15(8): p. 1630-1636.
31. Polstein, L.R. and C.A. Gersbach, Light-Inducible Spatiotemporal Control of
Gene Activation by Customizable Zinc Finger Transcription Factors. Journal
of the American Chemical Society, 2012. 134(40): p. 16480-16483.
32. Gautier, A., et al., How to control proteins with light in living systems. Nature
Chemical Biology, 2014. 10(7): p. 533-541.
33. Pathak, G.P., et al., Bidirectional approaches for optogenetic regulation of gene
expression in mammalian cells using Arabidopsis cryptochrome 2. Nucleic
Acids Res, 2017. 45(20): p. e167.
34. Benedetti, L., et al., Light-activated protein interaction with high spatial
subcellular confinement. Proceedings of the National Academy of Sciences,
2018. 115(10): p. E2238-E2245.