directed evolution of soluble single-chain human class ii mhc

Directed Evolution of Soluble Single-chain HumanClass II MHC Molecules

Olga Esteban1 and Huimin Zhao1,2,3,4*

1Department of Chemical andBiomolecular EngineeringUniversity of Illinois atUrbana-Champaign600 S. Mathews AveUrbana, IL 61801, USA

2Department of ChemistryUniversity of Illinoisat Urbana-Champaign600 S. Mathews AveUrbana, IL 61801, USA

3Center for Biophysics andComputational BiologyUniversity of Illinoisat Urbana-Champaign600 S. Mathews AveUrbana, IL 61801, USA

4Department of BioengineeringUniversity of Illinoisat Urbana-Champaign600 S. Mathews AveUrbana, IL 61801, USA

Major histocompatibility complex (MHC) class II molecules are mem-brane-anchored heterodimers that present antigenic peptides to T cells.Expression of these molecules in soluble form has met limited success,presumably due to their large size, heterodimeric structure and thepresence of multiple disulfide bonds. Here we have used directed evolu-tion and yeast surface display to engineer soluble single-chain humanlymphocyte antigen (HLA) class II MHC DR1 molecules without cova-lently attached peptides (scDR1ab). Specifically, a library of mutantscDR1ab molecules was generated by random mutagenesis and screenedby fluorescence activated cell sorting (FACS) with DR-specific confor-mation-sensitive antibodies, yielding three well-expressed and properlyfolded scDR1ab variants displayed on the yeast cell surface. Detailedanalysis of these evolved variants and a few site-directed mutants gener-ated de novo indicated three amino acid residues in the b1 domain areimportant for the improved protein folding yield. Further, molecularmodeling studies suggested these mutations might increase the proteinfolding efficiency by improving the packing of a hydrophobic core in thea1b1 domain of DR1. The scDR1ab mutants displayed on the yeast cellsurface are remarkably stable and bind specifically to DR-specific peptideHA306–318 with high sensitivity and rapid kinetics in flow cytometricassays. Moreover, since the expression, stability and peptide-bindingproperties of these mutants can be directly assayed on the yeast cellsurface using immuno-fluorescence labeling and flow cytometry, time-consuming purification and refolding steps of recombinant DR1molecules are eliminated. Therefore, these scDR1ab molecules will pro-vide a powerful technology platform for further design of DR1 moleculeswith improved peptide-binding specificity and affinity for therapeuticand diagnostic applications. The methods described here should begenerally applicable to other class II MHC molecules and also class IMHC molecules for their functional expression, characterization andengineering.

q 2004 Elsevier Ltd. All rights reserved.

Keywords: directed evolution; yeast display; fluorescence activated cellsorting (FACS); major histocompatibility complex (MHC); protein folding*Corresponding author

Introduction

Human major histocompatibility complex(MHC) class II molecules bind peptide antigensand present them to T cell receptors (TCRs) ofCD4þ T cells in cell-mediated immunity.1 These

MHC proteins have been linked to a variety ofhuman diseases, including multiple sclerosis,rheumatoid arthritis, type I diabetes, transplantrejection and certain infectious diseases such asmalaria.2,3 A detailed understanding of their bio-logical role in immune responsiveness has spurredthe design of MHC-based reagents that might beused as immunospecific human therapeutics anddiagnostics. For example, soluble MHC class Itetramers were used to modulate an antigen-specific T cell response in vivo,4 whereas solublepeptide–MHC class II complexes were shown to

0022-2836/$ - see front matter q 2004 Elsevier Ltd. All rights reserved.

E-mail address of the corresponding author:[email protected]

Abbreviations used: MHC, major histocompatibilitycomplex; FACS, fluorescence activated cell sorting; HLA,human lymphocyte antigen; TCRs, T cell receptors.

doi:10.1016/j.jmb.2004.04.054 J. Mol. Biol. (2004) 340, 81–95

control the activity of autoreactive T cells asso-ciated with Type I diabetes5,6 and experimentalallergic encephalomyelitis.7 In addition, detectionof a variety of antigen-specific human T cellshas been accomplished using multivalent solublepeptide–MHC complexes.8

A positive correlation between the affinity ofpeptide tightly bound to MHC molecules and invivo immunogenicity for generating potent T-cellresponses has been described in a number ofexperimental murine and human studies.9,10 It wasalso found that stronger affinities of particularpeptides for their MHC-presenting elements resultin more stable tetramer reagents.11 Thus, MHCmolecules with increased peptide-binding affinityand specificity are highly desired for successfuldevelopment of MHC-based therapeutic and diag-nostic agents. Unfortunately, a major drawback inthe design of MHC-based reagents with improvedaffinity and specificity is the lack of a convenientand efficient system that expresses soluble andfunctional MHC molecules and is amenable topowerful protein engineering approaches such asdirected evolution. As an alternative approach tostructure-based rational design, directed evolutioninvolves random mutagenesis and gene recombi-nation followed by high throughput screening orselection and is very effective in engineeringproteins with novel or improved functions, suchas affinity, activity, stability, and selectivity.12,13 Inparticular, directed evolution has been demon-strated to be very effective in overcoming thebottlenecks of functional expression of proteins insoluble form.14–16 Expression of soluble MHC classII molecules has met limited success mainly dueto their large size, heterodimeric structure, and thepresence of multiple disulfide bonds. Some ofthese molecules have been difficult to express dueto the failure of MHC class II a and b-chains toassemble and/or due to a strong tendency formolecules to aggregate. For example, leucinezippers were required to force the pairing of aand b-chain of DR217 and I-A18 in the absence oftheir transmembrane regions. Conversely, extra-cellular domains of a and b-chains from otherclass II molecules such as DR1 and DR4 have beenexpressed and assembled as soluble heterodimericproteins in insect cells,19–21 but such expressionsystem is not amenable to directed evolution.

To overcome this drawback, we have used yeastcell surface display and directed evolution. Yeastsurface display allows expression of a protein ofinterest as a fusion protein with the yeast AGA2agglutinin mating factor on the cell surface.22 It isan efficient system for directed evolution since alibrary of protein variants can be readily generatedand screened by fluorescence-activated cell sorting(FACS)23 or magnetic beads,24 and it offers multipleadvantages over other display methods such asphage display.25 Yeast is a eukaryote and thereforecontains protein-processing machinery similar tothat of a mammalian cell. Thus, yeast is moreappropriate than prokaryotes to correctly express

and display human therapeutic proteins, includingMHC molecules. Moreover, the robustness of theyeast surface provides an excellent scaffold fordirect biochemical and biophysical characterizationof the displayed protein. Yeast surface displaycoupled with sorting by flow cytometry or mag-netic beads has been used to engineer single-chain antibodies,26–28 single-chain TCR receptorsof increased affinity and stability,29–32 stabilizedversions of class II I-Ag7,33 and more recently,tumor necrosis factor-a (TNF-a) mutants withhigher expression levels.34 However, expression of“functionally empty” class II molecules capable ofbinding exogenously added antigenic peptides hasyet to be demonstrated.

Here we used directed evolution coupled withyeast cell surface display to engineer single-chainhuman class II MHC DR1 protein variants withoutcovalently linked peptides that are remarkablystable, well-expressed and capable of bindingDR-specific peptides on the yeast cell surface withhigh sensitivity and rapid kinetics in flow cyto-metric assays. These scDR1ab variants containspecific mutations located in the b1 domain whichincrease the folding yield of the DR1 molecules bypresumably improving the packing of a hydro-phobic core in the a1b1 domain. The yeast displaysystem developed in this work could substitutefor conventional cellular-binding assays withantigen presenting cells to investigate structuralrequirements for binding of peptides to cell surfaceclass II MHC molecules. More importantly, thissystem provides a basis for further engineering ofMHC-based diagnostic and therapeutic agents forthe treatment of autoimmune diseases, cancersand infectious diseases.

Results

Expression and detection of wild-type scDR1molecule on the yeast cell surface

To evaluate the expression of wild-type HLA-DR1 molecule in the yeast display system, genesencoding the single-chain DR1 constructs,scDR1ab (a-linker-b) or scDR1ba (b-linker-a),were cloned into the yeast pYD1 display vector asan AGA2 polypeptide fusion (Figure 1). Analysisof expression of Xpress and V5 epitope tagsthat flank the single-chain DR1 constructs by flowcytometry allowed the estimation of yeast surfaceexpression levels. A positive staining populationwas detected with the anti-Xpress (data notshown) and anti-V5 antibodies (Figure 2). A similarnumber of positive cells were observed for bothtags, indicating that all positive cells had expressedthe full-length protein, and unlike other hetero-logous eukaryotic proteins expressed in a similarsystem,32,33 no significant proteolytic cleavage tothe carboxyl end of the fused protein had occurred.The surface expression level of scDR1ab orscDR1ba was very high, as indicated by the

82 Evolved Single-chain DR1 Molecules

fluorescence intensity obtained with the V5 anti-body (mean fluorescence units (MFU) ¼ 121.0).Expression of properly folded wild-type scDR1abor scDR1ba on the yeast cell surface, however,could barely be detected by conformation-sensitiveanti-DR antibodies including L243, LB3.1, andImmu-357 (MFU ¼ 1.5–1.8, compared to 0.6 foryeast cells without expressing scDR1ab) (Figure2). It is noteworthy that the L243 and LB3.1 anti-bodies can only recognize correctly assembled DRheterodimers.21,35 On the other hand, binding ofthe wild-type single-chain DR1 molecules to the

DR-specific antibody, CR3/43, which recognizesdenatured b-chain of DR molecules, could bedetected by flow cytometry (Figure 2). It shouldbe noted that the negative population observed inhistograms corresponds to yeast cells in a specificstage of the cell cycle that do not express highlevels of the fusion protein. This negative popu-lation has been observed for all yeast displayedproteins.22,36

Binding of the surface-displayed AGA2-scDR1fusion proteins to CR3/43 was also confirmed byimmunoblot analysis (Figure 3). A band specific

Figure 1. Schematic representation of the single-chain HLA-DR1 constructs used for yeast cell surface display.V5 ¼ V5 epitope, Xpress ¼ Xpress epitope, L ¼ linker region.

Figure 2. Histograms showing fluorescence of cells displaying the wild-type scDR1ab and scDR1ba molecules. Cellswere labeled with anti-V5, anti-DR CR3/43, LB3.1, L234, Immu-357 antibodies followed by secondary labeling withbiotinylated goat-anti-mouse IgG and SA-PE, and then analyzed by flow cytometry. The two first columns correspondto histograms of cells stained with antibodies anti-V5 and CR3/43, which recognize a linear epitope in the wild-typescDR1 proteins. The three right columns represent histograms of cells stained with the conformation-sensitiveDR-specific antibodies LB3.1, L243 and Immu-357. As judged by the low reactivity against these antibodies of theyeast cells displaying wild-type scDR1 molecules, no folded protein is seen with wild-type scDR1 molecules. Approxi-mately 75% of the population of cells expressed scDR1ab on the surface. Labeled yeast cells were analyzed on aCoulter Epics XL flow cytometer collecting 30,000 cells gated on light scatter (size) to prevent analysis of the clumps.

Evolved Single-chain DR1 Molecules 83

to the yeast cells displaying the wild-typesingle-chain DR1 molecules was observed, whichcorresponds to a protein with an apparent molecu-lar mass of <90 kDa. This apparent molecularmass is <30 kDa larger than the expected size ofthe AGA2-DR1 fusion protein, indicating thefusion protein is glycosylated. Indeed, althoughthe predicted molecular mass of AGA2 is under7 kDa, AGA2 was found to have an apparentmolecular mass of 33 kDa on SDS-polyacrylamidegels because of its extensive O-glycosylation.37

Together, these data indicated that the wild-typescDR1 could be expressed on the yeast cell surfaceat high levels but not in their native state.

Directed evolution of folded scDR1ab variantswith increased expression level

To obtain properly folded scDR1ab variants withincreased expression level for further proteinengineering and characterization, a library ofscDR1ab variants generated by error-prone PCRwas screened by flow cytometric sorting with theL243 conformational antibody. Yeast cells were

selected through three cycles of sorting after label-ing with the L243 antibody followed by bio-tinylated-GAM IgG and streptavidin–phyco-erytrin (SA-PE). In each cycle, yeast cells collectedfrom the previous sort were cultured and proteinexpression was induced. A modest enrichmentcould be observed by the second sort and a posi-tive population was detected clearly after the thirdsort.

Nineteen clones isolated from the library werescreened for binding to the anti-V5 antibody andanti-DR L243, LB3.1, and Immu-357 antibodies. Incontrast to the wild-type construct, the mutantsshowed positive population of cells with the threeconformational antibodies. Representative flowcytometry histograms for one of the clones selectedfrom the library are shown in Figure 4. To ensurethe phenotype of the mutant yeast was plasmid-linked, the plasmid was rescued from the respec-tive mutant yeast clone and transformed into freshEBY100 cells to verify that the selected phenotypewas reconstituted. In general, all selected clonesshowed levels of binding to antibody L234 similarto those obtained with the LB3.1 and Immu-357antibodies.

To determine whether the peptide-bindinggroove of these evolved scDR1ab variantsremained empty, we used the conformation-specific KL304 antibody,38 which has been recentlyfound to bind exclusively to empty MHC class IImolecules.39 Flow cytometric analysis of yeast cellsdisplaying the evolved scDR1ab variants revealedno significant binding to this antibody since only avery low percentage of cells showed some reac-tivity against KL304 (Figure 4). This suggestedthat some endogenous low affinity peptides fromthe yeast or peptides present in the inductionmedia might be bound to the peptide-bindinggroove of the scDR1ab molecules. Indeed, theseevolved scDR1ab variants displayed on the yeastsurface were found to be associated with a collec-tion of low-abundance peptides between 1500 and3000 Da that could be stripped off at acidic pHand detected by matrix assisted laser desorptionionization-time of flight (MALDI-TOF) massspectrometer (data not shown). However, as shownlater, these peptides could be readily displaced

Figure 3. Immunoblot analysis of single-chain HLA-DR1 fusion proteins probed with the anti-DR, -DP and-DQ b-chain mAb CR3/43. The molecular masses of theprotein markers are shown on the left. Lane 1: pre-stained low-range marker, lane 2: AGA2-V5 protein(negative control), lane 3: AGA2-scba, and lane 4:AGA2-scab. Although the predicted molecular mass ofAGA2 is under 7 kDa, AGA2 has an apparent molecularmass of 33 kDa because of its extensive glycosylation.37

Figure 4. Flow cytometric analysis of a representative evolved scDR1ab variant. Yeast cells displaying the mutantDWP-7 were stained with anti-V5, anti-DR L234, LB3.1, Immu-357 and anti-IAg,k,n,f KL304 antibodies followed by bio-tinylated goat-anti-mouse IgG and SA-PE. Unshaded peaks represent yeast cells treated with only the secondary stain-ing reagents. Labeled yeast cells were analyzed on a Coulter Epics XL flow cytometer collecting 30,000 cells gated onlight scatter (size) to prevent analysis of the clumps.


by higher affinity peptides in a binding assay.Thus, it may be concluded that these evolvedscDR1ab variants are “functionally empty” ratherthan “physically empty”, as was previouslydescribed for other recombinant class IImolecules.40

Sequence analysis of the evolvedscDR1ab variants

Ten clones that exhibited the highest binding tothe conformational antibodies LB3.1, L243 andImmu-357 were selected for sequence analysis,and were classified into three unique groups,including DO-1, DWP-7 and DWP-5 according totheir sequences (Figure 5). Clones DO-1 andDWP-7 only differed in one amino acid substi-tution in the a-chain. Each of these variants con-tained multiple amino acid substitutions relativeto the wild-type. It should be noted that theLb11H substitution was found in eight of theseten sequenced clones, and more importantly,found in all functional mutants selected from alibrary expressing the heterotrimer of peptideHA, b-chain and a-chain as a covalently linkedsingle-chain protein (scHADR1ba) (O.E. & H.Z.,unpublished results).

Peptide binding to the evolved scDR1abvariants by flow cytometry assays

To determine whether the evolved scDR1abvariants were capable of binding specific antigenicpeptides, biotinylated DR-specific HA306–318 pep-tide was used to examine its direct binding to thescDR1ab molecules displayed on yeast cells. Bind-ing was measured by SA-PE and flow cytometry.Figure 6 shows the histograms of fluorescenceintensities of yeast displaying these evolvedscDR1 variants after incubation with the biotinyl-ated peptide for 20 hours at 37 8C. In all cases,25 mM of biotinylated HA306–318 peptide stained100% of the cells expressing folded scDR1abmolecules (.70% of the total yeast cells). Thesame result was obtained when these yeast cellsdisplaying scDR1 had been stored at 4 8C for atleast four months. In comparison, the same concen-tration of Tax-8Kbio, a biotinylated derivative ofthe peptide Tax specific for HLA-A2 molecules,resulted in fluorescence intensity similar to thebackground (Figure 6). Analogously, incubation ofyeast cells displaying a class I MHC moleculefailed to react with HA306–318 peptide. HA306–318

peptide bound in a dose-dependent manner withsaturation at 50 mM (Figure 7(A)). Moreover, the

Figure 5. Sequence analysis ofthe evolved scDR1ab variants.Schematic representation of thescDR1ab construct is shown on thetop of the group of sequences.The numbers below the diagramrefer to amino acid positions in thea and b-chains, respectively. Thenumber of independent isolates ofeach clone is shown in parentheses.The MFU values for LB3.1 andL234 antibodies are shown on theright of each sequence. Dot indi-

cates residue is same as wild-type DR1. The mutation L11bH was found in all the evolved variants selected of a libraryof single-chain DR1 molecules with the covalently bound antigenic peptide HA306–318 (O.E. & H.Z., unpublishedresults).

Figure 6. Flow cytometric analy-sis of binding of scDR1ab variantsto biotinylated HA306–318 (HLA-DR1-specific) or Tax (HLA-A2-specific) peptide. (Top) The DWP-7variant; (bottom) the DWP-5variant. Unshaded peaks representyeast cells treated with only thesecondary staining reagents.Labeled yeast cells were analyzedon a Coulter Epics XL flowcytometer collecting 30,000 cellsgated on light scatter (size) toprevent analysis of the clumps.


binding could be blocked by an excess of unbio-tinylated HA306–318 but not by the unlabeledTax-8K peptide (Figure 7(B)), indicating the labeledpeptide bound to the same site as the unbiotinyl-ated natural determinant. Scatchard plots of the

binding data were linear, allowing the calculationof apparent Kd values of HA306–318 to DR1-dis-played yeast cells (inset of Figure 7(A)).

Kinetics of peptide binding to the evolvedscDR1ab variants on yeast cell surface

The time-course of peptide binding wasmeasured by incubation of biotinylated HA306–318

and the evolved scDR1ab variants displayed onyeast cell surface for various time intervals at37 8C (Figure 8). In contrast to the previouslyreported binding of HA306–318 to intact antigenpresentation cells (APC),41 the kinetics of bindingwith scDR1ab molecules were much faster and amuch larger fraction of the molecules were loaded(50% maximum binding after less than five hourswith a plateau after 20–24 hours), with no appar-ent interference from the endogenous peptides. Inaddition, once it formed a complex with the yeastdisplayed scDR1ab variants in five hours, the HApeptide remained bound even after incubation at37 8C for two days in the presence of an excess ofunlabeled peptide (data not shown).

Thermostability analysis of the evolvedscDR1ab variants

The thermal stability of the evolved scDR1abvariants displayed on the yeast cell surface wasdetermined as described.42 Since the yeast displayscaffold remains intact at temperatures up to90 8C,42 yeast cells that expressed different scDR1

Figure 7. Specificity of peptide binding. (A) Direct peptide binding. scDR1ab-displaying yeast cells were incubatedfor 20 hours at 37 8C with a series of concentrations of biotinylated DR-specific HA306–318 (squares) or A2-specificTax-8K (circles) peptides. Inset: Apparent association constants of biotinylated HA306–318 peptide to yeast-displayedsingle-chain HLA-DR1 variants. (B) Competitive peptide binding. Binding of the biotinylated HA306–318 peptide wasinhibited by an excess of the unlabeled HA306–318 peptide (squares), but not by an A2-specifc Tax-8K peptide (circles).scDR1ab-displaying yeast cells were incubated for 20 hours at 37 8C with 10 mM of biotinylated peptide at pH 6.5 inthe presence of a competitor unlabeled peptide (0–200 mM). DR1-bound biotinylated peptide was quantified by flowcytometry. Specific binding is expressed as the percentage of binding by using the following formula: percentage ofbinding ¼ [(MFU with competitor 2 background)/(MFU without competitor 2 background)] £ 100%.

Figure 8. Kinetics of peptide binding. Associationkinetics of peptide binding to yeast cells displayingmutant scDR1abLb11H,Db57A. scDR1ab-displayingyeast cells were incubated with 40 mM of biotinylatedHA306–318 peptide at 37 8C for different periods of time,the amount of DR1-bound peptide was examined byflow cytometry using SA-PE. Yeast-displayed scDR1abmolecules were rapidly loaded (50% maximum signal inless than five hours and 100% in 20–24 hours).


molecules were incubated at a range of tempera-tures below 90 8C and the fraction of activemolecules was quantified by binding with twodifferent conformational antibodies. The percen-tage of maximal binding was plotted with respectto temperature and used to determine the tempera-ture at which half-maximal denaturation occurredðT1=2Þ (Figure 9). The calculated T1=2 values forscDR1ab displayed by the different mutants werebetween 70.4 and 73.3 8C (inset of Figure 9). Thesevalues are near the temperature at which the sec-ondary structure of recombinant DR1 moleculesbreaks down (67 8C), as determined by circulardichroism.35 The functional stability of thesescDR1ab proteins was also assessed by measuringresidual binding activity following incubationat 37 8C for several days. The different scDR1abvariants displayed on yeast cells were very stableat 37 8C as revealed by the high fraction of foldedproteins ($80%) upon incubation at 37 8C forthree days.

Identification of functional mutations in theevolved scDR1ab variants

The presence of multiple mutations in themajority of the variants makes predictions of themolecular basis for soluble expression difficult.

However, the Lb11H substitution in the b-chainwas found in the majority of clones selected froma library of scDR1ab variants (eight out of ten)and all functional clones selected from a library ofscHADR1ba variants (O.E. & H.Z., unpublishedresults), shedding some light on the importance ofthis amino acid substitution. Indeed, the presenceof this single mutation in both scDR1ab (abLb11H)and scDR1ba (baLb11H) yielded a folded protein(Figure 10A). However, this single mutant showeda lower level of folded protein than the mutantDWP-7, as measured by reactivity with L243 andLB3.1 antibodies. Moreover, the reactivity of theLb11H mutant with these two antibodies was alsoless than that for the double mutantscDR1abLb11H,Db57A, which gave an expression levelof folded proteins comparable to that obtained formutant DWP-7 (Figure 10A). The effect of the sub-stitution Db57A was clearly synergistic with theLb11H mutation since the single mutantscDR1abDb57A only gave about 20% of foldedproteins with respect to the double mutantscDR1abLb11H,Db57A (Figure 10A). On the otherhand, for those clones with the sequence ofDWP-5, the Lb26F substitution in the b-chainseemed to be critical for the functional expressionof these mutant scDR1 molecules since the singlemutant scDR1abLb26F has an expression level offolded proteins similar to that showed by DWP-5(Figure 10B).Amino acid substitutions Vb75A and Qb92R in

the b-chain were present in all mutants selectedfrom the library. However, they were also foundin a high percentage of unselected clones. Theireffect in expression of the scDR1 molecules wasinvestigated using a mutant scDR1ab with onlythese two amino acid substitutions. Like wild-typescDR1ab, scDR1abVb75A,Qb92R did not show sub-stantial reactivity against DR-specific confor-mational antibodies (Figure 10A).

Discussion

We have used directed evolution coupled withyeast cell surface display to engineer severalsingle-chain HLA-DR1 variants without covalentlylinked peptides that are remarkably stable, well-expressed, and functionally empty. To the best ofour knowledge, these DR1 molecules represent thefirst single-chain MHC molecules that are capableof directly binding specific antigenic peptides onthe yeast cell surface. Three novel single sitemutations, Lb11H, Db57A and Lb26F, in the b1domain, were found to be critical for the properfolding of the single-chain DR1 molecules.Availability of these variants will enable furtherengineering and study of functional HLA-DR1molecules as novel therapeutic and diagnosticagents for autoimmune and infectious diseases.Yeast is a particularly useful cell-surface

expression system because it enables folding andglycosylation of expressed heterologous eukaryotic

Figure 9. Irreversible denaturation curves for theDWP-7 variant displayed on the yeast cell surface. Afterten minutes of incubation at the specified temperature,yeast cells were stained with conformation-sensitiveDR-specific L243 and LB3.1 antibodies to monitor thefraction of native scDR1ab remaining on the cell surface.The data points representing the mean PE fluorescenceminus the autofluorescence at each temperature werefitted to a simple exponential decay curve. Representa-tive curves of two independent titrations are presentedfor each antibody. The midpoint of thermal denaturationfor different scDR1ab variants obtained with L243 anti-body is summarized in the inset. Similar results wereobtained when LB3.1 antibody was used (the maximaldifference of the calculated T1/2 values between L243and LB3.1 antibodies was 1.6 deg. C).


proteins and is easy to handle with ample genetictechniques available.43 However, our initial attemptto express single-chain DR1 molecules in theirfolded form on the yeast cell surface failed. Wild-type scDR1ab or scDR1ba molecules could beexpressed on the yeast surface at high levelsbut not in their native state. This finding wasunexpected since it has been reported that thequality control system of the yeast secretory appar-atus allows export of only correctly folded andassembled proteins.44 Yeast surface display ofa functional single-chain DR1 molecule wasachieved only after introduction of specificmutations such as Lb11H, Db57A or Lb26F intothe protein.

The effects of these mutations on soluble

expression of folded scDR1ab molecules can bepartially accounted for by molecular modeling. Asshown in Figure 11A, the single-chain DR1abmolecule consists of two polypeptide chains (a andb) connected by a 15 amino acid residue, linker.The peptide-binding groove is formed by the a1and b1 domains. All these three mutations arelocated in the b1 domain. Molecular modeling pre-dicts that Lb26F mutation positions the Fb26 side-chain near those of Fb13, Fb40 and Yb78, creatingan interaction network of four aromatic residuesthat links three anti-parallel b-sheet strands to thea-helix within the b1 domain (Figure 11B).Moreover,Yb78 forms part of a conserved network of aromaticresidues that appears to stabilize the secondarystructure motif that is completely conserved in

Figure 10. Identification of single site mutations in the evolved scDR1ab variants that confer elevated expressionlevels of folded proteins. A, Expression levels of folded single-chain DR1 protein in different mutant yeast clones.Yeast displaying wild-type scDR1ab are indicated as wt-ab. B, Comparison of single-chain DR1 protein levels in themutant clone Lb26F with the mutant DWP-5 clone. Results are shown as background-subtracted MFU normalized tothe highest MFU for each monoclonal antibody in each experiment. Error bars represent standard deviations (SDs) ofthree independent yeast clones.


human class II molecules and is highly conservedbetween rat, mouse and human MHC class IImolecules.45 Therefore, Fb26 could contribute to atighter packing of the hydrophobic core in the b1a1domain by increasing the number of aromatic–aromatic interactions and consequently to its overallstability. Indeed, far-sequence aromatic pairs havebeen shown to stabilize protein tertiary structures.46

In addition, although the total contribution ofaromatic–aromatic interactions to the stability ofproteins may be small relative to other types of inter-actions, it might be important for protein foldingsince these interactions may form nucleation sites inthe protein folding pathway.47

The Lb11H mutation seems to play an importantrole in the expression of folded scDR1ab mol-ecules. Although position 11 in the b-chain is poly-morphic, His is not found in any of the DR alleles

with known sequences. Molecular modeling indi-cates that the substitution Lb11H on the firstb-sheet strand of the b1 domain approaches thed(þ ) amino group of Hb11 within 5 A of the ringcentroid of Fb13 where it makes van der Waalscontacts with the d(2 ) p-electrons of the ring(Figure 11C). This amino–aromatic interaction isanalogous to the enthalpically favorable interactionbetween aromatic side-chains.47 In addition, thesulfur atom of Cb30 is placed at 4 A from the ringcentroid of Hb11, and may form a strong non-covalent interaction with the p-electron system ofthe aromatic ring (histidine) of Hb11. Sulfur–aromatic interactions are weakly polar interactionsthat are stronger than van der Waals interactionsbetween non-polar atoms.48 These sulfur–aromaticinteractions are commonly observed in the hydro-phobic core of proteins and may have special

Figure 11. Molecular modeling of site-directed scDR1ab variants. A, Schematic representation of the single-chainDR1 molecule, scDR1ab. The three mutations Lb11H, Db57A and Lb26F important for protein folding as well as themutations Ia8T and Da181N found in the majority of the mutants are shown in stick-and-ball. B, The b1a1 domainshowing the aromatic interaction network formed by Fb26. The original Lb26 residue which is superimposed onFb26 is shown in green. C, Region of the peptide-binding domain showing the substitution Lb11H on the b-chain.Lb11, superimposed on Hb11, is shown in green. D, Region of the b1a1 domain showing the location of the mutationDb57A. Db57 that forms a salt bridge with Ra76 in wild-type DR1 is shown in green and appears superimposed onAb57. The a-chain is shown in red and the b-chain is shown in blue. The broken lines indicate the distances in Abetween residues forming putative hydrophobic or aromatic–aromatic interactions.


significance for stabilizing the folded conformationof proteins.49,50 The Db57A mutation also promotesthe folding of the single-chain DR1ab moleculesince its presence in the single mutant Lb11Hincreases the expression level of folded protein byup to 50% (Figure 10A). Position Db57 in DRBalleles, although usually Asp, is polymorphic.Interestingly, the substitution Db57A is character-istic of DQ alleles that correlate with insulin-dependent diabetes mellitus (IDDM) suscepti-bility.51 Residues Db57 in the b1 domain and Ra76in the a1 domain form a salt-bridge underneaththe bound peptide that links the HLA-DR1 b1and a1 chain helical regions. The substitution ofAsp by Ala breaks this salt bridge and thereforecould destabilize the structure of HLA-DR1. How-ever, our thermostability data obtained with themutant scDR1abLb11H,Db57A (inset of Figure 9) donot seem to indicate that the Db57A substitutionaffects the stability of the single-chain DR1molecules. This observation is in agreement withdata reported for DQ molecules in which theDb57A substitution predominately alters the pep-tide-binding specificity rather than the overallstability of either empty or peptide-loaded formsof these MHC molecules.52 Therefore, the contri-bution of this salt bridge does not seem to beimportant for protein stability. However, formationof this salt bridge might be a kinetic barrier for thefolding of the scDR1ab molecule, as was proposedfor other proteins.53 Since Ab57 increases thehydrophobic interaction with Vb38 and Wb61 inthe b1 chain (Figure 11D), it is likely that Db57Amay lower a kinetic barrier in the folding pathwayof single-chain DR1 by enhancing the stability ofthe hydrophobic core of the b1a1 domain. How-ever, we cannot exclude the possibility that thesethree mutations favor the close packing with someyeast endogenous peptides that in turn help tostabilize a conformation that is critical to sub-sequent binding of high affinity peptides, such asthe HA306–318 peptide. Recently, it has beenreported that mutation S11F in the b1 domain ofDR3 stabilized the CLIP peptide in the antigen-binding groove,54 whereas different mutations inthe residue 57b of I-Ag7 molecules yielded morestabilized variants.33 Other mutations, such asIa8T or Da181N, seem to be not important for thefolding of scDR1. As shown in Figure 11A,mutation Ia8T is located on the interface betweena1b1 and a2b2. The single mutant abIa8T showednear background reactivity against the confor-mational antibodies L243 and LB3.1 (data notshown), indicating a negligible role of thismutation in the folding of scDR1. The othermutation, Da181N, is located on a surface-exposedloop at the carboxyl terminal end of b2, far awayfrom the peptide-binding platform. Thus, thismutation is also unlikely important for the foldingor stability of scDR1.

The evolved single-chain DR1 variants werefolded properly since they reacted with severalconformation-sensitive DR-specific monoclonal

antibodies and formed a stable complex withDR-specific antigenic peptide HA306–318. Althoughthese molecules seem to be occupied by someendogenous peptides, they were fully competentto bind exogenously added peptides. Furthermore,the kinetics of the peptide binding was also muchfaster than those reported for human or mouseclass II proteins (50% maximum binding after lessthan five hours) (Figure 8). More importantly, asshown in Figure 7, the binding of HA306–318 tothese variants was specific, sensitive, and appearedin a dose-dependent manner, which provides thebasis for the development of high throughputscreening methods for directed evolution of DR1variants with improved peptide binding affinityor isolation of novel DR1-binding peptides.

The apparent Kd values of these variants deter-mined by Scatchard plots were six to 12-foldlower than that obtained for DR1 molecules on thecell surface (50 mM) using indirect labeling andflow cytometry,41 but higher than that of purifiedrecombinant DR1 (14 nM).55 However, thesedirect binding assays do not necessarily reflect theintrinsic affinity between peptide and MHC. Themeasured affinities may also contain contributionsfrom conformational changes. It was recentlyshown that the conformational change in theDR1 molecules is the rate-determining step forHA306–318 binding to DR1, indicating that theenergy barrier for the conformational change is sig-nificantly higher than that for peptide binding.56

As a result, the peptide binding affinity couldbe vastly underestimated. It is noteworthy thatalthough some yeast endogenous peptides mayremain bound to the scDR1ab variants, and inturn, contribute to maintain scDR1ab molecules ina peptide-receptive conformation, other additionalconformational changes may be required for thebinding of specific high-affinity peptides. Theobservation that scDR1ab molecules displayed onthe yeast cell surface increase their reactivityagainst the LB3.1 and L243 antibodies upon incu-bation with the HA306–318 peptide suggests that thebinding of the high-affinity peptide HA306–318

further changes the conformation that is shapedby the low affinity peptides. In addition, inherentproblems of cellular binding assays such as aggre-gation of cells or other technical difficulties suchas limited solubility of peptides may complicatethe measurement of the real affinities.

Yeast-displayed scDR1ab variants formed stableab heterodimers in the absence of an antigenicpeptide (Figure 8). The “functionally empty”heterodimers remained stable after incubation at37 8C for three days and they were capable of bind-ing peptide after storage at 4 8C for more than fourmonths. It has been reported that empty class IIMHC molecules lose their receptive conformationquickly and consequently their ability forrapid binding of peptides.56 Conversely, class IImolecules that are bound to peptide ligand areextremely receptive for the binding of otherhigher affinity peptides.56 Thus, the use of the


yeast-displayed scDR1 molecules that are dis-sociating from low-affinity yeast peptides may pro-vide a homogenous pool of active MHC moleculesfor determination of peptide binding.

The system and strategy developed for displayof functionally empty single-chain HLA-DR1molecules may serve as a platform technology fordevelopment of new MHC-based diagnostic andtherapeutic reagents. Since the binding of exo-genous labeled peptides to cell surface-associatedHLA-DR1 can be monitored by flow cytometry atthe single cell level, this system may allow thefurther engineering of DR1 molecules with novelor improved peptide specificity or increased pep-tide affinity with great ease. Thus, these engineeredDR1 molecules may exhibit better clinical per-formance therapeutics and diagnostics reagentsfor autoimmune and infectious diseases. Similarly,the system developed might also enable the designof peptide-based vaccines with improved clinicalperformance. In addition, since the DR-peptidebinding reaction can be easily monitored by flowcytometry, the ability to engineer MHC moleculesby yeast cell surface display and directed evolutionmay offer excellent opportunities to characterizestructural requirements in peptide binding forthose class II and class I molecules recalcitrant toexpression or purification.57 Finally, it was reportedthat proteins expressed at higher levels on theyeast cell surface are also expressed at significantlyhigher levels in a yeast secretion system.58 Indeed,mutant scDR1abLb11H,Db57A resulted in more solublefolded proteins than the wild-type scDR1ab whenexpressed in Saccharomyces cerevisiae BJ5464 (O.E.& H.Z., unpublished results). Thus, it may now bepossible to produce selected class II proteins at alarge scale in yeast secretion systems that have notbeen successful to date.

Materials and Methods

Materials

sscDRbHA plasmid59 that encodes the single-chainHAba gene was provided by Dr M. Mage (NIH,Bethesda, MD) and served as a template for PCR cloning.pYD1, a vector for yeast surface display of proteins, andS. cerevisiae EBY100 strain were purchased from Invitro-gen (Carlsbad, CA). Oligonucleotides were synthesizedby Integrated DNA Technologies (Coralville, IA). ClonedPfuTurbo DNA polymerase and Escherichia coli XL1-Bluewere purchased from Stratagene (La Jolla, CA). TaqDNA polymerase was purchased from Promega(Madison, WI). Endonuclease restriction enzymes, DNAligase and PNGase were from New England Biolabs(NEB, Beverly, MA). Peptides used here were synthe-sized and purified (.90%) commercially (Jerini AG,Berlin, Germany) and included a peptide containingresidues 306–318 of influenza virus hemagglutinin(HA306–318) and a HLA-A2-specific Tax-derivative pep-tide (Tax-8K). For biotinylated HA306–318 peptide (bio-HA306–318), the biotin was attached to its N terminus viaa linker of two 6-amino-hexanoic acid molecules. Forbiotinylated Tax peptide, the biotin was attached to the

1-amino group of a lysine residue, substituted at position8 of the Tax peptide (Tax-8Kbio). Monoclonal antibodiesused here were anti-DR L243 (Biodesign International,Saco, ME), LB3.1 (American Tissue Culture Collection(ATCC), Manassas, VA), Immu-357 (Beckman Coulter,Fullerton, CA), anti-DR, -DP and -DQ CR3/43 (Biomeda,Foster City, CA), anti-IAs,k,u.f KL304 (ATCC), anti-Xpress,and anti-V5 (Invitrogen, Carlsbad, CA). Biotin-conjugated goat-anti-mouse (GAM) IgG was purchasedfrom Rockland (Gilbertsville, PA) and streptavidin–phycoerytrin (SA-PE) conjugate was purchased fromPharMingen (San Diego, CA). Alkaline phosphatase-con-jugated GAM IgG was purchased from Sigma (St. Louis,MO). The Zymoprep miniprep kit was obtained fromZymoResearch (Orange, CA). The QIAprep spin plasmidmini-prep kits and QIAquick PCR purification kits werepurchased from Qiagen (Valencia, CA). Unless otherwiseindicated, all chemicals were purchased from Sigma(St. Louis, MO).

Generation of single-chain DR1 constructs

DNA encoding the extracellular domains of DRa andDRb joined by a linker of 15 amino acid residues (G4SG3-RSG4S) (scDR1ab) was prepared by splicing overlapextension PCR (SOE-PCR).60 The a and b-domains wereamplified from plasmid sscDRbHA with the oligo-nucleotide pairs a-5BX (50 GTACCAGGATCCAGTGTGGTGGAAAGGAAAGAACATGTGATC 30)/a-3GS (50

GCCAGAGCGGCCGCCACCTGAGCCGCCGCCTCTAACGTTCTCTGTAGTCTCTGG 30), and b-5GS (50 TCAGGTGGCGGCCGCTCTGGCGGAGGTGGATCCGGGGACACCCGACCAC 30)/b-3XH (50 CCCTCTAGACTCGAGCTTGCTCTGTGCAGATTCAGAC 30), respectively.The primers a-3GS and b-5GS overlap by 20 nucleotides(nt) and were modified to introduce a unique NotIrestriction site in the linker sequence that connects the ato the b-domain. These two PCR products were mixedtogether and assembled by a primerless PCR, followedby reamplification of the assembled products with theexternal oligonucleotides a-5BX and b-3XH. The finalproduct was purified, digested with BstXI and XhoI andcloned into the pYD1 vector digested with the samerestriction enzymes, giving the plasmid pYD1scab(Figure 1). DNA encoding the single-chain ba (scDR1ba)was also obtained from plasmid sscDRbHA by PCRamplification with the oligonucleotides b-5BX (50 GTACCAGGATCCAGTGTGGTGGAAGGGGACACCCGACCACG 30) and a-3XH (50 CCCTCTAGACTCGAGTAAGTTCTC TGTA GTCTCTGG 30). The resulting amplificationproduct was cloned into pYD1 via BstXI and XhoI to givepYD1scba (Figure 1). The plasmids were sequencedthrough the entire encoding sequence to verify theabsence of undesired mutations introduced by PCR.

Site-directed mutagenesis

Plasmids pYD1scabLb11H, pYD1scabLb26F,pYD1scabLb11H,Db57A, pYD1scabDb57A, pYD1scabVb75A,Qb92R

and pYD1scbLb11Ha were constructed using yeast in vivorecombination.61,62 For construction of pYD1scabLb11H

encoding scDR1ab with the mutation Lb11H in theb-chain, a DNA fragment encoding the last eight aminoacid residues at the carboxyl terminus of the a-chain,the linker region, and the first 56 amino acid residues ofthe b-chain were amplified with primers afor183 (50

CCAAG CCCTCTCCCAGAGAC 30) and brev56 (50 GGCCGCCCCAGCTCC 30) by cloned PfuTurbo polymerase


using the DO-1 mutant as a template. The resulting PCRfragment was cotransformed into S. cerevisiae EBY100strain with the NotI-cut pYD1ab DNA. Gap-repair by invivo yeast homologous recombination yielded plasmidpYD1scabLb11H. Similarly, for construction ofpYD1scabLb11H,Db57A, a DNA fragment encoding the lasteight amino acid residues at the carboxyl terminus ofthe a-chain, the linker region, and the first 73 aminoacid residues of the b-chain were amplified with primersafor183 and brev73-67 (5

0 GGCCCGCCTCTGCTCCAGGA 30)using the DO-1 mutant as a template and inserted intothe NotI-cut pYD1ab by yeast homologous recombina-tion. pYD1scabLb26F was constructed in the same wayexcept that PCR was conducted using DWP-5 as a tem-plate. pYD1scabDb57A was obtained by cotransformationof EBY100 with the NotI-cut pYD1abLb11H,Db57A DNAand the PCR fragment encoding the linker region andthe first 55 amino acid residues of the b-chain of thewild-type scDR1ab. Yeast EBY100 clones with plasmidscontaining the desired mutations were selected by PCRscreening with specific primers.

The PCR product encoding the single-chain ab withthe mutations Vb75A and Qb92R was also obtained bySOE-PCR. Briefly, DNA encoding the carboxyl terminalhalf of the a-chain, the linker, and the first 73 aminoacid residues from the b-chain were amplified frompYD1scab with primers a-back (50 CATAGCTGTGGACA AAGC 30) and brev73-67. DNA encoding amino acid resi-dues 67 to 196 from the b-chain was amplified from theDO-1 mutant with primers bfor67–73 (5

0 TCCTGGAGCAGAGGCGGGCC 30) and pYDR3 (50 AGTATGTGTAAAGTTGGTAACG 30). Primers brev73-67 and bfor67–73 overlap20 nt at their 50 end to force the annealing of the tworesulting PCR fragments during the SOE-PCR reaction.After primerless PCR assembly and reamplificationwith primers a-back and pYDR3, the DNA fragmentwas cloned into NotI/XhoI cut pYD1scab by yeasthomologous recombination to give pYD1scabVb75A,Qb92R.

For construction of pYD1scbLb11Ha, DNA encodingscba with the mutation Lb11H in the b-chain was ampli-fied from plasmid H2-1 with primers Xpress (50 GGTCGGGATCTGTACGACGATGACGATAAGGTACCAGGATCCAGTGGGGACACCCGACCACGTTTC 30) and a-3XHin the presence of cloned PfuTurbo DNA polymerase.pYD1scbaLb11H was finally obtained by recombining theoverlapping PCR fragment into BstXI/SpeI digestedpYD1scba through cotransformation of both DNAmolecules in S. cerevisiae EBY100 strain.

Plasmids of the different site-directed mutants wererescued from yeast cells, transferred into E. coli, andsequenced to confirm the presence of the introducedspecific mutations and the absence of PCR associatedrandom mutations.

Generation of a library of scDR1ab variants

Error-prone PCR was used to create a library ofscDR1ab variants as described elsewhere.63 Briefly, thescDR1ab construct was amplified from pYD1scab usinga flanking AGA2-specific upstream primer, pYD1for (50

AGTAACGTTTGTCAGTAATTGC 30), and a MATatranscription terminator-specific downstream primer,pYDR3. The purified PCR product was digested withBstXI and XhoI and ligated into BstXI-XhoI-digestedpYD1. The ligation mixture was transformed intoXL-Blue electrocompetent E. coli yielding a library of1.1 £ 106 transformants. Clones of the library werepooled into 400 ml LB supplemented with

ampicillin and tetracycline, and grown overnight at37 8C. Plasmid DNA was purified and transformed intoyeast strain EBY100 as described elsewhere.64

Protein expression and analysis

EBY100 clones harboring the single-chain DR1 mol-ecules were grown in SD-CAA (4% (w/v) dextrose,0.67% (w/v) yeast nitrogen base, 1% (w/v) Casaminoacids) at 30 8C for <20 hours. To induce AGA2 fusionprotein expression, yeast cells were centrifuged and sus-pended to an absorbance value of A600 < 1.0 in SG-CAA(2% (w/v) galactose, 0.67% yeast nitrogen base, 1% Casa-mino acids) (for induction of libraries) or YPG medium(10 g/l yeast extract, 20 g/l peptone, 20 g/l galactose)(for induction of individual clones) at 20 8C for 48hours. For immunoblot analysis, 5 £ 107 cells were centri-fuged and resuspended in 50 ml of sample buffer (0.06 MTris–HCl (pH 6.8), 10% (v/v) glycerol, 2% (w/w) SDS,5% (v/v) 2-mercaptoethanol and 0.0025% bromophenolblue) and boiled for five minutes. Ten microliters of thissample was taken for analysis by SDS-12% PAGE andelectrotransferred onto PVDF membranes. After blockingwith bovine serum albumin (BSA), the membrane wassubjected to immunodetection with the DR, DP and DQb-chain-specific antibody CR3/43 for one hour at roomtemperature. Alkaline phosphatase-conjugated GAMantibody was used as a secondary antibody. The mem-branes were finally developed with the chromogenicsubstrates bromo-4-chloro-3-indolyl-phosphate andnitroblue tetrazolium. For flow cytometric analysis,<107 cells were washed with phosphate buffered saline(PBS) containing 0.5% (w/v) BSA and incubated for onehour at 4 8C with the primary antibody staining reagent.The antibodies used were anti-DR L243, LB3.1, Immu-357, CR3/43; anti-IAs,k,u.f KL304, anti-V5, and anti-Xpress. Cells were washed with PBS containing 0.5%BSA and incubated for one hour at 4 8C with biotinylatedGAM IgG followed by SA-PE for 30 minutes at 4 8C.Labeled yeast cells were analyzed on a Coulter Epics XLflow cytometer at the Biotechnology Center of Universityof Illinois (Urbana, IL).

Selection of scDR1ab variants by fluorescenceactivated cell sorting (FACS)

The library of scDR1ab variants was sorted throughthree cycles of FACS after yeast cell staining with anti-HLA-DR antibody L243 followed by biotin-labeledGAM IgG and SA-PE conjugate. In each cycle, yeastcells collected from the previous sort were cultured inSD-CAA and protein expression was induced withSG-CAA as described in the previous section. A total of5 £ 107 cells were examined during the first sortinground and <1.5% of the population with the highestfluorescence were collected by using a Coulter 753bench fluorescence-activated cell sorter. 107 cells werescreened during the second and third sorting round andthe top 0.4% and 0.1% of the population were collected,respectively. The concentrations of L243 antibody usedfor staining were 4 mg/ml for the first two sorts and0.4 mg/ml for the third sort. After the third round, sortedcells were plated on selective media and individualclones were isolated and analyzed by flow cytometrywith the conformational antibodies L243, LB3.1 andImmu-357 as well as the anti-V5 antibody. Plasmids ofthose clones with the highest fluorescence were rescuedfrom yeast using a Zymoprep miniprep kit and


transformed into E. coli DH5a cells. Plasmids were puri-fied using a Qiaprep spin plasmid miniprep kit. DNAsequencing was carried out using a BigDyee sequencingkit and an ABI PRISM 3700w sequencer (Applied Bio-systems, Foster City, CA) at the Biotechnology Center ofUniversity of Illinois (Urbana, IL).

Peptide binding assay

4 £ 106 yeast cells expressing single-chain DR1molecules were incubated with biotinylated HA306–318

(HLA-DR1-specific) or Tax (HLA-A2-specific) peptide atvarious concentrations for 20 hours at 37 8C in 40 ml ofYPG (pH 6.5). Cells were then washed and stained withSA-PE for one hour at 4 8C and analyzed by flowcytometry. Yeast cells displaying class I molecules werealso used as a negative control. For competitive bindingassays, the biotinylated HA306–318 peptide at a final con-centration of 10 mM in 50 ml of YPG was incubated withdifferent concentrations of unlabeled competitors(HA306–318 or Tax-8K) and 4 £ 106 scDR1-displayingyeast cells for 20 hours at 37 8C.

To determine the kinetics of peptide binding, 4 £ 106

yeast cells displaying scDR1ab molecules were incu-bated with 40 mM of biotinylated HA306–318 at 37 8C fordifferent time intervals and the fraction of bound peptidewas measured with SA-PE as described above.

Thermal stability assay

The thermal stability of scDR1ab variants was moni-tored directly on the yeast cell surface as describedelsewhere.42 Samples of 4 £ 106 yeast cells were incu-bated at temperatures of 40, 50, 60, 70, 75 or 80 8C forten minutes. Immediately after the incubation period,protein denaturation was halted with ice-cold PBS con-taining 0.5% BSA. Yeast cells were centrifuged and thefraction of folded DR1 protein was determined byincubation with conformation-sensitive L234 and LB3.1antibodies followed by biotinylated-labeled goat-anti-mouse and SA-PE. Thermal denaturation curves weregenerated in two independent experiments and the T1/2

values (temperature at which half-maximal denaturationoccurred) were calculated.

Molecular modeling

The crystal structure of the human class II DR1 incomplex with the HA306–318 peptide

65 (Protein Data Bankaccession code: 1DLH) was used as the basis for molecu-lar modeling by the Molecular Operating Environment(MOE; Chemical Computing Groups Inc., Montreal,Canada). A rotamer search was performed with thesingle site specific mutation (Lb11H, Db57A or Lb26F)and the whole structures of the single mutant (Lb26F)and the double mutant (Lb11H and Db57A) wereenergy minimized with the bound peptide. Energyminimization was performed using the MMFF94forcefield. To facilitate the examination of themolecular basis of these mutations on the proper foldingof evolved scDR1ab variants, the three-dimensionalstructures of the modeled single scDR1ab mutants andthe wild-type DR1 in complex with HA306–318 weresuperimposed.

Acknowledgements

We thank Dr Michael Mage for providing us thesscDRbHA plasmid, Dr Jeffrey Frelinger for theKL295 monoclonal antibody that was used in sub-stitution for the KL304 antibody in our earlyexperiments, and Dr Dave Kranz and his groupmembers, especially Brent Orr & Susan Brophy,for helpful discussions and advice on the yeast dis-play system. We also thank the School of ChemicalSciences’ Computer Application and NetworkServices (CANS) group at University of Illinoisfor access to MOE and Barbara Pilas, Ben Montez& Igor Trilisky of University of Illinois FlowCytometry Facility for flow cytometry and FACSassistance. The authors are grateful for commentson the manuscript by Dr Dave Kranz. This workwas supported by the Campus Research Boardand the Department of Chemical and BiomolecularEngineering of University of Illinois at Urbana-Champaign.

References

1. Strominger, J. L. & Wiley, D. C. (1995). The 1995Albert Lasker Medical Research Award. The class Iand class II proteins of the human major histo-compatibility complex. J. Am. Med. Assoc. 274,1074–1076.

2. Tiwari, J. L. & Terasaki, P. I. (1981). HLA-DR and dis-ease associations. Prog. Clin. Biol. Res. 58, 151–163.

3. Singh, N., Agrawal, S. & Rastogi, A. K. (1997). Infec-tious diseases and immunity: special reference tomajor histocompatibility complex. Emerging Infect.Dis. 3, 41–49.

4. Maile, R., Wang, B., Schooler, W., Meyer, A., Collins,E. J. & Frelinger, J. A. (2001). Antigen-specific modu-lation of an immune response by in vivo admini-stration of soluble MHC class I tetramers. J. Immunol.167, 3708–3714.

5. Casares, S., Hurtado, A., McEvoy, R. C., Sarukhan,A., von Boehmer, H. & Brumeanu, T. D. (2002).Down-regulation of diabetogenic CD4 þ T cells by asoluble dimeric peptide-MHC class II chimera.Nature Immunol. 3, 383–391.

6. Masteller, E. L., Warner, M. R., Ferlin, W., Judkowski,V., Wilson, D., Glaichenhaus, N. & Bluestone, J. A.(2003). Peptide-MHC class II dimers as therapeuticsto modulate antigen-specific T cell responses in auto-immune diabetes. J. Immunol. 171, 5587–5595.

7. Sharma, S. D., Nag, B., Su, X. M., Green, D., Spack,E., Clark, B. R. & Sriram, S. (1991). Antigen-specifictherapy of experimental allergic encephalomyelitisby soluble class II major histocompatibility complex-peptide complexes. Proc. Natl Acad. Sci. USA, 88,11465–11469.

8. Kwok, W. W., Ptacek, N. A., Liu, A. W. & Buckner,J. H. (2002). Use of class II tetramers for identificationof CD4 þ T cells. J. Immunol. Methods, 268, 71–81.

9. Boehncke, W. H., Takeshita, T., Pendleton, C. D.,Houghten, R. A., Sadegh-Nasseri, S., Racioppi, L.et al. (1993). The importance of dominant negativeeffects of amino acid side chain substitution inpeptide–MHC molecule interactions and T cellrecognition. J. Immunol. 150, 331–341.

10. van der Burg, S. H., Visseren, M. J., Brandt, R. M.,


Kast, W. M. & Melief, C. J. (1996). Immunogenicity ofpeptides bound to MHC class I molecules dependson the MHC–peptide complex stability. J. Immunol.156, 3308–3314.

11. Hackett, C. J. & Sharma, O. K. (2002). Frontiers inpeptide-MHC class II multimer technology. NatureImmunol. 3, 887–889.

12. Arnold, F. H. (2001). Combinatorial and compu-tational challenges for biocatalyst design. Nature,409, 253–257.

13. Schmidt-Dannert, C. (2001). Directed evolution ofsingle proteins, metabolic pathways, and viruses.Biochemistry, 40, 13125–13136.

14. Waldo, G. S. (2003). Genetic screens and directedevolution for protein solubility. Curr. Opin. Chem.Biol. 7, 33–38.

15. Pedelacq, J. D., Piltch, E., Liong, E. C., Berendzen, J.,Kim, C. Y., Rho, B. S. et al. (2002). Engineering solubleproteins for structural genomics. Nature Biotechnol.20, 927–932.

16. Bulter, T., Alcalde, M., Sieber, V., Meinhold, P.,Schlachtbauer, C. & Arnold, F. H. (2003). Functionalexpression of a fungal laccase in Saccharomycescerevisiae by directed evolution. Appl. Environ. Micro-biol. 69, 987–995.

17. Kalandadze, A., Galleno, M., Foncerrada, L.,Strominger, J. L. & Wucherpfennig, K. W. (1996).Expression of recombinant HLA-DR2 molecules—replacement of the hydrophobic transmembraneregion by a leucine zipper dimerization motif allowsthe assembly and secretion of soluble DR alpha betaheterodimers. J. Biol. Chem. 271, 20156–20162.

18. Scott, C. A., Garcia, K. C., Carbone, F. R., Wilson, I. A.& Teyton, L. (1996). Role of chain pairing for theproduction of functional soluble IA major histocom-patibility complex class II molecules. J. Expt. Med.183, 2087–2095.

19. Kozono, H., White, J., Clements, J., Marrack, P. &Kappler, J. (1994). Production of soluble MHC classII proteins with covalently bound single peptides.Nature, 369, 151–154.

20. Scheirle, A., Takacs, B., Kremer, L., Marin, F. &Sinigaglia, F. (1992). Peptide binding to solubleHLA-DR4 molecules produced by insect cells.J. Immunol. 149, 1994–1999.

21. Stern, L. J. & Wiley, D. C. (1992). The human class IIMHC protein HLA-DR1 assembles as empty alphabeta heterodimers in the absence of antigenic pep-tide. Cell, 68, 465–477.

22. Boder, E. T. & Wittrup, K. D. (1997). Yeast surface dis-play for screening combinatorial polypeptidelibraries. Nature Biotechnol. 15, 553–557.

23. Boder, E. T. & Wittrup, K. D. (1998). Optimal screen-ing of surface-displayed polypeptide libraries. Bio-technol. Prog. 14, 55–62.

24. Yeung, Y. A. & Wittrup, K. D. (2002). Quantitativescreening of yeast surface-displayed polypeptidelibraries by magnetic bead capture. Biotechnol. Prog.18, 212–220.

25. Wittrup, K. D. (2001). Protein engineering by cell-surface display. Curr. Opin. Biotechnol. 12, 395–399.

26. Boder, E. T., Midelfort, K. S. & Wittrup, K. D. (2000).Directed evolution of antibody fragments withmonovalent femtomolar antigen-binding affinity.Proc. Natl Acad. Sci. USA, 97, 10701–10705.

27. Feldhaus, M. J., Siegel, R. W., Opresko, L. K.,Coleman, J. R., Feldhaus, J. M., Yeung, Y. A. et al.(2003). Flow-cytometric isolation of human anti-bodies from a nonimmune Saccharomyces cerevisiae

surface display library. Nature Biotechnol. 21,163–170.

28. Kieke, M. C., Cho, B. K., Boder, E. T., Kranz, D. M. &Wittrup, K. D. (1997). Isolation of anti-T cell receptorscFv mutants by yeast surface display. Protein Eng.10, 1303–1310.

29. Holler, P. D., Holman, P. O., Shusta, E. V., O’Herrin,S., Wittrup, K. D. & Kranz, D. M. (2000). In vitroevolution of a T cell receptor with high affinity forpeptide/MHC. Proc. Natl Acad. Sci. USA, 97,5387–5392.

30. Kieke, M. C., Shusta, E. V., Boder, E. T., Teyton, L.,Wittrup, K. D. & Kranz, D. M. (1999). Selectionof functional T cell receptor mutants from a yeastsurface-display library. Proc. Natl Acad. Sci. USA, 96,5651–5656.

31. Kieke, M. C., Sundberg, E., Shusta, E. V., Mariuzza,R. A., Wittrup, K. D. & Kranz, D. M. (2001). Highaffinity T cell receptors from yeast display librariesblock T cell activation by superantigens. J. Mol. Biol.307, 1305–1315.

32. Shusta, E. V., Holler, P. D., Kieke, M. C., Kranz, D. M.& Wittrup, K. D. (2000). Directed evolution of astable scaffold for T-cell receptor engineering. NatureBiotechnol. 18, 754–759.

33. Starwalt, S. E., Masteller, E. L., Bluestone, J. A. &Kranz, D. M. (2003). Directed evolution of a single-chain class II MHC product by yeast display. ProteinEng. 16, 147–156.

34. Schweickhardt, R. L., Jiang, X., Garone, L. M. &Brondyk, W. H. (2003). Structure-expression relation-ship of tumor necrosis factor receptor mutants thatincrease expression. J. Biol. Chem. 278, 28961–28967.

35. Frayser, M., Sato, A. K., Xu, L. & Stern, L. J. (1999).Empty and peptide-loaded class II major histocom-patibility complex proteins produced by expressionin Escherichia coli and folding in vitro. Protein Expr.Purif. 15, 105–114.

36. Boder, E. T. & Wittrup, K. D. (2000). Yeast surface dis-play for directed evolution of protein expression,affinity, and stability. Methods Enzymol. 328, 430–444.

37. Zhao, H., Shen, Z. M., Kahn, P. C. & Lipke, P. N.(2001). Interaction of alpha-agglutinin and a-aggluti-nin, Saccharomyces cerevisiae sexual cell adhesionmolecules. J. Bacteriol. 183, 2874–2880.

38. LaPan, K. E., Klapper, D. G. & Frelinger, J. A. (1992).Production and characterization of two new mousemonoclonal antibodies reactive with denaturedmouse class II beta chains. Hybridoma, 11, 217–223.

39. Santambrogio, L., Sato, A. K., Fischer, F. R., Dorf,M. E. & Stern, L. J. (1999). Abundant empty class IIMHC molecules on the surface of immature den-dritic cells. Proc. Natl Acad. Sci. USA, 96,15050–15055.

40. Stratmann, T., Apostolopoulos, V., Mallet-Designe,V., Corper, A. L., Scott, C. A., Wilson, I. A. et al.(2000). The I-Ag7 MHC class II molecule linked tomurine diabetes is a promiscuous peptide binder.J. Immunol. 165, 3214–3225.

41. Busch, R. & Rothbard, J. B. (1990). Detection ofpeptide–MHC class-II complexes on the surface ofintact cells. J. Immunol. Methods, 134, 1–22.

42. Orr, B. A., Carr, L. M., Wittrup, K. D., Roy, E. J. &Kranz, D. M. (2003). Rapid method for measuringScFv thermal stability by yeast surface display. Bio-technol. Prog. 19, 631–638.

43. Ueda, M. & Tanaka, A. (2000). Genetic immobili-zation of proteins on the yeast cell surface. Biotechnol.Advan. 18, 121–140.


44. Hammond, C. & Helenius, A. (1994). Quality controlin the secretory pathway: retention of a misfoldedviral membrane glycoprotein involves cyclingbetween the ER, intermediate compartment, andGolgi apparatus. J. Cell Biol. 126, 41–52.

45. Chang, J. W., Mechling, D. E., Bachinger, H. P. &Burrows, G. G. (2001). Design, engineering, and pro-duction of human recombinant T cell receptorligands derived from human leukocyte antigen DR2.J. Biol. Chem. 276, 24170–24176.

46. Thomas, A., Meurisse, R. & Brasseur, R. (2002).Aromatic side-chain interactions in proteins. II.Near- and far-sequence Phe-X pairs. Proteins: Struct.Funct. Genet. 48, 635–644.

47. Burley, S. K. & Petsko, G. A. (1986). Amino–aromaticinteractions in proteins. FEBS Letters, 203, 139–143.

48. Burley, S. K. & Petsko, G. A. (1988). Weakly polarinteractions in proteins. Advan. Protein Chem. 39,125–189.

49. Zauhar, R. J., Colbert, C. L., Morgan, R. S. & Welsh,W. J. (2000). Evidence for a strong sulfur–aromaticinteraction derived from crystallographic data. Bio-polymers, 53, 233–248.

50. Reid, K. S. C., Lindley, P. F. & Thornton, J. M. (1985).Sulphur–aromatic interactions in proteins. FEBSLetters, 190, 209–213.

51. Todd, J. A., Bell, J. I. & Mcdevitt, H. O. (1987). HLA-DQ-beta gene contributes to susceptibility and resist-ance to insulin-dependent diabetes-mellitus. Nature,329, 599–604.

52. Sato, A. K., Sturniolo, T., Sinigaglia, F. & Stern, L. J.(1999). Substitution of aspartic acid at beta57 withalanine alters MHC class II peptide binding activitybut not protein stability: HLA-DQ (alpha1p0201,beta1p0302) and (alpha1p0201, beta1p0303). Hum.Immunol. 60, 1227–1236.

53. Waldburger, C. D., Jonsson, T. & Sauer, R. T. (1996).Barriers to protein folding: formation of buriedpolar interactions is a slow step in acquisition ofstructure. Proc. Natl Acad. Sci. USA, 93, 2629–2634.

54. Doebele, R. C., Pashine, A., Liu, W., Zaller, D. M.,Belmares, M., Busch, R. & Mellins, E. D. (2003).Point mutations in or near the antigen-bindinggroove of HLA-DR3 implicate class II-associatedinvariant chain peptide affinity as a constraint onMHC class II polymorphism. J. Immunol. 170,4683–4692.

55. Sato, A. K., Zarutskie, J. A., Rushe, M. M., Lomakin,A., Natarajan, S. K., Sadegh-Nasseri, S. et al. (2000).

Determinants of the peptide induced conformationalchange in the human class II major histocompati-bility complex protein HLA-DR1. J. Biol. Chem. 275,2165–2173.

56. Natarajan, S. K., Assadi, M. & Sadegh-Nasseri, S.(1999). Stable peptide binding to MHC class IImolecule is rapid and is determined by a receptiveconformation shaped by prior association with lowaffinity peptides. J. Immunol. 162, 4030–4036.

57. Ferlin, W., Glaichenhaus, N. & Mougneau, E. (2000).Present difficulties and future promise of MHCmultimers in autoimmune exploration. Curr. Opin.Immunol. 12, 670–675.

58. Shusta, E. V., Raines, R. T., Pluckthun, A. & Wittrup,K. D. (1998). Increasing the secretory capacity ofSaccharomyces cerevisiae for production of single-chain antibody fragments. Nature Biotechnol. 16,773–777.

59. Zhu, X., Bavari, S., Ulrich, R., Sadegh-Nasseri, S.,Ferrone, S., McHugh, L. & Mage, M. (1997). A recom-binant single-chain human class II MHC molecule(HLA-DR1) as a covalently linked heterotrimer ofalpha chain, beta chain, and antigenic peptide, withimmunogenicity in vitro and reduced affinity for bac-terial superantigens. Eur. J. Immunol. 27, 1933–1941.

60. Horton, R. M., Ho, S. N., Pullen, J. K., Hunt, H. D.,Cai, Z. & Pease, L. R. (1993). Gene splicing by over-lap extension. Methods Enzymol. 217, 270–279.

61. Oldenburg, K. R., Vo, K. T., Michaelis, S. & Paddon,C. (1997). Recombination-mediated PCR-directedplasmid construction in vivo in yeast. Nucl. AcidsRes. 25, 451–452.

62. Prado, F. & Aguilera, A. (1994). New in vivo cloningmethods by homologous recombination in yeast.Curr. Genet. 25, 180–183.

63. Zhao, H., Giver, L., Shao, Z., Affholter, J. A. &Arnold, F. H. (1998). Molecular evolution by stag-gered extension process (StEP) in vitro recombina-tion. Nature Biotechnol. 16, 258–261.

64. Gietz, R. D. & Woods, R. A. (2002). Transformation ofyeast by lithium acetate/single-stranded carrierDNA/polyethylene glycol method. Guide YeastGenet. Mol. Cell Biol., Part B, 350, 87–96.

65. Stern, L. J., Brown, J. H., Jardetzky, T. S., Gorga, J. C.,Urban, R. G., Strominger, J. L. & Wiley, D. C. (1994).Crystal structure of the human class II MHC proteinHLA-DR1 complexed with an influenza virus pep-tide. Nature, 368, 215–221.

Edited by I. Wilson

(Received 9 February 2004; received in revised form 16 April 2004; accepted 20 April 2004)


directed evolution of soluble single-chain human class ii mhc

Documents