differential mrp1-6 isoform expression and function in...

Prime-Chapman et al. 1

Differential MRP1-6 isoform expression and function in human

intestinal epithelial Caco-2 cells

Hannah M Prime-Chapman, Richard A. Fearn,

Anne E. Cooper, Vanessa Moore, Barry H Hirst

School of Cell & Molecular Biosciences, University of Newcastle, Medical

School, Newcastle upon Tyne NE2 4HH, UK (HMP-C, RAF, BHH)

and

Pharmaceutical & Analytical R&D (VM), and Department of Physical &

Metabolic Science (AEC), AstraZeneca R&D Charnwood, Bakewell Road,

Loughborough, Leicestershire LE11 5RH, UK

JPET Fast Forward. Published on June 21, 2004 as DOI:10.1124/jpet.104.068775

Copyright 2004 by the American Society for Pharmacology and Experimental Therapeutics.

This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 21, 2004 as DOI: 10.1124/jpet.104.068775

at ASPE

T Journals on A

ugust 5, 2020jpet.aspetjournals.org

Dow

nloaded from

http://jpet.aspetjournals.org/


Running title: Intestinal MRP isoform expression and function

Corresponding author:

Professor Barry H Hirst,

School of Cell & Molecular Biosciences, University of Newcastle, Medical School,

Newcastle upon Tyne NE2 4HH, UK.

Tel: +44-191 222 6993

Fax: +44 191 222 6706

Email: [email protected]

Total pages: 31 [Text pages excl. refs, legends 20]

Tables: 1

Figures: 5

References: 43

Words: Abstract 249

Introduction 596

Discussion 1263

Abbreviations: MRP, Multidrug resistance-associated protein

Recommended section: Absorption, Distribution, Metabolism, & Excretion


at ASPE

T Journals on A


Dow

nloaded from



Abstract

MRP isoforms 1-6 mRNA are expressed in the human intestine and Caco-2 cells. In

Caco-2 cells, the rank order for mRNA expression was MRP2 ≥ MRP6 > MRP4 ≥

MRP3 > MRP1 = MRP5. The functional expression of MRP-like activity was

quantified as the efflux of the fluorescent probe calcein from confluent, polarised

monolayers of Caco-2 cells. Calcein efflux was sensitive to temperature, energy-

depletion and the MRP antagonist MK571. Calcein efflux across the apical membrane

of Caco-2 cells exceeded that across the basolateral by approximately 2-fold,

correlating with the apical localisation of MRP2 visualised by immunocytochemical

staining. T84 cells do not express MRP2 and show a predominance of basolateral

calcein efflux over apical efflux. MRP3 was localised by immunocytochemical

staining to the basolateral membrane. MRP1 staining was not localised to either

membrane domain and MRP5 staining was not detected. Thus basolateral calcein

efflux may reflect a function of MRP3, or MRP4 & 6 inferred by their basolateral

localisation in other tissues. Basolateral, but not apical, calcein efflux was sensitive to

glutathione depletion with buthionine-sulphoximine, indicating that while MRP2-

mediated apical efflux is independent of glutathione, basolateral efflux is glutathione-

dependent. Benzbromarone, probenecid, pravastatin and diclofenac were able to

inhibit both apical and basolateral calcein efflux. The apical calcein efflux in Caco-2

cells was selectively sensitive to indomethacin and propranolol, but not verapamil or

erythromycin, whereas the converse was observed for basal efflux. The differential

pharmacological sensitivity of apical (MRP2) and basolateral calcein efflux provides

tools for dissecting MRP isoform functional roles.


at ASPE

T Journals on A


Dow

nloaded from



INTRODUCTION

The intestinal epithelium provides a selective barrier, limiting the access of toxins

and other xenobiotics, including orally administered drugs, taken in with the diet,

while presenting an optimal surface for nutrient absorption. The intestinal epithelium

is also an important site for excretion of specific classes of xenobiotics and

endogenous toxins (Hunter & Hirst, 1997; Chan et al. 2004). The multidrug

resistance, MDR1 (ABCB1), gene product P-glycoprotein, subserves an important

part of this barrier function. P-glycoprotein provides for ATP-dependent efflux of a

wide spectrum of chemically-unrelated xenobiotics and drugs, in addition to the

classic cytotoxics such as vinblastine and daunomycin. The apical localisation of P-

glycoprotein in the enterocyte allows it to function both in limiting xenobiotic

absorption and in mediating intestinal xenobiotic secretion (Hunter et al. 1993a, b).

While P-glycoprotein has wide substrate specificity, it is recognised that other

membrane transport proteins provide a complimentary role, allowing for a greater

spectrum of xenobiotics to be handled (Chan et al. 2004).

The multidrug resistance-associated proteins (MRP) belong to the same ATP

binding cassette (ABC) gene super-family of membrane transporters as P-

glycoprotein, but together with CFTR and SUR, form a distinct gene family (ABCC).

MRPs and P-glycoprotein have a tandem repeat of six membrane spanning domains

linked to an ATP binding cassette, although MRP1-3 and 6-7 have an N-terminal

extension of an additional 5 membrane spanning domains (Tusnady et al. 1997; Chan

et al. 2004). The MRP family has been shown to transport a diverse range of

substrates. They predominantly transport anionic substances, but non-anionic organic

drugs have also shown to be transported; it is thought this may be accomplished via

either co-transport or conjugation with glutathione (Evers et al. 1998, 2000; Gerk &


at ASPE

T Journals on A


Dow

nloaded from



Vore, 2002; Chan et al. 2004). This contrasts with P-glycoprotein which favours

lipophyllic compounds of a cationic nature. Nevertheless, it is recognised that P-

glycoprotein and MRP isoforms illustrate wide overlap in both their substrate

specificity and inhibitors. To this extent, P-glycoprotein and MRPs provide both

complimentary and overlapping functionality as drug efflux pumps.

MRP1, 4 and 5 (ABCC1, 4 & 5) mRNA show relatively ubiquitous expression,

while the expression of MRP2, 3 and 6 (ABCC2, 3 & 6) is more restricted; expression

of the latter are notable in renal, intestinal and hepatic epithelia (Chan et al. 2004).

MRP2 is the only MRP isoform identified to date as localising to apical membranes

(Buchler et al. 1996), where it may be postulated to provide for apical drug efflux,

analogous to P-glycoprotein (Chan et al. 2004). In contrast, other MRP isoforms are

described to localise to basolateral membranes in a variety of epithelia (Peng et al.

1999; Kool et al. 1999; Chan et al. 2004).

In the present study we have used the Caco-2 cell model of the human intestinal

enterocyte to investigate the molecular expression of MRP1-6 and their membrane

localisation. We have then quantified the functional expression of MRP-like activity

with the fluorescent probe calcein (Versantvoort et al. 1995; Essodaigui et al. 1998)

and probed for functional differences in MRP-like activities at apical and basal

membranes with a range of pharmacological tools. T84 cells, a model of human

colonocytes which lack MRP2 expression (Lowes & Simmons, 2001; 2002), are used

in comparison. We report that MRP2 is expressed apically in Caco-2 cells, correlating

with the predominant apical efflux of calcein. This apical mediated MRP function is

sensitive to indomethacin and propranolol, but not verapamil or erythromycin,

whereas the converse is observed for basal efflux. The differential pharmacological


at ASPE

T Journals on A


Dow

nloaded from



sensitivity of apical (MRP2) and basolateral (MRP3 and/or 4&6) provides important

tools for investigation of their different functional roles.

MATERIALS AND METHODS

Materials

Cell culture reagents were obtained from Sigma (Poole, UK.). Culture plastic ware

was from Corning Costar (Bucks. UK). Specific oligonucleotide primers (Table 1)

were synthesised by the Molecular Biology Unit, University of Newcastle upon Tyne

(MRP2-5) or Sigma (MRP1 & 6). Monoclonal antibodies to MRP1, 2, 3 & 5 were

from Alexis Biochemicals (Nottingham, UK). Calcein acetoxymethyl ester was

purchased from Molecular Probes (Netherlands). Unless otherwise indicated Western

blot reagents were obtained from Novex. All other reagents unless stated otherwise

were supplied from Sigma.

Cell culture

Caco-2 cells (passage numbers 25-45) were from American Type Culture

Collection (ATCC) and cultured in Dulbecco’s modified Eagle’s medium (DMEM)

with 4.5g/l glucose, supplemented with 20% (v/v) foetal bovine serum, penicillin-

streptomycin (100U/ml & 100µg/ml respectively) and 1% (v/v) non-essential amino

acids. Cells were maintained at 37°C in a humidified atmosphere of 5% CO2 in air and

sub-cultured weekly. T84 cells (passage 52-62) from ATCC were maintained as for

Caco-2 cells in 1:1 Ham’s F-12/DMEM (glucose 4.5g/l) supplemented with 5% (v/v)

newborn calf serum, 1% (v/v) nonessential amino acids, 14mM N-(2-hydroxyethyl)

piperazine-N’-(2-ethanesulfonic acid) (HEPES) and gentamicin (30mg/l). Cell

monolayers were prepared by seeding (2.0×105 cells/24mm insert or 1x 105


at ASPE

T Journals on A


Dow

nloaded from



cells/12mm insert for Caco-2 and 1.0×106/24mm insert for T84 cells) on tissue culture

inserts (Transwell polycarbonate, 0.4µm pore size) and maintained as above for 14-21

days, with media replacement every 2-3 days. Transport studies were carried out on

24mm diameter monolayers with transepithelial electrical resistance (voltohmmeter,

World Precision Instruments) values >300Ω.cm2 and >1000Ω.cm2 for Caco-2 and

T84 monolayers, respectively, after subtraction of resistance values of inserts alone.

Polymerase chain reactions (PCR) for MRP1-6

Flask grown Caco-2 cells (two-weeks post seeding) were washed and then lysed by

addition of lysis buffer (50µg/ml proteinase K, 5mM EDTA, 0.25M NaCl, 0.25M

Tris-HCl [pH7.5], 2mM MgCl2 and 10%[w/v] sodium dodecyl sulphate [SDS]). The

lysed cell solution was passed four times through a 21-gauge needle and incubated at

45°C for 45 min. NaCl (317µl of 5M stock) was added and passage through a needle

repeated. Poly A+ RNA was then isolated from the cell lysate via overnight incubation

with oligo-dT cellulose (N6, Pharmacia Biotech, Herts., U.K.). The solution was

centrifuged at 4000g for 8 min, and the oligo-dT cellulose-poly A+ RNA pellet was

subjected to a series of washes in high (500mM NaCl, 10mM Tris-HCl [pH7.5]) to

medium (250mM NaCl, 10mM Tris-HCl [pH7.5]) salt buffers. Poly A+ RNA was

finally obtained after elution in a spin column following addition of 10mM Tris-HCl

and then precipitation by storage overnight at -80°C in sodium acetate and absolute

ethanol.

Snap frozen human small intestine and colon samples were obtained from

specimens taken for diagnostic purposes (Newcastle NHS Hospital Trusts), with

ethical approval and written informed consent. Total RNA was isolated using the


at ASPE

T Journals on A


Dow

nloaded from



RNAzol B isolation kit (Biogenesis Ltd, Poole, U.K) after which poly A+ RNA was

isolated by the method described above.

Reverse transcription was performed by incubating 0.1µg of poly A+ RNA, 0.5mM

each of the four dNTP’s (MBI Fermentas, Vilnius, Lithuania), 0.001U/µl random

hexanucleotide primers (Pharmacia biotech), 16U Ribonuclease Inhibitor (MBI

Fermentas), 20U Moloney Murine Leukemia Virus Reverse Transcriptase and 1x

reaction buffer (both MBI Fermentas) in a final volume of 20 µl for 2 h at 42°C.

Expression of MRP1-6 was analysed by standard PCR; using a hot-start protocol with

Platinum Taq DNA polymerase (Invitrogen), 2mM MgCl2, 0.2mM dNTP mix and

oligonucleotide primers (Table 1; 0.5µM) for each MRP isoform. PCR amplification

consisted of 30 cycles of denaturation at 94°C for 30 sec, extension at 55.4-65.3°C

(primer specific) for 30 sec, and 72°C for 30 sec. PCR products were separated by gel

electrophoresis through 1% agarose, stained with ethidium bromide and imaged under

UV light (AlphaImager, Flowgen, Staffs., U.K). PCR products were subcloned

(TOPO-TA; Invitrogen) for subsequent sequencing.

The relative abundance of MRP mRNA was then determined by semi-quantitative

RT-PCR. Total RNA was isolated from confluent flasks of Caco-2 cells or 12mm

Transwell inserts using the SV total RNA extraction kit (Promega). Reverse

transcription was performed as above with the following exceptions: 1 µg total RNA,

40U RNasin (Promega) and 100U M-MLV Reverse Transriptase with 1x reaction

buffer (Promega) were used. Expression of MRP1-6 was then compared with 18S

ribosomal RNA using PCR. PCR was performed as above with the following

exceptions: MgCl2 (1.5-2.5mM) and gene-specific primers (Table 1; 0.4-1.0µM) were

optimised for each MRP isoform and an 18S rRNA primer: competitor ratio of 1:10

(QuantumRNA kit, Ambion) was used. PCR amplification consisted of 28 cycles of


at ASPE

T Journals on A


Dow

nloaded from



denaturation at 94°C for 30 sec, extension at 55.9-64.3°C (primer specific) for 30 sec,

and 72°C for 30 sec.

Expression of MRP1-6 was also analysed using a human multiple tissue cDNA

panel (Clontech) containing samples pooled from 5 or more male and female donors

(except liver, 1 female and stomach male donors only). This was used to assess the

distribution of MRP1-6 through the gastrointestinal tract. PCR conditions were as for

semi-quantitative analysis, with the inclusion of glyceraldhyde-3-phosphate

dehydrogenase to ‘standardise’ for cDNA (Clontech).

Immunofluorescent staining for MRP

Caco-2 cells were grown on 12mm diameter Transwell inserts for the purpose of

immunostaining. Inserts were washed three times in phosphate buffered saline (PBS);

similar washes were included between each of the following stages. Cells were fixed

in 3% paraformaldehyde for 15 min, then permeabilised with 0.1% Triton X-100 for

10 min. Non-specific binding sites were blocked by incubation for 30 min with, 5%

normal sheep serum (MRP2 & 3) or 5% normal mouse serum (MRP1 & 5). Inserts

were incubated in primary antibody (MRP1= MRPr1, MRP2= M2III-6, MRP3= M3II-

9 and MRP5= M5I-I) diluted to 12.5µg/ml with PBS, for 60 min. Primary antibody

was detected by incubation with fluorescein isothiocyanate conjugated sheep anti-

mouse antibody for 60 min (MRP2 & 3) or with biotin conjugated mouse anti-rat for

60 min followed by streptavidin-cy5 for 60 min (MRP1 & 5). Cell nuclei were stained

with propidium iodide; 5µg/ml for 5 min. Inserts were washed and mounted in

Vectashield. Staining was viewed using a Leica NTS confocal laser scanning

microscope. As a control for non-specific binding, the above procedure was carried

out on matching filters with omission of the primary antibody.


at ASPE

T Journals on A


Dow

nloaded from



MRP2 protein (Western blot)

Cell protein was obtained by lysing Caco-2 cells with 2% (v/v) Igepal, 0.2% (w/v)

SDS and 1mM dithiothreitol (DTT) made in PBS containing a mini protease inhibitor

cocktail tablet. The protein concentration was determined using a BioRad DC protein

assay kit. Samples were separated on NUPAGE Tris-acetate 3-8% gels alongside a

high range molecular weight marker (Sigma). Proteins were transferred to Hybond-P

membrane (Amersham Life Science, Ltd, Bucks., U.K) by overnight electroblotting

and non-specific binding was blocked (5% milk powder with 0.1% Tween-20, 60

min). Primary antibody, diluted in blocking solution (MRP2 = M2III-6, 10µg/ml, or β-

actin antibody: A5060, Sigma, 1:125 dilution) was added and incubated for 120 min.

Membranes were washed in Tween-TBS and secondary antibody diluted in blocking

solution (Anti-mouse or -rabbit peroxidase conjugated antibodies, Amersham,

1:30000 and 1:45000, respectively) added for 60 min. Membranes were washed in

Tween-TBS and developed using an enhanced chemiluminescence plus (ECL+) kit

from Amersham.

Transport Studies

MRP functional activity was investigated by quantifying calcein efflux from

confluent layers of Caco-2 cells. The principle of the assay is to load the cells with

calcein using the membrane permeant form, calcein acetoxymethyl (AM) ester which

is cleaved by intracellular esterases to release the fluorescent metabolite calcein. The

efflux of free calcein (the fluorescent form) is then determined after washing away

excess calcein-AM. While calcein AM is a substrate for MDR1 and MRP, calcein is

not a substrate for MDR1, thus allowing specific MRP efflux activity to be

determined (Versantvoort et al. 1995; Essodaigui et al. 1998).


at ASPE

T Journals on A


Dow

nloaded from



Inserts were washed three times in Kreb’s buffer (137mM NaCl, 5.4mM KCl,

1.0mM MgSO4, 0.3mM KH2PO4, 10mM HEPES, 2.8mM CaCl2, 10mM Glucose, pH

to 7.4 with Tris) and were loaded with calcein via incubation with the acetoxymethyl

ester derivative (30 min at 37°C with 2µM calcein acetoxymethylester, cleaved by

cellular esterases to the fluorescent calcein). Inserts were washed again, placed in new

cluster plates at 37°C, and Kreb’s buffer was added apically and basally. Efflux was

determined by measuring the appearance of fluorescence in the bathing solutions (λex

492nm and λem 518nm; Perkin-Elmer LS-5 spectrofluorimeter). At the end of the

experiment, cells were lysed in distilled water and calcein fluorescence was

determined spectrofluorimetrically. Calcein efflux was calculated as a percentage of

the available substrate at each time point.

For transport studies in the presence of inhibitors, both apical and basal solutions

contained the inhibitor; high concentrations, based on literature information, tests

were performed with the concentrations indicated in the appropriate figure legend.

None of the inhibitors used interfered with the fluorescence of calcein.

Results are shown as means ± 1 standard error of mean. Where appropriate (and

unless otherwise indicated), results were analysed by Student t-test using non-

normalised data with a significance level of P≤0.05. Calcein efflux inhibition data are

shown as percentage of control values at time point 60 min.


at ASPE

T Journals on A


Dow

nloaded from



RESULTS

Intestinal expression of MRP mRNA

The expression of MRP1-6 was analysed in the human digestive tract using a

multiple tissue cDNA panel consisting of samples pooled from healthy donors. Bands

of the predicted sizes were amplified for MRP1, 3, 4 & 5 in all of the tissues (Fig. 1).

In addition MRP1-6 all showed significant levels of expression in the jejunum and

ileum, with lower expression in the duodenum (Fig. 1). MRP2 showed only low

levels of expression in the distal intestine, contrasting to very high levels of

expression in liver (Fig. 1). MRP6 also showed high expression in liver with low

expression in the distal intestine and no product in oesophagus (Fig. 1). PCR products

of the predicted sizes were also obtained for MRP1-6 in Caco-2 cells (Fig. 2A).

Sequencing of the PCR products from Caco-2 cells revealed 100% identity with the

sequence in GenBank (Table 1). In addition, sequencing of the PCR products from

human small intestine (MRP1-6) and human colon (MRP1, 3, 5 & 6) also revealed

100% identity with the sequence in GenBank (Table 1). The low yield of PCR

product for MRP2 & 4 in human colon prevented sequencing to confirm identity of

the product.

The expression of MRP1-6 in Caco-2 cells was determined relative to that of 18S

rRNA. The expression of MRP isoforms was compared for cells grown in flasks with

cells grown on tissue culture inset filters (Fig. 2). MRP2 and 6 were most abundant

PCR products, followed by MRP3 and 4, with expression of MRP1 and 5 lowest (Fig.

2).


at ASPE

T Journals on A


Dow

nloaded from



Immunofluorescent staining for MRP1, 2, 3 & 5

The localisation of MRP1-3 & 5 was investigated by indirect immunofluorescent

staining and confocal laser scanning microscopy. Cell nuclei were revealed with

propidium iodide. Monolayers stained with anti-MRP5 antibody, M5I-I, did not show

a detectable staining above background (omission of primary antibody). Positive

staining was observed for MRP1-3 (Fig. 3). When viewed en face, in the plane of the

monolayer, MRP1 staining appeared cytoplasmic and distributed throughout the cells,

strong staining was observed for MRP2 localised above the cell nuclei and MRP3

staining outlined cell junctions. Viewed in the plane perpendicular to the monolayer

confirmed MRP1 staining as intracellular and not associated with the cell membrane.

MRP2 staining localised to the apical membrane with some intracellular staining also

apparent, while MRP3 staining localised at the lateral membrane with very little

intracellular staining (Fig. 3). Antibodies to MRP4 or 6 were unavailable.

Calcein efflux from Caco-2 cell monolayers

Efflux of calcein from Caco-2 cells was greater to the apical compartment than the

basal (approx. 2-fold greater at 60 min; 0.27±0.02 and 0.12±0.01% of available

substrate/min [n=12], respectively; Fig. 4B). Calcein efflux into both apical and

basolateral compartments was sensitive to ATP-depletion (apical efflux 0.41±0.01

and 0.05 ±0.003; basal efflux 0.08±0.01 and 0.04±0.01 % available calcein/min at

60min [n=12], in the absence or presence, respectively, of an ATP-depleting solution

[15mM sodium azide/ 50mM 2-deoxyglucose]). The efflux of calcein into the apical

and basal compartments was also both significantly (two-way ANOVA) inhibited by

reduction of temperature to 4°C (0.11±0.01 and 0.06±0.004% available calcein/min at

60 min, [n=12], apical and basal efflux, respectively). In the presence of 10µM of the

MRP inhibitor, MK571 (Gekeler et al. 1995), both apical and basal efflux was


at ASPE

T Journals on A


Dow

nloaded from



significantly reduced (37.1±4.7 and 66.5±7.1% of control efflux (n=12), respectively;

Fig. 4B). These data are consistent with MRP-like activity localised at both apical and

basolateral membranes of Caco-2 cells.

Role of MRP2 in apical calcein efflux

The greater magnitude of the apical calcein efflux, considered together with the

apical localisation of MRP2 (Fig. 3) and the relative abundance of MRP2 mRNA in

Caco-2 cells (Fig. 2), leads to the hypothesis that MRP2 is the isoform mediating

apical calcein efflux. This hypothesis was tested by use of human colonic T84 cells.

Western blot analyses confirmed that Caco-2 cells express MRP2 protein, whereas

MRP2 was not detectable in T84 cells (Fig. 4A), in agreement with the low levels of

MRP2 mRNA in the distal intestine (Fig. 1). In T84 cells, in contrast to Caco-2 cells

(Fig. 4B), basal calcein efflux was greater than apical efflux (0.07±0.01 and

0.03±0.01% of available substrate/min at 60 min (n=12), respectively; Fig. 4C).

MK571 10µM, in contrast to its more potent effect on apical efflux in Caco-2 cells

(Fig. 4B), failed to result in a significant reduction in apical efflux in T84 cells

(0.02±0.002% available calcein/min (n=12)), while basal efflux was sensitive to the

MRP inhibitor (0.02±0.003% available calcein/min (n=12)). Therefore, absence of

MRP2 in the T84 cells leads to a decrease in the apical calcein efflux, which is no

longer sensitive to the MRP inhibitor MK571, while basal calcein efflux is still

sensitive to MK571.

Differential pharmacological sensitivity of apical and basal calcein efflux

The differential sensitivity of apical and basal calcein efflux to some common

pharmacological agents was investigated in Caco-2 cells (Fig. 5). A range of agents

inhibited both apical and basal efflux of calcein, including benzbromarone,


at ASPE

T Journals on A


Dow

nloaded from



probenecid, pravastatin and diclofenac (Fig. 5). This inhibition of apical and basal

calcein efflux was associated with a significant increase in cellular retention of calcein

(Fig. 5). In contrast, verapamil 100µM and erythromycin 1 mM had no significant

effect on apical efflux (95.6±12.5 & 96.0±2.0 % of control, respectively) but

significantly reduced basal efflux to 31.7±8.6 & 63.8±5.0 % of control, respectively.

Verapamil and erythromycin inhibition of basal calcein efflux was not associated with

an increased cellular retention of calcein (Fig. 5), consistent with the predominant

apical efflux not having been affected. In contrast, indomethacin 500µM and

propranolol 1mM significantly reduced apical efflux of calcein, without significantly

reducing efflux of calcein into the basal solution. Indomethacin and propranolol,

similar to the agents that reduced both apical and basal efflux, resulted in significant

enhancement of calcein retention by the cells. Quinidine, a P-glycoprotein inhibitor,

had no significant effect on the efflux of calcein into either the apical or basal

compartments, while also not influencing cellular calcein retention. Thus

pharmacological tools that inhibit the dominant calcein efflux into the apical solution

(Fig. 4B), but not those that inhibit only the smaller efflux into the basal solution,

enhance cellular retention of calcein.

Buthionine sulphoximine treatment

Caco-2 cells were pre-treated for 24 hours with DL-buthionine-(S,R)-sulphoximine

(BSO) 9mM, a specific irreversible inhibitor of γ-glutamylcysteine synthetase

(Griffiths & Meister, 1979), to reduce intracellular glutathione, for 24 h

(Arttamangkul et al. 1999) before loading with calcein. Apical calcein efflux was

unaffected by BSO pre-treatment (0.25±0.01 and 0.26±0.01% available substrate/min

at 60min for control and BSO-pre-treated cells (n=12), respectively). In contrast,

basal calcein efflux was significantly (two-way ANOVA) reduced by BSO-pre-


at ASPE

T Journals on A


Dow

nloaded from



treatment (0.08±0.01% available substrate/min (n=12)) compared with control

(0.10±0.02% available substrate/min (n=12)).

DISCUSSION

Differential localisation of MRP isoforms to the apical and basolateral membrane

domains of intestinal enterocytes allows for complimentary roles in detoxification of

enterocytes, by excretion into the intestinal lumen or blood, respectively. In addition,

MRP2, localised to the apical membrane, may play a role, in parallel with MDR1 and

BCRP, in limiting oral drug absorption. In contrast, MRP isoforms localised to the

basolateral membrane domain may enhance intestinal absorption, by maintaining a

favourable gradient for drug absorption. Transport of the prototypic MRP substrate

calcein across the apical and the basolateral membranes of intestinal Caco-2 cell

layers shows differential sensitivity to a range of pharmacological agents. Thus the

function of different MRP isoforms may be separated on the basis of pharmacological

sensitivity.

The human small intestine and Caco-2 cells express MRP isoforms 1-6 (ABCC1-6)

at medium to low levels (Taipalensuu et al. 2001; Langmann et al. 2003). Additional

MRP isoforms 7, 8 and 9 have been described (ABCC10, 11 and 12, respectively).

There are no data to date to indicate significant expression in the intestine, while the

functional characterization is incomplete (Chan et al. 2004). The liver expresses

considerable higher levels of MRP3, 6 and in particular MRP2, compared with the

intestine. In general terms, duodenal expression of MRP isoforms is lower than that

in the jejunum and ileum, with MRP2 and MRP6 being particularly restricted to these

latter two segments. This may be a reflection of greater exposure of the distal small

intestine to digested food components, including those of a potentially toxic nature,


at ASPE

T Journals on A


Dow

nloaded from



and/or a greater role in the intestinal excretory pathway. In Caco-2 cells, based upon

the ratio of MRP:18S rRNA expression, the rank order for expression was MRP2 ≥

MRP6 > MRP4 ≥ MRP3 >MRP1 = MRP5 in the present study, similar to that found

in other studies using slightly different techniques and normalisation methods, with

MRP2 being consistently the most abundant mRNA and lower levels of MRP1 and

MRP5 (Hirohashi et al. 2000; Taipalensuu et al. 2001). We found no difference

whether Caco-2 cells were grown on plastic or on porous tissue culture inserts. The

parallel expression of MRP in the small intestine (jejunum/ileum) and Caco-2 cells

emphasises the utility of the latter as a cellular model for transport studies.

MRP2 is localised to the luminal membrane of the small intestine (Mottino et al.

2000; Fromm et al. 2000) and Caco-2 cells (Fig. 3; Walgren et al. 2000). Additional

intracellular MRP2 staining may reflect intracellular vesicular pools, or trafficking

pathways. Calcein efflux from polarised confluent layers of Caco-2 cells was

predominantly into the apical solution, paralleling calcein efflux from and secretion

across the rodent intestinal mucosa (Fujita et al. 1996; Stephens et al. 2002). MDR1

(ABCB1) and BCRP (ABCG2) are both highly expressed in the small intestine

(Taipalensuu et al. 2001; Langmann et al. 2003) where they are localised to the apical

membrane (Theibault et al. 1987; Maliepaard et al. 2001). MDR1 expression in Caco-

2 cells parallels that in the jejunum (Taipalensuu et al. 2001) with clear apical

localisation in Caco-2 cells (Hunter et al. 1993a). In contrast, expression of BRCP in

Caco-2 cells is 100-fold lower than in the jejunum (Taipalensuu et al. 2001). Neither

MDR1 nor BCRP count calcein among their diverse substrates (Hollo et al. 1994;

Litman et al. 2000); in the present study, calcein efflux was not influenced by

inclusion of the MDR1 substrate quinidine, similar to results in the mouse intestine

(Stephens et al. 2002). Taken together, these pieces of evidence argue for apical


at ASPE

T Journals on A


Dow

nloaded from



calcein efflux mediated by MRP2 in Caco-2 cells and by inference in the small

intestine. In T84 cells, which lack MRP2 expression (Fig. 4; Lowes & Simmons,

2001, 2002), basolateral calcein efflux dominates, consistent with apical calcein

efflux mediated by MRP2 in Caco-2 cells. T84 cells express MDR1, functionally

localised to the apical membrane (Hunter et al. 1991), again confirming that calcein

efflux is independent of MDR1 expression.

In contrast to MRP2, other MRP isoforms have only been reported to localise to

the basolateral membranes of a variety of tissues. We were unable to visualise MRP1

at either plasma membrane, consistent with its absence from plasma membrane

fractions of Caco-2 cells (Walle et al. 1999). MRP3 demonstrated pronounced

staining of the lateral membranes of Caco-2 cells (Fig. 3; Bock-Hennig et al. 2002),

consistent with lateral membrane localisation of endogenous MRP3 in HepG2 and

heterologously expressed MRP3 in polarised cells (Kool et al. 1999b). MRP4-

mediated prostaglandin transport is sensitive to indomethacin; while MRP1-mediated

transport is insensitive (Reid et al. 2003). If MRP4-mediated calcein transport is

similarly sensitive to indomethacin, it would exclude MRP4 as the transporter

mediating the indomethacin-insensitive basolateral calcein efflux in Caco-2 cells.

Direct studies of the affinity of MRP4 for calcein transport and its indomethacin

sensitivity are required to confirm this speculation; MRP4 localisation in Caco-2 was

not possible due to lack of availability of antibodies. MRP5 may also be excluded

from a role in the efflux as, calcein is not a substrate for MRP5 (McAleer et al. 1999)

while only low levels of MRP5 mRNA were observed and MRP5 protein was not

detected in Caco-2 cells (Figs. 2 & 3). Thus MRP3 may be a strong candidate for

basolateral MRP function in Caco-2 cells, but the involvement of MRP6, localised to


at ASPE

T Journals on A


Dow

nloaded from



the basolateral membrane in kidney and liver (Kool et al. 1999a) should also be

considered (MRP6 antibodies were unavailable for the present study).

The present study has identified pharmacological tools that enable at least partial

dissection of the functional roles of MRP isoforms. Thus apical, MRP2-mediated,

calcein efflux while sensitive to indomethacin and propranolol, was insensitive to

verapamil and erythromycin. In contrast, the basolateral, non-MRP2-mediated,

calcein efflux demonstrated a mirror-image sensitivity/insensitivity profile. Such

differential inhibitory profiles points to, hitherto unidentified (Stephens et al. 2002),

tools that may be useful in dissecting out the roles of specific MRP isoforms in

intestinal drug transport and toxicity, and may have wider utility in discerning the

functional roles of MRP isoforms in other tissues. It is likely that these tools are

imprecise, allowing differential, rather than absolute, discrimination. In addition, the

differential inhibitory profiles described here are for human MRP isoforms and

caution may be needed before extension to studies in other species.

The role of glutathione conjugation in MRP-mediated transport is complex (Evers

et al. 1998, 2000; Gerk & Vore, 2002; Chan et al. 2004). Thus some substrates

require glutathione conjugation, while for others co-transport of substrate with

glutathione is noted, and for yet others, independence of glutathione is noted. Basal,

but not apical, calcein efflux was sensitive to glutathione depletion with BSO. This

indicates that while MRP2-mediated apical efflux is independent of glutathione,

basolateral, non-MRP2 mediated efflux is glutathione-dependent. MRP1 transport of

calcein is reported to be glutathione-independent (Feller et al. 1995), again arguing

against a role for MRP1 in basolateral calcein efflux in Caco-2 cells. Thus an

additional experimental paradigm to reveal the roles of different MRP isoforms in

intestinal drug transport and detoxifying mechanisms is revealed.


at ASPE

T Journals on A


Dow

nloaded from



We have identified key pharmacological tools to investigate the role of different

MRP isoforms in the detoxification and membrane transport in intestinal enterocytes.

Apical MRP function dominates through the localised, relatively high level

expression of MRP2. Apical, MRP2-mediated function is selectively sensitive to

indomethacin and propranolol. In contrast, MRP-mediated transport at the basolateral

membrane is lower in magnitude, selectively sensitive to verapamil, erythromycin and

glutathione-depletion, probably mediated by MRP3 and/or 6. Identification of the

differential sensitivities of the intestinal apical and basolateral MRP-mediated efflux

systems allows for the development of selective agents to modify intestinal drug

absorption or drug excretion.

Acknowledgement

Maxine Geggie provided excellent technical support.


at ASPE

T Journals on A


Dow

nloaded from



REFERENCES

Arttamangkul S, Bhalgat MK, Haugland RP, Diwu Z, Liu J, Klaubert DH and

Haugland RP (1999) 5-(Pentafluorobenzoylamino)fluorescein: A selective

substrate for the determination of glutathione concentration and glutathione S-

transferase activity. Anal Biochem 269:410-417.

Bock-Hennig BS, Köhle C, Nill K and Bock KW (2002) Influence of t-

butylhydroquinone and β-naphthoflavone on formation and transport of 4-

methylumbelliferone glucuronide in Caco2/TC-7 cell monolayers. Biochem

Pharmacol 63:123-128.

Büchler M, König J, Brom M, Kartenbeck J, Spring H, Horie T and Keppler D (1996)

cDNA cloning of the hepatocyte canalicular isoform of the multidrug resistance

protein, cMrp, reveals a novel conjugate export pump deficient in

hyperbilirubinemic mutant rats. J Biol Chem 271:15091-15098.

Cantz T, Nies AT, Brom M, Hofmann AF and Keppler D (2000) MRP2, a human

conjugate export pump, is present and transports fluo 3 into apical vacuoles of Hep

G2 cells. Am J Physiol Gastrointest Liver Physiol 278:G522-G531.

Chan LMS, Lowes S and Hirst BH (2004) The ABCs of drug transport in intestine

and liver: efflux proteins limiting drug absorption and bioavailability. Eur J

Pharmaceut Sci 21:25-51.

Essodaigui M, Broxterman H and Garnier-Suillerot A (1998) Kinetic analysis of

calcein and calcein-acetoxymethylester efflux mediated by the multidrug resistance

protein and P-glycoprotein. Biochemistry 37:2243-2250.

Evers R, Kool M, Van Deemter L, Janssen H, Calafat J, Oomen LCJM, Paulusma CC,

Oude Elferink RPJ, Baas F, Schinkel AH and Borst P (1998) Drug export activity


at ASPE

T Journals on A


Dow

nloaded from



of the human canalicular multispecific organic anion transporter in polarised

kidney MDCK cells expressing cMOAT (MRP2) cDNA. J Clin Invest 101:1310-

1319.

Evers R, de Haas M, Sparidans R, Beijnen J, Wielinga PR, Lankelma J and Borst P

(2000) Vinblastine and sulfinpyrazone export by the multidrug resistance protein

MRP2 is associated with glutathione export. Br J Cancer 83:375-383.

Feller N, Broxterman HJ, Währer DCR and Pinedo HM (1995) ATP-dependent efflux

of calcein by the multidrug resistance protein (MRP): no inhibition by intracellular

glutathion depletion. FEBS Lett 368:385-388.

Fromm MF, Kauffman HM, Fritz P, Burk O, Kroemer HK, Warzok RW, Eichelbaum

M, Siegmund W and Schrenk D (2000) The effect of rifampin treatment on

intestinal expression of human MRP transporters. Am J Pathol 157:1575-1580.

Fujita T, Yamada H, Fukuzumi M, Nishimaki A, Yamamoto A and Muranishi S

(1997) Calcein is excreted from intestinal mucosal cell membrane by the active

transport system. Life Sci 60:307-313.

Gekeler V, Ise W, Sanders KH, Ulrich W-R and Beck J (1995) The leukotriene LTD4

receptor antagonist MK571 specifically modulates MRP associated multidrug

resistance. Biochem Biophys Res Com 208:345-352.

Gerk PM and Gore M (2002) Regulation of expression of the multidrug resistance-

associated protein 2 (MRP2) and its role in drug disposition. J Pharmacol Exp

Therap 302:407-415.

Griffith OW and Meister A (1979) Potent and specific inhibition of glutathione

synthesis by buthionine sulfoximine (S-n-butyl homocysteine sulfoximine).

J Biol Chem 254:7558-7560.


at ASPE

T Journals on A


Dow

nloaded from



Hirohashi T, Suzuki H, Chu X-Y, Tamai I, Tsuji A and Sugiyama Y (2000) Function

and expression of multidrug resistance-associated protein family in human colon

adenocarcinoma cells (Caco-2). J Pharmacol Exp Therap 292:265-270.

Holló Z, Homolya L, Davis CW and Sarkadi B (1994) Calcein accumulation as a

fluorometric functional assay of the multidrug transporter. Biochim Biophys Acta

1191:384-388.

Hunter J and Hirst BH (1997) Intestinal secretion of drugs. The role of P-

glycoprotein and related drug efflux systems in limiting oral drug absorption. Adv

Drug Delivery Rev 25:129-157.

Hunter J, Hirst BH and Simmons NL (1991) Epithelial secretion of vinblastine by

human intestinal adenocarcinoma cell (HCT-8 and T84) layers expressing P-

glycoprotein. Br J Cancer 64:437-444.

Hunter J, Hirst BH and Simmons NL, (1993a) Drug absorption limited by P-

glycoprotein-mediated secretory drug transport in human intestinal epithelial Caco-

2 cell layers. Pharm Res 10:743-749.

Hunter J, Jepson M, Tsuruo T, Simmons NL and Hirst BH (1993b) Functional

expression of P-glycoprotein in apical membranes of human intestinal Caco-2

cells. Kinetics of vinblastine secretion and interaction with modulators. J Biol

Chem 268:14991-14997.

Konig J, Rost D, Cui Y and Keppler D (1999) Characterisation of the human

multidrug resistance protein isoform MRP3 localised to the basolateral hepatocyte

membrane. Hepatology 29:1156-1163.

Kool M, Van Der Linden M, De Haas M, Baas F and Borst P (1999a) Expression of

human MRP6 a homologue of the multidrug resistance protein gene MRP1, in

tissues and cancer cells. Cancer Res 59:175-182.


at ASPE

T Journals on A


Dow

nloaded from



Kool M, Van Der Linden M, De Haas M, Scheffer GL, De Vree JM, Smith AJ, Jansen

G, Peters GJ, Ponne N, Scheper RJ, Elferink RP, Baas F and Borst P (1999b)

MRP3, an organic anion transporter able to transport anti-cancer drugs. Proc Natl

Acad Sci USA 96:6914-6919.

Langmann T, Mauerer R, Zahn A, Moehle C, Probst M, Stremmel W and Schmitz G

(2003) Real-time reverse transcription-PCR expression profining of the complete

human ATP-binding casetts transporter superfamily in various tissues. Clin Chem

49:230-238.

Litman T, Brangi M, Hudson E, Fetsch P, Abati A, Ross DD, Miyake K, Resau JH

and Bates SE (2000) The multidrug-resistant phenotype associated with

overexpression of the new ABC half-transporter, MXR (ABCG2). J Cell Sci

113:2011-2021.

Lowes S and Simmons NL (2002) Multiple pathways for fluoroquinolone secretion

by human intestinal epithelial (Caco-2) cells. Br J Pharmacol 135:1263-1275.

Lowes S and Simmons NL (2001) Human intestinal cell monolayers are preferentially

sensitive to disruption of barrier function from basolateral exposure to cholic acid:

correlation with membrane transport and transepithelial secretion. Pflügers Arch -

Eur J Physiol 443:265-273.

Madon J, Eckhardt U, Gerloff T, Stieger B and Meier PJ (1997) Functional expression

of the rat liver canalicular isoform of the multidrug resistance-associated protein.

FEBS Lett 406:75-78.

Maliepaard M, Scheffer GL, Faneyte IF, Van Gastelen MA, Pijnenborg ACLM,

Schinkel AH, Van De Vijver MJ, Scheper RJ and Schellens JHM (2001)

Subcellular localisation and distribution of the breast cancer resistance protein

transporter in normal human tissues. Cancer Res 61:458-3464


at ASPE

T Journals on A


Dow

nloaded from



McAleer MA, Breen MA, White NL and Matthews N (1999) pABC11 (also known as

MOAT-C and MRP5), a member of the ABC family of proteins, has anion

transporter activity but does not confer multidrug resistance when overexpressed in

human embryonic kidney 293 cells. J Biol Chem 274:23541-23548.

Mottino AD, Hoffman T, Jennes L and Vore M (2000) Expression and localization of

multidrug resistant protein mrp2 in rat small intestine. J Pharmacol Exp Ther

293:717-723.

Peng KC, Cluzeaud F, Bens M, Van Huyen JP, Wioland MA, Lacave R and

Vandewalle A (1999) Tissue and cell distribution of the multidrug resistance-

associated protein (MRP) in mouse intestine and kidney. J Histochem Cytochem

47:757-768.

Reid G, Wielinga P, Zelcer N, Van Der Heijden I, Kuil A, De Haas M, Wijnholds J

and Borst P (2003) The human multidrug resistance protein MRP4 functions as a

prostaglandin efflux transporter and is inhibited by nonsteroidal antiinflammatory

drugs. Proc Natl Acad Sci USA 100:9244-9249

Scheffer GL, Hu X, Pijnenborg AC, Wijnholds J, Bergen AA and Scheper RJ (2002a)

MRP6 (ABCC6) detection in normal human tissues and tumors. Lab Invest

82:515-518.

Scheffer GL, Kool M, De Haas M, De Vree JM, Pijnenborg AC, Bosman DK,

Elferink RP, Van Der Valk P, Borst P and Scheper RJ (2002b) Tissue distribution

and induction of human multidrug resistant protein 3. Lab Invest 82:193-201.

Scheffer GL, Maliepaard M, Pijnenborg AC, Van Gastelen MA, De Jong MC,

Schroeijers AB, Van Der Kolk DM, Allen JD, Ross DD, Van Der Valk P, Dalton

WS, Schellens JH and Scheper RJ (2000) Breast cancer resistance protein is


at ASPE

T Journals on A


Dow

nloaded from



localized at the plasma membrane in mitoxantrone- and topotecan-resistant cell

lines. Cancer Res 60:2589-2593.

Stephens RH, O'Neill CA, Bennett J, Humphrey M, Henry B, Rowland M and

Warhurst G (2002) Resolution of P-glycoprotein and non-P-glycoprotein effects on

drug permeability using intestinal tissues from mdr1a (-/-) mice. Br J Pharmacol

135:2038-2046.

Taipalensuu J, Tornblom H, Lindberg G, Einarsson C, Sjoqvist F, Melhus H, Garberg

P, Sjostrom B, Lundgren B and Artursson P (2001) Correlation of gene expression

of ten drug efflux proteins of the ATP-binding cassette transporter family in

normal human jejunum and in human intestinal epithelial Caco-2 cell monolayers.

J Pharmacol Exp Ther 299:164-170.

Thiebaut F, Tsuruo T, Hamada H, Gottesman MM, Pastan I and Willingham MC,

(1987) Cellular localisation of the multidrug-resistance gene product P-

glycoprotein in normal human tissues. Proc Natl Acad Sci USA 84:7735-7738.

Tusnady G E, Bakos E, Varadi A and Sarkadi, B (1997) Membrane topology

distinguishes a subfamily of the ATP-binding cassette (ABC) transporters. FEBS

Letters 402:1-3.

Versantvoort CHM, Bagrij T, Wright KA and Twentyman PR (1995) On the

relationship between the probenecid-sensitive transport of daunorubicin or calcein

and the glutathione status of cells overexpressing the multidrug resistance-

associated protein (MRP). Int J Cancer 63:855-862

Walgren RA, Karnaky KJ, Lindenmayer GE and Walle T (2000) Efflux of dietary

flavonoid quercetin 4'-β-glucoside across human intestinal Caco-2 cell monolayers

by apical multidrug resistance-associated protein-2. J Pharmacol Exp Ther

294:830-836.


at ASPE

T Journals on A


Dow

nloaded from



Walle UK, Galijatovic A and Walle T (1999) Transport of the flavonoid chrysin and

its conjugated metabolites by the human intestinal cell line Caco-2. Biochem

Pharmacol 58:431-438.


at ASPE

T Journals on A


Dow

nloaded from



Footnote

The studies were supported by AstraZeneca. RAF was supported by a BBSRC-CASE

studentship, in collaboration with AstraZeneca.


at ASPE

T Journals on A


Dow

nloaded from



Table 1. Sequence and position in the relevant cDNA of each MRP isoform

oligonucleotide primers used in PCR analyses.

Figure 1. Expression of MRP 1-6 mRNA along the human gastrointestinal

tract. Expression of multidrug resistance associated proteins (MRP) 1-6 was

analysed by PCR in the following human tissues, oesophagus (1), stomach (2), liver

(3), duodenum (4), jejunum (5), ileum (6), ileocaecum (7), caecum (8), ascending (9)

transverse (10) and descending (11) colon and rectum (12). Lane 13 was human

placenta and lane 14 was a negative PCR control (omission of cDNA). Reactions

were also performed with primers to glyceraldehyde-3-phosphate dehydrogenase

(GAPDH). Reaction products were separated by agarose gel electrophoresis along

with a 100bp ladder to aid in determining product size. The reactions for each MRP

and GAPDH are labelled as well as the 100bp marker for MRP1-6 and 1kb marker for

GAPDH.

Figure 2. Semi-quantitative PCR of MRP1-6 mRNA in filter and flask grown

Caco-2 cells. A. Polymerase chain reactions (PCR) were performed to analyse the

expression of multidrug resistance associated proteins (MRP) 1-6 relative to an 18S

rRNA control in Caco-2 samples grown in 162cm2 flasks or on 12mm diameter filters

for two weeks. Caco-2 samples were of the same passage number and post-seeding

time. Reaction products were separated by agarose gel electrophoresis along with a

100bp ladder. The 500 and 100bp markers and flask and filter grown samples are

indicated. Products of the appropriate size (≈500bp for 18S rRNA and for MRP1-6

(Table 1)) were produced in each test reaction.


at ASPE

T Journals on A


Dow

nloaded from



B & C. The band intensities for MRP1-6 and 18S rRNA products shown in A were

obtained using an AlphaImager gel documentation and analysis system (Flowgen).

Values obtained for MRP1-6 were normalised to the corresponding 18S rRNA

intensity to determine the relative expression values. B. Data from cells grown in

162cm2 flasks for two weeks. C. Data for cells grown on 12mm diameter culture

inserts for two weeks. The results are expressed as mean values with error bars of ± 1

SEM n=6 for flask samples and n=9 for filter samples.

Figure 3. Immunostaining for MRP1-3 & 5 in Caco-2 cell monolayers. Indirect

immunofluorescent staining was performed and viewed via confocal laser scanning

microscopy. Cell nuclei were stained with propidium iodide and are shown in red,

MRP staining is shown in green. Panel A, staining with secondary antibody only;

control for MRP1 & 5 staining (panels B & C). Panel B, MRP1 staining. Panel C,

MRP5 staining. Panel D, staining with secondary antibody only; control for MRP 2 &

3 staining (panels E & F). Panel E, MRP2 staining. Panel F, MRP3 staining. Control

(secondary antibody only) staining images were collected and are displayed with the

same settings as the relevant samples with primary anti-MRP isoform antibody. Scale

bar = 10µm. Images are shown as projections through the whole plane of the cell

monolayer viewed en face. In addition, perpendicular X-Z images are shown below

the appropriate en face images for each of the MRP isoforms.

Figure 4. Analysis of MRP2 expression and calcein efflux in Caco-2 and T84

cell lines. A. Western blot analysis for MRP2 expression. Blots were probed with

M2III6, monoclonal antibody to MRP2, then re-probed with a polyclonal antibody to

actin to confirm equal protein loading. B&C. Calcein efflux from Caco-2 and T84


at ASPE

T Journals on A


Dow

nloaded from



cell lines respectively. Apical efflux = and continuous lines, basal efflux = and

dashed lines. Efflux in the presence of MK571 (10µM) apically and basally is shown

by open symbols. Inset graphs show retained cellular calcein. Results are means ± 1

SEM, n=12.

Figure 5 Inhibitor effect on calcein efflux in Caco-2 cells. Calcein efflux was

performed as described in materials and methods, in the presence of benzbromarone

(50µM), diclofenac (1mM), pravastatin (1mM), probenecid (1&2mM), erythromycin

(1mM), verapamil (100µM), indomethacin (500µM), propranolol (1mM) or quinidine

(1mM). Apical efflux (A) and basal efflux (B) are shown as a percentage of control at

the 60minute time point. Remaining intracellular fluorescence is shown in C.

Significant differences to control are shown by *.


at ASPE

T Journals on A


Dow

nloaded from


MRP isoform Primer sequence (position)

NCBI GenBank Accession No.

Product size

Sense 693AGGTGGACCTGTTTCGTGAC712 MRP1

(ABCC1) Antisense 875ACCCTGTGATCCACCAGAAG856

NM_004996 183

Sense 3541AGGTTTGCCAGTTATCCGTG3560 MRP2

(ABCC2) Antisense 3760AACAAAGCCAACAGTGTCCC3741

NM_000392 220

Sense 4315GGACTTCCAGTGCTCAGAGG4334 MRP3

(ABCC3) Antisense 4432AGCTGTGGCCTCGTCTAAAA4413

NM_003786 118

Sense 3710ATTATTGATGAAGCGACGGC3729 MRP4

(ABCC4) Antisense 3899GCAAAACATACGGCTCATCA3880

NM_005845 190

Sense 5158CCTTTTCACTCCCTCCATCA5177 MRP5

(ABCC5) Antisense 5342ACAGGTCTTGGAGCTGGAGA5323

NM_005688 185

Sense 366ATGAGCTTCGCAGTGTTCCT385 MRP6

(ABCC6) Antisense 539TAGGTAGGTGGACAGGTGGC520

NM_001171 174


at ASPE

T Journals on A


Dow

nloaded from



at ASPE

T Journals on A


Dow

nloaded from


differential mrp1-6 isoform expression and function in...

Documents