Copyright � 2007 by the Genetics Society of AmericaDOI: 10.1534/genetics.107.075689

Differential Effect of Allorecognition Loci on Phenotype in Hydractiniasymbiolongicarpus (Cnidaria: Hydrozoa)

Anahid E. Powell,*,1 Matthew L. Nicotra,* Maria A. Moreno,† Fadi G. Lakkis,‡

Stephen L. Dellaporta† and Leo W. Buss*,§

*Department of Ecology and Evolutionary Biology, †Department of Molecular, Cellular, and Developmental Biology, and§Department of Geology and Geophysics, Yale University, New Haven, Connecticut 06520 and ‡Thomas E. Starzl

Transplantation Institute, Departments of Surgery and Immunology, University of Pittsburgh School ofMedicine, Pittsburgh, Pennsylvania 15261

Manuscript received June 8, 2007Accepted for publication September 24, 2007

ABSTRACT

The allorecognition complex of Hydractinia symbiolongicarpus is a chromosomal interval containing twoloci, alr1 and alr2, that controls fusion between genetically distinct colonies. Recombination betweenthese two loci has been associated with a heterogeneous class of phenotypes called transitory fusion. Alarge-scale backcross was performed to generate a population of colonies (N ¼ 106) with recombinationbreakpoints within the allorecognition complex. Two distinct forms of transitory fusion were correlatedwith reciprocal recombination products, suggesting that alr1 and alr2 contributed differentially to theallorecognition response. Specifically, type I transitory fusion is associated with rapid and persistentseparation of allogeneic tissues, whereas type II transitory fusion generates a patchwork of continuouslyfusing and separating tissues.

H YDRACTINIA symbiolongicarpus is a colonial cni-darian commonly found as an encrustation on

hermit crab shells. Like many sessile, colonial inverte-brates, Hydractinia can discriminate among allogeneicconspecific tissues. Many substrate-bound colonialmarine invertebrates exhibit indeterminate growththrough asexual propagation, which in turn can pro-mote intense competition for space ( Jackson 1977).When colonies sharing a substratum grow into contact,compatible colonies can fuse, giving rise to chimeras,while incompatible colonies reject, often leading to anantagonistic response (Hauenschild 1954, 1956; Muller

1964; Ivker 1972; Buss et al. 1984; Lange et al. 1989;Buss and Grosberg 1990; Shenk and Buss 1991;Grosberg et al. 1996; Cadavid et al. 2004). In the casein which two allogeneic colonies fuse, competitionensues between the nonidentical cell lines for contri-bution to the germline (Buss 1982; Stoner et al. 1999;Laird et al. 2005). Allorecognition mediates the natureof these competitive interactions, effectively controllingthe switch between two different levels of naturalselection—the colony and the cell line (Buss 1982).

While the topic has been studied for a century in awide diversity of taxa, genetic techniques have been

accessible in only two systems: the athecate hydroidHydractinia and the compound ascidian Botryllus schlos-seri, although other approaches have been pursued in avariety of other systems (e.g., Wiens et al. 2000, 2004). Inboth the hydroid and ascidian systems, allorecognitionis controlled by a set of two linked loci, FuHc and fester inBotryllus and alr1 and alr2 in Hydractinia (Cadavid

et al. 2004; De Tomaso et al. 2005; Nyholm et al. 2006),while allodeterminants in all other systems remain un-known. In Hydractinia, fusion, characterized by com-plete ectodermal and gastrovascular continuity, occurswhen colonies share one or both alleles at both loci,whereas rejection, characterized by a failure to adhereand nematocyst discharge, occurs when colonies shareno loci at either allele (Cadavid et al. 2004). The Botryllussystem is similar in that fusion occurs if colonies matchone or more alleles at FuHc and rejection occurs ifcolonies share no loci (De Tomaso et al. 2005).

An obvious question arises as to what phenotypes mayoccur in individuals recombinant across this interval. Anearlier study demonstrated that transitory fusion pheno-types appear when colonies share alleles at one allor-ecognition locus and not at the other (Cadavid et al.2004). Transitory fusion is characterized by an initialfusion of allogeneic tissues, followed by a variety ofpatterns of subsequent incompatibility (Hauenschild

1954, 1956; Grosberg et al. 1996; Cadavid et al. 2004).Transitory fusion is clearly a heterogeneous phenotypiccategory with known variation in the amount of timecolonies remain fused, whether separation occurs, and

Sequence data from this article have been deposited with the EMBL/GenBank Data Libraries under accession nos. EU020112–EU020116.

1Corresponding author: Osborn Memorial Labs, Yale University, P. O. Box208106, 165 Prospect St., New Haven, CT 06520-8106.E-mail: anahid.powell@yale.edu

Genetics 177: 2101–2107 (December 2007)

whether the separation persists. Only 13 recombinantswere isolated by Cadavid et al. (2004), motivating us toinitiate a much larger backcross that yielded 106 recom-binants. We report here that in this population two pre-dominant classes of transitory fusion were observedand that these two categories covaried with the directionof recombination within the interval. This result clari-fies considerably the diversity of Hydractinia allorecog-nition phenotypes and provides the first evidence thatthe two allorecognition loci contribute differentially tophenotype.

MATERIALS AND METHODS

Animals: H. symbiolongicarpus grows as a colony by asexualbudding. The colony is composed of various types of polyps(‘‘P’’ in Figure 1), specialized for the different functions offeeding, sexual reproduction, and defense. Gastrovascularcanals, called stolons (‘‘S’’ in Figure 1), connect the polyps in abranching web-like network that over time becomes encasedwithin the mat tissue (‘‘M’’ in Figure 1).

Animal care and breeding have been described in detailelsewhere (Muller 1973; Blackstone and Buss 1991; Cadavid

et al. 2004). One modification of protocol was that newly meta-morphosed polyps were not hand fed but instead immersed inseawater containing a high density of 2-day-old Artemia salinanauplii. Individuals unable to capture brine shrimp succumbedand were not tested further.

Genetic crosses and allorecognition nomenclature: Themapping population was generated by backcrossing animals

derived from inbred and congenic lines developed previously(Mokady and Buss 1996; Cadavid et al. 2004). In theselaboratory lines, two haplotypes of the allorecognition com-plex, designated f and r, segregate. Parents of the crossesdiagrammed in Figure 2 of this article can be found in thepedigree shown in Figure 2 of Cadavid et al. (2004). We adopthere a terminology slightly different from that used byCadavid et al. (2004). Animals homozygous for the f haplotypeare genetically designated as alr1-f alr2-f/alr1-f alr2-f, which isequivalent to the alr1-f, alr2-a/alr1-f, alr2-a designation used inCadavid et al. (2004). Likewise, animals homozygous for the rhaplotype are genetically designated as alr1-r alr2-r/alr1-r alr2-r,which is equivalent to the alr1-r, alr2-b/alr1-r, alr2-b designa-tion used in Cadavid et al. (2004). As a shorthand, from hereon we omit the locus designations and write simply ff/ff, rr/rr,or, in the case of heterozygotes, rr/ff. To describe the animalsrecombinant between alr1 and alr2, we use rf/ff (correspond-ing to alr1-r alr2-f/alr1-f alr2-f ) or fr/ff (corresponding to alr1-falr2-r/alr1-f alr2-f ).

Fusibility assays/determination of allorecognition pheno-type: All individuals identified as recombinant over the inter-val were tested for their fusibility phenotype in a colony assayunless they died between DNA sampling and genotyping. Aninbred individual of genotype rr/rr was used as the testercolony in fusibility assays. Once the colony reached sexualmaturity, a small excision from the colony mat bearing two tosix feeding polyps was placed next to a similar excision of thetester individual on a glass slide. The excised tissues were heldagainst the slide by a string tied around the slide and allowedto adhere over 2–3 days. The string was removed and the col-onies were allowed to grow into contact. Their interactionwas observed daily for at least the first 2 days of contact and6 days/week thereafter for at least 2 weeks. Fusibility tests werenoted for ectodermal and gastrovascular continuity. All testswere observed genotype blind and all tests were repeated at

Figure 1.—Schematic showing the morphology of a Hy-dractinia colony. P, polyp; M, mat; S, stolon.

Figure 2.—Pedigree used to generate mapping popula-tion. 431-63 is a heterozygote, and 833-8 is a homozygote.Squares represent males, and circles represent females. Thelineage of 833-8 can be found in Figure 2 of Cadavid et al.(2004) and likewise the heterozygous male (431-63) was amember of the 431 population represented as the final prod-uct of the mating program in Cadavid et al. (2004).

2102 A. E. Powell et al.

least twice, except in cases where this was not possible due tomortality.

SNP discovery/generation of markers: Five amplified frag-ment length polymorphisms (AFLPs) were previously identi-fied as linked to the allorecognition trait (Cadavid et al. 2004).To increase the throughput of this study, a strategy was em-ployed that enabled the simultaneous, codominant genotyp-ing of all five markers spanning the interval. The technologyused, Sequenom MassARRAY Homogenous MassEXTEND(hME) assay, required a large collection of SNPs to identify asubset of markers that were compatible in a multiplex reac-tion. Therefore, the five markers identified by Cadavid et al.(2004) were used as starting markers from which to identifyphysically linked SNPs by a variety of approaches (see supple-mental materials at http://www.genetics.org/supplemental/).A collection of 85 SNPs was identified over the chromosomalinterval. Sequenom SpectroDESIGNER 2.0 software was usedto analyze the SNP collection for potential multiplex assaysthat included at least one SNP linked to each of the originalfive AFLPs. The multiplex assay was tested and validated on 95samples of known alr genotypes.

DNA extraction: To minimize the time required to maintainthe testcross progeny, we developed a nondestructive tech-nique to extract DNA from young colonies at the earliestpossible developmental time. A single polyp was removed fromthe colony with forceps (sterilized in 10% bleach and rinsedwith dH2O) and dipped into 100 ml rinse buffer (50 mm Tris–HCl, pH 8, 20 mm NaCl, 1 mm EDTA, pH 8) to remove excessseawater. The polyp was placed into a well of a 96-well micro-titer plate containing 2.5 ml digestion buffer (50 mm Tris–HCl,pH 8, 20 mm NaCl, 1 mm EDTA, pH 8, 0.2% SDS, 0.1%proteinase K) and incubated at 55� for 30 min, followed by 5min at 99.9� to destroy residual proteinase activity. The heat-treated extract was then diluted in 20 ml sterile dH2O andcentrifuged at 4000 3 g for 30 min. Supernatant (15 ml) wastransferred to a new plate well. Samples were then dilutedfurther to 1:200 in dH2O to a concentration of�2 ng/ml, 1 mlof which was used in the genotyping assay.

Genotyping: Sequenom hME genotyping was performed byeither the W. M. Keck Foundation Biotechnology ResourceLaboratory at Yale University (New Haven, CT) or at theHarvard Partners Center for Genetics and Genomics (HPCGG,Cambridge, MA). PCR conditions prior to the Keck Founda-tion processing were the following: 2 ng template DNA,1 pm primers (for primer sequences see Table 1), QIAGEN(Valencia, CA) HotStar Taq buffer 13, 1.625 mm supplemen-tal magnesium chloride, 0.5 mm dNTP, 0.03 unit QIAGENHotStarTaq in a 5-ml total volume reaction. Thermal cyclingconditions were 95� for 15 min, 95� for 20 sec, 56� for 30 sec,and 72� for 1 min repeated 45 times, followed by 72� for 3 min.For samples genotyped by HPCGG, genomic template was

provided to their facilities where PCR and downstream manip-ulations were performed according to internal protocols.Animals identified as recombinant were genotyped a secondtime from an independent DNA extraction for verification.Animals identified as nonrecombinant were discarded.

A small percentage of the population (182 individuals or5%) was screened with only the two flanking markers of theallorecognition complex (194 and 29). Marker 194 genotyp-ing was performed as in Poudyal et al. (2007), with PCRprimers that assay a size fragment polymorphism physicallylinked to 194m6. Marker 29 genotyping was performed using acleaved amplified polymorphic sequence (CAPS) marker(Konieczny and Ausubel 1993) by amplifying a 736-bp prod-uct (forward primer 59-CACAAACGGTGAAATATCAAAGCA-39and reverse primer 59-TGACAGGATGTTGCGTTAAGGT-39),followed by digestion with SspI, which does not cut the r allele,but cuts the f allele into two fragments (441 and 295 bp). ThisCAPS marker assays a SNP physically linked to 29m9. Anyanimals identified as recombinants between markers 194 and29 were subsequently genotyped with all other markers acrossthe interval to further localize the breakpoint.

Linkage analysis: Map distances between the five SNPs, alr1,and alr2 were estimated using MapMaker (Lander et al. 1987).This analysis excluded the individuals genotyped with only thePCR markers 194 and 29. Because the alr1 and alr2 genes havenot yet been identified, the genotype of alr1 and alr2 inrecombinant animals had to be inferred from phenotypeanalysis. Note that in this study animals identified as non-recombinant were not fusibility tested because alr1 and alr2were assumed to match the genotype of flanking markers. Thisassumption relied on the small genetic intervals in questionover which double recombination is highly unlikely and alsoon the Cadavid et al. (2004) study, which phenotyped all490 animals of the mapping population and found no vio-lation of the principal fusibility phenotype predicted byflanking markers.

RESULTS

Allorecognition phenotypes: Recombination be-tween the five SNPs assayed was detected in 106 animals.Of these, 73 were viable for a period long enough to betested in colony fusibility assays to determine theirallorecognition phenotype. In total, four distinct phe-notypes were observed: fusion, rejection, and two typesof transitory fusion. Additionally, a low frequency ofcases (6) exhibited ambiguous phenotypes that werenot easily classifiable. These are referred to as ‘‘excep-tional phenotypes’’ (see below).

TABLE 1

MassARRay primers (59 / 39)

Marker First PCR primera Second PCR primera Amplicon length Extension primer

194m6 GACATACATAATTTACGTAAC CCATTGATTTTAGGACGTGAC 120 GGACGTGACTTAACAGA18m1 TGCAGCAAATGGTGATGTAC ACAGACGAAATGGGAAATCC 114 CCATGTTGTAAAATACGCC28m6 AGCGACGGGCTTAAGGTTTT CGAAGTTCTTGATACACATGC 112 TTGTTAATTTTCTCACTCGTAA174m4 AAATATTCAAACTGATGCTC AGCCGAAACAGTTATCAGTC 115 AATTTTTTATTGTGCGGAAC29m9 GAATTCATTTTTCTAAACAG TGCATTGGATTGAAGCAAAG 107 GATTGAAGCAAAGAAGTTTAG

The SNP markers are named by the following convention: a number, e.g., 194, refers to the original AFLP from Cadavid et al.(2004) to which the SNP is linked, followed by a letter, ‘‘m,’’ indicating that the polymorphism was detected by matrix-assisted laserdesorption/ionization-based methods, and finally a number that reflects that each SNP is part of a collection of similarly linked SNPs.

a All primers shown here contain a 59 leader (ACGTTGGATG).

Invertebrate Allorecognition 2103

As was previously reported (Cadavid et al. 2004),recombination between alr1 and alr2 resulted in ani-mals that underwent transitory fusion against an rr/rrtester. Recombination outside of this interval resulted inanimals that underwent simple fusion or rejection. Inthis study, careful observation of the transitory fusionsrevealed that these fusions could be further subdividedinto two distinct categories, which we refer to here astype I and type II transitory fusion.

In type I transitory fusions, colonies initially fused(Figure 3) and remained fused for �1–3 days beforeinitial signs of rejection began. The first indication ofthis change was a gray or whitish opaqueness occurringin a demarcation along the interaction zone. Generallywithin a day, loss of gastrovascular transport across thisline was observed and was followed by separation of thegastrovascular canals accompanied by separation of themat. As the gastrovascular canals ceased to connectacross the interaction zone, they began to branch lat-erally (parallel to the contact zone) and to makeconnections with canals on the same side of the fusionboundary (Figure 4). Frequently, a border of whitefibrous material began to accumulate between the twosides until they no longer appeared to be in physicalcontact (arrow, Figure 4). The separation between colo-nies was stable unless both colonies began to growvertically over the border in such a way as to recontacttheir neighbor or if the periphery was externally dis-rupted, e.g., by manually causing tissue trauma or by re-moving the fibrous border. In these cases, the transitoryfusion process began again from fusion to separation.

The second category of transitory fusion, type II,initiated in a manner identical to type I, but differed inlater stages of the phenotype’s progression. Coloniesfused upon contact but within 1–3 days showed signs ofseparation. Tissue at the interaction zone took on a gray

or white opaque quality that was followed within 24–48hr by the onset of loss of gastrovascular continuityaccompanied by ectodermal separation and some lat-eral branching (Figure 5A). Up to this point in the in-teraction, the phenotype was indistinguishable fromtype I transitory fusion. Subsequently, however, the inter-action became distinct. A ring canal was almost neverfully reformed and, instead of lasting separation, thecolonies continued to show contact with gastrovascularcanals refusing throughout the separated zone (Figure5B). This gastrovascular discontinuity and refusionalong the interaction zone continued for the durationof observation (weeks or even months), forming apatchwork of serially fusing and separating areas.

Type I and type II transitory fusion phenotypes corre-lated with specific genotypes. Consider that, in ourtestcross, recombination between alr1 and alr2 would beexpected to generate one of two reciprocal allotypes:rf/ff or fr/ff. Given that all recombinants were fusiontested against a homozygous rr/rr colony, the two inter-acting colonies were expected to share either one alleleat alr1 and no alleles at alr2 (i.e., rf/ff) or to share oneallele at alr2 and no alleles at alr1 (i.e., fr/ff). The corre-lation of the type of transitory phenotype and recombi-nant genotype was evident and is illustrated in Table 2.The sharing of one allele at alr1 and no shared alleles atalr2 correlated with type II transitory fusion and, re-ciprocally, no shared alleles at alr1 but one shared alleleat alr2 correlated with the observation of type I transitoryfusion. These results suggested a differential contribu-tion of alr1 and alr2 loci to the allorecognition process.

Exceptional phenotypes occurred at a low frequency:In addition to type I and type II transitory fusion

Figure 3.—Initial stages of fusion and transitory fusion. (A)Colony assay prior to contact where the two colonies grow sideby side. (B) Fusion 48 hr later showing continuity betweenmat tissue and gastrovascular canals. Bar, 200 mm.

Figure 4.—Outcome of type I transitory fusion. This close-up of interacting tissue between colonies depicts the outcomeof type I transitory fusion. The two colonies have already un-dergone fusion and initial stages of rejection and have sepa-rated, indicated by the white fibrous material between thecolonies that creates a border (arrow). Note also the gastro-vascular canals that branch laterally along the line of separa-tion and rejoin one another. P, polyps. Bar, 200 mm.

2104 A. E. Powell et al.

phenotypes described above, six colonies exhibitedexceptional phenotypes that could not be easily catego-rized. For each animal exhibiting an exceptional pheno-type, the colony assay was repeated three separate times.In all cases, the colonies initially fused to the rr/rr tester,

but within �3–4 days a gray line appeared across theinteraction zone, followed by occasional, transient sepa-rations of mat and gastrovascular canals and accumula-tion of debris over the interaction zone. In contrast to theother two transitory phenotypic classes described here,the colonies failed to achieve complete separation. Themost prominent feature of exceptional phenotypes was anecrotic character in the interaction zone, meaning thatthe tissue there appeared gray, inflamed, granular, andeasily torn, as opposed to the smooth and elastic char-acter of healthy mat tissue. The necrotic appearanceoccurred in a diffuse swath between the two colonies asopposed to the precise line of separation that appearedbetween colonies undergoing transitory fusion, as shownin Figure 4. Individual colonies varied in visual character-istics such as transparency, width of gastrovascular canals,frequency of branching, and thickness of mat, whichmade it possible to observe that in some cases theinteraction zone shifted as though one colony’s tissuewas overtaking the other. This ‘‘conversion’’ of tissue wasvariable, appearing in only some colony assays and in onlya subset of replicates.

The occurrence of exceptional phenotypes did notshow a clear relationship to breakpoint location. Threecases occurred when the breakpoint was between 194m6and 18m1 (colonies AP100-1279, AP100-1369, AP100-2801). Two cases occurred when the breakpoint wasbetween 18m1 and 28m6 (colonies AP100-51 andAP100-2388). One case occurred when the breakpointwas between 28m6 and 174m4 (colony AP100-1546). Inall these cases, marker 194m6 was in a heterozygousstate. For the purpose of linkage analysis, no value wasassigned to alr1 or alr2 for these colonies.

High-resolution genetic mapping of the Hydractiniaallorecognition complex: The backcross used to gener-ate recombinants permitted us to refine the geneticmap of the allorecognition interval. Linkage analysis ofthe five SNPs distributed across the allorecognitioncomplex (supplemental data at http://www.genetics.org/supplemental/) produced a refined map (Figure 6).Of the 3565 animals genotyped, 7 (numbered AP100-644, AP100-993, AP100-2146, AP100-2224, AP100-2635,AP100-2728, AP100-3562) appeared to be recombinant butwere genotyped three or more times from independent

Figure 5.—Two stages of type II transitory fusion. This re-gion of interacting tissue between two colonies depicts theseparation and refusion phases that occur in type II transitoryfusion. (A) The separation phase after the colony has alreadyundergone contact and fusion. The zone of interaction/sep-aration is indicated by an arrow. This is an early stage of sep-aration common to both type I and II transitory fusion wherethe mat and gastrovascular canals are separate, but unlike Fig-ure 4, there is no border accumulation or extensive lateralbranching of canals. (B) Refusion 24 hr later. The arrow in-dicates one of several areas where colonies have rejoined theirgastrovascular canals. P, polyps. Bar, 200 mm.

TABLE 2

Distribution of phenotype with respect to alr genotype

GenotypeType I transitory

fusionType II transitory

fusion

fr/ff 27 1rf/ff 0 24

Figure 6.—Genetic map of the allorecognition complex.Markers are named as in Table 1. Loci are alr1 and alr2.Bar, 0.1 cM as shown. The total mapped interval represents1.7 cM. Numbers below the map represent how many re-combinants were recovered between each of the markers.

Invertebrate Allorecognition 2105

DNA extractions and failed to give unambiguous resultsand so were not included in linkage analysis.

Mendelian segregation in the backcross populationused here predicts that half of the individuals should behomozygous for the genetic markers tested and halfshould be heterozygous. In contrast to this prediction, adeficit was observed in the number of homozygousoffspring recovered (46% of the total population) and asurplus in the number of heterozygous offspring (54%of the total population) for each of the five markerstested. These results differed significantly (P , 0.0001 foreach marker) from a 1:1 ratio in a x2 goodness-of-fit test.

DISCUSSION

Transitory fusions are a class of phenomena definedby fusion upon initial contact followed by a hetero-geneous set of subsequent events. The archetypal re-sponse is that described by Hauenschild (1954, 1956)and later by Cadavid et al. (2004) and here identified astype I. The type II response has also been observed.Grosberg et al. (1996, p. 2224) reported an ‘‘ambiguous’’phenotype occurring at a low frequency, which theydescribed as having ‘‘different areas of interclonal con-tact simultaneously and persistently involved fusion andrejection.’’ Other forms of variation are also known, mostnotably colonies that remain fused for prolonged inter-vals only to separate at a large size (Shenk and Buss

1991) and colonies in which the separation process be-gins but is not completed (Cadavid et al. 2004). Clarifi-cation of this phenomenological zoo would be desirable.

Two factors affect allorecognition phenotypes: allo-recognition genetics and colony ontogeny. Allorec-ognition genetics determine the compatibility of twocolonies, while the ontogeny of the allorecognition phe-notype in large part depends on developmental andenvironmental variation. One example of such varia-tion is ‘‘passive’’ vs. ‘‘aggressive’’ rejection as describedby Buss and Grosberg (1990). Rejection between twoincompatible colonies can be either passive or aggres-sive, depending on whether tissue contact is betweenmat or stolon, respectively. In passive rejection, nem-atocysts are deployed and cause tissue damage, buteventually a stable border forms between the coloniesand they cease growth on the front of contact. In ag-gressive rejection, the stoloniferous tissue proliferatesand becomes hyperplastic, swollen with nematocytes.Tissue damage and cell lysis can be observed whereverhyperplastic stolons contact other tissues. Typically, thisaggressive interaction escalates until only one colony sur-vives (Ivker 1972; Buss et al. 1984; Buss and Grosberg

1990). In both cases, the genetics of allorecognition is thebasis for rejection, but factors unrelated to allorecogni-tion genetics cause a dramatic phenotypic difference.

Similarly, the occurrence of transitory fusion here hada clear genetic basis, but the phenotype depended on

several sources of variation. The rejection following aninitial fusion depended on (1) an as-yet-unknown pro-cess that caused tissue death in the interaction zonewhen colonies were still fused and that allowed the col-onies to separate, (2) the lateral branching betweenisogeneic gastrovascular canals that accompanied sepa-ration, (3) the accumulation of a fibrous material thatformed a border between colonies, and (4) whetherand how quickly colonies grew back into contact afterhaving separated. The relative rates at which theseevents occurred in large part determined the pheno-typic outcome.

These biological processes occurred at different ratesin different colonies and led to subtle variations be-tween tests. For example, Table 2 notes that 27 individ-uals of the fr/ff recombinant genotype underwent type Itransitory fusion, but 1 individual (number AP100-815)exhibited a phenotype more characteristic of type IItransitory fusion. In two independent tests, AP100-815succeeded in separating from the rr/rr tester butgastrovascular canals failed to laterally branch followingseparation. Instead, the unfused ends of the canals grewimmediately forward again to reconnect with the testercolony before any significant border had accumulated,leading to repeated cycles of fusion and rejection. Thiscould have been due to the strength of allorecognitionsignaling, to epistatic effects, or to an idiosyncratic effectof AP100-815’s growth pattern.

In related effects, certain areas of some assays exhib-iting type II transitory fusion remained either stablyseparated or stably continuous in ways that seemed todepend on local colony architecture. Some patchesremained stably separated in a particular location forthe duration of observation if they succeeded in re-forming a ring canal at that spot, such that two ringcanals lay parallel, sandwiched against each other, buton either side of this spot the colonies fused andseparated serially. Some gastrovascular canals of largediameter and strong gastrovascular flow were observedto maintain continuity throughout the duration of thetest, perhaps because the strong flow allowed by thelarge diameter visibly carried away blockages that wouldotherwise accumulate and eventually block gastrovascu-lar exchange via the canal. In a similar sense, given thatthe exceptional phenotypes did not map to a particularlocation, an alternative interpretation of the phenotypecould be that they were type II transitory fusions (sinceall were heterozygous at the marker 194, which is mostclosely linked to alr1) that had only a weak ability tobreak continuity with a non-isogeneic partner.

Nonetheless, type I and type II transitory fusionshowed a clear relationship to genotype: the phenotypicdifference mapped onto the reciprocal recombinationproducts fr/ff and rf/ff. The first of these two possibleproducts correlated with type I transitory fusion and thelatter with type II transitory fusion. Effectively, thedifference between the recombinant and the rr/rr tester

2106 A. E. Powell et al.

in this case was whether alleles were shared only at alr1or only at alr2. Therefore, a system of only two lociaccounted for these phenotypic differences.

The fact that reciprocal recombinant haplotypes didnot lead to the same fusibility outcome shows that alr1and alr2 components contribute unequally to the allo-recognition process. The nonequivalence of alr1 and alr2could be due to an epistatic interaction between theseloci or it could depend on allelic interactions. In otherwords, it is not yet clear whether the same phenotypewould be observed whenever, e.g., alr1 matches one alleleand alr2 none, or whether a different phenotype wouldbe observed if alleles other than f and r were present. Ourfinding that two major categories of transitory fusion areexplained by differential locus or allele-specific contri-butions does not explain all known forms of variation intransitory fusion. For example, we do not yet know whatcontrols the timing of separation, which may be rapid asin type I and type II transitory fusion, but can also bedelayed, as observed by Shenk and Buss (1991). Simi-larly, the fact that some colonies begin to separate butthereafter return to a permanently fused state (Cadavid

et al. 2004) remains unexplained. Conceivably, other alralleles or as-yet-undiscovered modifying loci may be atplay. In addition to discriminating between two majorcategories of transitory fusion, our work yielded a refinedgenetic map for the interval, identified a deficit of ho-mozygotes, and found no compelling evidence for addi-tional loci in the interval. Specifically, an increase insample size from past populations (N ¼ 490) to the cur-rent population (N¼ 3565) has shrunk the interval from3.4 to 1.7 cM. The slight deficit of homozygotes recallssimilar observations noted in genetic studies of theallorecognition system of Botryllus (De Tomaso andWeissman 2004). Finally, the failure to observe any novelphenotype cosegregating with marker genotype is con-sistent with the suggestion that no further loci impactingallorecognition segregate within our defined genetic lines.

We thank Christina Glastris and Krista Joy Altland for providinganimal care, James Signorovitch for helpful discussions, and KarlHager for aid in designing the Sequenom hME assay. This work wassupported by National Institutes of Health (NIH) grant 1R21-AI066242 (to F.G.L., L.W.B., and S.L.D.) and by a New DirectionsGrant for Established Investigators from the American Society ofNephrology (to F.G.L.). A.E.P. was supported by NIH Training Grantin Genetics T32-GM07499.

LITERATURE CITED

Blackstone, N. W., and L. W. Buss, 1991 Shape variation in hydrac-tiniid hydroids. Biol. Bull. 180: 394–405.

Buss, L. W., 1982 Somatic cell parasitism and the evolution of somatictissue compatibility. Proc. Natl. Acad. Sci. USA 79: 5337–5341.

Buss, L. W., and R. K. Grosberg, 1990 Morphogenetic basis for phe-notypic differences in hydroid competitive behavior. Nature 343:63–66.

Buss, L. W., C. S. McFadden and D. R. Keene, 1984 Biology of hy-dractiniid hydroids. 2. Histocompatibility effector system/com-petitive mechanism mediated by nematocyst discharge. Biol.Bull. 167: 139–158.

Cadavid, L. F., A. E. Powell, M. L. Nicotra, M. Moreno and L. W.Buss, 2004 An invertebrate histocompatibility complex. Genet-ics 167: 357–365.

De Tomaso, A. W., and I. L. Weissman, 2004 Evolution of a proto-chordate allorecognition locus. Science 303: 977.

De Tomaso, A. W., S. V. Nyholm, K. J. Palmeri, K. J. Ishizuka, W. B.Ludington et al., 2005 Isolation and characterization of a pro-tochordate histocompatibility locus. Nature 438(7067): 454–459.

Grosberg, R. K., D. R. Levitan and B. B. Cameron, 1996 The evo-lutionary genetics of allorecognition in the colonial hydrozoanHydractinia symbiolongicarpus. Evolution 50: 2221–2240.

Hauenschild, C., 1954 Genetische und EntwicklungsphysiologieUntersuchungen uber Intersexualitat und Gewebevertraglich-keit bei Hydractinia echinata. Rouxs Arch. Dev. Biol. 147: 1–41.

Hauenschild, C., 1956 Uber die Vererbung einer Gewebevertra-glichkeits-Eigenschaft bei dem Hydroidpolypen Hydractinia echi-nata. Z. Naturforsch. 11b: 132–138.

Ivker, F. B., 1972 A hierarchy of histo-compatibility in Hydractiniaechinata. Biol. Bull. 143: 162–174.

Jackson, J. B. C., 1977 Competition on marine hard substrata:the adaptive significance of solitary and colonial strategies.Am. Nat. 111: 743–767.

Konieczny, A., and F. M. Ausubel, 1993 A procedure for mappingArabidopsis mutations using co-dominant ecotype-specific PCR-based markers. Plant J. 4(2): 403–410.

Laird, D. J., A. W. De Tomaso and I. L. Weissman, 2005 Stem cellsare units of natural selection in a colonial ascidian. Cell 123:1351–1360.

Lander, E., P. Green, J. Abrahamson, A. Barlow, M. Daly et al.,1987 MAPMAKER: an interactive computer package for con-structing primary genetic linkage maps of experimental and nat-ural populations. Genomics 1: 174–181.

Lange, R., G. Plickert and W. Muller, 1989 Histocompatibility ina low invertebrate, Hydractinia echinata: analysis of the mecha-nism of rejection. J. Exp. Zool. 249: 284–292.

Mokady, O., and L. W. Buss, 1996 Transmission genetics of allore-cognition in Hydractinia symbiolongicarpus (Cnidaria:Hydrozoa).Genetics 143: 823–827.

Muller, W., 1964 Experimentelle Untersuchungen uber Stockent-wicklung, Polypdifferenzierung und Sexualchimaren bei Hydrac-tinia echinata. Rouxs Arch. Dev. Biol. 155: 181–268.

Muller, W., 1973 Induction of metamorphosis by bacteria and ionsin the planulae of Hydractinia echinata: an approach to mode ofaction. Publ. Seto Marine Biol. Lab. 20: 195–208.

Nyholm, S. V., E. Passegue, W. B. Ludington, A. Voskoboynik, K.Mitchel et al., 2006 Fester, a candidate allorecognition recep-tor from a primitive chordate. Immunity 25(1): 163–173.

Poudyal, M., S. Rosa, A. E. Powell, M. Moreno, S. L. Dellaporta

et al., 2007 Embryonic chimerism does not induce tolerance inan invertebrate model organism. Proc. Natl. Acad. Sci. USA 104:4559–4564.

Shenk, M. A., and L. W. Buss, 1991 Ontogenic changes in fusibilityin the colonial hydroid Hydractinia symbiolongicarpus. J. Exp. Zool.257: 80–86.

Stoner, D. S., B. Rinkevich and I. L. Weissman, 1999 Heritablegerm and somatic cell lineage competitions in chimeric colonialprotochordates. Proc. Natl. Acad. Sci. USA 96: 9148–9153.

Wiens, M., A. Krasko, I. M. Muller and W. E. G. Muller,2000 Increased expression of the potential proapoptotic mole-cule DD2 and increased synthesis of leukotriene B4 during allo-graft rejection in a marine sponge. Cell Death Differ. 7: 461–469.

Wiens, M., S. Perovic-Ottstadt, I. M. Muller and W. E. G. Muller,2004 Allograft rejection in the mixed cell reaction system of thedemosponge Suberites domuncula is controlled by differential ex-pression of apoptotic genes. Immunogenetics 56: 579–610.

Communicating editor: S. Dutcher

Invertebrate Allorecognition 2107