dichotomy of ca2+ signals triggered by different phospholipid
TRANSCRIPT
![Page 1: Dichotomy of Ca2+ signals triggered by different phospholipid](https://reader031.vdocuments.mx/reader031/viewer/2022020411/589d9c9d1a28abef498bca61/html5/thumbnails/1.jpg)
Dichotomy of Ca2+ signals triggered by different phospholipid pathways in antigen stimulation
of human mast cells.
Alirio J. Melendez and Aik Kia Khaw
Department of Physiology, Faculty of Medicine, National University of Singapore, Singapore
117597.
Corresponding author:
Alirio J. Melendez
Telephone: (+65) 874 1697
Fax: (+65) 778 8161
E-mail: [email protected]
Running title: Calcium signaling by SPHK1 and PLCγ1
1
Copyright 2002 by The American Society for Biochemistry and Molecular Biology, Inc.
JBC Papers in Press. Published on February 20, 2002 as Manuscript M110944200 by guest on A
pril 8, 2018http://w
ww
.jbc.org/D
ownloaded from
![Page 2: Dichotomy of Ca2+ signals triggered by different phospholipid](https://reader031.vdocuments.mx/reader031/viewer/2022020411/589d9c9d1a28abef498bca61/html5/thumbnails/2.jpg)
Summary
Mast cell activation triggers Ca2+ signals and the release of enzyme containing granules, events
that play a major role in allergic/hypersensitivity reactions. However, the precise molecular
mechanisms that regulate antigen triggered degranulation and Ca2+ fluxes, in human mast cells,
are still poorly understood. Here we show, for the first time, that a receptor can trigger Ca2+ via
two separate molecular mechanisms. Using an antisense approach, we show that IgE-antigen
stimulation, of human bone marrow-derived mast cells, triggers a sphingosine kinase 1
(SPHK1)-mediated fast and transient Ca2+ release from intracellular stores. However, PLCγ1
triggers a second (slower) wave of calcium release from intracellular stores, and it this PLCγ1
generated signal that is responsible for Ca2+ entry. Surprisingly, FcεRI triggered mast cell
degranulation depends on the first, sphingosine kinase-mediated, Ca2+ signal. These two
pathways act independently, since antisense knock down of either enzyme does not interfere with
the activity of the other. Of interest, similarly to PLCγ1, SPHK1 rapidly translocates to the
membrane, after FcεRI crosslinking. Here we also show that SPHK1 activity depends on
phospholipase D1 (PLD1), and that, FcεRI-triggered mast cells degranulation depends primarily
on the activation of both PLD1 and SPHK1.
Abbreviations used in this paper: IgE, immunoglobulin E; FcεRI, high affinity receptor for IgE;
hBMMC, human bone marrow-derived mast cells; SPHK1, sphingosine kinase 1; SPP,
sphingosine-1-phosphate; PLD1, phospholipase D1; PtdCho, phosphatidylcholine; PA,
phosphatidic acid; PLCγ1, phospholipase C-gamma 1; DAG, diacylglycerol; IP3, inositol-
1,4,5-trisphosphate.
2
by guest on April 8, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 3: Dichotomy of Ca2+ signals triggered by different phospholipid](https://reader031.vdocuments.mx/reader031/viewer/2022020411/589d9c9d1a28abef498bca61/html5/thumbnails/3.jpg)
Introduction
Aggregation of the high affinity receptor for IgE (FcεRI) on Mast cells triggers the Ca2+
dependent release and production of a wide range of mediators responsible for the major
symptoms of immediate hypersensitivity reactions (1, 2, 3). Although some of the signaling
cascades triggered by FcεRI have been characterized, the regulatory mechanisms governing mast
cell degranulation and calcium release from internal stores are only partially understood. FcεRI
is a heterotrimeric receptor complex (αβγ2) that contains immunoreceptor tyrosine-based
activation motifs (ITAMs) in both the β and the γ subunit cytoplasmic domains (4). The
protein-tyrosine kinase Lyn is associated with the β subunit in resting cells (5), and its activation
is promoted by FcεRI cross-linking (6). Activated Lyn phosphorylates ITAMs of the β and γ
subunits, resulting in the recruitment of other Src-like as well as Syk protein tyrosine kinases
(PTK), through Src homology-2 (SH2) domain-mediated interactions with phosphotyrosine
residues (7, 8). Activation of these newly recruited PTKs, in turn, facilitates the translocation
and phosphorylation of multiple signaling molecules, including phospholipase Cγ (PLCγ)
isoforms and phosphoinositide 3-kinases (PI3K) (9). Activated PLCγ hydrolyses
phosphatidylinositol 4,5-bisphosphate (PI-4,5-P2) to D-myo-inositol 1,4,5-trisphosphate (Ins-
1,4,5-P3) and diacylglycerol (DAG), which induce the release of Ca2+ from intracellular stores
and the activation of protein kinase C isoforms (PKCs), respectively. The amplitude and
duration of the Ca2+ response potentially modulates the activation of different transcription
factors (10), regulating different gene expression. Ca2+ signals are also indispensable for the
release of histamine containing granules (1), the synthesis of arachidonic acid-derived mediators
and the release and generation of various cytokines (2), which together are responsible for the
major symptoms of immediate hypersensitivity reactions. Thus, an understanding of mast cell
activation, and Ca2+ signaling, therefore, has obvious therapeutic implications. It has previously
been shown that FcεRI, on the rat mast cell line RBL-2H, triggers Ca2+ signals via a novel
pathway potentially involving sphingosine kinase activity (11) and not phospholipase Cγ, even
though IP3 production was observed (11). We have recently shown that a similar receptor, FcγRI
in monocytes, triggers intracellular Ca2+ via the sequential activation of phospholipase D and
3
by guest on April 8, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 4: Dichotomy of Ca2+ signals triggered by different phospholipid](https://reader031.vdocuments.mx/reader031/viewer/2022020411/589d9c9d1a28abef498bca61/html5/thumbnails/4.jpg)
sphingosine kinase (12); however, no IP3 generation was observed in this case (12).
Phospholipase D hydrolysis phosphatidylcholine (PtdCho) to yield phosphatidic acid (PA) and
choline (13), PA has been shown to play many intracellular signaling functions (13, 14),
including the activation of sphingosine kinase (SPHK) (14-16). SPHK phosphorylates
sphingosine to generate sphingosine-1-phosphate (SPP) (15, 16, 17). SPP has been
demonstrated to act as an alternative second messenger to Inositol-1,4,5-trisphosphate in the
release of Ca2+ from intracellular stores (11, 12). In this study we show, for the first time, a dual
molecular mechanism responsible for triggering different calcium signals. Firstly, a rapid rise in
internal calcium, triggered by the sequential activation of phospholipase D1 (PLD1) and
sphingosine kinase 1 (SPHK1). Secondly a prolong calcium response is triggered by
phospholipase Cγ1. Furthermore, mast cell degranulation is triggered by the combined action of
PLD1 and SPHK1. However, the PLCγ1 activation is necessary to trigger calcium entry into the
cells.
Understanding the intracellular signaling pathways coupling FcεRI activation, by IgE-antigen, to
physiological responses triggered by mast cell activation has profound therapeutic implications
for allergic/inflammatory diseases.
4
by guest on April 8, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 5: Dichotomy of Ca2+ signals triggered by different phospholipid](https://reader031.vdocuments.mx/reader031/viewer/2022020411/589d9c9d1a28abef498bca61/html5/thumbnails/5.jpg)
Materials and MethodsUnless stated differently all chemicals and reagents were obtained from Sigma.
BMMC Generation, and cell culture
Bone marrow was collected from human donors following the protocol approved by the FDA
Committee for Research Involving Human Subjects. Normal donor eligibility criteria include
healthy males and non-pregnant females between the ages of 18 and 45 years old. The donors
must have a negative medical history for all major diseases. Bone marrow was withdrawn by
board-certified physicians from two separate sites of the posterior pelvic bone into syringes
containing preservative-free heparin sodium injection (20-50 units heparin per ml bone
marrow). BMMCs were generated using the, previously described 18, following protocol: fresh
human bone marrow cells were cultured in complete RPMI 1640 supplemented with 10ng/ml
IL-3 (Calbiochem) and 100ng/ml Stem Cell Factor (Calbiochem) for two weeks. Cells were
characterized as BMMCs by flow cytometry as CD45+, CD117+, CD9+, positive with FITC-
labeled human IgE, CD4-, CD8-, CD45-, CD11b-, CD11c-, and MHC class II-. Purity was
estimated at >95%. All antibodies were FITC or biotin labeled (Serotec).
Antisense oligonucleotides were purchased from Oswell DNA Services; 20-mers were
synthesised, capped at either end by the phosphorothiorate linkages (first two and last two
linkages), and corresponded to the reverse complement of the first 20 coding nucleotides for
PLD1, SPHK1, PLCγ1, and a scrambled oligo for control. The sequences of the oligonucleotides
were:
5‘CCGTGGCTCGTTTTTCAGTG 3‘ for PLD1,
5‘CCCGCAGGATCCATAACCTC 3‘ for SPHK1.
5‘GGGGACGCGGCGCCCGCCAT 3‘ for PLCγ1.
5‘CTGGTGGAAGAAGAGGACGT 3‘ scrambled for control
Cells were incubated/transfected with 1µM oligonucleotides mixed with transfection reagent
(FuGene, Roche) for a total of 48 hrs (36 hrs prior to, and then for the duration of sensitisation).
Reverse Transcription PCR
mRNA from BMMC was isolated using the Quiagen midi kit for mRNA extraction. Specific
5
by guest on April 8, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 6: Dichotomy of Ca2+ signals triggered by different phospholipid](https://reader031.vdocuments.mx/reader031/viewer/2022020411/589d9c9d1a28abef498bca61/html5/thumbnails/6.jpg)
forward (TGAACCCGCGCGGCAAGGGC) and reverse (GGTCAGCCGGCGCCATCCACG)
primers were designed for the human SPHK1 to yield a 570 bp fragment.
Peptide-derived polyclonal antibody specific for the human SPHK1
A peptide sequence, specific for the human SPHK1, was selected for its apparent hydrophobisity
properties, and synthesised.
Peptide: FIADVDLESEKYRRLGEMRFTLGT. Two rabbits were immunised giving rise to
two peptide-derived antisera. The polyclonal antibodies were purified using protein-A agarose
affinity columns. The polyclonal antibodies only recognised one band, in western blots, for the
correct molecular weight of endogenous, or recombinant human SPHK1. The antibody was also
successfully used, as primary antibody, for immune-staining for confocal microscopy analysis.
FcεRI aggregation
BMMC cells were sensitized with 1µg/ml human DNP-specific IgE overnight. Then cells were
collected, washed, resuspended in RPMI-1% FBS, activated by the antigen DNP-BSA
(1µg/ml), and activation stopped at the times indicated in the figures.
Cell lyses and subcellular fractionation
For translocation experiments, cell lyses and subcellular fractions were prepared following the
method previously described (19). Briefly, cells were harvested and resuspended in cold nuclear
preparation lyses buffer (10 mM Tris-HCL, pH 7.4, 2 mM magnesium chloride, 140 mM
sodium chloride, 1% Triton X100, 0.25% sodium deoxycholate, 1 mM EGTA, 1 mM PMSF, 10
mM sodium orthovanadate, 10 µg/ml chymostatin, 10 µg/ml leupeptin, 10 µg/ml antipain and 10
µg/ml pepstatin). After lyses by freeze thaw (x 3 in liquid nitrogen), from the total cell lysates,
the nuclei and cell debris (containing the cytoskeleton) were removed by centrifugation at 15,000
g for 5 min. The supernatant was centrifuged at 100,000 g and 4°C for 60 min. The pellet
containing the nuclear-free membrane fraction was resuspended in 200 µl of nuclear preparation
buffer (without detergents) and stored at -20 °C. The amount of protein recovered in each
fraction was quantified using the Bradford reagent system (Bio-Rad, UK).
6
by guest on April 8, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 7: Dichotomy of Ca2+ signals triggered by different phospholipid](https://reader031.vdocuments.mx/reader031/viewer/2022020411/589d9c9d1a28abef498bca61/html5/thumbnails/7.jpg)
Gel Electrophoresis and Western Blots
Unless stated otherways, 40 µg of lysate for each sample was resolved on 10% polyacrylamide
gels (SDS-PAGE) under denaturing conditions and then transferred to 0.45µm nitrocellulose
membranes. For translocation experiments, 40 µg of lysate for each sample was fractionated as
mentioned above, the supernatant and the membrane fractions for each sample were separately
resolved on 10% polyacrylamide gels (SDS-PAGE) under denaturing conditions and then
transferred to 0.45µm nitrocellulose membranes. After blocking overnight at 4°C with 5% non-
fat milk in TBS, 0.1% Tween 20 and washing, the membranes were incubated with the relevant
antibodies for 4 hr at room temperature. The membranes were washed extensively in TBS/0.1%
Tween 20 (washing buffer). The blots were probed using specific, monoclonal (anti-PLCγ1,
Santa Cruz) ; polyclonal (anti-PLD1, QCB) ; (anti-SPHK1 made in house as described) ;
primary antibodies. Blots were stripped and reprobed with policlonal antibodies: an anti-
PDGFRα antibody (against the alpha subunit of the PDGF receptor, Santa Cruz), for membrane loading
control; or with an anti-HSP 90 (H-114, against the heat shock protein 90, Santa Cruz) for
cytosol loading control. The anti-PDGFα antibody was also used as a loading control for blots
containing whole cell lysates. Bands were visualised using the appropriate HRP-conjugated
secondary antibody, and the ECL Western Blotting Detection System (Amersham, UK).
Phospholipase D (PC-PLD) activity
PLD activity was measured as previously described (12) using the transphosphatidylation assay.
Briefly, BMMC cells were labeled (106 cells/ml) with [3H] palmitic acid (5 µCi/ml, Amersham,
UK) in the cell culture medium for 16 hr. Following washing, the cells were incubated at 37°C
for 15 min in RHB medium, containing butan-1-ol (0.3% final). Following FcεRI aggregation,
cells were incubated for a further 30 min and then extracted by Bligh-Dyer phase separation.
The accumulated phosphatidyl butanol was assayed as described previously (12).
Inositol-1,4,5-trisphosphate
Inositol-1,4,5-trisphosphate (IP3) was measured as previously described (20), using the
BIOTRAK TRK 1000 kit (Amersham-Pharmacia). Briefly, this is a competition binding assay
7
by guest on April 8, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 8: Dichotomy of Ca2+ signals triggered by different phospholipid](https://reader031.vdocuments.mx/reader031/viewer/2022020411/589d9c9d1a28abef498bca61/html5/thumbnails/8.jpg)
in which cellular generated (unlabelled) IP3 competes with a fixed, known amount of [3H]IP3
for binding to the IP3 receptor present in homogenates from bovine adrenal glands, which has a
high affinity and specificity for IP3. FcεRI aggregation was carried out described above, and
activation stopped at the times indicated in the figures.
Sphingosine kinase activity
Activation of sphingosine kinase was measured as described previously (12, 21). Briefly, cells
were resuspended in ice-cold 0.1 M phosphate buffer (pH 7.4) containing 20% glycerol, 1 mM
mercaptoethanol, 1 mM EDTA, phosphatase inhibitors (20 mM ZnCL2, 1 mM sodium
orthovanadate, and 15 mM sodium fluoride), protease inhibitors (10 µg/ml leupeptin, 10 µg/ml
aprotinin, and 1 mM PMSF), and 0.5 mM 4-deoxypyridoxine, disrupted by freeze thawing and
centrifuged at 105,000 g for 90 min at 4ºC. Supernatants (cytosolic) and particulate (membrane)
fractions were assayed for sphingosine kinase activity by incubating with sphingosine (Sigma)
and [γ32P]ATP (2 µCi, 5 mM) for 30 min at 37ºC and products were separated by TLC on silica
gel G60 (Whatman, U.K.) using chloroform/methanol/acetic acid/water (90:90:15:6) and
visualized by autoradiography. The radioactive spots corresponding to sphingosine phosphate
were scraped and counted in a scintillation counter.
Cytosolic Ca2+
Cytosolic calcium was measured as described previously (12, 21), except that for some
experiments the buffer was Ca2+ supplemented (final concentration 1.5 mM Ca2+). Briefly,
sensitized cells were loaded with 1 µg/ml Fura2-AM (Molecular Probes, Leiden, The
Netherlands) in PBS, 1.5 mM Ca2+ and 1 % BSA. After removal of excess reagents by dilution
and centrifugation, the cells were resuspended in 1.5 mM Ca2+ supplemented PBS and warmed
to 37°C in the cuvette. FcεRI was aggregated as described above. Fluorescence was measured
at 340 and 380 nm and the background-corrected 340:380 ratio was calibrated as previously
described (12).
8
by guest on April 8, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 9: Dichotomy of Ca2+ signals triggered by different phospholipid](https://reader031.vdocuments.mx/reader031/viewer/2022020411/589d9c9d1a28abef498bca61/html5/thumbnails/9.jpg)
Confocal microscopy
After receptor aggregation, suspended cells were fixed in 4% paraformaldehyde and deposited on
microscope slides in a cytospin centrifuge, then permeabilised for 5 min in 0.1% Triton X100 in
PBS. Fluorescent labeling was performed as previously described (22), using anti-PLCγ1
monoclonal antibody (Santa Cruz), or anti-SPHK1 polyclonal (made in house as described), as
primary antibodies. Stainings were analyzed in horizontal confocal microscopy sections (50-100
sections of 0.2 µm), recorded by a Leica TCS NT, and images deconvoluted. Signals were
projected into one image as an extended focus view.
β-Hexosaminidase release
Degranulation was measured using a previously described (23) colorimetric assay to assess the
release of β-hexosaminidase. Briefly, 50µl of the sample supernatant was incubated with 200µl
of 1mM p-nitrophenyl N-acetyl-β-D-glucosiaminide for 1hr at 37°C. The total β-
hexosaminidase concentration was determined by a 1:1 extraction of the remaining buffer and
cells with 1% Triton X-100; a 50µl aliquot was removed and analyzed as described. Reactions
were quenched by addition of 500µl of 0.1M sodium carbonate buffer. The enzyme
concentration was determined by measuring the OD at 400nm. β-hexosaminidase release was
represented as a percent of total enzyme.
9
by guest on April 8, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 10: Dichotomy of Ca2+ signals triggered by different phospholipid](https://reader031.vdocuments.mx/reader031/viewer/2022020411/589d9c9d1a28abef498bca61/html5/thumbnails/10.jpg)
Results
In this study we explored the molecular mechanisms regulating receptor coupling to various lipid
modifying-enzymes and relate these to the triggering of Ca2+ signals, and degranulation.
Since SPHK had been shown to play a potential role in triggering Ca2+ release from intracellular
stores, we decided to investigate whether SPHK is indeed involved in the FcεRI triggering of
Ca2+ signals in the human mast cells. Two human sphingosine kinases have recently been cloned
and characterized, namely sphingosine kinase 1 (SPHK1) (15), and sphingosine kinase 2
(SPHK2) (17). First, the presence of specific SPHK isozymes present in the cells was examined.
In bone marrow-derived mast cells only SPHK1 was found by RTPCR (Figure 1A), and by
western blot (Figure 1B). Western blot analysis showed that SPHK1, in resting cells, is found
primarily in the cytosolic fraction of the cells (Figure 1B upper). However, aggregation of FcεRI
resulted in the rapid translocation of SPHK1, from the cytosol to the nuclear-free membrane
fraction (Figure 1B lower). In agreement with this, confocal microscopy also shows that in
resting cells SPHK1 is primarily cytosolic, but after receptor engagement it rapidly translocates
to the cell periphery (Figure 1C).
Sphingosine kinase activity, and its product sphingosine-1-phosphate (SPP), has been shown to
be involved in many cellular processes, including Ca2+ signals (11, 12), suppression of
ceramide-mediated apoptosis (24), and cell survival and proliferation (24). However, the
regulation of SPHK activity is still poorly understood. We have previously shown that a similar
receptor, FcγRI in monocytic cells, triggers sphingosine kinase activity dependent on
phospholipase D (PLD) activation (11, 21). There is also in-vitro evidence for the regulation of
SPHK activity by acidic phospholipids (such as phosphatidic acid, the direct product of PLD
activity) (16). Here we show that in the human bone marrow-derived mast cells FcεRI couples
to PLD1 to activate SPHK1. Antisense to PLD1 blocks FcεRI triggered PLD activity (Figure 2A
upper), and considerably reduced endogenous PLD1 expression levels to only 18% + 5% of the
PLD1 expressed in the control cells taken as 100% (Figure 2A lower). In resting cells, very little
SPHK activity is observed, however, following FcεRI crosslinking SPHK activity very rapidly
increases (Figure 2B). In agreement with the translocation experiments (Figures 1A and 1C),
very little SPHK activity is observed in the membrane fraction of resting cells, however,
10
by guest on April 8, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 11: Dichotomy of Ca2+ signals triggered by different phospholipid](https://reader031.vdocuments.mx/reader031/viewer/2022020411/589d9c9d1a28abef498bca61/html5/thumbnails/11.jpg)
following FcεRI crosslinking, SPHK activity very rapidly increases in the membrane fraction to
higher levels than that observed in the cytosolic fraction (Figure 2B, right and left, respectively).
Moreover, antisense to PLD1 blocked the FcεRI triggered SPHK1 activity (Figure 2B upper), but
had no effect on SPHK1 expression (Figure 2B lower). Furthermore, an antisense to SPHK1
blocked FcεRI triggered sphingosine kinase activity (Figure 2B upper), and had no effect on
PLD activity (figure 2A upper), or on PLD1 expression levels (Figure 2A lower), but
considerably reduced endogenous SPHK1 expression levels to only 15% + 5% of the SPHK1
expressed in the control cells taken as 100% (Figure 2B lower). The scrambled oligo used as
control had no effect on the level of expression of either protein. These data suggest that SPHK1
is downstream of PLD1 activity in the FcεRI triggered signal transduction pathways.
In the rat mast cell line RBL-2H, Choi and co-workers (11) showed that FεRI triggered Ca2+
release from intracellular stores was dependent on sphingosine kinase activity, by addition of the
non-selective sphingosine kinase inhibitor dihydrosphingosine (DHS); which reduced the
increase in Ca2+ in response to antigen, while the antigen induced production of IP3 was
unimpaired. However, IP3 is widely known to trigger the release of Ca2+ from intracellular
stores by activating specific receptors on the membranes of these stores (25, 26), and PLCγ has
been shown to be phosphorylated, and to translocate following FcεRI triggering in rat mast cells
(27, 28). To determine whether in the human mast cells, FcεRI triggers IP3-generation and IP3-
mediated Ca2+ release, IP3 generation was monitored over time. We found that, in the human
mast cells, PLC is activated by FcεRI, as shown by the generation of IP3 (Figure 3A).
Moreover, PLCγ1 is the PLC isoform that translocates to the membrane, following FcεRI
engagement (Figure 3B upper). Furthermore, antisense to PLCγ1 inhibited IP3 generation
triggered by FcεRI (Figure 3A), and dowregulated the endogenous PLCγ1 expression levels
(Figure 3B lower). Antisense to SPHK1 had no effect on IP3 production (Figure 3A), or on
PLCγ1 expression levels (Figure 3B lower).
For all experiments the antisense transfection efficiency was very even, an average 85% of the
cells treated with any of the antisense used showed complete downregulation in the expression
11
by guest on April 8, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 12: Dichotomy of Ca2+ signals triggered by different phospholipid](https://reader031.vdocuments.mx/reader031/viewer/2022020411/589d9c9d1a28abef498bca61/html5/thumbnails/12.jpg)
levels of the targeted protein (FACS analysis, data not shown).
In order to clarify the roles of SPHK1 and/or PLCγ1 in the Ca2+ signals generated following
FcεRI engagement, we next used the antisense oligonucleotides against the human SPHK1 and
PLCγ1, to demonstrate which pathway was responsible for Ca2+ triggering in the human mast cells.
It was found that antisense downregulation of SPHK1 substantially inhibited the initial rise in
Ca2+ release from intracellular stores (Figure 4A); however, Ca2+ entry was unaffected (Figure
4A). In cells pretreated with antisense to PLCγ1 the first peak in Ca2+ was unaffected (Figure
4B), however, calcium entry was reduced (Figure 4B). Experiments without extracellular Ca2+
showed that the first, initial, rise in intracellular Ca2+ is due to SPHK1 (Figure 4C), whereas, a
second (smaller) increase in Ca2+ release from internal stores was dues to PLCγ1 (Figure 4C). A
combination of both, antisense to SPHK1 and PLCγ1, completely blocked the calcium response
triggered by FcεRI (Figure 4D). The use of specific inhibitors for SPHK, N,N-dimethyl-
sphingosine (DMS); or for PLC, ET-18-OCH3, generated similar results as those observed with
the antisense oligonucleotides (data not shown).
These results show that FcεRI triggers Ca2+ signals by two different pathways. Firstly, a novel
pathway that uses SPHK1, and is responsible for the initial strong Ca2+ released from internal
stores. Secondly, a more classical pathway that triggers IP3 generation via PLCγ, which triggers
a second although smaller peak in Ca2+ release from intracellular stores, but which is
responsible for triggering Ca2+ entry.
In contrast to previous studies in rat mast cells (11), the non-selective tyrosine kinase inhibitor,
genistein, completely blocked SPHK activity and IP3 generation (Figures 5A and 5B), as well as
FcεRI induced PLD activity, but had no effect on PMA induced PLD activity, suggesting that the
tyrosine kinase inhibitor does not directly inhibits PLD activity (Figure 5C). The FcεRI
triggered membrane translocation of SPHK1 and PLCγ1 was also inhibited by the tyrosine
kinase inhibitor (Figures 5D and 5E, respectively). Moreover, the Ca2+ signals triggered by
12
by guest on April 8, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 13: Dichotomy of Ca2+ signals triggered by different phospholipid](https://reader031.vdocuments.mx/reader031/viewer/2022020411/589d9c9d1a28abef498bca61/html5/thumbnails/13.jpg)
FcεRI, were also completely blocked in cells pretreated with genistein (Figure 5D). These data show
that SPHK1 and PLCγ1 activities, as well as all the Ca2+ signals triggered by FcεRI, are
completely tyrosine kinase dependent.
Mast cells degranulation has been shown to be Ca2+ dependent (2, 3), and linked to
Phospholipase D activity (23, 29, 30). Antisense downregulation of different PLD isoforms is
proving a very useful tool in dissecting the functions of each particular isoenzyme (31).
Antisense downregulation of PLD1 substantially inhibits FcεRI triggered mast cell degranulation
(Figure 6A), but has no effect on IP3 generation (Figure 6B). Similarly, antisense to SPHK1 also
inhibited enzyme release (Figure 6A), and a combination of antisense to PLD1 and SPHK1
almost completely inhibited FcεRI triggered degranulation (Figure 6A), but had no effect on IP3
production. Antisense to PLCγ1 had no effect on enzyme release (Figure 6A), but significantly
reduced IP3 generation (Figure 6B).
These results show that both PLD1 and SPHK1 are necessary for FcεRI to trigger mast
cell degranulation.
13
by guest on April 8, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 14: Dichotomy of Ca2+ signals triggered by different phospholipid](https://reader031.vdocuments.mx/reader031/viewer/2022020411/589d9c9d1a28abef498bca61/html5/thumbnails/14.jpg)
Discussion
Taken together, the data presented here demonstrates that the activation of FcεRI by surface
IgE-antigen complexes, on human bone marrow-derived mast cells, stimulates two different
pathways to trigger Ca2+ release from internal stores. A novel pathway, that couples
phospholipase D1 (PLD1) to sphingosine kinase1 activation (SPHK1), is responsible for the
initial peak in the FcεRI generated Ca2+ signals as well as the mast cell degranulation; and a
more classical pathway which triggers PLCγ1 activity and IP3 dependent second wave of Ca2+
release from internal stores, as well as Ca2+ entry into the cells.
The activation of sphingosine kinase and the generation of sphingosine-1-phosphate have been
previously proposed to play a role in mobilizing calcium from intracellular stores (11, 12, 32-
34). However, this proposal has proven highly controversial due to the presence of extracellular
G protein-coupled receptors for sphingosine-1-phosphate (35, 36), which are able to mobilize
calcium through conventional IP3 receptor-dependent pathways. However, the resent cloning of
the SCaMPER receptor (37) provides additional evidence that sphingoid derivatives are able to
engage intracellular receptors and effect calcium release from intracellular stores independently
of IP3 generation. The data presented here provide evidence for specific immune receptor
triggering of this pathway in mast cells. Thus, aggregation of FcεRI resulted in the rapid
membrane translocation and activation of SPHK1. The results presented in this report
demonstrate that the initial peak in Ca2+ release from intracellular stores, triggered by FcεRI, is
dependent on sphingosine kinase activity. In this respect, FcεRI aggregation in human mast cells
is behaving like in the rat mast cell line RBL-2H (11), and like the high affinity IgG receptor,
FcγRI, in human myeloid cells (12). Of interests, both these receptors use the same signal-
transducing molecule (γ-chain) to recruit soluble tyrosine kinases (38, 39). However, unlike the
study in the RBL-2H cells (11), and that of FcγRI in human myeloid cells (12), a second peak in
Ca2+ release from internal stores, as well as Ca2+ influx to the cells, triggered by FcεRI in mast
cells, was dependent on PLCγ1 activation. The mechanism of coupling of tyrosine kinases to
sphingosine kinase activation following FcεRI aggregation in the RBL-2H cells was unclear
(11). Here, we demonstrate that PLD1 is activated following FcεRI aggregation in human mast
cells and that SPHK1 activation is dependent on PLD1 activation. The immediate product of
14
by guest on April 8, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 15: Dichotomy of Ca2+ signals triggered by different phospholipid](https://reader031.vdocuments.mx/reader031/viewer/2022020411/589d9c9d1a28abef498bca61/html5/thumbnails/15.jpg)
PtdCho-PLD is phosphatidic acid, and this is subsequently converted to DAG through the action
of phosphatidic acid phosphohydrolases (14). Previous studies have shown that sphingosine
kinase is activated by phosphatidic acid (16, 40) and not by DAG (16, 40), a product of both
phospholipase D and phospholipase C. Our finding that sphingosine kinase is downstream of
PLD is, therefore, consistent with this in vitro work. Moreover, both components of this novel
FcεRI-coupled intracellular signaling pathway involving the sequential activation of PLD and
sphingosine kinase depend on tyrosine kinase. This finding is consistent with previous in vitro
studies demonstrating that v-Src can activate PLD (41).
Aggregation of FcεRI in mast cells triggers a number of effector functions. The novel
intracellular signaling pathway demonstrated here appears to be functionally associated with
these. Thus, previous studies have implicated phospholipase D in modulating neutrophil,
monocyte and macrophage function, in particular by influencing the respiratory burst/NADPH
oxidase cascade (42), vesicular trafficking (6), and phagocytosis (43). In the study reported here,
inhibiting this pathway at either PLD1 or SPHK1 level reduced the ability of this receptor to
mobilize Ca2+ from intracellular stores. In addition, the inhibition of PLD and/or sphingosine
kinase significantly reduced enzyme release/degranulation. Of interest, ADP-ribosylation factor
(ARF) plays a major role in regulating vesicular trafficking (44-46), and this small weight G
protein has also been demonstrated to regulate phospholipase D activity (31, 45-47).
This potential diversity of phospholipid signaling pathways offers the opportunity within the cell
to very tightly regulate different physiological events of the cell effector mechanisms. The
finding that FcεRI is coupled to the release of calcium from intracellular stores and enzyme
release/degranulation via a novel pathway has profound implication for the development of
strategies for therapeutic intervention against different allergic and inflammatory responses.
Acknowledgements
We thank Dr. Laszlo Takacs for helpful comments during the preparation of the manuscript. A
start-up grant form the National Medical Research Counsel of Singapore supported this work.
15
by guest on April 8, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 16: Dichotomy of Ca2+ signals triggered by different phospholipid](https://reader031.vdocuments.mx/reader031/viewer/2022020411/589d9c9d1a28abef498bca61/html5/thumbnails/16.jpg)
References
1. Beaven, M.A., and Metzger, H. (1993) Immunol. Today 14, 222-226
2. Barnes, P.J., Chung, K.F., and Page, C.P. (1998) Pharmacol. Rev. 50, 515-596
3. Kinet, J.P. (1999) Ann. Rev. Immunol. 17, 931-972
4. Metzger, H. (1992) Immunol. Rev. 125, 37-48
5. Vonakis, B.M., Chen, H., Haleen-Smith, H., and Metzger, H. (1997) J. Biol. Chem. 272,
24072-24080
6. Pribluda, V.S., Pribluda, C., and Metzger, H. (1994) Proc. Natl. Acad. Sci. U.S.A. 91,
11246-11250
7. Jouvin, M.H., Adamczewski, M., Numerof, R., Letourneur, O., Valle, A., and Kinet, J. P.
(1994) J. Biol. Chem. 269, 5918-5925
8. Kihara, H., and Siraganian, R.P. (1994) J. Biol. Chem. 269, 22427-22432
9. Metcalfe, D.D., Baram, D., and Mekori, Y.A. (1997) Physiol. Rev. 77, 1033-1079
10. Dolmetsch, R.E., Lewis, R.S., Goodnow, C.C., and Healy, J.I. (1997) Nature 386, 855-
857
11. Choi, O.H., Kim, J-H., and Kinet, J-P. (1996) Nature 380, 634-636
12. Melendez, A., Floto, R.A., Gillooly, D.J., Harnett, M.M., and Allen, J.M. (1998) J. Biol.
Chem. 273, 9393-9402
13. Exton, J.H. (1997) Physiol. Rev. 77, 303-320
14. English, D., Cui, Y., and Sidiqui, R.A. (1996) Chem. Phys. Lips. 80, 117-132
15. Melendez, A.J., Carlos-Dias, E., Gosink, M., Allen, J.M., and Takacs, L. (2000) Gene
251, 19-26
16. Olivera, A., Kohama, T., Tu, Z., Milstein, S., and Spiegel, S. (1998) J. Biol. Chem. 273,
12576-12583
17. Liu, H., Sugiura, M., Nava, V.E., Edsall, L.C., Kono, K., Poulton, S., Milstien, S.,
Kohama, T., and Spiegel, S. (2000) J. Biol. Chem. 275, 19513-19520
18. Rottem, M., Hul,l G., and Metcalfe, D.D. (1994) Exp. Hematol. 22, 1147-1155
19. Melendez, A.J., Harnett, M.M., and Allen, J.M. (1999) Immunol. 96, 457-464
20. Melendez, A.J., Harnett, M.M., and Allen, J.M. (1999) Immunol. 98, 1-8
21. Melendez, A.J., Bruetschy, L., Floto, R.A., Harnett, M.M., and Allen, J.M. (2001) Blood
16
by guest on April 8, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 17: Dichotomy of Ca2+ signals triggered by different phospholipid](https://reader031.vdocuments.mx/reader031/viewer/2022020411/589d9c9d1a28abef498bca61/html5/thumbnails/17.jpg)
98, 3421-3428
22. Vietor, I., Bader, T., Paiha, K, and Huber, L.A. (2001) EMBO 4:306-312
23. Cohen, J.S., and Brown, A. (2001) Biochemistry 40, 6589-6597
24. Cuvillier, O., Pirianov, G., Kleuser, B., Vanek, P.G., Coso, O.A., Gutkind, J.S., and
Spiegel, S. (1996) Nature 381, 800-803
25. Berridge, M.J. (1993) Nature 261, 315-325
26. Finch, E.A., and Augustine, G.J. (1998) Nature 396, 24-31
27. Park, D.J., Min, H.K., and Rhee, S.G. (1991) J. Biol. Chem. 266, 24237-24240
28. Atkinson, T.P., Kaliner, M.A., and Hohman, R.J. (1992) J. Immunol. 148, 2194-2200
29. Way, G., O’Luanaigh, and Cockroft, S. (2000) Biochem. J. 346, 63-70
30. Brown, F.D., Thompson, N., Saqib, K.M., Clark, J.M., Powner, D., Thompson, N.T.,
Solari, R., and Wakelam, M.J. (1998) Curr. Biol. 8, 835-838
31. Melendez, A.J., Harnett, M.M., and Allen, J.M. (2001) Curr. Biol. 11, 869-874
32. Ghosh, T.K., Bian, J., and Gill, D.L. (1990) Science 248, 1653-1656
33. Mattie, M., Brooker, G., and Spiegel, S. (1994) J. Biol. Chem. 269, 3181-3188
34. Olivera, A., Zhang, H., Carlsson, R.O., Mattie, M.E., Schmidt, R.R., and Spiegel, S.
(1994) J. Biol. Chem. 269, 17924-17930
35. Wu, J., Spiegel, S., and Sturgill, T.W. (1995) J. Biol. Chem. 270, 11484-11488
36. Postma, F.R., Jalink, K., Hengeveld, T., and Moolenaar, W.H., (1996) EMBO J. 15,
2388-2395
37. Mao, C., Kim, S.H., Almenoff, J.H., Rudner, X.L., Kearney, D.M., and Kidman, L.A.
(1996) Proc. Natl. Acad. Sci. U.S.A. 93, 1993-1996
38. Ra, C., Jouvin, M-H., Blank, J., and Kinet, J-P. (1989) Nature 341, 752-754
39. Cambier, J.C. (1995) J. Immunol. 155, 3281-3285
40. Olivera, A., Rosenthal, J., and Spiegel, S. (1996) J. Cell. Biochem. 60, 529-537
41. Jlang, H., Luo, J.Q., Urano, T., Frankel, P., Foster, D.A., and Feig, L.A. (1995) Nature
378, 409-412
42. Qualliotine-Mann, D., Agwu, D.E., Ellenburg, M.D., McCall, C.E., and McPhail, L.C.
(1993) J. Biol. Chem. 268, 23843-23849
43. Kusner, D.J., Hall, C.F., Jackson, S. (1999) J. Immunol. 162, 2266-2274
17
by guest on April 8, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 18: Dichotomy of Ca2+ signals triggered by different phospholipid](https://reader031.vdocuments.mx/reader031/viewer/2022020411/589d9c9d1a28abef498bca61/html5/thumbnails/18.jpg)
44. Ktistakis, N.T., Brown, H.A., Waters, M.G., Sternweis, P.C., and Roth, M.G. (1996) J.
Cell. Biol. 134, 295-306
45. Morgan, C.P., Sengelov, H., Whatmore, J., Borregaard, N., and Cockcroft S. (1997)
Biochem. J. 325, 581-585
46. Caumont, A-S., Galas, M-C., Vitale, N., Aunis, D., and Bader, M-F. (1998) J. Biol.
Chem. 273, 1373-1379.
47. Le Stunff, H., Dokhac, L., Bourgoin, S., Bader, M.F., and Harbon, S. (2000) Biochem. J.
352, 491-499
18
by guest on April 8, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 19: Dichotomy of Ca2+ signals triggered by different phospholipid](https://reader031.vdocuments.mx/reader031/viewer/2022020411/589d9c9d1a28abef498bca61/html5/thumbnails/19.jpg)
Figure legends:
Figure 1. SPHK1 expression and subcellular localization in human BMMC.A. RTPCR analysis of mRNA expression levels before sensitization (1); and after
sensitization (2); line 3 is without primers.B. Western blot analysis of SPHK1 subcellular localization before and after FcεRI
crosslinking. Upper panel, time course for FcεRI crosslinking probing for SPHK1 in the cytosolic fraction: resting cells (1); 30 sec after FcεRI crosslinking (2); 1 min after FcεRI crosslinking (3). Blots were stripped and reprobed HSP 90 for cC. ytosol loading control; Lower panel, time course for FcεRI crosslinking probing for SPHK1 in the nuclear-free membrane fraction: resting cells (1); 30 sec after FcεRI crosslinking (2); 1 min after FcεRI crosslinking (3). Blots were stripped and reprobed for PDGFRα, for membrane loading control.
D. Confocal microscopy of cells immuno-stained for SPHK1. Cells before FcεRI aggregation (Resting cells); cells after crosslinking FcεRI for 1 min (XL FcεRI).Results shown are representative of three separate experiments.
Figure2. FcεRI triggers PLD1 activity upstream of SPHK1.A. Upper panel: PLD basal activity (1); PLD activity after FcεRI crosslinking in control
cells (2); PLD activity after crosslinking FcεRI in cells pretreated with an antisense to PLD1 (3); PLD activity in cell pretreated with an antisense to SPHK1 (4). Results shown are the mean + the standard deviation of triplicate measurements and are representative of three separate experiments.
A. Lower panel: PLD1 expression is downregulated by the antisense against PLD1. Western blot probed with anti PLD1 antibody, extracts from control cells (control); cells pretreated with an scrambled oligo (Scrambled a.s.); cells pretreated with the antisense to PLD1 (a.s.PLD1); cells pretreated with the antisense to SPHK1 (a.s.SPHK1). For loading control, blots were stripped and reprobed with an anti-PDGFRα antibody (edited band).Results shown are representative of three separate experiments.
B. Upper panel left = cytosol; right = membrane: FcεRI triggers SPHK1 activity downstream of PLD1. Basal SPHK activity control (Basal); SPHK activity after FcεRI crosslinking control (XL FcεRI); SPHK activity after FcεRI crosslinking in cells pretreated with the antisense to SPHK1 (XL FcεRI a.s.SPHK1); SPHK activity after FcεRI crosslinking in cells pretreated with the antisense to PLD1 (XL FcεRI a.s.PLD1). Results shown are the mean + the standard deviation of triplicate measurements and are representative of three separate experiments.Lower panel: SPHK1 expression is downregulated by the antisense against SPHK1, but not by the PLD1 antisense. Western blot probed with anti SPHK1 antibody, cell extracts from control cells (Control); cells pretreated with an scramble oligo (Scrambled a.s.); cells pretreated with the antisense to SPHK1 (a.s.SPHK1); cells pretreated with the antisense to PLD1 (a.s.PLD1); and 0.5ng of purified recombinant SPHK1 (rSPHK1). For loading control, blots were stripped and reprobed with an anti-PDGFRα antibody (edited band). Results are representative of three separate experiments.
19
by guest on April 8, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 20: Dichotomy of Ca2+ signals triggered by different phospholipid](https://reader031.vdocuments.mx/reader031/viewer/2022020411/589d9c9d1a28abef498bca61/html5/thumbnails/20.jpg)
Figure 3. FcεRI triggers PLCγ1 activity and translocation.A. IP3 generation basal control (Basal); IP3 generation after FcεRI crosslinking, control
time course (XL FcεRI); IP3 generation after FcεRI crosslinking, time course, in cells
pretreated with an antisense to PLCγ1 (XL FcεRI a.s.PLCγ1); IP3 generation after FcεRI
crosslinking, time course, in cells pretreated with an antisense to SPHK1 (XL FcεRI a.s.SPHK1). Results sB. hown are the mean + the standard deviation of triplicate measurements and are representative of three separate experiments.
C. Western blots showing PLCγ1 translocation and downregulation by antisense to PLCγ1. Upper panel: a time course of FcεRI crosslinking, cytosolic fraction probed with an anti- PLCγ1 antibody (upper band), loading control using an anti-HSP 90 antibody (lower band). Middle panel: a time course of FcεRI crosslinking, nuclear-free membrane fraction probed with an anti- PLCγ1 antibody (upper band), loading control using an anti-PDGFRα antibody (lower band). Lower panel: antisense downregulation of PLCγ1. Western blot probed with an anti-PLCγ1 antibody, cell extracts from: control cells (Control); cells pretreated with an Scrambled oligo (Scrambled a.s.); cells pretreated with the antisense to PLCγ1 (a.s.PLCγ1); cells pretreated with the antisense to SPHK1 (a.s.SPHK1). For loading control, blots were stripped and reprobed with an anti- PDGFRα antibody. Results shown are representative of three separate experiments.
Figure 4. FcεRI triggers different cytosolic Ca2+ signals from SPHK1 and PLCγ1.
A. Cytosolic Ca2+ triggered by FcεRI aggregation, cells in 1.5M extracellular Ca2+, time
course control (XL Control); cytosolic Ca2+ triggered by FcεRI aggregation, time course, in cells pretreated with the antisense to SPHK1 (XL a.s.SPHK1), cells in 1.5M
extracellular Ca2+.
B. Cytosolic Ca2+ triggered by FcεRI aggregation, cells in 1.5M extracellular Ca2+, time
course control (XL Control); cytosolic Ca2+ triggered by FcεRI aggregation, time course, in cells pretreated with the antisense to PLCγ1 (XL a.s.PLCγ1), cells in 1.5M
extracellular Ca2+.
C. Cytosolic Ca2+ triggered by FcεRI aggregation, no extracellular Ca2+, time course
control (XL Control); cytosolic Ca2+ triggered by FcεRI aggregation, time course, in
cells pretreated with the antisense to PLCγ1 (XL a.s.PLCγ1), no extracellular Ca2+;
cytosolic Ca2+ triggered by FcεRI aggregation, time course, in cells pretreated with the
antisense to SPHK1 (XL a.s.SPD. HK1), no extracellular Ca2+.
E. Cytosolic Ca2+ triggered by FcεRI aggregation, cells in 1.5M extracellular Ca2+, time
course control (XL Control); cytosolic Ca2+ triggered by FcεRI aggregation, time course, in cells pretreated with both, antisense to SPHK1 and antisense to PLCγ1 (XL a.s.SPHK1
+ a.s.PLCγ1), cells in 1.5M extracellular Ca2+.Results shown are representative of three separate experiments.
Figure 5. FcεRI triggered SPHK activity, PLC activity, PLD activity, Ca2+ signals, as well as
20
by guest on April 8, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 21: Dichotomy of Ca2+ signals triggered by different phospholipid](https://reader031.vdocuments.mx/reader031/viewer/2022020411/589d9c9d1a28abef498bca61/html5/thumbnails/21.jpg)
the translocation of SPHK1 and PLCγ1, are completely blocked by the tyrosine kinase inhibitor genistein.
A. SPHK activity left = cytosol; right = membrane: Basal SPHK activity in control cells (Basal); SPHK activity triggered by FcεRI in control cells (XL FcεRI Control); basal SPHK activity in cells pretreated with 0.35M genistein (Basal + Gen); SPHK activity triggered by FcεRI in cells pretreated with 0.35M genistein (XL FcεRI + Gen). Results shown are the mean + the standard deviation of triplicate measurements and are B. representative of three separate experiments.
C. IP3 generation: Basal IP3 generation in control cells (Basal control); basal IP3
generation in cells pretreated with 0.35M genistein (Basal + Gen); IP3 generation
triggered by FcεRI in control cells (XL control); IP3 generation triggered by FcεRI in
cells pretreated with 0.35M genistein (XL + Gen). Results shown are the mean + the standard deviation of triplicate measurements and are representative of three separate experiments.
D. PLD activity: Basal PLD activity in control cells (1); PLD activity triggered by FcεRI in control cells (2); basal PLD activity in cells pretreated with 0.35M genistein (3); PLD activity triggered by FcεRI in cells pretreated with 0.35M genistein (4); PLD activity triggered by 10µM PMA iE. n control cells (5); PLD activity triggered by 10µM PMA in cells pretreated with 0.35M genistein (6).
F. Confocal microscopy of cells immunostained for SPHK1. Control cells (Resting cells); control cells 1 min after FcεRI crosslinking (XL Control); cells pretreated with 0.35M genistein 1 min after FcεRI crosslinking (XL + Gen). Results shown are representative of three separate experiments.
G. Confocal microscopy of cells immunostained for PLCγ1. Control cells (Resting cells); control cells 1 min after FcεRI crosslinking (XL Control); cells pretreated with 0.35M genistein 1 min after FcεRI crosslinking (XL + Gen). Results shown are representative of three separate experiments.
H. Cytosolic Ca2+ signals triggered by FcεRI aggregation in control cells (XL Control); or in cells pretreated with 0.35M genistein (XL + Gen). Results shown are representative of three separate experiments.
Figure 6. Mast cell degranulation triggered by FcεRI is dependent on PLD1 and SPHK1, but not on PLCγ1.
Α. β-Hexosaminidase release. Basal (1); β-hexosaminidase release after FcεRI crosslinking control (2); β-hexosaminidase release after FcεRI crosslinking in cells pretreated with the antisense to PLCγ1 (3); β-hexosaminidase release after FcεRI crosslinking in cells pretreated with the antB. isense to SPHK1 (4); β-hexosaminidase release after FcεRI crosslinking in cells pretreated with the antisense to PLD1 (5); β-hexosaminidase release after FcεRI crosslinking in cells pretreated with the combined antisense oligos to SPHK1 and to PLD1 (6).
C. IP3 generation is not inhibited by the combined antisense oligos to SPHK1 and to PLD1.
Basal IP3 generation (Basal); IP3 generation after FcεRI crosslinking control (XL
FcεRI); IP3 generation after FcεRI crosslinking in cells pretreated with the combined aD. ntise
nse oligos to SPHK1 and to PLD1 (XL FcεRI a.s.SPHK1 + a.s.PLD1); IP3 generation
21
by guest on April 8, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 22: Dichotomy of Ca2+ signals triggered by different phospholipid](https://reader031.vdocuments.mx/reader031/viewer/2022020411/589d9c9d1a28abef498bca61/html5/thumbnails/22.jpg)
after FcεRI crosslinking in cells pretreated with the antisense to PLCγ1 (XL FcεRI a.s.PLCγ1).Results shown are the mean + the standard deviation of triplicate measurements and are representative of three separate experiments.
22
by guest on April 8, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 29: Dichotomy of Ca2+ signals triggered by different phospholipid](https://reader031.vdocuments.mx/reader031/viewer/2022020411/589d9c9d1a28abef498bca61/html5/thumbnails/29.jpg)
Alirio J. Melendez and Aik K. Khawstimulation of human mast cells
Dichotomy of Ca2+ signals triggered by different phospholipid pathways in antigen
published online February 20, 2002J. Biol. Chem.
10.1074/jbc.M110944200Access the most updated version of this article at doi:
Alerts:
When a correction for this article is posted•
When this article is cited•
to choose from all of JBC's e-mail alertsClick here
by guest on April 8, 2018
http://ww
w.jbc.org/
Dow
nloaded from