developmental changes in trichoderma viride enzymes abundant in conidia and the light-induced...

J. Basic Microbiol. 45 (2005) 3, 219–229 DOI: 10.1002/jobm.200410354

© 2005 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 0233-111X/05/0306-0219

(Department of Biochemistry and Microbiology, Slovak University of Technology, Radlinského 9, 81237-Bratislava, Slovakia; 1Institute of Cellular and MolecularBotany, Rheinische Friedrich-Wilhelms Universität, Kirschallee 1, 53115-Bonn, Germany)

Developmental changes in Trichoderma viride enzymes abundant in conidia and the light-induced conidiation signalling pathway

RICHARD POKORNÝ, PETER VARGOVIČ, UDO HÖLKER1, MARTINA JANSSEN1, JUTTA BEND1, DANIELA HUDECOVÁ and ĽUDOVÍT VAREČKA*

(Received 24 August 2004/Accepted 05 November 2004)

The expression of glutamic acid decarboxylase gene and the laccase activity were measured during the development of surface-cultivated Trichoderma viride mycelia in order to examine their up-regulation by light. The results show that the changes in activity of GAD induced by light observed previously are caused by transcriptional regulation of gad gene expression in both submerged mycelia and aerial mycelia after photoinduction. The expression of tga gene encoding a T. viride G

α protein was found

not to be up-regulated by light and was also present in the non-conidiating mutant of T. viride suggesting that this protein is not involved in the regulation of conidiation in this fungus, or that it plays a role is in later stages of conidia development. The activity of laccase was also not light-inducible and may be related to the maturation of conidia.

The light-induced conidiation has been studied in Trichoderma viride within the last dec-ades and was characterised mainly by effects of inhibitors and metabolic changes (BETINA and FARKAŠ 1998). The study of signalling pathway of this process, which belongs to the class of blue-light phenomena, indicated that cAMP is involved in transmitting the light signal (GREŠÍK et al. 1989, NEMČOVIČ and FARKAŠ 1998, JAIN et al. 2002). This finding suggests that G-proteins, known for decades to be coupled with adenylate cyclase, are also involved in the light signal transduction. So far, there are four different G

α

− protein-coding genes known in the genus Trichoderma/Hypocrea. The T. atroviride tga3 gene was recently described (ZEILINGER 2004) but no information is available about its connection to conidia-tion. H. virens tgaB gene and the tgaA gene of the same fungus were recently found not to be involved in conidiation. H. virens loss-of-function mutants in these genes grew as well as the wild type, conidiated normally, did not conidiate in the dark and responded to the blue light by forming a conidial ring (MUKHERJEE et al. 2004). On the other hand, T. atroviride tga1 gene (ROCHA-RAMIREZ et al. 2002) was found to play an important role in conidiation as a negative regulator. Its overexpression suppressed conidiation, and the expression of a corresponding antisense oligonucleotide stimulated the conidiation. Similar results were found in Aspergillus nidulans the conidiation of which seems to depend on the inactivation of Gα protein FADA (HICKS et al. 1997). On the other hand, mutants of Fusarium oxy-sporum with disrupted G

α protein-coding gene were found to exhibit a phenotype with

damaged conidiation (JAIN et al. 2002). This suggests that Gα proteins are involved in co-

nidiation in fungi in general but their specific roles have to be identified for each fungal genus.

* Corresponding author. Dr. L. VAREČKA; e-mail: [email protected]

220 R. POKORNÝ et al.

© 2005 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

The link that couples the cAMP signal to the genetic re-programming of microorganisms, which occurs as a final consequence of light pulse, remains obscure so far. One approach which could be helpful to dissect the light-induced signalling pathway is the analysis of the transcriptional regulation of genes up-regulated by light. In order to track those genes, we searched enzymes and/or proteins characteristic for conidia. In the first instance, SCHMIT and BRODY (1975), CHRISTENSEN and SCHMIT (1980) and HAO and SCHMIT (1991) found that glutamic acid decarboxylase (GAD) is present in Neurospora crassa conidia and its activity disappears in the course of germination so that its activity in mycelia is not detect-able. GAD (EC 4.1.1.15) catalyses α-decarboxylation of L-glutamic acid forming γ-amino-butyric acid (GABA). This reaction is a part of the metabolic pathway known as GABA shunt (SCHMIT and BRODY 1975) that provides conidia with energy needed to survive and germinate. Indeed, previous observations in N. crassa were confirmed using T. viride as a model and we found that the GAD activity is stimulated by light pulse (STRIGÁČOVÁ et al. 2001). Another enzyme which was found to be present in conidia but not in mycelia is laccase (copper-containing benzenediol:oxygen oxidoreductase, EC 1.10.3.2) of Aspergillus nidu-lans (LAW and TIMBERLAKE 1980). This enzyme, involved in Aspergillus conidia pigment biosynthesis (converts a yellow precursor to the green pigment, SCHERER and FISCHER 2001), was further found to be encoded by yA gene (O’HARA and TIMBERLAKE 1989). In the 5′ flanking region of yA gene coding sequence, two functionally distinct elements were identified: element I contained potential BrlA binding sites and was required for full level yA transcription and element II contained putative TEF-1 binding sites flanking a CCAAT element and was sufficient for developmental regulation of yA gene transcription. This gene was proposed to be regulated by a developmental regulatory factor AbaA as this factor and TEF-1 possess similar DNA-binding domains (ARAMAYO and TIMBERLAKE 1993). How-ever, abaA gene is regulated by the product of its upstream regulatory gene, brlA, as inacti-vation of the brlA gene prevented expression of the abaA gene (BOYLAN et al. 1987). Thus, BrlA can regulate yA gene expression directly or through the AbaA. Further, it was found that N-terminal regions of the BrlA and a number of plant phytochromes (plant photorecep-tors for red light) show a moderate level of sequence similarity and that the region of simi-larity corresponds to the phytochrome domains believed to be responsible for photorecep-tion (GRIFFITH et al. 1994). As conidiation in A. nidulans is induced by red light and suppressed by an immediate shift to far red light (MOONEY and YAGER 1990), a phenome-non similar to light-regulated responses mediated by phytochromes in plants, BrlA can be a putative Aspergillus photoreceptor. Therefore, laccase activity could be considered as a candidate enzyme showing light-induced up-regulation also in other fungi. The aim of this paper was to examine whether the activity of laccase and the level of gad and tga gene expression are activated by light T. viride.

Materials and methods

Strains: Trichoderma viride, strain CCM F-534 (Czech Collection of Microorganism, T.G. Masaryk University, Brno, Czech Republic); Trichoderma atroviride, strain CBS 349 and Trichoderma harzianum, strain DSM 63059, were used. One non-conidiating mutant of T. viride (parental strain is mentioned above) was obtained by UV-mutagenesis in the laboratory of Ľ.VAREČKA. Growth of strains: Fungi were grown at 25–26 °C on CZAPEK-DOX (Cz-D) media (30 g sucrose l–1, 2 g NaNO3 l–1, 0.5 g KCl l–1, 0.5 g MgSO4 · 7 H2O l–1, 0.01 g FeSO4 · 7 H2O l–1, 1 g K2HPO4 l–1, 5 g yeast extract l–1; pH before sterilisation 6.5–6.7). For laccase activity assays, fungi were grown on glucose media (12 g glucose monohydrate l–1, 1.2 g KH2PO4 l–1, 0.4 g NaH2PO4 l–1, 0.6 g MgSO4 · 7 H2O l–1, 1 g NH4NO3 l–1, 1.1 ml elements for sporulation (0.6% MnSO4, 1.1% ZnSO4, 0.1% FeSO4, 0.03% CoCl2, 4% CuSO4, 0.06% H3BO3, 0.5% EDTA) l–1, 10 ml glycerol l–1; pH before

Developmental changes in Trichoderma viride enzymes 221


sterilisation 5.8). Media for submerged cultivation were inoculated with 1 × 106 conidia ml–1. Solid media contained agar (2% w/v). Photoinduction of mycelia: Fungi were grown on Cz-D solid media in 9 cm PETRI dishes as follows: a 2.5 cm cellophane disk concentrically overlaying a 3.5 cm cellophane disk on the media surface was inoculated with 5 × 105 conidia applied to an 0.5 cm paper disk in the centre of cellophane disks. When a non-conidiating mutant of T. viride was used, cellophane disks were inoculated with a piece of agar that was cut from another PETRI dish overgrown with vegetative mycelium of this mutant with sterile cork borer. After certain time of growth in total darkness when the edge of the colony slightly overlaps smaller cellophane disk, one set of PETRI dishes was illuminated by exposure to a standard white-light source (1.2 kLx, 15 min) and turned back to total darkness for the required time (photoinduced mycelia). Two control sets of PETRI dishes were handled in parallel: one set was grown in total darkness throughout the whole time (constant dark mycelia) and the other set was grown at constant light (1.2 kLx) throughout the whole time (constant light mycelia). For isolation of total RNA, the conidiation ring was scraped from the surface of the larger cellophane disk with a sterile spatula after removing the smaller cellophane disk with a sterile tweezers and samples were immediately frozen in liquid nitrogen. DNA isolation: DNA was isolated from vegetative mycelia of submerged cultures frozen with liquid nitrogen according to the original procedure of RAEDER and BRODA (1988) with some modifications (SCHEEL et al. 1999) and starting with approximately 0.3 g (wet weight) of material. RNA isolation: Total RNA was isolated from the liquid nitrogen-frozen samples using the original method of MUKHTAR et al. (1998) with modifications for small-scale conditions. Young submerged mycelia (8 and 12 h) were recovered by centrifugation (2200 × g, 20 min), older submerged mycelia were harvested by filtration through a nylon mesh and surface mycelia were obtained from cellophane disks as described above. Samples were transferred to 2 ml tubes, immediately frozen with liquid nitrogen and ground with a pre-chilled POLYTRON homogenizer under liquid nitrogen. The efficiency of cell breakage was monitored under light microscope in preliminary experiments. The same amount of starting material (50–100 mg of liquid nitrogen powder) was used for subsequent RNA extraction for all samples. As the amount of starting material was reduced compared to the original method, the volumes of extraction buffer and buffered phenol were also reduced to 500 µl so that eppendorf tubes could be used in all further steps that were performed as in the original method except that the RNA pellet was dried in a thermoblock at 65 °C for 10 min and dissolved in 20 µl of RNase-free water. DEPC (diethyl pyrocarbonate, 0.1%) and subsequent autoclaving was used to treat all solutions and material used in RNA isolation process to ensure RNase-free conditions. Primer design, PCR and cloning of PCR fragments: For amplification of the gad gene fragment, degenerate primers designed on the basis of consensus amino acid sequence of A. oryzae GAD (KATO et al. 2002, protein accession number BAA88152) and N. crassa GAD (HAO and SCHMIT 1993, protein accession number CAB91726) were used. Primers that amplified the whole coding region of tga gene were designed on the basis of sequence of T. atroviride tga1 gene (ROCHA-RAMIREZ et al. 2002, accession number AY036905). Sequences of primers used to amplify fragment of β-actin-coding gene that served as a housekeeping gene in the expression experiments were taken from literature data for primers used to amplify human β-actin-coding gene fragment and were checked for matching A. terreus (accession number AF276240) and N. crassa (accession number AABX01000274) β-actin mRNA and genomic sequences. Sequences of the primers are stated in Table 1.

Table 1 Primers used to amplify fragments of the target genes

Primers (from 5′ to 3′) Target gene

Forward Reverse

gad ttyathgaytaygargarta tartaytgnccdatnacytg tga atgggttgcggaatgtctac ctaaatgagaccgcataaacg β-actin-coding actatgtttgagaccttcaa catctcttgctcgaagtcca



PCR was performed in a total volume of 50 µl using 1 U of Taq DNA-polymerase (PROMEGA) with the corresponding buffer (supplied with the enzyme), 1.5 mM MgCl2 (for gad gene) or 2 mM MgCl2 (for tga and β-actin-coding genes), 0.2 mM dNTPs, 2 µM of each primer and 100 ng of genomic DNA as a template. Mixtures were incubated for 30 cycles that were as follows: initial denaturation at 95 °C for 5 min, denaturation at 95 °C for 30 s, annealing at 50 °C (for gad gene) or at 55 °C (for tga and β-actin-coding genes) for 30 s, extension at 72 °C for 1 min or 1.5 min (for tga gene), final extension at 72 °C for 10 min and cooling down to 4 °C. PCR products were cloned into pGEM T-Easy vector (PROMEGA) according to manufacturer´s instructions and sequenced to ensure that they represent the required genes. RT-PCR: RT was performed immediately after RNA isolation in a total volume of 20 µl using 10 U of AMV reverse transcriptase (PROMEGA) with corresponding buffer (supplied with enzyme), 0.5 mM dNTPs, 10 µM oligo-dT primer and 5 µl of total RNA as a template. The mixture was incubated for 50 min at 37 °C and after AMV RT inactivation (70 °C for 15 min) it was cooled down to 4 °C and stored at –20 °C. PCR was then performed as above except that 0.5–5 µl of RT reaction (first strand cDNA) was used as a template and that the number of cycles was optimised in order to avoid excessive cycling that may cause non-exponential amplification of PCR product and therefore reset the differences in band intensities. This minimal number of cycles was determined using total RNA isolated in three different times of cultivation (from the beginning, from the middle and from the end of desired time spans) and as a consensus between this three values for each gene and each analysis separately (data not shown). The results of electrophoresis were analyzed by LabImage software. Laccase activity assays: Laccase activity was measured using ABTS [2,2′-azino-bis-(3-ethyl-benzthiazoline-6-sulfonic acid] (HARKIN and OBST 1973, WOLFENDEN and WILSON 1982). Conidia were released from conidiophores into 100 mM citrate-phosphate buffer, pH 4.5 (if not indicated otherwise) with spatula, the suspension was filtered through gauze (in order to remove mycelia and to obtain only conidia, which were not geminated, as it was checked under light microscope), spun down (14000 × g for 1–2 min) and the resulting pellet was re-suspended in the same buffer in order to obtain the required conidial concentration. For conidia germination experiments, germinated conidia and young mycelium were quantitatively recovered into buffer from cellophane disks. ABTS (final concentration 0.3 mM) was then added to the suspension (3 × 108 conidia per assay in the total volume 1.5 ml, if not indicated otherwise), the mixture was vortexed, centrifuged again and the absorption of the supernatant at 420 nm was measured immediately (0 min). The mixture was re-suspended and A420 was measured again after 10 min incubation at 28 °C and subsequent centrifugation. This procedure was repeated 3–4 times. GenBank accessions: The sequences of obtained gene fragments are accessible at GenBank under following accession numbers: AY220261 (gad) and AY220262 (tga). Chemicals: The chemicals used were from the following sources: Agarose, Phenol, Tris (Tris-(hydroxymethyl)-aminomethane) and Triton X-100 from APPLICHEM, Darmstadt, Germany; Glycerol from REACHIM, Novosibirsk, Russia; RNase A and SDS (Sodium Dodecyl Sulphate) from SERVA, Heidelberg, Germany; ABTS [2,2′-azino-bis-(3-ethyl-benzthiazoline-6-sulfonic acid], DEPC (diethyl pyrocarbonate) and Lysing Enzymes from T. harzianum (Novozyme 234) from SIGMA-ALDRICH, St. Louis, MO, U.S.A. Primers were synthetized by PROLIGO, La Jolla, CA, U.S.A. Enzymes used for molecular biology techniques were from PROMEGA, Madison, WI, U.S.A. Kits for PCR fragment and plasmid purifications were from QIAGEN, Hilden, Germany. All other chemicals of analytical grade were purchased from LACHEMA, Brno, Czech Republic.

Results

Trichoderma glutamic acid decarboxylase (gad) gene expression

The partial sequence of the gad gene of T. atroviride, strain CBS 349, was cloned using degenerate primers derived from heterologous sequences of A. oryzae and N. crassa. The deduced amino acid sequence of this fragment exhibited 84% identities with corresponding



GAD fragments of A. oryzae and N. crassa. This fragment was amplified also from T. viride, strain F-534, resulting in a PCR product with the length of 781 base pairs. The RT-PCR product was shorter (731 base pairs) because of the presence of an intron in the PCR fragment. This DNA fragment was used for the examination of gad expression using β-actin-encoding gene as a housekeeping gene. The time-course of its expression was meas-ured in both submerged (Fig. 1A) and aerial mycelia (Fig. 1B). In submerged mycelia, the

Fig. 1 Developmental changes in expression of the gad gene in T. viride mycelia. A Submerged mycelia. Left panel: Gel slides with bands corresponding to gad gene (upper slide) and β-actin-coding gene (lower slide) RT-PCR products. The cultivation time (in h) of mycelia used for total RNA isolation is indicated above the lanes. M indicates a marker lane. Arrows mark the positions of marker bands which lengths (in bp) are indicated leftward. Right panel: Quantitative analysis of gad gene band intensities normalized to β-actin-coding gene bands (if no bands were detectable, values of background in the expected positions of bands were used for calculations). B Aerial mycelia. Left and middle panels: Gel slides with bands corresponding to gad gene (six left slides) and to β-actin-coding gene (six middle slides) RT-PCR products. Light conditions of mycelia growth are indicated above each slide pair (parallel experiments). Other attributes are the same as for A. Right panel: The same as for A. Asterisk with an arrow indicates the time of cultivation at which mycelia were photoinduced



quantity of the gad gene RT-PCR product normalised to the quantity of β-actin-coding gene RT-PCR product changed with time with a maximum signal at about 24 h followed by a depression and another maximum at about 96 h of cultivation (Fig. 1A). This corresponds to the time-course of GAD activity observed previously (STRIGÁČOVÁ et al. 2001). In aerial my-celia, photoinduction after 36 h of growth in darkness caused a rapid increase in the gad gene transcript level after 3 h followed by an expression pattern similar to that in control constant dark mycelia (Fig. 1B). Expression patterns of gad gene in constant light and in constant dark mycelia were very similar without a peak present in photoinduced mycelia in 39th h of cultiva-tion. Thus, the gad gene expression is both developmentally regulated and light-stimulated.

T. viride Gα protein-coding (tga) gene expression

The PCR and RT-PCR products from a similar culture using specific primers for the tga gene encoding for the Gα protein of T. viride were of expected length (1321 and 1062 base pairs, respectively) and the deduced amino acid sequence of PCR fragment exhibited 92% identity with corresponding TGA1 fragment of T. atroviride. The expression of this gene was measured in aerial mycelia of T. viride wild-type strain (Fig. 2A) and of a non- A T. viride CCM F-534

*

20 27 30 36 48 72 960

1

2

3

4

5

rela

tive

tga

gene

ban

d in

tens

ityno

rmal

ized

to ββ ββ

-act

in-c

odin

g ge

ne b

and

time, h

photoinducedconstant dark

photoinduced mycelia M 20 27 30 36 48 72 96

300 bp

400 bp

constant dark mycelia M 20 27 30 36 48 72 96

300 bp

400 bp

ββββ-actin-coding gene


1.0 kbp

1.5 kbp


1.0 kbp

1.5 kbp

tga gene

B Non-conidiating mutant of T. viride

20 27 30 36 48 72 960.0

0.4

0.8

1.2

1.6

rela

tive

tga

gene

ban

d in

tens

ityno

rmal

ized

to ββ ββ

-act

in-c

odin

g ge

ne b

and

time, h

photoinducedconstant dark

*


1.0 kbp

1.5 kbp


1.0 kbp

1.5 kbp

tga genephotoinduced mycelia

M 20 27 30 36 48 72 96

300 bp

400 bp


300 bp

400 bp

ββββ-actin-coding gene

Fig. 2 Developmental changes in expression of the tga gene in T. viride mycelia. A Wild-type aerial mycelia. Left panel: Gel slides with bands corresponding to tga gene (two left slides) and β-actin-coding gene (two right slides) RT-PCR products. Light conditions of mycelia growth are indicated above each slide. The cultivation time (in h) of mycelia used for total RNA isolation is indicated above the lanes. M indicates a marker lane. Arrows mark the positions of marker bands which lengths (in bp or kbp) are indicated leftward. Right panel: Quantitative analysis of tga gene band intensities normalized to β-actin-coding gene bands (if no bands were detectable, values of background in the expected positions of bands were used for calculations). Asterisk with an arrow indicates the time of cultivation at which mycelia were photoinduced. B Non-conidiating mutant aerial mycelia. Left and right panel: The same as for A



conidiating mutant (Fig. 2B) which lacked the light-induced changes in GAD activity (STRIGÁČOVÁ et al. 2001). It was found that the illumination after 27 h of growth in dark-ness did not stimulate the tga gene expression in a way observed with the gad gene probe. The expression levels of illuminated samples closely followed those cultivated in the dark with maximal levels after 25–30 and 40–60 h, respectively. The expression patterns were similar in both wild-type and mutant strain mycelia (Fig. 2B).

Trichoderma laccase activity

First experiments were performed to find out the basic characteristics of laccase activity in T. viride. It was found that the laccase activity was proportional to the number of conidia per assay in the range of 1–3.5 × 108. The activity had a pH optimum at 4.5 (Fig. 3) and its significant inhibition was observed when measurements were done at 0 °C instead of 28 °C (not shown). The laccase could not be released from conidia to supernatant by the proto-plasting enzyme Novozyme 234 (i.e. lysing enzymes from T. harzianum, 5–20 mg/ml) nor by subsequent treatment with Triton X-100, while these treatments did not cause the inacti-vation of laccase in protoplasting enzyme-digested or lysed conidia in the pellet (not shown). A mechanic disintegration of conidia also did not release laccase activity to super-natant but led to its rapid inactivation (not shown). These observations indicate that the enzyme is strongly bound to the membrane and is susceptible to proteolytic enzymes acti-vated by the cell disintegration. Developmental patterns of laccase activity were substantially different from those of gad or of tga gene expression (Fig. 4). No laccase activity could be found in aerial mycelia even after green conidia appeared in the culture, i.e. after 3–4 days, regardless of the way of conidiation induction (i.e. aging or illumination; not shown). The measurable laccase activity appeared only after 6–7 days of cultivation and reached a maximum at about 10–15 days of cultivation (Fig. 4). Upon prolonged cultivation the activity decreased almost to zero after 25 days. This interesting time-course was also observed in two other genera,

1.0x108 1.5x108 2.0x108 2.5x108 3.0x108 3.5x108

0.003

0.004

0.005

0.006

0.007 A

Y = A + B * XA 0.0030 ± 0.0006B 9.39×10-12 ± 2.59×10-12

R 0.96

∆∆ ∆∆A

420.m

in-1

conidia.assay-13 4 5 6 7 8

0.00

0.01

0.02

0.03

0.04B

∆∆ ∆∆A

420.m

in-1

pHexternal Fig. 3 Basic characteristics of laccase activity in T. viride: dependence on the conidia number (A) and on pH (B). A Laccase activity was measured in 100 mM citrate-phosphate buffer (pH 4.5) with the indicated number of conidia per assay. The equation of regression line and the regression coefficient are inscribed. B A set of 100 mM citrate-phosphate buffers with different pH was used for laccase activity measurements using 3 × 108 conidia per assay. Values of ∆A420 · min–1 were obtained from slopes of linear changes in A420 within 40 minutes. The experiment was carried out in triplicates



T. harzianum and T. atroviride (Fig. 4). The laccase activity (observed in conidia with maxi-mal laccase activity) rapidly disappeared in the course of germination. A substantial part of the activity (about 50%) was lost within 5 h (Fig. 5A) and the whole activity was lost 15 h after starting the germination (Fig. 5B).

5 10 15 20 25 30

0.000

0.005

0.010

0.015

0.020

0.025

0.030

0.035

∆∆ ∆∆A

420.m

in-1

days of cultivation

T. virideT. harzianumT. atroviride

Fig. 4 Developmental changes in laccase activity in Trichoderma conidia of various age. Measurements were carried out in 100 mM citrate-phosphate buffer (pH 4.5) using 3 × 108 conidia of different age per assay. Conidia were maintained on aerial mycelia on solid glucose media (see Material and Methods) in PETRI dishes in a wet box for the time indicated. Three different species of the genus Trichoderma were used in this experiment, T. viride (open squares), T. harzianum (open circles) and T. atroviride (open triangles). Values of ∆A420 · min–1 were obtained from slopes of linear changes in A420 within 40 minutes. The experiment was carried out in triplicates

0 10 20 30 40

0.00

0.05

0.10

0.15

0.20 B

A42

0

time, min

0 h12 h15 h17 h19 h

0 5 10 15 20 25 30

0.00

0.04

0.08

0.12

0.16

0.20A

A42

0

time, min

0 h1 h2 h3 h5 h

Fig. 5 Disappearance of laccase activity during T. viride conidia germination. Laccase activity was measured in 100 mM citrate-phosphate buffer (pH 4.5) with 3 × 108 conidia (from the 10th to 15th day of cultivation) per assay. Conidia were germinated for the indicated time (in h) on cellophane disks overlaying solid glucose media in PETRI dishes. A420 was measured within the indicated time (i.e. 30 min for A and 40 min for B). The experiment was carried out in triplicates



Discussion

The results show that developmental patterns and the response to a light pulse of the conid-ial enzymes GAD and laccase are different in the temporal aspects. While gad gene expres-sion rose up very early after photoinduction, the activity of laccase was delayed to the late phase of conidia formation. Furthermore, obtained data strongly suggest that tga gene is not involved in the regulation of T. viride photoconidiation. The gad gene expression in both submerged and aerial mycelia (Fig. 1) correlated with the previous measurements of GAD activity (STRIGÁČOVÁ et al. 2001). Therefore, it could be proposed that the activity of GAD is regulated at the gene transcription level. It is likely that a pulse of light can transiently break developmental (or circadian) regulation of gad gene expression and causes a rapid increase in gad mRNA level (Fig. 1B) which returns under previous regulation by bringing mycelia back to dark. In mycelia grown under constant illu-mination, however, the photo-induction event might occur earlier as in photo-induced myce-lia because it is known that T. viride colony with the diameter of 1 cm are mature for the photo-induction. Further studies aimed to the understanding of gad gene transcription regu-lation could contribute to understanding of both light- and starvation-induced conidiation. The use of β-actin-encoding gene as a housekeeping gene in this study could be discussed separately. Based on their observations, some investigators suggest that levels of transcript of this gene vary rather substantially. However, the pgk (phosphoglycerate kinase) gene and the gpd (glyceraldehyde-3-phosphate dehydrogenase) gene, commonly used as housekeep-ing genes in gene expression studies, are down-regulated during conidiation after light-pulse in Trichoderma (GOLDMAN et al. 1992, PUYESKY et al. 1997) and are therefore unsuitable as housekeeping genes in expression studies of potentially light-induced genes. The expression of the tga gene (Fig. 2) was neither up- nor down-regulated by light. In addition, this gene was expressed similarly in the dark culture where conidia formation may be elicited by a different mechanism (BETINA and FARKAŠ 1998, for review). It can be sug-gested that the G

α protein encoded by cloned tga gene is not involved in the regulation of

T. viride conidiation, similarly as it was found in H. virens (MUKHERJEE et al. 2004) or, it may have a role on later stages of conidia formation. This might be valid also for cAMP synthesis and cAMP-dependent changes which should be dependent on the adenylate cy-clase activity (BETINA and FARKAŠ 1998) that seems to be ubiquitously coupled to a G

α-

dependent transducing mechanism. We made also attempts to measure changes in adenylate cyclase expression but degenerate primers for adenylate cyclase designed on the basis of known fungal genes did not yield reproducible PCR signals. Thus, the role of the cAMP-signalling pathway in Trichoderma conidiation requires additional studies. The laccase in Trichoderma was found to be a conidia-associated enzyme similar to that encoded by yA gene in A. nidulans which is mainly connected with phialide formation (LAW and TIMBERLAKE 1980, O’HARA and TIMBERLAKE 1989). Another gene encoding for the tip laccase or laccase I was found in A. nidulans and named tilA (SCHERER and FISCHER 2001). This enzyme is localized at the growing tips of hyphae. Because no ABTS oxidation was observed with intact or lysed T. viride mycelia even after photoinduction (not shown), it can be concluded that laccase activity in T. viride is connected only with conidia. This can be supported by the rapid disappearance of laccase activity during T. viride conidia germina-tion (Fig. 5). However, laccase activities in Trichoderma and in Aspergillus seem to appear in different developmental phases of conidial development (HÖLKER et al. 2002). In A. parasiticus, laccase activity reached a maximum after 120 h of mycelia cultivation (BATT and SOLBERG 1982) what is consistent with data obtained with A. nidulans (LAW and TIMBERLAKE 1980). In contrast, three Trichoderma strains displayed a maximum of laccase activity only in conidia after 10–15 days of aerial mycelia cultivation (Fig. 4), i.e. at time when green ma-ture conidia are already present in the culture (even 5 day-old-conidia are already green,



mature and capable of multiplication). The differences between Aspergillus and Tricho-derma strains may be due to the differences in biosynthetic pathways of their conidia pig-ments. In A. fumigatus, a laccase-encoding gene abr2 with homology to yA gene of A. nidu-lans is located in the gene cluster together with three genes coding for enzymes from the dihydroxynaphthalene (DHN)-melanin pathway (TSAI et al. 1999) which suggests that co-nidial pigment biosynthesis in this fungus is more complex than this known pathway. The advance in understanding the significance of laccase activation would be expected after discovering the pathway of the green melanin biosynthesis. It should be mentioned that the role of laccase in the development and/or differentiation of fungi may be also more complex because laccase could be induced and secreted under certain conditions, as it has been demostrated in N. crassa (TAMARU and INOUE 1989) and two Trichoderma species (HÖLKER et al. 2002). This may indicate the existence of multiple enzymes or more com-plex cellular distribution of the enzyme(s). This aspect of laccase metabolism should be clarified in the future. Several attempts were made to isolate the gene encoding the laccase from the genomic DNA of T. viride but did not yield DNA fragments with sufficient iden-tity to known laccase genes. In summary, our results demonstrated different developmental changes in gad and tga expression and in laccase activity in T. viride. Only GAD is up-regulated by light while the activation of laccase is neither light-sensitive nor related to the early phase of conidia for-mation. Furthermore, the expression of tga gene encoding for G

α protein is also neither up-

or down-regulated by light and may not be directly involved in the light-induced changes in T. viride.

Acknowledgements

This work has been supported by grants VEGA 01/0109/03 and VTP grant 2/9012/21 and by BIOREACT GmbH, Bonn, Germany.

References

ARAMAYO, R. and TIMBERLAKE, W. E., 1993. The Aspergillus nidulans yA gene is regulated by abaA. EMBO J., 12, 2039–2048.

BATT, C. and SOLBERG, M., 1982. Asexual developmental markers in an aflatoxigenic strain of Asper-gillus parasiticus. Can. J. Microbiol., 28, 1206–1209.

BETINA, V. and FARKAŠ, V., 1998. Sporulation and light-induced development in Trichoderma. In: Trichoderma and Gliocladium (KUBICEK, C. P. and HARMAN, G. E., Editors), pp. 75–94, 1st ed., Taylor and Francis, London.

BOYLAN, M. T., MIRABITO, P. M., WILLETT, C. E., ZIMMERMAN, C. R. and TIMBERLAKE, W. E., 1987. Isolation and physical characterization of three essential conidiation genes from Aspergillus nidu-lans. Mol. Cell Biol., 7, 3113–3118.

CHRISTENSEN, R. L. and SCHMIT, J. C., 1980. Regulation and glutamic acid decarboxylase during Neurospora crassa conidial germination. J. Bacteriol., 144, 983–990.

GOLDMAN, G. H., GEREMIA, R. A., CAPLAN, A. B., VILA, S. B., VILLARROEL, R., VAN MONTAGU, M. and HERRERA-ESTRELLA, A., 1992. Molecular characterization and regulation of the phosphoglyce-rate kinase gene from Trichoderma viride. Mol. Microbiol., 6, 1231–1242.

GREŠÍK, M., KOLAROVA, N. and FARKAŠ, V., 1989. Light-stimulated phosphorylation of proteins in cell-free extracts from Trichoderma viride. FEBS Lett., 248, 185–187.

GRIFFITH, G. W., JENKINS, G. I., MILNER-WHITE, E. J. and CLUTTERBUCK, A. J., 1994. Homology at the amino acid level between plant phytochromes and a regulator of asexual sporulation in Emericella (= Aspergillus) nidulans. Photochem. Photobiol., 59, 252–256.

HAO, R. and SCHMIT, J. C., 1991. Purification and characterization of glutamate decarboxylase from Neurospora crassa conidia. J. Biol. Chem., 266, 5135–5139.

HAO, R. and SCHMIT, J. C., 1993. Cloning of the gene for glutamate decarboxylase and its expression during conidiation in Neurospora crassa. Biochem. J., 293, 735–738.



HARKIN, J. M. and OBST, J. R., 1973. Syringaldazine, an effective reagent for detecting laccase and peroxidase in fungi. Experimentia, 29, 381–387.

HICKS, J. K., YU, J. H., KELLER, N. P. and ADAMS, T. H., 1997. Aspergillus sporulation and mycoto-xin production both require inactivation of the FadA G alpha protein dependent signaling pathway. EMBO J., 16, 4916–4923.

HÖLKER, U., DOHSE, J. and HÖFER, M., 2002. Extracellular laccase in the ascomycetes Trichoderma atroviride and Tichoderma harzianum. Folia Microbiol., 47, 423–427.

JAIN, S., AKIYAMA, K., MAE, K., OHGUCHI, T. and TAKATA, R., 2002. Targeted disruption of a G protein α subunit gene results in reduced pathogenicity in Fusarium oxysporum. Curr. Genet., 41, 407–413.

KATO, Y., KATO, Y., FURUKAWA, K. and HARA, S., 2002. Clonning and nucleotide sequence of the glutamate decarboxylase-encoding gene gadA from Aspergillus oryzae. Biosci. Biotechnol. Bio-chem., 66, 2600–2605.

LAW, D. J. and TIMBERLAKE, W. E., 1980. Developmental regulation of laccase levels in Aspergillus nidulans. J. Bacteriol., 144, 509–517.

MOONEY, J. L. and YAGER, L. N., 1990. Light is required for conidiation in Aspergillus nidulans. Genes Dev., 4, 1473–1482.

MUKHERJEE, P. K., LATHA, J., HADAR, R. and HORWITZ, B. A., 2004. Role of two G-protein alpha subunits, TgaA and TgaB, in the antagonism of plant pathogens by Trichoderma virens. Appl. En-viron. Microbiol., 70, 542–549.

MUKHTAR, M., PARVEEN, Z. and LOGAN, D. A., 1998. Isolation of RNA from the filamentous fungus Mucor circinelloides. J. Microbiol. Methods, 33, 115–118.

NEMČOVIČ, M. and FARKAŠ, V., 1998. Stimulation of conidiation by derivatives of cAMP in Tricho-derma viride. Folia Microbiol., 43, 399–402.

O’HARA, E. B. and TIMBERLAKE, W. E., 1989. Molecular characterization of the Aspergillus nidulans yA locus. Genetics, 121, 249–254. Erratum in: Genetics, 124, 791.

PUYESKY, M., PONCE-NOYOLA, P., HORWITZ, B. A. and HERRERA-ESTRELLA, A., 1997. Glyceralde-hyde-3-phosphate dehydrogenase expression in Trichoderma harzianum is repressed during conidi-ation and mycoparasitism. Microbiology, 143, 3157–3164.

RAEDER, U. and BRODA, P., 1988. Preparation and characterization of DNA from lignin degrading fungi. Methods Enzymol., 161, 211–220.

ROCHA-RAMIREZ, V., OMERO, C., CHET, I., HORWITZ, B. A. and HERRERA-ESTRELLA, A., 2002. Tri-choderma atroviride G-protein alpha-subunit gene tga1 is involved in mycoparasitic coiling and conidiation. Eukaryot. Cell., 1, 594–605.

SCHEEL, T., HÖLKER, U., LUDWIG, S. and HÖFER, M., 1999. Evidence for and expression of a laccase gene in three basidiomycetes degrading humic acids. Appl. Microbiol. Biotechnol., 52, 66–69.

SCHERER, M. and FISCHER, R., 2001. Molecular characterization of a blue-copper laccase, TILA, of Aspergillus nidulans. FEMS Microbiol. Letters, 199, 207–213.

SCHMIT, J. C. and BRODY, S., 1975. Neurospora crassa conidial germination: role of endogenous amino acid pools. J. Bacteriol., 124, 232–242.

STRIGÁČOVÁ, J., CHOVANEC, P., LIPTAJ, T., HUDECOVÁ, D., TURSKÝ, T., ŠIMKOVIČ, M. and VAREČKA, Ľ., 2001. Glutamate decarboxylase activity in Trichoderma viride conidia and developing myceli-um. Arch. Microbiol., 175, 32–40.

TAMARU, H. and INOUE, H., 1989. Isolation and characterization of a laccase-derepressed mutant of Neurospora crassa. J. Bacteriol., 171, 6288–6293.

TSAI, H. F., WHEELER, M. H., CHANG, Y. C. and KWON-CHUNG, K. J., 1999. A developmentally regu-lated gene cluster involved in conidial pigment biosynthesis in Aspergillus fumigatus. J. Bacteriol., 181, 6469–6477.

WOLFENDEN, B. S. and WILSON, R. L., 1982. Radical cations as reference chromogens in kinetic stud-ies of one-electron transfer reactions. J. Chem. Soc. Perkin. Trans. II, 805–812.

ZEILINGER, S., 2004. Gene disruption in Trichoderma atroviride via Agrobacterium-mediated trans-formation. Curr. Genet. 45, 54–60.

Mailing address: Dr. ĽUDOVÍT VAREČKA, Department of Biochemistry and Microbiology, Slovak University of Technology, Radlinského 9, 812 37-Bratislava, Slovakia Telephone: **421 2 59325 514 Telefax: **421 2 5249 3198 E-mail: [email protected]

developmental changes in trichoderma viride enzymes abundant in conidia and the light-induced...

Documents