RESEARCH ARTICLE

Development of the Novel Loop Mediated IsothermalAmplification (LAMP) of IS711 Sequence for Rapid Detectionof Brucella Species

Stanzin Zadon • Narinder Singh Sharma •

Anil Kumar Arora • Mudit Chandra

Received: 30 January 2014 / Revised: 22 April 2014 / Accepted: 10 June 2014

� The National Academy of Sciences, India 2014

Abstract A reliable and novel loop mediated isothermal

amplification (LAMP) was developed in the laboratory for

rapid and specific detection of the Brucella species. Four

specific LAMP primers were designed targeting IS711

gene, a highly conserved element in the genus Brucella.

The assay could correctly amplified Brucella abortus S19,

B. abortus S99, B. abortus, B. melitensis and eight clinical

isolates of B. abortus but did not show any cross reaction

with non-Brucella organisms. Detection limit of LAMP

assay was 75 fg.

Keywords IS711 gene � LAMP � 75 fg

Introduction

Brucellosis is one of the worldwide zoonoses that is still of

veterinarian, public health and economic concern in many

parts of the world. Though brucellosis in livestock and its

transmission to humans has significantly decreased after

the effective vaccination-based control and prevention

programmes in many parts of the world, it remains an

uncontrolled problem in regions of high endemicity such as

the Mediterranean, Middle East, Africa, Latin America and

parts of Asia. Brucellosis may cause considerable eco-

nomic loss in terms of reduced productivity, abortions and

weak offsprings [1]. The disease is caused by genus Bru-

cella comprising of six classical species, Brucella abortus,

Brucella melitensis, Brucella suis, Brucella canis, Brucella

ovis, Brucella neotomae, two marine species: B. ceti, B.

pennipedilis and one human origin species B. innoponita

[2]. For the definite diagnosis of brucellosis, bacterial

isolation and identification is a gold standard [3] because

the clinical signs and symptoms are non-specific. However,

isolation is hampered by slow growth of the organisms and

their risk to laboratory personnel [4]. Molecular techniques

such as PCR and multiplex PCR [5] are useful for the

diagnosis of brucellosis and detection of the pathogen

because they are specific, rapid and simple. However, PCR

is not appropriate for resource limited laboratories since

costly specialised equipment and skilled personnel are

needed. Therefore, development of a rapid, accurate, sen-

sitive and more practical diagnostic method is of high

priority in the detection of brucellosis. A promising and

valuable tool that could fulfil these requirements is loop

mediated isothermal amplification (LAMP) which is an

innovative nucleic acid amplification method which can

amplify DNA with high specificity, efficiency and speed

[6]. The amplified products of LAMP could be visualised

either by gel electrophoresis generating a ladder of DNA

fragments or simply detected visualising fluorescence by

adding fluorescent dyes to the reaction tube after amplifi-

cation [7]. Till now only four reports of LAMP on Brucella

have been published [8–11].

The present study was aimed to develop a novel LAMP

test for the rapid detection of Brucella spp.

Material and Methods

Bacterial strains: B. abortus vaccine strain S19, B. abortus S99,

B. melitensis, B. abortus field isolates (n = 8) and non-Brucella

organisms include Pasteurella multocida, Proteus sp, Esche-

richia coli, Salmonella enteritidis and Staphylococcus aureus

S. Zadon (&) � N. S. Sharma � A. K. Arora � M. Chandra

Department of Veterinary Microbiology, Guru Angad Dev

Veterinary and Animal Sciences University (GADVASU),

Ludhiana 141004, Punjab, India

e-mail: stenza_303@yahoo.com; tenzinzadon@gmail.com

123

Proc. Natl. Acad. Sci., India, Sect. B Biol. Sci.

DOI 10.1007/s40011-014-0377-9

available in the Department of Veterinary Microbiology

GADVASU, Ludhiana, India were used.

Extraction of Genomic DNA

DNA was extracted from the organisms by phenol chlo-

roform method as described by Wilson [12].

Primer Design

Four Brucella specific primers for LAMP were designed by

primer explorer V4 software based on the IS711 element gene

sequence (Accession number: NC_006933) including two outer

primers (F3 and B3) and two inner primers (FIP and BIP) fol-

lowing the criteria described by Notomiet al [6, 13].

Nucleotide sequence of IS711 gene of B. abortus used for

designing the primers. Location of the target sequences of

primers are shown in red colour font.

Sequence of Primers Used in LAMP for Detection of

Brucella spp.

Optimization of the Novel Visual LAMP Conditions

The standardised final 25 ll reaction mixture consisted of

20 pmol (each) FIP and BIP primers, 10 pmol (each) of F3

and B3 outer primers, 10 mM dNTP (Qiagen), 1 M betaine

(Sigma), 0.5 ll of SYBR Green dye (New England Biolab),

50 mM Mgso4 (MBI Fermentas), 19 thermopol buffer (New

England Biolabs), 1 ll of Bst polymerase large fragment

(New England Biolabs) and 1 ll genomic DNA. The optimal

response time and temperature was maintained at 63 �C for

60 min followed by termination at 95 �C for 2 min. The

LAMP product was analysed by adding 0.5 ll SYBR Green

dye (1000X) after the amplification based on the conven-

tional LAMP. After amplification, the results of the novel

LAMP reaction could be visually judged by unaided eye

under day light or UV light.

PCR reaction was carried out to examine specificity of

the LAMP with F3 and B3 primers in 25 ll volume

reaction mixture containing 2.5 ll 109 PCR buffer,

10 mM of dNTP, 15 mM Mgcl2, 0.5 ll (20 pmol/ll each

forward and backward outer primers) and 5 U Taq

polymerase and 5 ll of template DNA. The cycling

condition consisted of initial denaturation at 95 �C for

5 min followed by 35 cycles of denaturation at 95 �C for

60 s, annealing at 56 �C for 60 s and extension at 72 �C

for 10 min and a final extension at 72 �C for 5 min. The

5 ll of LAMP and 10 ll PCR products were electro-

phoresed in 2 and 1 % agarose gel containing 0.5 lg/ml

ethidium bromide, respectively.

Specificity and sensitivity of the LAMP reaction was

studied by using DNA extracted from Brucella and non-

Brucella organisms. To evaluate the specificity of the LAMP

primers, B. abortus S19, B. abortus S99, B. abortus and B.

melitensis were tested. Further to check the cross reaction:

one B. abortus vaccine strain S19, eight clinical isolates of B.

abortus (isolated from the bovine aborted foetal stomach

contents, placental tissues, uterine discharges and vaginal

swabs of the animals having history of abortion in the last

term of pregnancy in and around Ludhiana, Punjab) and five

non-Brucella organisms (P. multocida, Proteus sp, E. coli, S.

Enteritidis and S. aureus) were tested.

Primers type Sequences (50–30) Length (bp)

F3 GCAGCCTATGATGCCGATC 19

B3 CAATGTTTTCTCGCATCGCA 20

FIP GGCACTGGAACGTGTTGGATTG

ttttCTTAAGGGCCTTCATTGCCA

46

BIP TCGACTGGAGGCTGTACAAGGA

ttttACGACGATAGCGTTTCAACT

46

S. Zadon et al.

123

The detection limit of novel visual LAMP assay was

tested by serial tenfold dilutions of purified genomic DNA

of B. abortus S19 starting from 75 ng per reaction. The

detection limit was defined as the last positive dilution and

the reactions were done in triplicates.

Results and Discussion

Diagnosis of a disease is very important in context of its

proper management and control. Various detection system

of Brucella spp. mainly include bacterial isolation, sero-

logical methods and molecular techniques such as PCR,

multiplex PCR and nested PCR [14–17]. However, more

specific and safe detection for Brucella spp. in the simple

laboratories and field level can be achieved by LAMP

without the need of expensive equipments such as thermal

cycler and real time thermal cycler [13–15]. LAMP is an

innovative gene amplification technique which is emerging

as a simple, fast diagnostic tool for early detection and

identification of microbial diseases [18]. Unlike PCR,

LAMP requires minimum four primers targeting six dis-

tinct regions on the target gene. In this study the authors

have used newly designed four primers against IS711 gene

sequence because of multi-copy target gene present in all

species of the Brucella [19]. This assay was performed by

incubating the reaction mixtures at a constant temperature

of 63 �C in a regular dry bath for 1 h and was terminated at

95 �C for 2 min. So, only 1 h is needed to perform LAMP

as compared to 2.5 h for PCR assay. Result of the novel

LAMP reaction could be simply observed by the devel-

opment of green colour/strong fluorescence in positive

reaction under day light/UV light and no change of colour/

orange in negative samples (Fig. 1). Upon gel electropho-

resis the characteristic ladder like pattern of bands was

obtained in LAMP reaction (Fig. 2).

The LAMP method is highly sensitive, specific, fast and

easy to perform. It has been widely used in detection of

food borne bacteria, viruses and parasites [20–22]. This

assay specifically identified targeted nucleic acid sequences

in the Brucella genome with minimal requirement of

technical equipments. The primers of LAMP correctly

identified vaccine strain B. abortus S19, B. abortus S99,

two classical species included B. abortus and B. melitensis

(Fig. 3 a, b, c) as well as in the eight field isolates of

Brucella while all the organisms other than Brucella

showed negative results (Fig. 4 a, b, c). Similar type of

specificity was also reported [8–10] targeting BCSP31 and

omp25 gene sequences of the Brucella species. The

amplified DNA was visualized after the addition of the

intercalating dye as SYBR Green dye to the amplified

LAMP products. Although SYBR Green dye has a high

Fig. 1 Visual detection of

Brucellla IS711-LAMP

products using SYBR Green dye

Fig. 2 Agar gel electrophoresis result of LAMP products. 1 B.

abortus S19, 2 control negative (nuclease free water), 3 control

negative (P. multocida), M 100 bp plus DNA ladder

Development of LAMP for Brucella species

123

binding activity to DNA [23], the colour change is dis-

cernable in LAMP assays but not in conventional PCR due

to the higher DNA yields of LAMP i.e. 10 lg as compared

to 0.2 lg in PCR in 25 ll reaction scale [18, 24].

The PCR products were analysed by 1 % gel electro-

phoresis and generated a band size at 223 bp (Fig. 5 a). The

detection limit of PCR and LAMP on serially tenfold diluted

DNA (75 ng, 7.5 ng, 0.75 ng, 75 pg, 7.5 pg, 0.75 pg, 75 fg,

7.5 fg) indicated that PCR was able to detect DNA up to

7.5 pg, while LAMP detected DNA up to 75 fg which

showed that Brucella-LAMP assay is approximately 100-

fold more sensitive than conventional PCR (Fig. 5 b, c, d).

Previous studies reported that sensitivity of LAMP was

higher such as 10 times for the detection of fish pathogen

[25], 20 times for the rapid detection of Avian Leucosis virus

from culture isolates and clinical samples [26], 50 times for

the detection of M. tuberculosis, M. avium, M. intracellulare

for the diagnosis of pulmonary tuberculosis in microscopy

Fig. 3 a–c Specificity of IS711

LAMP assay for specific

detection of B. abortus S99 and

two classical Brucella species

(B. abortus and B. melitensis). aSpecificity of LAMP products

after addition of SYBR Green

under day light. b Specificity of

LAMP products after addition

of SYBR Green under UV light.

c Specificity results of LAMP

on 2 % agarose gel. 1 B. abortus

S19 (Standard), 2 control

negative (nuclease free water), 3

control negative (P. multocida),

4 B. abortus S99, 5 B. abortus, 6

B. melitensis, M 100 bp plus

DNA ladder

S. Zadon et al.

123

centre of developing countries [27, 28] and 100 times more

sensitive than conventional PCR [29] for the detection of

yellow mosaic virus.

Based on the results of present work, LAMP primers and

conditions are very specific for Brucella spp. Further the

authors are interested in the extension of studies with more

species and strains of Brucella and non-Brucella organisms

and application on direct clinical samples.

Conclusion

Brucella IS711- LAMP assay developed in the present

study can be useful for Brucella diagnostic test in low

resource setting laboratories particularly in developing

countries because this assay is easy to perform, cost

effective, sensitive and rapid diagnostic technique for

assessment of brucellosis.

Fig. 4 a–c Analysis of

specificity of IS711 LAMP

assay for specific detection of

Brucella field isolates. aSpecificity of LAMP products

after addition of SYBR Green

under day light. b Specificity of

LAMP products after addition

of SYBR Green under UV light.

c Specificity LAMP products on

2 % agarose gel. 1 B. abortus

S19 (Standard), 2 control

negative (nuclease free water), 3

P. multocida, 4 Proteus, 5

E. coli, 6 S. Enteritidis, 7 S.

aureus, 8–15 B. abortus isolate

no. 1–8, M 100 bp plus DNA

ladder

Development of LAMP for Brucella species

123

Fig. 5 a–d Comparison of

sensitivity of IS711 LAMP

products with PCR assay for

detection of Brucella species. aAfter addition of SYBR Green

dye-under day light. b After

addition of SYBR Green dye-

under UV light. cElectrophoretic analysis of

LAMP products. M 100 bp plus

DNA Ladder, Lane 1 75 ng,

Lane 2 7.5 ng, Lane 3 0.7 ng,

Lane 4 75 pg, Lane 5 7.5 pg,

Lane 6 0.7 pg, Lane 7 75 fg,

Lane 8 7.5 fg, Lane 9 Control

negative. d Electrophoretic

analysis of PCR products. M

100 bp plus DNA Ladder, Lane

1 B. abortus S19, Lane 2 control

negative, Lane 3 75 ng, Lane 4

7.5 ng, Lane 5 0.7 ng, Lane 6

75 pg, Lane 7 75 pg, Lane 8

0.7 pg, Lane 9 75 fg, Lane 10

7.5 fg, Lane 11 Control

negative

S. Zadon et al.

123

Acknowledgments The authors are thankful to the university

administration for providing necessary facilities. None of the authors

of this paper has a financial or personal relationship with other people

or organisations that could inappropriately influence or bias the

content of the paper.

References

1. Smits HK, Kadri SM (2005) Brucellosis in India: a deceptive

infectious disease. Indian J Med Res 122:375–384

2. De BK, Stauffer L, Koylass MS (2008) Novel Brucella strain

(BO1) associated with a prosthetic breast implant infection. J Clin

Microbiol 46:43–49

3. OIE (2010) Caprine and Ovine Brucellosis (excluding Brucella

ovis). Manual of diagnostic tests and vaccines for terrestrial

animals (Chapter 2.7.2)

4. Yagupsky P, Baron EJ (2005) Laboratory exposures to Brucellae

and implications for bioterrorism. Emerg Infect Dis 11:1180–

1185

5. Leal-Klevezas DS, Martinez-Vazquez IO, Lopez-Merino A,

Martinez-Soriano JP (1995) Single-step PCR for detection of

Brucella spp. from blood and milk of infected animals. J Clin

Microbiol 33:3087–3090

6. Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe

K, Amino N, Hase T (2000) Loop-mediated isothermal amplifi-

cation of DNA. Nucleic Acids Res 28:e63–e63

7. Qiao YM, Guo YC, Zang XE, Zhou YF, Zhang ZP (2007) Loop

mediated isothermal amplification for rapid detection of Bacillus

anthracis spores. Biol Lett 29:1939–1946

8. Ohtsuki R, Kawamoto K, Kato, Y, Shah MM, Ezaki T, Makino SI

(2008) Rapid detection of Brucella spp. by the loop-mediated

isothermal amplification method. J Appl Micro 108:1364–1372

9. Lin G, Zheng FY, Zhou JZ, Gong XW, Wang GH, Cao XA, Qiu

CQ (2011) Loop-mediated isothermal amplification assay tar-

geting the omp25 gene for rapid detection of Brucella spp. Mol

Cell Probes 25:126–129

10. Pan W, Wang JY, Shen HY, Zhao MQ, Ju CM, Dong XY, Yi L,

Chen JD (2011) Development and amplification of the novel

visual loop mediated isothermal amplification of omp 25

sequence for rapid detection of Brucella sp. J Anim Vet Adv

10:2120–2126

11. Song L, Li J, Hou S, Li X, Chen S (2012) Establishment of loop-

mediated isothermal amplification (LAMP) for rapid detection of

Brucella spp and application to milk and blood samples. J

Microbiol Methods 90:292–297

12. Wilson K (1987) Preparation of genomic DNA from bacteria. In:

Ausubal FM, Brent R, Kirston RL, Moore DD, Seidman JG,

Smith JA, Struhl K (eds) Current protocols in molecular biology,

vol 1. John Wiley and Sons, New York, pp 2.4.1–2.4.2

13. Tomita N, Mori Y, Kanda H, Notomi T (2008) Loop mediated

isothermal amplification (LAMP) of gene sequences and simple

visual detection of products. National Proto 3:877–882

14. Sreevatsan S, Bookout JB, Ringpis F, Perumaalla VS, Ficht TA,

Adams LG, Hagius SD, Elzer PH, Bricker BJ, Kumar GK, Raj-

asekhar M, Isloor S, Barathur RR (2000) A multiplex approach to

molecular detection of Brucella abortus and/or Mycobacterium

bovis infection in cattle. J Clin Microbiol 38:2602–2610

15. Dahouk AS, Nockler K, Hensel A, Tomaso H, Scholz HC, Hagen

RM, Neubauer H (2002) Human brucellosis in a nonendemic

country: a report from Germany, 2002 and 2003. Eur J Clin

Microbiol Infect Dis 24:450–456

16. Ping Z, Yang GL, Chen DJ (2008) Progress in studies on bru-

cellosis in cattle. China Cattle Sci 34:50–52

17. Wang J, Xu WM (2008) Progress in studies on the serum diag-

nosis of brucellosis. Chin J Pathol Biol 3:149–152

18. Parida M, Sannarangaiah S, Dash PK, Rao PVL, Morita K (2008)

Loop mediated isothermal amplification (LAMP): a new gener-

ation of innovative gene amplification technique; perspectives in

clinical diagnosis of infectious diseases. Rev Med Virol 18:407–

421

19. Ouahrani S, Michaux S, Sri WJ, Bourg G, Tournebize R, Ramuz

M, Liautard JP (1993) Identification and sequence analysis of

IS6501, an insertion sequence in Brucella spp.: relationship

between genomic structure and the number of IS6501 copies. J

Gen Intern Med 139:3265–3273

20. Maruyama F, Kenzaka T, Yamaguchi N, Tani K, Nasu M (2003)

Detection of bacteria carrying the stx2 gene by in situ loop-

mediated isothermal amplification. Appl Environ Microbiol

69:5023–5028

21. Ikadai H, Tanaka H, Shibahara N, Matsuu A, Uechi M, Itoh N,

Oshiro S, Kudo N, Garashi I, Oyamada T (2004) Molecular

evidence of infections with Babesia gibsoni parasites in Japan

and evaluation of the diagnostic potential of a loop mediated

isothermal amplification method. J Clin Microbiol 42:2465–2469

22. Yoshikawa T, Ihira M, Akimoto S, Usui C, Miyake F, Suga S,

Enomoto Y, Suzuki R, Nishiyama Y, Asano Y (2004) Detection

of human herpesvirus 7 DNA by loop mediated isothermal

amplification. J Clin Microbiol 42:1348–1352

23. Karleson F, Steen H, Nesland J (1995) SYBR green I DNA

staining increases the detection sensitivity of viruses polymerase

chain reaction. J Virol Methods 55:153–156

24. Nagamine K, Watanabe K, Ohtsuka K, Hase T, Notomi T (2001)

Loop mediated isothermal amplification reaction using a non

denatured template. Clin Chem 47:1742–1743

25. Tsai MA, Wang PC, Yoshida T, Liaw LL, Chen SC (2013)

Development of a sensitive and specific LAMP PCR assay for

detection of fish pathogen Lactococcus garvieae. Dis Aqua Organ

102:225–325

26. Zhang X, Liao M, Jiao P, Luo K, Zhang H, Ren T, Zhang G, Xu

C, Xin C, Cao W (2010) Development of a loop-mediated iso-

thermal amplification assay for rapid detection of subgroup J

avian leukosis virus. J Clin Microbio 48:2116–2121

27. Iwamoto T, Sonobe T, Hayashi K (2003) Loop-mediated iso-

thermal amplification for direct detection of Mycobacterium

tuberculosis complex, M. avium, and M. intracellulare in sputum

samples. J Clin Microbiol 41:2616–2622

28. Boehme CC, Nabeta P, Henostroza G, Raqib R, Rahim Z, Ger-

hardt M, Sanga E, Hoelscher M, Notomi T (2007) Operational

feasibility of using loop-mediated isothermal amplification for

diagnosis of pulmonary tuberculosis in microscopy centres of

developing countries. J Clin Microbiol 45:1936–1940

29. Zhang ZY, Liu XJ, Li DW, Yu JL, Han CG (2011) Rapid

detection of wheat yellow mosaic virus by reverse transcription

loop-mediated isothermal amplification. J Virol 8:550

Development of LAMP for Brucella species

123