development of real-time pcr based methods for...
TRANSCRIPT
ACTAUNIVERSITATISUPSALIENSISUPPSALA2006
Digital Comprehensive Summaries of Uppsala Dissertationsfrom the Faculty of Medicine 202
Development of Real-Time PCRBased Methods for Detection ofViruses and Virus Antibodies
AMAL ELFAITOURI
ISSN 1651-6206ISBN 91-554-6725-3urn:nbn:se:uu:diva-7320
To my husband KKhaled my daughters RRhma and NNora
my son AAbdulaziz
List of publications
This thesis is based on the following papers, which are referred to in the text by their Roman numerals:
I Nahla Mohamed, Amal Elfaitouri, Jan Fohlman, Göran Friman, Jonas Blomberg. A sensitive and quantitative single-tube real time reverse transcriptase- PCR for detection of enteroviral RNA. J Clin Virol. 2004 Jun; 30(2): 150-6.
II Amal Elfaitouri, Nahla Mohamed, Jan Fohlman, Robert Aspholm, Gun Frisk, Göran Friman, Lars Magnius, and Jonas Blomberg. Quantitative PCR-Enhanced Immunoassay for Measurement of Enteroviral Immunoglobulin M Antibody and Diagnosis of Aseptic Meningitis. Clin Diagn Lab Immunol. 2005 Feb; 12(2): 235-241.
III Amal Elfaitouri, Anna-Lena Hammarin, Jonas Blomberg.Quantitative Real-Time PCR Assay for Detection of Human Polyomavirus infection. J Virol Methods. 2006 Sep;135 :207-213
IV Amal Elfaitouri, Anna-Karin Berg , Gun Frisk, Hong Yin,Torsten Tuvemo, Jonas Blomberg. Recent enterovirus infection in type 1 diabetes (Submitted).
Reprints of paper I, II and III were printed with permission of the publishers.
Contents
Introduction...................................................................................................11Diagnosis of virus infections....................................................................11Detection of viral genomes (molecular techniques).................................12
Conventional PCR ...............................................................................12RT (reverse transcription)-PCR...........................................................12
Real-time PCR..........................................................................................13TaqMan® probes ..................................................................................14
Data analysis and interpretation in QPCR................................................17Target nucleic acid selection relies on sequence conservation.................17
Selection for constant protein structure ...............................................18Selection for constant RNA structure ..................................................18
Implications for choice of conserved target sequences for QPCR ...........18
Material and methods....................................................................................21Virus infectivity determination: Karber method (Paper I&II) .................21ELISA: Chessboard or checkerboard titrations (CBTs) (Paper IV) .........22Optimisation of Viral Antigen Dose by ELISA. ......................................22Optimisation of IgM Capture by ELISA..................................................22Real-time RT (reverse transcription)-PCR (QRT-PCR) ..........................23
rTth DNA polymerase properties.........................................................24Carry-over contamination ........................................................................25
HK ™-UNG Thermolabile Uracil N-Glycosylase ..............................25Optimization of QPCR and QRT-PCR ....................................................26
Design of primers and probe for QPCR and QRT-PCR......................26Divalent metal concentration...............................................................28
Degenerate and broadly targeted QPCR ..................................................28QPCR and QRT-PCR controls .................................................................28Sensitivity and Specificity of the enteroviral and polyomaviral QPCRs .29Comparison between QPCR and other PCRs...........................................29QPCR standard.........................................................................................30Patient samples and nucleic acid extraction .............................................30
Aims of the Study .........................................................................................32
Development of real-time PCR based methods. ...........................................33Enteroviruses............................................................................................33
The enterovirus capsid and genome ....................................................33Clinical features ...................................................................................34Aseptic meningitis (AM) .....................................................................34
Paper I ......................................................................................................35Paper II .....................................................................................................37Human Polyomavirus and SV40 ..............................................................41
Structure of the virion of polyomaviruses ...........................................41The viral genome .................................................................................41Clinical features ...................................................................................42Progressive multifocal leukoencephalopathy (PML) ..........................43
Paper III....................................................................................................44Recent enterovirus infection in type 1 diabetes........................................46
Human enterovirus association with type 1 diabetes...........................46Detection of anti-EV IgM and EV RNA .............................................47Mechanisms of EV to induce T1D ......................................................47TNF- , IP-10 and development of T1D .............................................47
Paper IV ...................................................................................................48
Conclusions and final remarks......................................................................50
Acknowledgements.......................................................................................51
References:....................................................................................................53
Abbreviations
AIDS Acquired Immunodeficiency Syndrome AM Aseptic Meningitis BKV BK virus cDNA Complementary DNA CPE Cytopathic effect CSF Cerebrospinal Fluid Ct Threshold cycle DABCYL [4-((4-(dimethylamino) phenyl) azo) benzoic acid ester] DNA Deoxyribonucleic acid dNTPs Deoxyribonucleotide triphosphate DUTP deoxyuridine triphosphate ELISA Enzyme linked immunosorbent assay EVs Enteroviruses FAM 6-carboxyfluorescein IgM Immunoglobulin M IP-10 Interferon-inducible protein 10 JCV JC virus PCR Polymerase chain reaction PML Progressive multifocal leukoencephalopathy QPCR Real-time PCR QRT-PCR Real-time RT-PCR RDDP RNA dependent DNA polymerase RNA Ribonucleic acid RT-PCR Reverse transcription PCR rTth Recombinant Thermus thermophilus polymerase SV40 Simian virus 40 TAMRA carboxytetramethylrhodamine TBE Tick Borne EncephalitisTCID50 50% tissue culture infective dose T1D Type 1 diabetes Tm Melting temperatureTNF- . Tumour necrosis factor –UNG Uracil-N-glycosylase 5´UTR 5´ untranslated region
11
Introduction
Diagnosis of virus infections Several techniques have been used in laboratory diagnosis of virus infections. The virus isolation assay was used to cultivate and identify the most viruses from a variety of different types of infected biological material. Because virus isolation is an unambiguous proof of the presence of virus able to replicate it can be considered as a type of “gold standard”. Virus isolation in cell culture requires days or weeks to provide a definitive result. Not all viruses are able to infect and replicate in all cells. The morphological changes to the infected cells caused by infecting viruses known as cytopathic effect (CPE). CPE is the first step in virus identification, and depends on the virus and the cells on which it is grown. The development of the CPE requires 18 h to 4 weeks. The type of CPE is sometimes characteristic of a specific virus or a virus group. The CPE effect can be used to measure the number of infectious virus particles according to the Karber method (Gray, 1999), by determining of the highest dilution of the virus suspension that produces a CPE in 50% of the cell cultures inoculated (50% tissue culture infective dose (TCID50)).The virus isolation technique is labour intensive and some of the viruses are not readily detected in cell cultures. For these reasons, alternative techniques such as serological investigation, antigen detection and detection of viral nucleic acids are preferred options for the diagnostic laboratory. The virus neutralization (NT) test in cell culture and complement fixation (CF) test are serological techniques, which were previously widely used, in clinical virology. NT is labour intensive for routine diagnostic use and cannot be performed on viruses which are difficult to grow in culture. CF is a less sensitive assay and can have problems due to nonspecific binding. Virus antigens can be detected directly from clinical samples, using antigen capture enzyme linked immunosorbent assay (ELISA) or immunofluorescence detection. ELISA is also the most common serological technique. It is rapid, sensitive and well suited for processing large numbers of samples. Among recent serological techniques, Immunoglobulin M (IgM) - capture (µ-capture) assays have become available for the detection of virus-specific IgM. IgM detection plays an important role in the diagnosis of acute virus infections. In IgM- capture, anti- human IgM immobilized on the solid
12
phase, to capture IgM molecules from the sample all other classes of immunoglobulin are unbound, and are removed during washing. The virus-specific IgM binds virus antigen, which is detected with an enzyme-labelled anti-virus antibody.
Detection of viral genomes (molecular techniques) Polymerase chain reaction (PCR) is a molecular biology technique that allows amplifying a specific sequence of deoxyribonucleic acid (DNA) in vitro by a cycling process where the DNA is separated into two strands and is incubated oligonucleotide primers and DNA polymerase (Kleppe et al., 1971). The PCR process was demonstrated in 1985 (Saiki et al., 1985) However, it was still necessary to inject fresh thermolabile polymerase prior to each elongation step (Mullis et al., 1986; Mullis and Faloona, 1987). In 1988 a heat stable DNA polymerase was used (Saiki et al., 1988). PCR is generally a three-step process, with denaturation, annealing and elongation steps at different temperatures. The number of cycles depend on the amount of target present.
Conventional PCR The final step in PCR is the detection of amplification products (post PCR, the so called PCR amplicon). They can be identified by their size using gel electrophoresis (end –point measurement of PCR product).
RT (reverse transcription)-PCR Ribonucleic acid (RNA) cannot be a template for PCR. The ability of retroviruses to transcribe their RNA genome into DNA by the viral reverse transcriptase (RNA dependent DNA polymerase (RDDP)) prior to its integration into host cells was discovered in 1970 (Baltimore, 1970; Temin and Mizutani, 1970). RT -PCR was first described in 1987 (Powell et al., 1987). RT-PCR contains two enzymatic steps: production of a single-strand complementary DNA copy (cDNA) from reverse transcription of RNA, then amplification of the cDNA resulting from the reverse transcription. It may be completed in two separate reactions in two separate tubes (two-tube/two-enzyme), or as two separate reactions in a single tube (one-tube/one or two-enzyme). At least four different RT enzymes are commercially available, HIV-1 –RT from human immunodeficiency virus type 1, AMV –RT from avian myeloblastosis virus, M-MLV –RT from Moloney murine leukemia virus, and recombinant Thermus thermophilus polymerase rTth.
13
In RT-PCR assays there are many variables that could influence the final result: the yield of extracted RNA; the efficiency of reverse transcription (cDNA synthesis), the efficiency of the PCR amplification; the concentration of deoxyribonucleotide triphosphates (dNTPs), MgCl2 concentration,primers, polymerase, and PCR temperature cycle scheme (Burchill et al., 1999).
Real-time PCR In conventional PCR, gel electrophoresis is used to analyze the PCR reaction after it is completed. This amplimer identification technique has limited specificity and is time consuming. These limitations led to the development of real-time PCR, which is also called quantitative PCR (QPCR) or kinetic PCR.
The principle of real-time PCR is based on monitoring of a fluorescent signal, which arises during the amplification process. Real-time PCR eliminates post-PCR processing of PCR products. This helps to increase throughput and reduces the chances of carryover contamination.
The idea to monitor the PCR reaction in the thermal cycler as it progresses was first realized by Higuchi and colleagues (Higuchi et al., 1992). The accumulation of PCR product could be visualized at each cycle by adding ethidium bromide (EtBr) to the PCR and by continuously measuring the increase in EtBr intensity during amplification with a charge-coupled device camera (Higuchi et al., 1993). A few years later, commercial platforms were released on the market. The first was the Applied Biosystems ABI Prism 7700 Sequence Detection System, followed by the Idaho Technology LightCycler (Wittwer et al., 1997).
There are two methods used to obtain a fluorescent signal from the PCR product. One method involves the use of DNA- specific intercalating dyes such as SYBR Green I to bind to double stranded DNA. The second method is to use fluorescent resonance energy transfer (or Förster resonance energy transfer (FRET)) (Didenko, 2001), FRET occurs by energy transfer between two fluorescent molecules donor to an acceptor fluorophore. These molecules are attached to primers, the PCR product or probes such as TaqMan® probes.
14
TaqMan® probes The real-time PCR system is based on the detection and quantification of a fluorescent reporter (Heid et al., 1996). TaqMan probes are one of the main fluorescence monitoring systems for DNA amplification. TaqMan® probesare oligonucleotides (single stranded DNA (ssDNA)) that contain a fluorescent dye, typically on the 5´ base (6-carboxyfluorescein (FAM)), and a quenching dye (carboxytetramethylrhodamine (TAMRA)), or ([4-((4-(dimethylamino) phenyl) azo) benzoic acid ester] (DABCYL)), typically located on the 3´ base or attached to a thymidine in a middle position of the probe sequence. The 3´ end should be phosphate to prevent it from being extended as an amplimer by the DNA polymerase. The quencher dye has the ability to quench the fluorescence emitted by the reporter. TaqMan probes are designed to anneal to an internal region of the PCR substrate, between the two PCR primers. The probe melting temperature (Tm) should be 5-10 ºC greater than that of the primers. The GC content of the probe should be in the 30-80% range, there should be no Gs at the 5´end, and the probe sequence should not overlap with the primer regions (Fig.1).
Figure 1. The TaqMan probe was designed to anneal to the target sequence between the positions of the forward FP and reverse RP primer. Attached to the 5´ end of the probe is a fluorescent reporter dye (R) and at the 3´ end there is a quencher dye (Q). The quencher has the ability to absorb the fluorescence emitted by the reporter.
During PCR, when the polymerase replicates a template on which a TaqMan® probe is bound, the 5´ 3´ exonuclease activity of the polymerase degrades the probe (Holland et al., 1991), resulting in the separation of the reporter and the quencher dye and therefore an increase in reporter fluorescence emission (Fig.2).
15
Figure 2. A more detailed view of the TaqMan 5´ exonuclease assay.
16
During the early PCR cycles, the background signal in the well is used to determine the baseline fluorescence across the entire reaction plate. A fluorescence threshold can be set above the baseline. Relative fluorescence values are recorded during every cycle and plotted against cycle number. The cycle at which the fluorescence rises above the threshold is defined as the threshold cycle, Ct. The higher the starting copy number of the nucleic acid target, the sooner a significant increase in fluorescence will be observed. Amplification data measured as an increase in reporter fluorescence are collected in real time and are analysed by the detection system software (Fig.3).
Figure 3. Rn is the difference between Rn+ (reaction containing template) and Rn- (reaction containing no template). Rn is plotted against cycle numbers to produce the amplification curves and gives the Ct value.
17
Data analysis and interpretation in QPCR The DNA concentration in the sample is quantified by comparing the Ct obtained from the sample with the Ct obtained from a dilution series of a standard, usually a plasmid DNA, in the same run. The Ct values of the plasmid standard are typically plotted against plasmid copy number to generate a standard curve. The accuracy of quantification by real-time PCR depends on the quality of the standard curve. Major sources of error in quantitative real-time PCR are the measurement threshold, variations during sample preparation and pipetting errors. If the sample contains inhibitors, or the probe has lost fluorescence, absence of amplification, erroneously high Ct values or low signal strength may occur.
The accuracy of quantitative real-time PCR is also dependent on variations in PCR efficiency. The efficiency of PCR reactions can be estimated from the slope of the crossing threshold against copy number line. The expected slope at 100% PCR efficiency is 3.3 cycles per tenfold concentration difference.
Real-time PCR results are dependent on the optimal master mix reagents, since the amount of the fluorescent signal can be affected by the correct amount of polymerase, the optimal concentration of dNTPs, MgCl2, primer and probe. The purity of the probe is also important. Mistakes during synthesis or mishandling (e.g. exposure to light, possibly also freezing and thawing) can adversely affect probe function.
Target nucleic acid selection relies on sequence conservationThe viral information carrier is either DNA or RNA. The genomes of all organisms have to change to improve adaptation. The molecular mechanisms involved are the substitution of nucleotides, because of misincorporation of nucleotides, which may arise due to the limitations of proofreading mechanisms, insertions, duplications and deletions, some of which are also caused by polymerase errors, and recombination. Recombination may occur by chance or as part of a viral strategy.
Viruses are under strong selection pressure. Only the fittest viruses will survive. Like in the host cells, the prime effector molecules of viruses are proteins and RNA. Therefore, selection can act at both protein and nucleic acid levels. An understanding of these mechanisms is important for the construction of broadly targeted PCRs
18
Selection for constant protein structure The genetic code is degenerate. Commonly, the first two codon positions are needed to encode a certain amino acid. However, the third, or “wobble” position can vary rather much without changing the encoded amino acid. Therefore, mutations in this position tend to be “silent”. They are called synonymous mutations. In contrast, nonsynonymous mutations are substitutions, which alter a codon so that it encodes a different amino acid. The error rate of an RNA dependent DNA polymerase of an RNA virus like Influenza A is high, having 10-4 substitutions per site (Drake, 1993; Fitch et al., 1991), compared with about 10-9 for a human DNA virus like Herpes Simplex. In general, RNA dependent RNA polymerases, used by many RNA viruses, have a considerably higher error rate than DNA dependent DNA polymerases. The RNA dependent RNA polymerases lack a proofreading mechanism. Some small DNA viruses, like BK virus (BKV), JC virus (JCV), and Simian virus 40 (SV40) depend on the enzymatic machinery of the infected cell for their replication and therefore are relatively constant.
Selection for constant RNA structure The single-stranded nature of most RNA molecules enables RNA to assume a wide variety of secondary and tertiary structures. This may be the case for the 5´ untranslated region (5´UTR) of enteroviruses (EVs) (see below).
Implications for choice of conserved target sequences for QPCR The conservation of the 5´UTR of EVs is probably caused by selection at thelevel of RNA structure. EV genomes have 750 bases at their 5´ end and 70 bases at the 3´end that are untranslated; these sequences are involved in viral regulatory activities such as replication and translation. Although genetic differences in the capsid coding region result in a large variety of EV serotypes, great similarities exist among the genomes of many of the EVs in a number of other regions along the RNA, including the untranslated sequences at the 5´ and 3´ ends and sequences coding for the polymerase, protease, and VPg proteins.
The high degree of conservation makes possible the design of primers and probe for real-time RT-PCR able of detecting RNA from many EVs, e.g. in cerebrospinal fluid (CSF) samples (Fig.4).
19
NMF1 GCCCCTGAATGCGGC
MP CGGAACCGACTACTTTGGGTGTCCGT*NMR1 AATTGTCACCATAAGCAGC
Polio1 GCCCCTGAATGCGGC CGGAACCGACTACTTTGGGTGTCCGT GCTGCTTATGGTGACAATTPolio2 GCCCCTGAATGCGGC CGGAACCGACTACTTTGGGTGTCCGT GCTGCTTATGGTGACAATC Polio3 GCCCCTGAATGCGGC CGGAACCGACTACTTTGGGTGTCCGT GCTGCTTATGGTGACAATC
Ente71 GCCCCTGAATGCGGC CGGAACCGACTACTTTGGGTGTCCGT GCTGCTTATGGTGACAATTCoxA16 GCCCCTGAATGCGGC CGGAACCGACTACTTTGGGTGTCCGT GCTGCTTATGGTGACAATT
CoxB2 GCCCCTGAATGCGGC CGGAACCGACTACTTTGGGTGTCCGT GCTGCTTATGGTGACAATTCoxB3 GCCCCTGAATGCGGC CGGAACCGACTACTTTGGGTGACCGT GCTGCTTATGGTGACAATTCoxA9 GCCCCTGAATGCGGC CGGAACCGACTACTTTGGGTGTCCGT GCTGCTTATGGTGACAATTEcho5 GCCCCTGAATGCGGC CGGAACCGACTACTTTGGGTGTCCGT GCTGCTTATGGTGACAATTEcho2 GCCCCTGAATGCGGC CGGAACCGACTACTTTGGGTGTCCGT GCTGCTTATGGTGACAATCEcho13 GCCCCTGAATGCGGC CGGAACCGACTACTTTGGGTGTCCGT GCTGCTTATGGTGACAATCCoxB1 GCCCCTGAATGCGGC CGGAACCGACTACTTTGGGTGACCGT GCTGCTTATGGTGACAATAEcho12 GCCCCTGAATGCGGC CGGAACCGACTACTTTGGGTGTCCGT GCTGCTTATGGTGACAATTEcho4 GCCCCTGAATGCGGC CGGAACCGACTACTTTGGGTGTCCGT GCTGCTTATGGTGACAATTCoxB4 GCCCCTGAATGCGGC CGGAACCGACTACTTTGGGTGTCCGT GCTGCTTATGGTGACAATCEcho25 GCCCCTGAATGCGGC CGGAACCGACTACTTTGGGTGTCCGT GCTGCTTATGGTGACAATTEcho30 GCCCCTGAATGCGGC CGGAACCGACTACTTTGGGTGTCCGT GCTGCTTATGGTGACAATTCoxB6 GCCCCTGAATGCGGC CGGAACCGACTACTTTGGGTGTCCGT GCTGCTTATGGTGACAATTCoxB5 GCCCCTGAATGCGGC CGGAACCGACTACTTTGGGTGTCCGT GCTGCTTATGGTGACAATTEcho6 GCCCCTGAATGCGGC CGGAACCGACTACTTTGGGTGTCCGT GCTGCTTATGGTGACAATT
EntE70 GCCCCTGAATGCGGC CGGAACCGACTACTTTGGGTGTCCGT GCTGCTTATGGTGACAATTConsen.***************/ **************************/*******************
Figure 4. Alignment of a selected conserved part of the 5´UTR of 22 human enterovirus sequences poliovirus (PV1-3), human enterovirus A (CAV16 and EV71), human enterovirus B (CBV 1-6, CAV9, E2, E4-E6, E12, E13, E25, E30), human enterovirus D (EV70). The numbering is derived from the coxsackie B2 genome sequence (Genbank accession no. AJ295199), NMF1: 334-347, NMR1:464-482, and MP: 416-441positions in the Coxsackievirus B2 sequence, GenBank accession number AJ295199. Intervening sequences not targeted by primers and probes are indicated by a slash (“/”). Aberrant nucleotides are underlined.
* Reporter dye (6-FAM) at 5´. Internal Quencher dye "dark" (DABCYL) attached to a thymidine in a middle position of the probe sequence (14 bp from the 5´ end) the 3´ end was phosphate.
P 1-3
A
B
D
20
The transcripts for the structural proteins VP1, VP2, and VP3 of the human polyomavirus and the SV40 are generated from a common precursor messenger RNA (mRNA) by alternative splicing. VP2 (351 residues) and VP3 (232 residues) are translated from the same messenger by using alternative start codons. The coding region for the amino terminus of VP1 overlaps that for the carboxy termini of VP2 and VP3, but VP1 is translated from a different reading frame to produce a 362 amino acids long protein.
The high degree of conservation, presumably acting at the protein level,made possible the selection of degenerate primers from a conserved region of the VP2 gene of JCV, BKV, and SV40 (Fig.5).
Protein G++D++L++V++A++T++V++S++E++A++A++A++A++T++G++F++S++V++A++ BJS-FP 5´GGGGACCTARTTGCYASTGT3´BJS-P 5´ACWGGATTTTCAGTRGCTJCV GGGGACCTAGTTGCTACTGTTTCTGAGGCTGCTGCTGCCACAGGATTTTCAGTAGCT 57
BKV GGGGACCTAGTTGCCAGTGTATCTGAGGCTGCTGCTGCCACAGGATTTTCAGTGGCT 57
SV40 GGGGACCTAATTGCTACTGTGTCTGAAGCTGCTGCTGCTACTGGATTTTCAGTAGCT 57Consensus ********* **** * *** ***** *********** ** *********** ***
Protein E++I++A++A++G++E++A++A++A++T++I++E++V++Q++I++A++S++L++A++
BJS-RP as ordered 5´GCAASRGATGCAAKTTSMAC3´
BJS-P GAAATTGCTGCTGG3´*
Target of BJS-RP 5´GTKSAAMTTGCATCYSTTGC3´
JCV GAAATTGCTGCTGGAGAGGCTGCTGCTACTATAGAAGTTGAAATTGCATCCCTTGC 113
BKV GAAATTGCTGCTGGGGAGGCTGCTGCTGCTATAGAAGTTCAAATTGCATCCCTTGC 113
SV40 GAAATTGCTGCTGGAGAGGCCGCTGCTGCAATTGAAGTGCAACTTGCATCTGTTGC 113Consensus ************** ***** ****** * ** ***** ** ******* ****
Figure 5. Alignment of a selected conserved part of the VP2 gene of the BKV, JCV, and SV40. BJS-FP: 648-667, BJS-RP: 687-718, and BJS-P: 741-760 positions in the reference strain of human BK virus, strain Dunlop (V01108.1) (III). * Reporter dye (6-FAM) at 5´. Quencher dye (TAMRA) at 3´. Variable sites (degenerations) of primers and probe are according to the IUPAC ambiguity codes, where R= AG, Y= CT, M=AC, K= GT, S= CG, W= AT. The protein translation is given above the nucleic acid sequence. “+”means the sense direction, relative to the mRNA sequence.
21
Material and methods
Virus infectivity determination: Karber method (Paper I&II)Virus infectivity was determined by using several prototype strains of coxsackievirus B1-B5 (CB1-5), coxsackievirus A9 (CA9), and echovirus 6, 11, and 30 (E6, E11, and E30) were obtained from the American Type Culture Collection (ATCC). (ATCC Cat. No. VR-28; -29; -30; -36; -41; -184; -185; -186; and -322) and PV1-3 Sabin vaccine strains obtained from the Swedish National Bacteriological Laboratory (SBL). Virus replication was determined by TCID50 titrations on green monkey kidney (GMK) cells (Vero cells) from the ATCC in 96-well plates in Eagle’s minimal essential medium (EMEM) supplemented with 5% newborn bovine serum according to the Karber method (Gray, 1999) Table 1. The virus dilutions (0.1 ml) were added to each of four Vero cell-containing wells, and incubated at 37 ºC for 5 days. Four uninoculated cell culture wells were also included, as controls. The virus titer was determined from the highest dilution able to induce CPE in 50% (TCID50) of the inoculated cell culture wells. The TCID50 were obtained from the following formula; Log TCID50 = L-d (s-0.5), where L is the Log of the lowest dilution, d is the difference between dilution steps and s is the sum of the proportion of positive tubes.
Table 1. Virus infectivity determination: Karber method Virus dilution CPE present in tube
1 2 3 4 Proportion of tubes infected
10-1 + + + + 4/4= 1 10-2 + + + + 4/4= 1 10-3 + + + - 3/4= 0.75 10-4 + + - - 2/4= 0.5 10-5 + + - - 2/4= 0.5 10-6 - - - - 0/4= 0
For the sample data given above (Table 1): Log TCID50 =-1-1(3.75-0.5) = -4.25, TCID50= 10-4.25 , 100 TCID50=10-2.25 . Therefore the dilution of the virus suspension that gives 100 TCID50 is 1 in 178. The TCID50 is generally calculated from a volume of 0.1 ml.
22
ELISA: Chessboard or checkerboard titrations (CBTs) (Paper IV)
To develop an ELISA system, the working concentration of each component of the test must be optimized by using chessboard or checkerboard titration (CBTs). In CBTs the dilution of two reagents can be titrated on a plate at the same time (Crowther, 2001).
Optimisation of Viral Antigen Dose by ELISA. In QPIA, the viral RNA is used to measure the amount of RNA-containing antigen, presumably complete virus particles, bound to the solid phase. Different virus preparations can contain different proportions of complete to incomplete (empty capsids, free capsomers) viral antigen. The latter may compete with the former for binding to the solid phase. This complicates the standardisation of the QPIA assay. There is also an uncertainty regarding the maximum viral antigen binding capacity of a microtiter well. The amount of added viral antigen should not exceed this capacity. To roughly optimize the antigen concentration of the two isolates T1 and Adrian, the following CBT steps were used. Ten fold (105 TCID50 -102 TCID50) and two fold (50 TCID50-3.125 TCID50) dilutions of antigen were used with monoclonal mouse anti-enterovirus diluted 1:80 in 0.1% gelatin in PBS (DAKO, catalog no. M7064) and anti-mouse IgG labeled with alkaline phosphatase-conjugated 1:80 in 0.1% gelatin in PBS (Sigma Chemicals, catalog no. A4312). A high virus dose, 104 TCID50 per microplate well was chosen. This was at the upper limit of the dynamic range, and was chosen to give an optimal sensitivity. Although the contribution of nonviral molecules to the saturation of the plastic in the microtiter well is unknown the chosen virus antigen concentration, the lowest that almost saturated the microtiter well, can be regarded as a maximal dose for practical purposes.
Optimisation of IgM Capture by ELISA Different concentrations of anti-human IgM (5, 2.5, and 1.25 µg/ml) were titrated against different concentrations of normal serum (1/100 to 1/3200) by CBTs. The optimal concentration of anti-human IgM (2.5 µg/ml) was tested with human IgM standard (purified immunoglobulin from Sigma, catalog no. I8260) Table 2.
23
Table 2. Optimisation of anti-human IgM concentration used for coating microtiter plate wells. Part of a CBT with varying anti-human IgM, and human IgM concentrations. Results with 2.5 µg/ml of anti-human IgM are shown.
Human IgM standard (ng/ml) Optical Density at 405 nm 1000 3.268 500 2.994 250 2.810 125 2.221 62.5 1.103
31.25 0.606 15.625 0.285 7.8125 0.146
Substrate blank 0.071
The results obtained from the two fold serial dilution of a human IgM standard showed that coating with 2.5 µg/ml of anti-human IgM gave an optimal IgM binding over the human IgM concentration range of 1000 ng/ml and 7.8 ng/ml. A partial saturation effect was seen above 250 ng/ml. These OD values were also relatively close to the absorbance maximum of the plate photometer. This may mean that at very high IgM concentrations the IgM binding capacity per well is exceeded, which can misrepresent the actual amount of anti-enteroviral IgM. If the patient has had several recent infections, which give rise to high concentrations of IgM, and there are only small amounts of anti-enteroviral IgM, this could lead to false negativity in the QPIA test. It probably is a rare situation. The conditions of IgM binding were those that provided the highest IgM binding capacity, still using a limited amount of anti-IgM. Together with the selected liberal dose of viral antigen these conditions should be adequate for most clinical situations.
Real-time RT (reverse transcription)-PCR (QRT-PCR) The RNA molecule is reverse transcribed to cDNA via primer extension with a RDDP. Primers can be random primer, oligo-dT, or target sequence specific primers. Oligo-dT is more specific for synthesis of cDNA from mRNA than random primers, but does not prime ribosomal RNA (rRNA) or any other RNA molecule that lacks a poly A tail. To achieve accurate quantification of mRNAs by real time PCR, target sequence specific primers were more efficient than oligo-dT and hexamer priming (Lekanne Deprez et al., 2002).
In single tube RT-PCR, all reaction components are added at once. It reduces the risk of mixing up samples and contaminating one sample with another sample and involves less time and effort. The entire cDNA quantity serves as a template for the subsequent PCR phase (Aatsinki et al., 1994; Goblet et al.,
24
1989; Mallet et al., 1995; Wang et al., 1992). In the RT-PCR (Elfaitouri et al., 2005; Mohamed et al., 2004) 10 rTth units per PCR reaction were used . However, by decreasing denaturation temperature and time polymerase activity could be conserved even during 55 cycles (Manuscript IV). The revised conditions thus were more economical and faster, yet yielding similar results as the previous temperature protocol (Paper I & II), which employed higher rTth concentration.
Two-tube RT-PCR systems may have higher sensitivity and higher specificity than single-tube systems, due to the less efficient RT activity of rTth DNA polymerase (Cusi et al., 1994) or because the reverse transcription and the DNA amplification reactions are run under their own respective optimized conditions.
rTth DNA polymerase properties rTth DNA polymerase was found to possess both reverse transcription (RDDP) and DNA amplification (DDDP) functions. They can occur in the same tube, in a single buffer containing Mn2+ (Myers and Gelfand, 1991; Young et al., 1993). rTth was efficient for detection of low abundant mRNA from single cells (Chiocchia and Smith, 1997). Increased concentrations of the Mn2+ ions required for rTth are known to decrease the fidelity of cDNA synthesis (Beckman et al., 1985).
Real-time RT-PCR described here takes advantage of ability of rTth DNA polymerase to reverse transcribe RNA in the presence of Mn2+ at elevated temperatures. These activities are modulated by the use of a bicine based buffer, which gives a different pH at different temperatures.
The low thermal stability of most RT enzymes can cause problems when mRNA or other RNA targets contain secondary structures (Buell et al., 1978; Kotewicz et al., 1988; Shimomaye and Salvato, 1989). At 35-55º C such structures can cause premature termination during synthesis of cDNA or can cause the RT to skip over the secondary structures and continue RNA synthesis without termination (Brooks et al., 1995; Zhang et al., 2001). Because of the thermostability of rTth, reverse transcription can be performed at 60-70ºC with increases the efficiency of melting RNA secondary structures and decreases nonspecific primer binding. rTth posesses RNase H and 5´ 3´ exonuclease activities (Myers and Gelfand, 1991). RNase H is a ribonuclease function that degrades the RNA in a RNA: DNA hybrid and is inactive on ss- or dsRNAs and DNAs alone. Reduced RNase H activity can affect the RT by interfering with the synthesis of cDNA or by binding undegraded RNA template to newly synthesized cDNA in RNase H-ve RT.
25
Carry-over contaminationA PCR carry-over contamination protection technique, utilizing deoxyuridine triphosphate (dUTP) and Uracil N-Glycosylase (UNG), has been described (Longo et al., 1990). UNG removes uracil from DNA by cleaving the N-glycosidic bond between the base and the sugar-phosphate backbone. UNG is purified from Escherichia coli. UNG is active on single and double stranded uracil-containing DNA, but does not react with thymine-containing DNA.
HK ™-UNG Thermolabile Uracil N-Glycosylase HK (Heat-Killed)-UNG used in our QRT-PCR (Cat. No. HU59100; Epicentre Technologies Corporation, Madison, Wisconsin) is a thermolabile (heat-labile) enzyme that is fully active at 37ºC, 42ºC and 50ºC. It is completely inactived by a 10 min incubation at 65ºC or higher, unlike thermostable (heat-stable) UNG enzymes that remaining active after treatment at 70ºC-95ºC (Thornton et al., 1992). To avoid degradation of the dUTP-containing PCR product, which then cannot be cloned or visualized in an agarose gel electrophoresis reactions should be held at 72 ºC until used (Ritzler et al., 1999). In QRT-PCR, different concentrations of HKTM UNG were tested; up to 0.1 units per reaction did not have any adverse effect on the QRT-PCR (data not shown).
26
Optimization of QPCR and QRT-PCR Design of primers and probe for QPCR and QRT-PCR Good primer and probe design will promote reliable QPCR. In this work, complete or partial genomes available in GenBank from the target sequences are first aligned with the on-line software MultAlin or with BLAST, using a reference strain sequence as query. (http://prodes.toulouse.inra.fr/multalin/multalin.html). (http://www.ncbi.nlm.nih.gov/blast/).
BLAST, Clustal, Megalign, Multalin or BioEdit alignments of 2-20000 target sequences were examined for conserved stretches by the ConSort program (Blomberg J, unpublished). Areas of sequence conservation are identified, and the degree of representativity for all sequences in the alignment, or selected groups included in the alignment, is computed. The output shows the most common variant for each position, then less common ones in decreasing order. Insertions and deletions are marked especially. The positions of highly conserved stretches were selected for primers and probes (Fig.6 & 7).
Figure 6. Result of the conservation analysis of the entire polyoma virus genome, and the conserved stretch used for primer and probe construction. The figure was based on a BLAST search using the SV40 genome as query.
27
Figure 7. The same analysis as in figure 6 but for enteroviral genomes, using poliovirus as the query. The ConSort© program was used.
All primers and probes were designed after evaluation using the on-line software Oligo Analyzer 3.0.(http://www.idtdna.com/analyzer/Applications/OligoAnalyzer/) When designing the oligonucleotide, primer and probe self- and intercomplementarity should be avoided. Especially, complementarity of the probe to the 3´ end of the primer should be avoided. The primer 3´ ends should be free from repetitive sequences and highly degenerate sequences.
The stability of the interaction between oligonucleotides (primers and probe) and a complementary target determines the melting temperature (Tm), which is the temperature at which 50% of a given oligonucleotide is hybridized. The Tm of oligonucleotides depends on length and GC content. The latter ideally should be between 40-70%. Tm as determined using oligo analyzer 3.0 was used as an initial guide. An optimal annealing temperature was determined experimentally (paper I and III).
To optimize the annealing temperature, a PCR using a temperature gradient of 48-60ºC was initially performed on an iCycler IQ TM PCR-cycler (Bio-Rad Laboratories, Hercules, CA, USA). All PCR products were run on a 2% agarose gel. The annealing temperature which gave a bright band of the expected size from specific amplification and less or no primer –dimer was selected (Paper III). Primers were designed with the goal of minimizing the free energy ( G) of primer-primer and primer-probe interactions.
28
Divalent metal concentration The optimal Mn2+ concentration was determined by testing 2 and 3 mM concentrations. In the initial testing of the EV QPCR, at 2 mM Mn2+,sensitivity was low. By increasing the Mn2+ to 4mM and the rTthconcentration up to 10 units an optimal sensitivity for low template concentrations was achieved. As mentioned above, the latter could later be reduced.Magnesium chloride concentration is an important parameter. High concentration can lead to increased production of primer-dimer, incomplete denaturation and low PCR yield, whereas a low Mg2+ concentration reduces the ability of polymerase to extend the primers. In this work, a standard Mg2+
concentration that gives a minimum Ct value and high fluorescence intensity was selected.
Degenerate and broadly targeted QPCR To develop a specific QPCR for every viral species within a viral family is expensive and time-consuming. Broadly targeted QPCR gives the possibility to detect a variety of related viral sequences with a smaller number of QPCRs. Degenerate primers, which have in some positions several bases, can accommodate some of the target variation. For example BJS-FP (Paper III), which one or more of its positions were occupied by one of several possible nucleotides (GGGGACTARTTGCYASTGT) is a sequence written using IUPAC ambiguity codes, where R stands for one of A or G (2X), Y stands for one of C or T (2X), and S stands for one of C or G (2X). The degeneracy of a sequence is the number of different sequences that it represents. Thus, the degeneracy of GGGGACCTARTTGCYASTGT is 8 (it has 23 variants).
Increased degeneracy of primers may decrease the PCR efficiency and give low sensitivity. This may be partially counteracted by increasing primer concentration, which in its turn gives a higher risk of primer-dimer formation. This short circuit the PCR, which leads to lower sensitivity. In this QPCR, the PCR efficiency could be kept high even if degenerate primers were used.
QPCR and QRT-PCR controls False negatives occur as a result of presence of inhibitors, the failure of one or more PCR reagents (Burgos et al., 2002; Kainz, 2000) , failure of the PCR thermal cycling process (Rossen et al., 1992; Wilson, 1997), or unexpected
29
mismatches between primer or probe and their target. To control for the former sources of error, a standard of known concentration as well as positive controls were also included. If the samples contain inhibitors, low signal strength (a more flat curve), increased Ct values, or entire absence of an amplification curve may occur.
False positives occur as a result of cross contamination from either positive samples or previous amplimer. To avoid that closed tube RT-PCR, and UNG carry-over contamination were used (Paper I and II). No template (water) controls were always included in all QPCR reactions. To avoid the risk of false positive results due the common laboratory contamination with plasmids containing the T-antigen gene of the SV40, a conserved region of the VP2 gene was targeted instead (Paper III).
Sensitivity and Specificity of the enteroviral and polyomaviral QPCRs In order to assess the specificity and sensitivity of EV QRT-PCR, the Third and Fourth ‘European Union Quality Control Concerted Action (EU-QCCA) EV proficiency panel’were tested. The panels contained coxsackieviruses A9, A16, B5, echovirus types 6, 11, enterovirus 71 and negative samples. The ability to detect a range of EV serotypes was also tested; coxsackieviruses A9, A16, B2 and B5, and echovirus types 6, 11 and 30 were included (Paper I). For human Polyomavirus and SV40 QPCR, twenty-four serum samples from anonymous blood donors were used to test the specificity of the QPCR. The sensitivity was estimated by end-point titration, with four observations per dilution step, into the stochastic zone of 1-10 DNA copies per QPCR reaction from clinical samples. They were titrated in tenfold dilution steps down to complete negativity. The sensitivity was also assessed with synthetic oligonucleotides. The sensitivity was enhanced by elution of DNA from the QIAprep column with volumes of less than 200 µl (50 µl) in order to increase the final DNA concentration in the eluate, according to the instructions of the manufacturer (QIAamp® DNA Blood Mini kit (Qiagen, Hilden, Germany)) (Paper III).
Comparison between QPCR and other PCRs Total of 62 CSF specimens of patient diagnosed as having meningitis were tested by EnteroVisionTM PCR detection kit (DNA Technology A/S, Aarhus,
30
Denmark) and our QRT-PCR. The results from the EnteroVisionTM PCR detection kit and QRT-PCR were compared with clinical data. (Paper I) The presence of BKV and JCV DNA in 41 clinical samples from kidney and bone marrow transplanted patients were analysed with nested PCR, as described earlier (Bogdanovic et al., 1994). These 41 samples were analysed by QPCR without information on the nested PCR results. The sequences of the PCR products from the positive samples by QPCR, which were negative by nested PCR, confirmed the specificity of the QPCR (Paper III).
QPCR standard Coxsackievirus B2 plasmid DNA and RNA extracts from tenfold serial dilution (104 to 10-2 TCID50/mL) of viral culture supernatants of coxsackievirus A16, A9, B2 and B5, echovirus types 6, 11 and 30 were used as a standard for EVs QRT-PCR. Tenfold serial dilution of RNA extracts from a mixture of 10,000 TCID50 of CB1-5, CA9, E6, E11, and E30 were used to calculate the amount of RNA bound per microtiter well for each sample in QPIA. Tenfold dilutions of SV40 plasmid DNA, within a range of 105 – 101
copies/µl, were used for calculation of approximate copy numbers (gene equivalents/ml) and for BKV, JCV, and SV40 QPCR standardization. 10-fold dilutions of synthetic DNA oligonucleotides from JCV, BKV and SV40 ranging from 1×100 to 1×107 copies were run in BKV, JCV, and SV40 QPCR. Tenfold serial dilutions of RNA extracts from 10,000 TCID50 of EV from newly debuted T1D patients, calibrated against the coxsackie B2 plasmid DNA, were used to calculate the amount of RNA equivalents bound per microtiter well for each sample in QPIA.The term equivalents is further discussed in paper III.
Patient samples and nucleic acid extraction A total of 336 specimens were investigated by QRT-PCR for EV RNA, QPIA for EV IgM and QPCR for BKV, JCV, and SV40 DNA, as shown in (Table 3). DNA and RNA were extracted from patient samples according to the instructions of the manufacturer in QIAamp® DNA Blood Mini Kit and QIAamp® viral RNA Mini Kit (Qiagen, Hilden, Germany).
31
Table 3. Type of sample used in the study Sample type Total no. Patients
CSF 62 Aseptic Meningitis (AM) (I) 1 Progressive multifocal leukoencephalopathy (PML) (III)
Serum 20 Positive EV IgM (II) 59 Aseptic Meningitis (AM) (II) 13 RIA EV IgM negative (II) 30 Blood donor (II) 24 Blood donor (III) 33 T1D (Manuscript IV) 27 Controls (Manuscript IV) 24 Siblings (Manuscript IV) 2 T1D (Manuscript IV) 7 Bone marrow and kidney transplant (III)
Urine 32 Bone marrow and kidney transplant (III) Plasma 2 Bone marrow and kidney transplant (III)
For Roman numbers I, II, III, and IV see the list of publications.
32
Aims of the Study
General aims
To develop broadly targeted real-time PCR techniques for early diagnosis of viral infection.
Specific aims
I.To develop a sensitive and quantitative single-tube RT-PCR for detection of enteroviral RNA, and apply it to samples from patients with AM.
II.To develop a sensitive and specific EV IgM detection method Quantitative PCR-Enhanced Immunoassay (QPIA), and apply it to samples from patients with AM.
III.To develop a sensitive real-time PCR for detection of BKV, JCV, and SV40 DNA, and apply it to samples from immunosuppressed patients (renal and bone marrow transplantation), PML patients, and to samples from patients with tumours previously reported to contain polyomavirus.
IV.To investigate if T1D children had higher frequencies of EV-IgM measured with a QPIA method that uses EV from newly debuted T1D.
33
Development of real-time PCR based methods.
Real-time PCR methods have been extremely useful for diagnosis of viral diseases (Gunson et al., 2006; Mackay, 2004; Niesters, 2002; Niesters, 2004). Viral quantitation by real-time PCR has proven diagnostically useful in clinical virology (Mackay et al., 2002; Niesters, 2001).
EnterovirusesThe enterovirus genus contains non-enveloped single-strand RNA viruses, which belong to the Picornaviridae family. EVs consist of 62 serotypes, as defined by the 8th report of the International Committee for Taxonomy of Viruses (ICTV) January 2005. It includes the polioviruses (1-3), human enterovirus A (human coxsackievirus A2, A3, A5, A7, A8, A10, A12, A14, A16, human enterovirus 71) human enterovirus B (human coxsackievirus B1-B6, A9, human echovirus 1-7, 9, 11-21,24-27,29-33, human enterovirus 69) human enterovirus C (human coxsackievirus A1, A11, A13, A15, A17-22, A24) and human enterovirus D (human enterovirus 68,70). However, the family recently was greatly expanded due to the finding of many new human and animal viruses (Norder et al., 2003; Oberste et al., 2001; Oberste et al., 2005; Oberste et al., 2004) . Recent human picornaviruses are subclassified into human enterovirus A (human enterovirus 76, 89, 90,91) and human enterovirus B (human enterovirus 73, 74, 75, 77,78).
The enterovirus capsid and genome EVs are nonenveloped viruses with an icosahedral capsid of about 27-30 nm in diameter; the capsid contains four proteins, VP1 to VP4, arranged in 60 repeating protomeric units (capsomers) of an icosahedron. Genomic RNA is approximately 7.4 kilobase pairs in length and serves as a template for both viral protein translation and RNA replication. A small protein, VPg. is covalently bound to the 5´-end. The 3´-end contains a poly (A) tail. A single polyprotein is translated from the single open reading frame. It is posttranslationally modified by viral proteases to form the viral protein cleavage products (four separate capsid proteins, VPg, a polymerase, and the proteases themselves (Fig. 8).
34
Figure 8. Genomic organization and translation products of the EVs.
Clinical features EVs frequently infect humans. EV infections are usually asymptomatic or may present themselves with low-grade fever and upper respiratory tract symptoms (Grist et al., 1978), but frequently also aseptic meningitis (AM). EVs are also the cause of paralytic poliomyelitis, and a major part of myocarditis cases (Muir et al., 1998). After a viremic phase specific organ manifestations may ensue in a secondary phase with disease entities like AM, myocarditis, systemic neonatal infection and potentially even dilated cardiomyopathy (Fohlman et al., 1996) and diabetes mellitus (Fohlman and Friman, 1993; Frisk et al., 1985; Jenson and Rosenberg, 1984; King et al., 1983) .
Aseptic meningitis (AM) Aseptic meningitis (AM) is an acute inflammation in the meninges of the brain or spinal cord which not caused by bacteria. It can be caused by any of a number of viruses, including EVs, the mumps virus and the herpesviruses. The most common viruses causing AM are EVs, causing as many as 80% of such cases (Rotbart, 1990). The patient presents with headache, fever, and neck stiffness, with or without vomiting and /or photophobia, more than 5000 leukocytes/ml in CSF, slightly increased in CSF pressure, with near normal protein and glucose concentrations.
35
Paper ISingle-tube real-time RT- PCR for detection of enteroviral RNA.Conventional laboratory diagnosis of EV infections is based on the detection of the virus in clinical specimens by cell culture, followed by neutralization typing. This method is laborious and time consuming. Recently, single- tube real-time reverse transcription QRT-PCR assay, using TaqMan probes, a fluorogenic probe based on 5´ 3´ exonuclase activity, have been used to determine the amount of EV RNA in CSF samples (Verstrepen et al., 2001). In contrast to the Verstrepen et al (2001) assay, a two step RT-PCR was developed by Nijhuis et al. (2002) (Nijhuis et al., 2002) which used multiple primer and probe sets to detected all 60 different enterovirus species in different clinical specimens with a detection limit down to 0.36 TCID50 of CVA9 of the third EU-QCCA panel. A highly sensitive two step RT-PCR assay was also developed to quantify down to 510 copies of enteroviral RNA /ml of CSF (Lai et al., 2003). An additional one-step SYBR green RT-PCR targeting the 5´ UTR was demonstrated to have a detection limit down to 3.6 TCID50 /ml of the CA9 of the EU-QCCA panel (Archimbaud et al., 2004). In real-time RT-PCR, it is important to know the real DNA or RNA standard concentration to generate a standard curve. “Armored” enterovirus RNA (Ambion Diagnostics, USA) has been used as a standard in TaqMan, SYBR Green I and Lux-primer systems to demonstrate sensitivities down to 1-10 copies (Donia et al., 2005).
Several authors have developed real-time RT-PCR assays, Table 4. The real-time RT-PCR (QRT-PCR) (Mohamed et al., 2004) of paper I is unique in that it can be performed in a single closed tube. No post-amplification steps are required. It includes thermolabile uracil N-glycosylase for carryover prevention. The lowest RNA concentration we detected was 0.001 TCID50 of coxsackievirus B2 and 1-10 molecules of coxsackievirus B2 plasmid DNA. A large number of samples can therefore be rapidly screened with high sensitivity, making it a suitable tool for the routine laboratory.
36
Table 4. Application of QRT-PCR to the detection of enterovirus infection.
Gene targeted Technology and Instrument
RT-PCR/UNGtreatment
Sensitivity Reference
5'UTR TaqMan with ABI Prism 7700
One-step /no UNG
1250 EV genome equivalents/ml of
CSF
Verstrepen et al., 2001
5'UTR TaqMan with ABI Prism 7700
Two-step/UNG 0.36 TCID50 of CVA9 of the
third EU-QCCA
Nijhuis et al., 2002
5'UTR TaqMan with A LightCycler
Two-step/UNG 510 RNA copies /ml of CSF
Lai et al., 2003
5'UTR TaqMan with Rotor-Gene 2000
One-step/UNG 0.001 TCID50/mL of CoxB2
and 1-10 copies of coxB2
plasmid per PCR reaction
Mohamed et al., 2004
5'UTR SYBR Green I with LightCycler
One-step/no UNG
3.6 TCID50 of CVA9 of the
EU-QCCA panel
Archimbaud et al., 2004
5'UTR TaqMan , SYBR Green I and Lux-
primers with BioRad iCycler
One-step/ no UNG
1-10 copies of Armored
Enterovirus RNA per PCR
reaction
Donia et al., 2005
5´UTR: 5´ untranslated region. RT-PCR: reverse transcription PCR TCID50: 50% tissue culture infective dose UNG: uracil N-glycosylase
From a total of 62 CSF specimens of patients diagnosed as having meningitis, 34 out of 62 were found to be positive when tested with the RT-PCR assay while 21 out of the 62 were found to be positive when tested with the EnteroVisionTM PCR detection kit.
All samples were tested without knowledge of clinical data and compared to the final clinical analysis of the 62 meningitis patients; 45 were classified as non-bacterial, non-herpetic and non-TBE (Tick Borne Encephalitis) aseptic meningitides, 7 were found to be bacterial meningitis, 6 were diagnosed as herpes simplex type 2 meningitis infections, one was diagnosed as TBE, and 3 were diagnosed as “other diseases”.
QRT-PCR detected 34 out of the 45 enteroviral meningitis cases (76%) while the EnteroVisionTM PCR detection kit detected 21 out of the 45 (47%). None of the 17 samples from nonenteroviral meningitis cases were positive in QRT-PCR and the EnteroVisionTM PCR detection kit.
37
Paper II
Quantitative PCR-Enhanced Immunoassay (QPIA) for Measurement of Enteroviral IgM (Application to patients with AM).
The performance of viral serology is useful in the diagnosis of recent or chronic viral infections. Analysis of antibodies in serum is an additional means for the detection of EV infections after clearance of viral RNA. Immunoglobulin M (IgM) appears within several days after onset of symptoms, peaks at 7-10 days, and declines to undetectable levels within 1-2 months (Hodinka, 1999) after the disappearance of virus from CSF. IgM antibodies are more useful clinically than neutralizing antibody tests, which mostly measure IgG, because IgM indicates recent infection with a serotype not previously encountered.
The combination of PCR with antibody capture has been used to type EV (Shen et al., 1997), and with immunoglobulin capture solid phase immunoassay (Aspholm et al., 1999). In QPIA, immune capture in itself purifies the viral antigen and the PCR detection step is virus specific. QPIA combines the sensitivity and specificity of QRT-PCR (Mohamed et al., 2004) with an immunoglobulin capture solid phase immunoassay (Aspholm et al., 1999).
The QPIA was developed to detect antibodies against a broad range of native EV antigens CB1 to CB5, CA9, E6, E11, and E30. The viral strains were chosen for known cross reactivity (Samuelson et al., 1994) and frequency and severity of infection. The PV vaccine strains were included to enable the method to be used in current efforts to certify PV eradication.
In contrast to other EV IgM techniques; PIA (Aspholm et al., 1999), solid phase immunosorbent test, SPRIST (Glimaker et al., 1992; Magnius et al., 1988), and an EV IgM radioimmunoassay (RIA) (Frisk et al., 1989); QPIA was rational due to measurement at a single serum dilution, and obviated the need for additional detection steps using antiviral antibodies, chemically coupled virus antigen conjugates or isotope marked virus antigens. It still had an acceptable sensitivity and specificity.
The sensitivity of QPIA was tested using serum samples from patients with AM or from patients which EV had been isolated. QPIA values were compared with values from PIA and SPRIST (group 1). Nine serum samples were positive by PIA and 4 were positive by SPRIST. QPIA gave a positive reaction with all nine IgM-positive serum samples (Table 5).
38
Table 5. Comparison of QPIA with PIA and SPRIST Group and patient no.
Isolated virus
PIA titer SPRIST titer QPIA RNA copies
QPIA Value
1-13 CBV-5 10,000 100 7386 15.9 1-14 ND 10,000 Negative 7873 17.0 1-15 CBV-5 10,000 Negative 1606 3.5 1-18 ND 10,000 Negative 891 1.9 1-26 ND 10,000 10, 000 2180 4.7 1-29 ND 10,000 100 630 1.4 1-30 ND 10,000 10, 000 695 1.5 1-41 ND 10,000 Negative 1905 4.1 1-43 ND 10,000 Negative 3582 7.7
QPIA RNA of 12 viruses copies bound per well. QPIA Value is the ratio between amount of bound virus relative to the cut-off.
The QPIA values were also compared with values from RIA (group 4). RIA detected EV-specific IgM in 11 serum samples at different titers. QPIA gave a positive reaction for all. Nine of the 11 were strongly positive, defined as a sample/cutoff value of over 3. QPIA gave a negative result for 13 serum samples from patients infected with herpes simplex virus, cytomegalovirus, adenovirus, or mumps virus. All of them were negative by RIA (Table 6).
Table 6. Comparison of QPIA with RIA.Group and patient no.
Isolated virus RIA titer QPIA RNA copies
QPIA Value
4-949 CBV-4 500 2 832 6.14-1259 CBV-2 1000 2 577 5.64-989 CBV-2 125 846 1.8
4-1085 CBV-1 1000 3 057 6.64-1254 CBV-1 1000 1 657 3.64-1280 CBV-4 125 2 750 5.94-1254 CBV-1 125 2 517 5.44-1022 CBV-3 1000 8 083 17.44-810 CBV-2,3 250, 2000 5 511 11.9
4-1059 CBV-4 1000 6 694 14.4
QPIA RNA of 12 viruses copies bound per well. QPIA Value is the amount of bound virus relative to the cutoff.
None of the blood donor serum samples (group 3) had EV IgM by QPIA, indicating a high specificity.
Serum samples were available for 59 of the 62 patients (paper I and II), and for 43 of the 45 patients finally diagnosed with AM not due to bacteria, herpes simplex, or TBE (Table 7). Sixteen of the remaining 17 patients were diagnosed with non-EV infections. QPIA was positive for 24 of the 43
39
(56%) cases. However, samples from four cases finally diagnosed as bacterial or probable bacterial meningitis were also (weakly) positive by QPIA. One sample weakly positive by QPIA was from a case of herpes simplex type 2 meningitis, and one was from a case of TBE. Nineteen out of 30 (63%) serum samples obtained on the day of hospital admission were QPIA positive. Of these, 17 were positive for EV by QRT-PCR. Sixteen of 43 samples were positive by both QRT-PCR and QPIA. These included samples from two patients from whom EV (E6 and E30) had been isolated. Sixteen of 43 samples were positive by QRT-PCR alone, and 8 of 43 were positive by QPIA alone.
Altogether, half of 32 enteroviral meningitis cases positive with QRT-PCR were positive with QPIA. 8 of enteroviral meningitis cases positive with QPIA were negative with QRT-PCR (Table 7).
Table 7. Comparison of the results of the QRT-PCR and QPIA in CSF and serum specimens from meningitis cases. Method Enteroviral
meningitis Herpessimplex meningitis
TBEmeningitis
Bacterial meningitis
Otherdiseases
Total
QRT-PCR/CSF
34/45(76%) 0/7 0/1 0/6 0/3 62
QPIA/serum 24/43(56%) 1/7 1/1 4/6 0/2 59
The combination of QRT-PCR and QPIA detected 40 of 43 (93%) AM cases when both CSF and serum were available (Fig.9).
Figure 9. Diagnosis of EV infection by QRT-PCR and QPIA.
40
Figure 10. Analytic steps for diagnosis of EV infection by QRT-PCR and QPIA.
41
Human Polyomavirus and SV40 The BKV, JCV and SV-40 are double-stranded DNA viruses. They are species of the genus polyomavirus within the family Polyomaviridae. The taxonomy is based on the 8th report of the International Committee on Taxonomy of Viruses (ICTV), January 2005. Until the 7th report the genus polyomavirus was assigned as one of two genera within the family Papovaviridae. The name polyoma comes from Greek words denoting: polyfor “many”, and –oma for “tumors”. The first of these viruses to be identified was mouse polyoma virus (PyV) (Stewart et al., 1958) or polyoma virus and simian virus 40 (SV40) (Sweet and Hilleman, 1960). SV40 has been shown to be oncogenic in hamsters (Eddy et al., 1962).
Therefore, the question of whether SV40 might have caused infections in humans exposed to the virus via inactivated Salk polio vaccines during the years of 1955-1963 (Shah and Nathanson, 1976) has been debated. The vaccine was prepared in primary cultures of kidney cells derived from rhesus monkeys, which were contaminated with SV40. As an experimental model of oncogenesis, SV40 became a model system for cell biology (Hilleman, 1998; Levine, 1994).
In 1971, two polyomaviruses that infect humans were identified. JC virus was isolated from brain tissue from a patient with PML (Padgett et al., 1971). In the same year, a second human polyomavirus BK virus was isolated from the urine of a renal transplant patient (Gardner et al., 1971). The name of these viruses comes from the patient’s initials from where they were isolated.
Structure of the virion of polyomaviruses Polyomaviruses are nonenveloped viruses with an icosahedral capsid of about 40- 45 nm in diameter. The capsid is composed of different structural proteins: a major capsid protein, VP1, and minor capsid proteins, VP2 and VP3 as well as the agnoprotein. VP1 represents 80% and VP2 together with VP3 represent 20% of total virion protein in the capsid. The capsid is composed of 72 pentamers, with 360 molecules of VP1 and 30-60 molecules of VP2 and VP3 (Liddington et al., 1991; Rayment et al., 1982).
The viral genome The viral genome of polyomaviruses consists of a single copy of a circular double-stranded DNA molecule of approximately 5 kilobase pairs. The DNA sequence of JCV, BKV and SV40 are 70% identical. Their genome includes
42
two coding regions: the early region encodes the regulatory proteins large tumor antigen (TAg) and small tumor antigen (tag) and the late region, encodes the four late proteins: agnoprotein, VP1, VP2, and VP3. The early and late regions are separated at their 5´ termini by the regulatory region (RR), which contains the cis-acting elements that control viral DNA replication (Ori) and transcription.
TAg and tag share N-terminal amino acid sequences, but their C- terminal regions are unique. The coding sequence for VP2 completely includes that for VP3 in the 3´ terminus in the same reading frames. The 3´ terminus of the coding sequences for VP2 and VP3 partly overlap the 5´ terminus of VP1 in different reading frames (Fig.11).
Figure 11. Late region of polyomaviruses genome. The stretch used in paper III is also indicated.
Clinical features The infection with the JCV and BKV are thought to be subclinical and occur during childhood. After primary infection BKV and JCV, persist as life-long silent infections in the kidney until they reactivate under immunosuppressive conditions (Bogdanovic et al., 1992), such as leukaemia, Acquired Immunodeficiency Syndrome (AIDS) and organ transplantation. Reactivation of BKV is primarily associated with urinary tract disorders, mainly in bone marrow (Arthur et al., 1986) and renal transplant patients (de Bruyn and Limaye, 2004; Limaye et al., 2001). Reactivation of JCV may cause PML (Major et al., 1992). The pathogenic role of SV40 in humans is uncertain.Epidemiological studies of humans exposed to SV40 contaminated poliovirus vaccines have failed to demonstrate an association between SV40 and cancer (Fraumeni et al., 1963; Tognon et al., 2004). In a few cases, BKV has been detected in patients with CNS disorders (Bratt et al., 1999; Jorgensen et al., 2003) and JCV has been reported in allograft nephropathy
43
in renal transplant recipients in the absence of BKV (Kazory et al., 2003). However, SV40 can also cause polyomavirus nephropathy (PVN) (Milstone et al., 2004) and hemorrhagic cystitis (HC) in children after bone marrow transplantation (BMT) (Comar et al., 2004).
Progressive multifocal leukoencephalopathy (PML) Progressive multifocal leukoencephalopathy (PML) is a primary demyelinating disease in which oligodendrocyte infection results in the death of the myelin forming cell. PML was discovered and described in 1958 (Astrom et al., 1958). It occurs almost exclusively in people with severe immunodeficiency as transplant patients on immunosuppressive medications, or AIDS patients. The first AIDS-association PML case was described by Miller et al. 1982 (Miller et al., 1982). Symptoms include weakness or paralysis, vision loss, impaired speech, cognitive deterioration.
44
Paper IIISensitive real-time PCR for detection of Human Polyomavirus and SV40 DNA.
Real-time QPCR has become a very useful diagnostic method for management of immunocompromised patients following solid organ or bone marrow transplantation, AIDS PML patients and SV40 relation tumours. BKV DNA can also be detected in the blood of healthy individuals (Dolei et al., 2000); therefore quantifying the viral load in the plasma of renal transplant patients may allow reducing the dose of immunosuppressive therapy and minimizing viral multiplication. The JCV load in CSF samples from AIDS patients with PML receiving HAART (Highly Active Anti-Retroviral Therapy) showed that a high JCV load was associated with increased mortality (Koralnik et al., 1999; Yiannoutsos et al., 1999).
Several reports have described real-time PCR assays for detection and quantitation of BKV (Leung et al., 2002; Vats et al., 2003), JCV (Whiley et al., 2001), and SV40 (Engels et al., 2002; Mayall et al., 2003). The target gene used for detection of SV40 was TAg. The high degree of conservation, and the opportunity of avoiding the risk of false positive results due to contamination by common laboratory plasmids containing the TAg gene of SV40 (Lopez-Rios et al., 2004), lead to the selection of degenerate primers from a conserved region of the VP2 gene of JCV, BKV, and SV40. Therefore, our QPCR is more reliable for studies on the relation of polyomaviruses to disease, like tumours.
A broadly targeted quantitative real-time PCR (QPCR) technique, based on the TaqMan technology for amplification of BKV, JCV, and SV40 DNA, was developed. QPCR provided accurate detection results compared to another PCR technique. Ten copies of the target gene were consistently detected. One copy is detected in 10-fold dilutions of synthetic DNA oligonucleotides from JCV, BKV and SV40. 45 cycles have been used without loss of sensitivity and no fluorescence in the non-template control samples was observed during the 45 reaction cycles of the QPCR. For 41 clinical samples from kidney and bone marrow transplanted patients, 24 (58.5%) were positive with QPCR and 31 (75.6%) were positive with nested PCR (Bogdanovic et al., 1994). Ten were negative in both PCRs and seven were positive with QPCR only.
None of the 24 samples from healthy blood donors was positive with QPCR.
45
Together with the sequencing results of the seven QPCR positive only samples, this verified the specificity of the QPCR.
The stochastic positivity (tenfold titration of positive sample down to complete negativity, with four observations per dilution step) results of four clinical samples, two positive for JCV and two positive for BKV indicated a sensitivity of 1-10 copies per PCR reaction for both JC and BK viruses.
One CSF sample from a patient with PML was tested. The sample was negative by nested PCR, but confirmed to be positive by another real-time PCR for JCV DNA (Bossolasco et al., 2005). The positive outcome of quantitative PCR in a cerebrospinal fluid sample from a patient with PML indicates that quantitative PCR can be used to diagnose PML patients. The QPCR we developed is believed to be a clear improvement over existing assays because it broadly targeted and less time consuming, still sensitive and quantitative (McNees et al., 2005; Pal et al., 2006) Table 8.
Table 8. Application of real-time PCR to the detection of BKV, JCV, and SV40 infection.
Gene targeted Technology & instrument
PCR Sensitivity per PCR reaction
Reference
T-antigen TaqMan with ABI Prism 7700
Specific for each virus (one set of primer/probe for
each virus)
10 copies McNees., et al 2005
Early and late region
TaqMan with ABI Prism 7700
Specific for each virus (four set of primer/probe for
each virus)
1-10 copies Pal et al., 2006
VP2 gene TaqManwith Rotor-Gene 3000
Broadly targeted (one set of
primer/probe for all three viruses)
1-10 copies Elfaitouri et al., 2006
46
Recent enterovirus infection in type 1 diabetes
In the present study Quantitative PCR-Enhanced Immunoassay (QPIA) was used to measure of IgM antibodies against EVs in newly diagnosed T1D children, siblings and controls (T1D-EV-QPIA). The novelty of this study is the new method QPIA and that viral antigen isolated from T1D cases at onset was used.
Type 1 diabetes mellitus (T1D), also known as insulin-dependent diabetes (IDDM) or juvenile-onset diabetes, is a disease that is characterized by the loss of the insulin producing ß-cells in the islets of langerhans of the pancreas. T1D is most commonly diagnosed in children and adolescents. Many viruses have been implicated in the pathogenesis of T1D as environmental disease-precipitating factors (Jun and Yoon, 2003). Enteroviruses (Lonnrot et al., 2000; Tauriainen et al., 2003), rubella virus (Forrest et al., 1971; Sever et al., 1985), cytomegalovirus (Powell et al., 1987), mumps (Hyoty et al., 1988) and rotavirus (Honeyman et al., 2000) have been discussed.
Human enterovirus association with type 1 diabetes Various environmental triggers i.e. certain viruses and cytokines/chemokines have been proposed to initiate the autoimmune process, in which T-lymphocytes play an important role. Theoretically, anything that could produce liberation of autoantigens or induce cytokine/chemokine secretion from the islets could initiate the process. The viruses most often considered to be involved in the induction of T1D are the human enteroviruses (Gladisch et al., 1976; Jun and Yoon, 2003).
Virus isolation The most striking finding, supporting enteroviral involvement in T1D, is the presence of EV RNA in the human pancreatic islets in T1D cases that died shortly after onset of the disease (Roivainen et al., 2000). The diabetogenic potential of coxsackievirus B, isolated from the pancreas of T1D patient, in mice was proven (Champsaur et al., 1982; See and Tilles, 1995; Szopa et al., 1993; Yoon et al., 1979).
47
Detection of anti-EV IgM and EV RNAIn several studies IgM against coxsackie B viruses was found to be more frequent in newly diagnosed type 1 diabetes patients compared to age-matched healthy individuals (Frisk et al., 1985; Gamble and Taylor, 1973). EV RNA has been identified by PCR in the sera of children with new-onset diabetes mellitus (Clements et al., 1995; Moya-Suri et al., 2005; Yin et al., 2002).
Mechanisms of EV to induce T1D The pathways by which enteroviruses may induce T1D is not well understood, both direct ß-cell damage by virus- induce cell lysis (Frisk and Diderholm, 2000; Roivainen et al., 2000) and molecular mimicry by virus induced antiviral response that cross reacts with ß-cell autoantigens such as GAD65 (glutamic acid decarboxylase) (Baekkeskov et al., 1990) which could lead to ß-cell destruction, have been proposed to explain how T1D may be induced by EV infection.
TNF- , IP-10 and development of T1D The induction of tumour necrosis factor - (TNF- ) and interferon-inducible protein 10, also called CXCL10 (IP-10) may attract immune cells that might contribute to the ß-cell destruction seen in T1D. TNF- promotes up-regulation of adhesion molecules and activates macrophages (Bigda et al., 1994; Heidenreich et al., 1988). IP-10 attracts cytotoxic T-cells and elevated levels of that chemokine has been detected in T1D patients (Christen and Von Herrath, 2004; Shimada et al., 2001).
48
Paper IV Recent enterovirus infection in type 1 diabetes By using disease-derived viral strains (originating from T1D patients) as antigens in a quantitative PCR enhanded immunoassay (T1D-EV-QPIA) we have measured IgM antibodies against such potentially diabetogenic viruses in serum from 33 newly diagnosed T1D children, 24 siblings, and 27 healthy children. A cutoff of 2 times the standard deviation of negative controls is used. Positive values range from just over the cutoff, to 100 times the cutoff. It is desirable to increase the difference between positive and negative IgM values in future versions of the method. A systematic evaluation of EV strains, T1D derived or not, is also desirable. The data are too limited to determine if there are T1D specific epitopes on EVs, and whether there are specific diabetogenic EV strains.
TNF- , IP-10, anti-GAD65, EV-RNA, and EV-IgM in serum from T1D patients, siblings and controls Sera were also analyzed with regard to autoantibodies against GAD65, the cytokine TNF- and the chemokine IP-10. EV-RNA detection was performed on peripheral white blood cells (PBMC).
The frequency of TNF- positivity was significantly lower among the T1D children (57.7%), than among the siblings 72%, or among the controls 87% (p<0.001). Measurement of IP-10 levels in serum samples from the three groups revealed that there were no differences between the groups, although there was a tendency of lower levels in samples from T1D children. In all samples there were detectable levels of IP-10. The high frequencies of antibodies against the islet antigen GAD-65 were observed among the T1D children (60.1%), while the frequency among the siblings was (16.7%) and the controls had no such antibodies in serum (0%), reconfirming the high specificity of this marker (Vandewalle et al., 1995).
A higher frequency of EV-PCR positive samples was observed among the T1D children, 78.1 %, then among the healthy control children, 8% (p<0.001). Among the siblings the frequencies of EV-RNA in their white blood cells were higher than among the controls, 45.8%, but significantly lower than the ones obtained in the T1D children (p< 0.003).
IgM antibodies against this antigen cocktail, originating from T1D patients, were much more frequent among the T1D children than among the controls. 33% of the T1D patient had an IgM titre compared with 4.2% of controls and siblings (p< 0.001).
To conclude, i) Lower frequencies of TNF- were found in serum from the T1D patients than in controls, suggesting an effect of the infection on the
49
immune response or an impaired immune response allowing the virus to spread. ii) There was a clear correlation between detection of EV-RNA and EV-IgM in recent or ongoing EV infections. iii) A majority of the patients (60.1%) revealed antibodies against GAD65, considered a marker for the autoimmune response, indicating that the patients studied can be considered to have had an immune reaction against the pancreatic ß-cells. iv) The previous results regarding the frequencies of IgM antibodies against EVs in newly diagnosed T1D children, siblings and controls were clearly confirmed by using viral antigen isolated from T1D cases at onset.
50
Conclusions and final remarks
Broadly targeted real-time PCR techniques for early diagnosis of viral infection by detection of virus nucleic acid (DNA and RNA) and virus antibodies (IgM) were developed.
I. The developed QRT-PCR detected EV RNA from samples which contain a few copies of RNA (1-10 gene equivalents per PCR reaction) and from a broad variety of EVs in reference panels.
II. Our results indicate that QPIA achieves a rapid diagnosis of enterovirus infection. The combination of QRT-PCR and QPIA detected 40/43 (93%) of aseptic meningitis cases from which both serum and CSF were available.
III. A broadly targeted, simple, single tube real-time degenerated quantitative PCR (QPCR) technique for detection of JCV, BKV and SV40 DNA was developed. At least down to 10-100 gene equivalents of target DNA per PCR reaction were detected. The QPCR is simple to perform and should be valuable for diagnosis of polyoma virus infection.
IV. The previous results regarding the frequencies of IgM antibodies against EVs in newly diagnosed T1D children, siblings and controls were confirmed by using viral antigen isolated from T1D cases at onset (T1D-EV-QPIA).
51
Acknowledgements
The studies presented in this thesis were performed at the Department of Medical Sciences, Section of Virology, Uppsala University, Sweden. Financial support was provided by local funds at the Uppsala Academic Hospital.
I wish to express my sincere gratitude first of all to Allah (God) who helps me to complete this thesis.
I wish to express my sincere gratitude to all the people that have supported and encouraged me during these years, especially:
Jonas Blomberg, my supervisor, for his help, support, and guidance throughout all these years. Thank you for having introduced me into the field of clinical virology. I am grateful for all the things I learnt from you.
All my co-authors and in particular, Jan Fohlman, Göran Friman, Gun Frisk, Lars Magnius, Anna-Lena Hammarin, and Torsten Tuvemo for fruitful collaboration and sharing their knowledge in virology field.
Bawantee Dudhee, Nahla Shaverdy, Sultan Golbob, Parisa Haraty, and Mehrangiz Moghadam for technical assistance and introduced me into the lab work from the very beginning of my studies. Thank you all for your guidance and help.
Eva Tano and Markus Klint for great help with the sequencing work.
Eva Haxton and Birgitta Sembrant for their assistance and support.
I am also grateful to my colleagues, Nahla Mohamed, Shamam Muradrasoli, Lijuan Hu, Zhihong Yan, Dmitrij Ushameckis, Amarinder Bindra, Guma Abdeldaim, Farid Benachenhou, Patric Jern, Tove Airola, Anna Forsman, and Charlotta Ekstrand helped to create such a pleasant and stimulating scientific environment. Good luck!
All the people at clinical virology, clinical bacteriology and the hygiene staff.
52
I would also like to thank all of my friends, Eyman Shebani, Asma Elshebani, Samira Garboui, and Fawzeia Elmhalli, for your friendship and support.
I would have not been where I am now without them (my family), My father and mother, for never ending love and support.
My sisters and brothers (and their families), for all the good time we have spent together and supported me in all I have done in my life.
My friend Abeer and her family.
My husband’s family and my sister in-law Rabab and her son Ibrahem for their support and love.
My children Rhma, Nora, and Abdulaziz for the happy time we have spent together.
My husband for his care and understanding. Thank you Khaled.
53
References:
Aatsinki, J.T., Lakkakorpi, J.T., Pietila, E.M. and Rajaniemi, H.J., 1994. A coupled one-step reverse transcription PCR procedure for generation of full-length open reading frames. Biotechniques 16, 282-4, 286-8.
Archimbaud, C., Mirand, A., Chambon, M., Regagnon, C., Bailly, J.L., Peigue-Lafeuille, H. and Henquell, C., 2004. Improved diagnosis on a daily basis of enterovirus meningitis using a one-step real-time RT-PCR assay. J Med Virol 74, 604-11.
Arthur, R.R., Shah, K.V., Baust, S.J., Santos, G.W. and Saral, R., 1986. Association of BK viruria with hemorrhagic cystitis in recipients of bone marrow transplants. N Engl J Med 315, 230-4.
Aspholm, R., Zuo, S., Fohlman, J., Frisk, G., Friman, G. and Blomberg, J., 1999. A novel serological technique: polymerase chain reaction enhanced immunoassay. Application to enterovirus IgM diagnosis. J Virol Methods 80, 187-96.
Astrom, K.E., Mancall, E.L. and Richardson, E.P., Jr., 1958. Progressive multifocal leuko-encephalopathy; a hitherto unrecognized complication of chronic lymphatic leukaemia and Hodgkin's disease. Brain 81, 93-111.
Baekkeskov, S., Aanstoot, H.J., Christgau, S., Reetz, A., Solimena, M., Cascalho, M., Folli, F., Richter-Olesen, H. and De Camilli, P., 1990. Identification of the 64K autoantigen in insulin-dependent diabetes as the GABA-synthesizing enzyme glutamic acid decarboxylase. Nature 347, 151-6.
Baltimore, D., 1970. RNA-dependent DNA polymerase in virions of RNA tumour viruses. Nature 226, 1209-11.
Beckman, R.A., Mildvan, A.S. and Loeb, L.A., 1985. On the fidelity of DNA replication: manganese mutagenesis in vitro. Biochemistry 24, 5810-7.
Bigda, J., Beletsky, I., Brakebusch, C., Varfolomeev, Y., Engelmann, H., Bigda, J., Holtmann, H. and Wallach, D., 1994. Dual role of the p75 tumor necrosis factor (TNF) receptor in TNF cytotoxicity. J Exp Med 180, 445-60.
Bogdanovic, G., Brytting, M., Cinque, P., Grandien, M., Fridell, E., Ljungman, P., Lonnqvist, B. and Hammarin, A.L., 1994. Nested PCR for detection of BK virus and JC virus DNA. Clin Diagn Virol 2, 127-36.
Bogdanovic, G., Grandien, M., Brytting, M. and Fridell, E., 1992. [BK and JC viruses--2 polyomaviruses causing disease in immunosuppressed patients]. Lakartidningen 89, 3925-6.
Bossolasco, S., Calori, G., Moretti, F., Boschini, A., Bertelli, D., Mena, M., Gerevini, S., Bestetti, A., Pedale, R., Sala, S., Sala, S., Lazzarin, A. and Cinque, P., 2005. Prognostic significance of JC virus DNA levels in cerebrospinal fluid of patients with HIV-associated progressive multifocal leukoencephalopathy. Clin Infect Dis 40, 738-44.
54
Bratt, G., Hammarin, A.L., Grandien, M., Hedquist, B.G., Nennesmo, I., Sundelin, B. and Seregard, S., 1999. BK virus as the cause of meningoencephalitis, retinitis and nephritis in a patient with AIDS. Aids 13, 1071-5.
Brooks, E.M., Sheflin, L.G. and Spaulding, S.W., 1995. Secondary structure in the 3' UTR of EGF and the choice of reverse transcriptases affect the detection of message diversity by RT-PCR. Biotechniques 19, 806-12, 814-5.
Buell, G.N., Wickens, M.P., Payvar, F. and Schimke, R.T., 1978. Synthesis of full length cDNAs from four partially purified oviduct mRNAs. J Biol Chem 253, 2471-82.
Burchill, S.A., Lewis, I.J. and Selby, P., 1999. Improved methods using the reverse transcriptase polymerase chain reaction to detect tumour cells. Br J Cancer 79, 971-7.
Burgos, J.S., Ramirez, C., Tenorio, R., Sastre, I. and Bullido, M.J., 2002. Influence of reagents formulation on real-time PCR parameters. Mol Cell Probes 16, 257-60.
Champsaur, H.F., Bottazzo, G.F., Bertrams, J., Assan, R. and Bach, C., 1982. Virologic, immunologic, and genetic factors in insulin-dependent diabetes mellitus. J Pediatr 100, 15-20.
Chiocchia, G. and Smith, K.A., 1997. Highly sensitive method to detect mRNAs in individual cells by direct RT-PCR using Tth DNA polymerase. Biotechniques 22, 312-4, 316, 318.
Christen, U. and Von Herrath, M.G., 2004. IP-10 and type 1 diabetes: a question of time and location. Autoimmunity 37, 273-82.
Clements, G.B., Galbraith, D.N. and Taylor, K.W., 1995. Coxsackie B virus infection and onset of childhood diabetes. Lancet 346, 221-3.
Comar, M., D'Agaro, P., Andolina, M., Maximova, N., Martini, F., Tognon, M. and Campello, C., 2004. Hemorrhagic cystitis in children undergoing bone marrow transplantation: a putative role for simian virus 40. Transplantation 78, 544-8.
Crowther, J.R., 2001. The ELISA Guidebook. Humana press, inc., Totowa, N.J. Cusi, M.G., Valassina, M. and Valensin, P.E., 1994. Comparison of M-MLV reverse
transcriptase and Tth polymerase activity in RT-PCR of samples with low virus burden. Biotechniques 17, 1034-6.
de Bruyn, G. and Limaye, A.P., 2004. BK virus-associated nephropathy in kidney transplant recipients. Rev Med Virol 14, 193-205.
Didenko, V.V., 2001. DNA probes using fluorescence resonance energy transfer (FRET): designs and applications. Biotechniques 31, 1106-16, 1118, 1120-1.
Dolei, A., Pietropaolo, V., Gomes, E., Di Taranto, C., Ziccheddu, M., Spanu, M.A., Lavorino, C., Manca, M. and Degener, A.M., 2000. Polyomavirus persistence in lymphocytes: prevalence in lymphocytes from blood donors and healthy personnel of a blood transfusion centre. J Gen Virol 81, 1967-73.
Donia, D., Divizia, M. and Pana, A., 2005. Use of armored RNA as a standard to construct a calibration curve for real-time RT-PCR. J Virol Methods 126, 157-63.
Drake, J.W., 1993. General antimutators are improbable. J Mol Biol 229, 8-13.
55
Eddy, B.E., Borman, G.S., Grubbs, G.E. and Young, R.D., 1962. Identification of the oncogenic substance in rhesus monkey kidney cell culture as simian virus 40. Virology 17, 65-75.
Elfaitouri, A., Mohamed, N., Fohlman, J., Aspholm, R., Frisk, G., Friman, G., Magnius, L. and Blomberg, J., 2005. Quantitative PCR-enhanced immunoassay for measurement of enteroviral immunoglobulin M antibody and diagnosis of aseptic meningitis. Clin Diagn Lab Immunol 12, 235-41.
Engels, E.A., Sarkar, C., Daniel, R.W., Gravitt, P.E., Verma, K., Quezado, M. and Shah, K.V., 2002. Absence of simian virus 40 in human brain tumors from northern India. Int J Cancer 101, 348-52.
Fitch, W.M., Leiter, J.M., Li, X.Q. and Palese, P., 1991. Positive Darwinian evolution in human influenza A viruses. Proc Natl Acad Sci U S A 88, 4270-4.
Fohlman, J. and Friman, G., 1993. Is juvenile diabetes a viral disease? Ann Med 25, 569-74.
Fohlman, J., Pauksen, K., Hyypia, T., Eggertsen, G., Ehrnst, A., Ilback, N.G. and Friman, G., 1996. Antiviral treatment with WIN 54 954 reduces mortality in murine coxsackievirus B3 myocarditis. Circulation 94, 2254-9.
Forrest, J.M., Menser, M.A. and Burgess, J.A., 1971. High frequency of diabetes mellitus in young adults with congenital rubella. Lancet 2, 332-4.
Fraumeni, J.F., Jr., Ederer, F. and Miller, R.W., 1963. An evaluation of the carcinogenicity of simian virus 40 in man. Jama 185, 713-8.
Frisk, G. and Diderholm, H., 2000. Tissue culture of isolated human pancreatic islets infected with different strains of coxsackievirus B4: assessment of virus replication and effects on islet morphology and insulin release. Int J Exp Diabetes Res 1, 165-75.
Frisk, G., Fohlman, J., Kobbah, M., Ewald, U., Tuvemo, T., Diderholm, H. and Friman, G., 1985. High frequency of Coxsackie-B-virus-specific IgM in children developing type I diabetes during a period of high diabetes morbidity. J Med Virol 17, 219-27.
Frisk, G., Nilsson, E., Ehrnst, A. and Diderholm, H., 1989. Enterovirus IgM detection: specificity of mu-antibody-capture radioimmunoassays using virions and procapsids of Coxsackie B virus. J Virol Methods 24, 191-202.
Gamble, D.R. and Taylor, K.W., 1973. Coxsackie B virus and diabetes. Br Med J 1, 289-90.
Gardner, S.D., Field, A.M., Coleman, D.V. and Hulme, B., 1971. New human papovavirus (B.K.) isolated from urine after renal transplantation. Lancet 1, 1253-7.
Gladisch, R., Hofmann, W. and Waldherr, R., 1976. [Myocarditis and insulitis following coxsackie virus infection]. Z Kardiol 65, 837-49.
Glimaker, M., Samuelson, A., Magnius, L., Ehrnst, A., Olcen, P. and Forsgren, M., 1992. Early diagnosis of enteroviral meningitis by detection of specific IgM antibodies with a solid-phase reverse immunosorbent test (SPRIST) and mu-capture EIA. J Med Virol 36, 193-201.
Goblet, C., Prost, E. and Whalen, R.G., 1989. One-step amplification of transcripts in total RNA using the polymerase chain reaction. Nucleic Acids Res 17, 2144.
56
Gray, J., 1999. Assays for virus infection. Oxford University Press, Oxford, United Kingdom.
Grist, N.R., Bell, E.J. and Assaad, F., 1978. Enteroviruses in human disease. Prog Med Virol 24, 114-57.
Gunson, R.N., Collins, T.C. and Carman, W.F., 2006. Practical experience of high throughput real time PCR in the routine diagnostic virology setting. J Clin Virol 35, 355-67.
Heid, C.A., Stevens, J., Livak, K.J. and Williams, P.M., 1996. Real time quantitative PCR. Genome Res 6, 986-94.
Heidenreich, S., Weyers, M., Gong, J.H., Sprenger, H., Nain, M. and Gemsa, D., 1988. Potentiation of lymphokine-induced macrophage activation by tumor necrosis factor-alpha. J Immunol 140, 1511-8.
Higuchi, R., Dollinger, G., Walsh, P.S. and Griffith, R., 1992. Simultaneous amplification and detection of specific DNA sequences. Biotechnology (N Y) 10, 413-7.
Higuchi, R., Fockler, C., Dollinger, G. and Watson, R., 1993. Kinetic PCR analysis: real-time monitoring of DNA amplification reactions. Biotechnology (N Y) 11, 1026-30.
Hilleman, M.R., 1998. Discovery of simian virus 40 (SV40) and its relationship to poliomyelitis virus vaccines. Dev Biol Stand 94, 183-90.
Hodinka, R.L., 1999. Designing studies to confirm a link between viral infection and atherosclerosis. Am Heart J 138, S554-5.
Holland, P.M., Abramson, R.D., Watson, R. and Gelfand, D.H., 1991. Detection of specific polymerase chain reaction product by utilizing the 5'----3' exonuclease activity of Thermus aquaticus DNA polymerase. Proc Natl Acad Sci U S A 88, 7276-80.
Honeyman, M.C., Coulson, B.S., Stone, N.L., Gellert, S.A., Goldwater, P.N., Steele, C.E., Couper, J.J., Tait, B.D., Colman, P.G. and Harrison, L.C., 2000. Association between rotavirus infection and pancreatic islet autoimmunity in children at risk of developing type 1 diabetes. Diabetes 49, 1319-24.
Hyoty, H., Leinikki, P., Reunanen, A., Ilonen, J., Surcel, H.M., Rilva, A., Kaar, M.L., Huupponen, T., Hakulinen, A., Makela, A.L. and et al., 1988. Mumps infections in the etiology of type 1 (insulin-dependent) diabetes. Diabetes Res 9, 111-6.
Jenson, A.B. and Rosenberg, H.S., 1984. Multiple viruses in diabetes mellitus. Prog Med Virol 29, 197-217.
Jorgensen, G.E., Hammarin, A.L., Bratt, G., Grandien, M., Flaegstad, T. and Johnsen, J.I., 2003. Identification of a unique BK virus variant in the CNS of a patient with AIDS. J Med Virol 70, 14-9.
Jun, H.S. and Yoon, J.W., 2003. A new look at viruses in type 1 diabetes. Diabetes Metab Res Rev 19, 8-31.
Kainz, P., 2000. The PCR plateau phase - towards an understanding of its limitations. Biochim Biophys Acta 1494, 23-7.
Kazory, A., Ducloux, D., Chalopin, J.M., Angonin, R., Fontaniere, B. and Moret, H., 2003. The first case of JC virus allograft nephropathy. Transplantation 76, 1653-5.
57
King, M.L., Shaikh, A., Bidwell, D., Voller, A. and Banatvala, J.E., 1983. Coxsackie-B-virus-specific IgM responses in children with insulin-dependent (juvenile-onset; type I) diabetes mellitus. Lancet 1, 1397-9.
Kleppe, K., Ohtsuka, E., Kleppe, R., Molineux, I. and Khorana, H.G., 1971. Studies on polynucleotides. XCVI. Repair replications of short synthetic DNA's as catalyzed by DNA polymerases. J Mol Biol 56, 341-61.
Koralnik, I.J., Boden, D., Mai, V.X., Lord, C.I. and Letvin, N.L., 1999. JC virus DNA load in patients with and without progressive multifocal leukoencephalopathy. Neurology 52, 253-60.
Kotewicz, M.L., Sampson, C.M., D'Alessio, J.M. and Gerard, G.F., 1988. Isolation of cloned Moloney murine leukemia virus reverse transcriptase lacking ribonuclease H activity. Nucleic Acids Res 16, 265-77.
Lai, K.K., Cook, L., Wendt, S., Corey, L. and Jerome, K.R., 2003. Evaluation of real-time PCR versus PCR with liquid-phase hybridization for detection of enterovirus RNA in cerebrospinal fluid. J Clin Microbiol 41, 3133-41.
Lekanne Deprez, R.H., Fijnvandraat, A.C., Ruijter, J.M. and Moorman, A.F., 2002. Sensitivity and accuracy of quantitative real-time polymerase chain reaction using SYBR green I depends on cDNA synthesis conditions. Anal Biochem 307, 63-9.
Leung, A.Y., Chan, M., Tang, S.C., Liang, R. and Kwong, Y.L., 2002. Real-time quantitative analysis of polyoma BK viremia and viruria in renal allograft recipients. J Virol Methods 103, 51-6.
Levine, A.J., 1994. The origins of the small DNA tumor viruses. Adv Cancer Res 65, 141-68.
Liddington, R.C., Yan, Y., Moulai, J., Sahli, R., Benjamin, T.L. and Harrison, S.C., 1991. Structure of simian virus 40 at 3.8-A resolution. Nature 354, 278-84.
Limaye, A.P., Jerome, K.R., Kuhr, C.S., Ferrenberg, J., Huang, M.L., Davis, C.L., Corey, L. and Marsh, C.L., 2001. Quantitation of BK virus load in serum for the diagnosis of BK virus-associated nephropathy in renal transplant recipients. J Infect Dis 183, 1669-72.
Longo, M.C., Berninger, M.S. and Hartley, J.L., 1990. Use of uracil DNA glycosylase to control carry-over contamination in polymerase chain reactions. Gene 93, 125-8.
Lonnrot, M., Korpela, K., Knip, M., Ilonen, J., Simell, O., Korhonen, S., Savola, K., Muona, P., Simell, T., Koskela, P. and Hyoty, H., 2000. Enterovirus infection as a risk factor for beta-cell autoimmunity in a prospectively observed birth cohort: the Finnish Diabetes Prediction and Prevention Study. Diabetes 49, 1314-8.
Lopez-Rios, F., Illei, P.B., Rusch, V. and Ladanyi, M., 2004. Evidence against a role for SV40 infection in human mesotheliomas and high risk of false-positive PCR results owing to presence of SV40 sequences in common laboratory plasmids. Lancet 364, 1157-66.
Mackay, I.M., 2004. Real-time PCR in the microbiology laboratory. Clin Microbiol Infect 10, 190-212.
Mackay, I.M., Arden, K.E. and Nitsche, A., 2002. Real-time PCR in virology. Nucleic Acids Res 30, 1292-305.
58
Magnius, L.O., Saleh, L.H., Vikerfors, T. and Norder, H., 1988. A solid-phase reverse immunosorbent test for the detection of enterovirus IgM. J Virol Methods 20, 73-82.
Major, E.O., Amemiya, K., Tornatore, C.S., Houff, S.A. and Berger, J.R., 1992. Pathogenesis and molecular biology of progressive multifocal leukoencephalopathy, the JC virus-induced demyelinating disease of the human brain. Clin Microbiol Rev 5, 49-73.
Mallet, F., Oriol, G., Mary, C., Verrier, B. and Mandrand, B., 1995. Continuous RT-PCR using AMV-RT and Taq DNA polymerase: characterization and comparison to uncoupled procedures. Biotechniques 18, 678-87.
Mayall, F., Barratt, K. and Shanks, J., 2003. The detection of Simian virus 40 in mesotheliomas from New Zealand and England using real time FRET probe PCR protocols. J Clin Pathol 56, 728-30.
McNees, A.L., White, Z.S., Zanwar, P., Vilchez, R.A. and Butel, J.S., 2005. Specific and quantitative detection of human polyomaviruses BKV, JCV, and SV40 by real time PCR. J Clin Virol 34, 52-62.
Miller, J.R., Barrett, R.E., Britton, C.B., Tapper, M.L., Bahr, G.S., Bruno, P.J., Marquardt, M.D., Hays, A.P., McMurtry, J.G., 3rd, Weissman, J.B. and Bruno, M.S., 1982. Progressive multifocal leukoencephalopathy in a male homosexual with T-cell immune deficiency. N Engl J Med 307, 1436-8.
Milstone, A., Vilchez, R.A., Geiger, X., Fogo, A.B., Butel, J.S. and Dummer, S., 2004. Polyomavirus simian virus 40 infection associated with nephropathy in a lung-transplant recipient. Transplantation 77, 1019-24.
Mohamed, N., Elfaitouri, A., Fohlman, J., Friman, G. and Blomberg, J., 2004. A sensitive and quantitative single-tube real-time reverse transcriptase-PCR for detection of enteroviral RNA. J Clin Virol 30, 150-6.
Moya-Suri, V., Schlosser, M., Zimmermann, K., Rjasanowski, I., Gurtler, L. and Mentel, R., 2005. Enterovirus RNA sequences in sera of schoolchildren in the general population and their association with type 1-diabetes-associated autoantibodies. J Med Microbiol 54, 879-83.
Muir, P., Kammerer, U., Korn, K., Mulders, M.N., Poyry, T., Weissbrich, B., Kandolf, R., Cleator, G.M. and van Loon, A.M., 1998. Molecular typing of enteroviruses: current status and future requirements. The European Union Concerted Action on Virus Meningitis and Encephalitis. Clin Microbiol Rev 11, 202-27.
Mullis, K., Faloona, F., Scharf, S., Saiki, R., Horn, G. and Erlich, H., 1986. Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harb Symp Quant Biol 51 Pt 1, 263-73.
Mullis, K.B. and Faloona, F.A., 1987. Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol 155, 335-50.
Myers, T.W. and Gelfand, D.H., 1991. Reverse transcription and DNA amplification by a Thermus thermophilus DNA polymerase. Biochemistry 30, 7661-6.
Niesters, H.G., 2001. Quantitation of viral load using real-time amplification techniques. Methods 25, 419-29.
Niesters, H.G., 2002. Clinical virology in real time. J Clin Virol 25 Suppl 3, S3-12. Niesters, H.G., 2004. Molecular and diagnostic clinical virology in real time. Clin
Microbiol Infect 10, 5-11.
59
Nijhuis, M., van Maarseveen, N., Schuurman, R., Verkuijlen, S., de Vos, M., Hendriksen, K. and van Loon, A.M., 2002. Rapid and sensitive routine detection of all members of the genus enterovirus in different clinical specimens by real-time PCR. J Clin Microbiol 40, 3666-70.
Norder, H., Bjerregaard, L., Magnius, L., Lina, B., Aymard, M. and Chomel, J.J., 2003. Sequencing of 'untypable' enteroviruses reveals two new types, EV-77 and EV-78, within human enterovirus type B and substitutions in the BC loop of the VP1 protein for known types. J Gen Virol 84, 827-36.
Oberste, M., Schnurr, D., Maher, K., al-Busaidy, S. and Pallansch, M., 2001. Molecular identification of new picornaviruses and characterization of a proposed enterovirus 73 serotype. J Gen Virol 82, 409-16.
Oberste, M.S., Maher, K., Michele, S.M., Belliot, G., Uddin, M. and Pallansch, M.A., 2005. Enteroviruses 76, 89, 90 and 91 represent a novel group within the species Human enterovirus A. J Gen Virol 86, 445-51.
Oberste, M.S., Michele, S.M., Maher, K., Schnurr, D., Cisterna, D., Junttila, N., Uddin, M., Chomel, J.J., Lau, C.S., Ridha, W., al-Busaidy, S., Norder, H., Magnius, L.O. and Pallansch, M.A., 2004. Molecular identification and characterization of two proposed new enterovirus serotypes, EV74 and EV75. J Gen Virol 85, 3205-12.
Padgett, B.L., Walker, D.L., ZuRhein, G.M., Eckroade, R.J. and Dessel, B.H., 1971. Cultivation of papova-like virus from human brain with progressive multifocal leucoencephalopathy. Lancet 1, 1257-60.
Pal, A., Sirota, L., Maudru, T., Peden, K. and Lewis, A.M., Jr., 2006. Real-time, quantitative PCR assays for the detection of virus-specific DNA in samples with mixed populations of polyomaviruses. J Virol Methods.
Powell, L.M., Wallis, S.C., Pease, R.J., Edwards, Y.H., Knott, T.J. and Scott, J., 1987. A novel form of tissue-specific RNA processing produces apolipoprotein-B48 in intestine. Cell 50, 831-40.
Rayment, I., Baker, T.S., Caspar, D.L. and Murakami, W.T., 1982. Polyoma virus capsid structure at 22.5 A resolution. Nature 295, 110-5.
Ritzler, M., Perschil, I. and Altwegg, M., 1999. Influence of residual uracil-DNA glycosylase activity on the electrophoretic migration of dUTP-containing PCR products. J Microbiol Methods 35, 73-6.
Roivainen, M., Rasilainen, S., Ylipaasto, P., Nissinen, R., Ustinov, J., Bouwens, L., Eizirik, D.L., Hovi, T. and Otonkoski, T., 2000. Mechanisms of coxsackievirus-induced damage to human pancreatic beta-cells. J Clin Endocrinol Metab 85, 432-40.
Rossen, L., Norskov, P., Holmstrom, K. and Rasmussen, O.F., 1992. Inhibition of PCR by components of food samples, microbial diagnostic assays and DNA-extraction solutions. Int J Food Microbiol 17, 37-45.
Rotbart, H.A., 1990. Enzymatic RNA amplification of the enteroviruses. J Clin Microbiol 28, 438-42.
Saiki, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R., Horn, G.T., Mullis, K.B. and Erlich, H.A., 1988. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239, 487-91.
Saiki, R.K., Scharf, S., Faloona, F., Mullis, K.B., Horn, G.T., Erlich, H.A. and Arnheim, N., 1985. Enzymatic amplification of beta-globin genomic
60
sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230, 1350-4.
Samuelson, A., Forsgren, M., Johansson, B., Wahren, B. and Sallberg, M., 1994. Molecular basis for serological cross-reactivity between enteroviruses. Clin Diagn Lab Immunol 1, 336-41.
See, D.M. and Tilles, J.G., 1995. Pathogenesis of virus-induced diabetes in mice. J Infect Dis 171, 1131-8.
Sever, J.L., South, M.A. and Shaver, K.A., 1985. Delayed manifestations of congenital rubella. Rev Infect Dis 7 Suppl 1, S164-9.
Shah, K. and Nathanson, N., 1976. Human exposure to SV40: review and comment. Am J Epidemiol 103, 1-12.
Shen, S., Desselberger, U. and McKee, T.A., 1997. The development of an antigen capture polymerase chain reaction assay to detect and type human enteroviruses. J Virol Methods 65, 139-44.
Shimada, A., Morimoto, J., Kodama, K., Suzuki, R., Oikawa, Y., Funae, O., Kasuga, A., Saruta, T. and Narumi, S., 2001. Elevated serum IP-10 levels observed in type 1 diabetes. Diabetes Care 24, 510-5.
Shimomaye, E. and Salvato, M., 1989. Use of avian myeloblastosis virus reverse transcriptase at high temperature for sequence analysis of highly structured RNA. Gene Anal Tech 6, 25-8.
Stewart, S.E., Eddy, B.E. and Borgese, N., 1958. Neoplasms in mice inoculated with a tumor agent carried in tissue culture. J Natl Cancer Inst 20, 1223-43.
Sweet, B.H. and Hilleman, M.R., 1960. The vacuolating virus, S.V. 40. Proc Soc Exp Biol Med 105, 420-7.
Szopa, T.M., Titchener, P.A., Portwood, N.D. and Taylor, K.W., 1993. Diabetes mellitus due to viruses--some recent developments. Diabetologia 36, 687-95.
Tauriainen, S., Salminen, K. and Hyoty, H., 2003. Can enteroviruses cause type 1 diabetes? Ann N Y Acad Sci 1005, 13-22.
Temin, H.M. and Mizutani, S., 1970. RNA-dependent DNA polymerase in virions of Rous sarcoma virus. Nature 226, 1211-3.
Thornton, C.G., Hartley, J.L. and Rashtchian, A., 1992. Utilizing uracil DNA glycosylase to control carryover contamination in PCR: characterization of residual UDG activity following thermal cycling. Biotechniques 13, 180-4.
Tognon, M., Martini, F., Corallini, A. and Barbanti-Brodano, G., 2004. SV40 and human cancers. Int J Cancer 110, 778-9; author reply 780.
Vandewalle, C.L., Falorni, A., Svanholm, S., Lernmark, A., Pipeleers, D.G. and Gorus, F.K., 1995. High diagnostic sensitivity of glutamate decarboxylase autoantibodies in insulin-dependent diabetes mellitus with clinical onset between age 20 and 40 years. The Belgian Diabetes Registry. J Clin Endocrinol Metab 80, 846-51.
Wang, R.F., Cao, W.W. and Johnson, M.G., 1992. A simplified, single tube, single buffer system for RNA-PCR. Biotechniques 12, 702, 704.
Vats, A., Shapiro, R., Singh Randhawa, P., Scantlebury, V., Tuzuner, A., Saxena, M., Moritz, M.L., Beattie, T.J., Gonwa, T., Green, M.D. and Ellis, D., 2003. Quantitative viral load monitoring and cidofovir therapy for the
61
management of BK virus-associated nephropathy in children and adults. Transplantation 75, 105-12.
Verstrepen, W.A., Kuhn, S., Kockx, M.M., Van De Vyvere, M.E. and Mertens, A.H., 2001. Rapid detection of enterovirus RNA in cerebrospinal fluid specimens with a novel single-tube real-time reverse transcription-PCR assay. J Clin Microbiol 39, 4093-6.
Whiley, D.M., Mackay, I.M. and Sloots, T.P., 2001. Detection and differentiation of human polyomaviruses JC and BK by LightCycler PCR. J Clin Microbiol 39, 4357-61.
Wilson, I.G., 1997. Inhibition and facilitation of nucleic acid amplification. Appl Environ Microbiol 63, 3741-51.
Wittwer, C.T., Ririe, K.M., Andrew, R.V., David, D.A., Gundry, R.A. and Balis, U.J., 1997. The LightCycler: a microvolume multisample fluorimeter with rapid temperature control. Biotechniques 22, 176-81.
Yiannoutsos, C.T., Major, E.O., Curfman, B., Jensen, P.N., Gravell, M., Hou, J., Clifford, D.B. and Hall, C.D., 1999. Relation of JC virus DNA in the cerebrospinal fluid to survival in acquired immunodeficiency syndrome patients with biopsy-proven progressive multifocal leukoencephalopathy. Ann Neurol 45, 816-21.
Yin, H., Berg, A.K., Tuvemo, T. and Frisk, G., 2002. Enterovirus RNA is found in peripheral blood mononuclear cells in a majority of type 1 diabetic children at onset. Diabetes 51, 1964-71.
Yoon, J.W., Austin, M., Onodera, T. and Notkins, A.L., 1979. Isolation of a virus from the pancreas of a child with diabetic ketoacidosis. N Engl J Med 300, 1173-9.
Young, K.K., Resnick, R.M. and Myers, T.W., 1993. Detection of hepatitis C virus RNA by a combined reverse transcription-polymerase chain reaction assay. J Clin Microbiol 31, 882-6.
Zhang, Y.J., Pan, H.Y. and Gao, S.J., 2001. Reverse transcription slippage over the mRNA secondary structure of the LIP1 gene. Biotechniques 31, 1286-90.
Acta Universitatis UpsaliensisDigital Comprehensive Summaries of Uppsala Dissertationsfrom the Faculty of Medicine 202
Editor: The Dean of the Faculty of Medicine
A doctoral dissertation from the Faculty of Medicine, UppsalaUniversity, is usually a summary of a number of papers. A fewcopies of the complete dissertation are kept at major Swedishresearch libraries, while the summary alone is distributedinternationally through the series Digital ComprehensiveSummaries of Uppsala Dissertations from the Faculty ofMedicine. (Prior to January, 2005, the series was publishedunder the title “Comprehensive Summaries of UppsalaDissertations from the Faculty of Medicine”.)
Distribution: publications.uu.seurn:nbn:se:uu:diva-7320
ACTAUNIVERSITATISUPSALIENSISUPPSALA2006