development of novel vaccines for the concurrent...

1

Development of Novel Vaccines for the Concurrent Immunisation against Multiple

Dengue Virus Serotypes

A thesis submitted for the degree of Doctor of Philosophy

by

Steven Christopher Liew

B. App. Sci. (Hons)

2006

School of Life Sciences Queensland University of Technology

Australia.

3

KEYWORDS

Dengue virus; dengue vaccine; DNA vaccine; tetravalent vaccine; E protein;

recombinant subviral particles; signal peptide; signal peptidases; CpG motifs; hybrid

E proteins.

4

ABSTRACT

A major obstacle to the development of dengue virus (DENV) vaccines has been the

need to immunise concurrently against each of the four DENV serotypes in order to

avoid sensitising recipients to developing severe DENV infections. A problem

already encountered with live attenuated tetravalent DENV vaccines has been the

difficulty in eliciting adequate immune responses against all four DENV serotypes in

human hosts. This could have been due to variations in the antigenicity and/or the

replication rates of the four DENV serotypes. Non-replicating DNA vaccines avoid

the issue of different replication rates. Currently, only DENV-1 and DENV-2 DNA

vaccines have been evaluated.

In this study, a number of DNA vaccines for each of the four DENV serotypes were

developed and their immunogenicity was evaluated in outbred mice. These vaccines

included DNA vaccines encoding the DENV prM-E protein genes derived from the

four DENV serotypes (pVAX-DEN1, -DEN2, -DEN3 and -DEN4), and DNA

vaccines encoding DENV prM and hybrid-E protein genes derived from multiple

DENV serotypes. The hybrid-E protein genes were constructed by substituting either

domains I and II, domain III, and/or the stem-anchor region from the E protein of

one DENV serotype with the corresponding region from another DENV serotype.

A number of superior DNA vaccines against each of the four DENV serotypes were

identified based on their ability to elicit high titres (≥40, FFURNT50) of neutralising

antibodies against the corresponding DENV in mice. The superior DNA vaccines

against DENV-1 were pVAX-DEN1, pVAX-C2M2E211, pVAX-C2M2E122 and

pVAX-C2M1E122. The superior DNA vaccine against DENV-2 was pVAX-

C2M1E122 and the superior DNA vaccines against DENV-3 were pVAX-DEN3 and

pVAX-C2M3E344. The superior DNA vaccines against DENV-4 were pVAX-

C2M3E344, pVAX-C2M4E434 and pVAX-C2M4E433. Each of these DNA

vaccines could provide effective protection against infection by the corresponding

DENV serotypes. This is the first study to describe the development of DNA

vaccines against DENV-3 and DENV-4.

5

However, mice immunised with a tetravalent DENV DNA vaccine, composed of a

DNA vaccine encoding the prM-E protein genes from each of the four DENV

serotypes (pVAX-DEN1-4), elicited high titres of neutralising antibodies against

DENV-1 and DENV-3 only. Nevertheless, the results from this study suggested that

a tetravalent DENV DNA vaccine, composed of pVAX-DEN1, pVAX-C2M1E122,

pVAX-DEN3 and pVAX-C2M4E434, may provide effective concurrent protection

against infection by each of the four DENV serotypes.

In addition, mice immunised with pVAX-C2M1E122, which encoded a hybrid-E

protein gene derived from DENV-1 and DENV-2, elicited high titres of anti-DENV-

1 and anti-DENV-2 neutralising antibodies, and mice immunised with pVAX-

C2M3E344, which encoded a hybrid-E protein gene derived from DENV-3 and

DENV-4, elicited high titres of anti-DENV-3 and anti-DENV-4 neutralising

antibodies. This result suggested that the co-immunisation of these two hybrid-E

DNA vaccines also may provide effective concurrent protection against infection by

each of the four DENV serotypes.

Extracellular E proteins, believed to be in the form of recombinant subviral particles

(RSPs), were recovered from the tissue culture supernatant of all DNA vaccine-

transfected mammalian cells by ultracentrifugation, except for cells transfected with

the pVAX-C2M2E122 hybrid-E DNA vaccine. Western blotting with the

monoclonal antibody 4G2 (flavivirus cross-reactive) demonstrated that the

extracellular E proteins expressed by the DNA vaccines were synthesized and

cleaved in a manner similar to that of native DENV E proteins.

In addition, mammalian cells transfected with pVAX-DEN1, pVAX-DEN2 or

pVAX-DEN3 secreted higher amounts of extracellular E proteins than cells

transfected with pVAX-DEN4. The amount of extracellular E protein secreted by

pVAX-DEN4-transfected cells increased when the c-region of the prM/E signal

peptidase cleavage site was made more polar. In contrast, decreasing the polarity of

the c-region of the C/prM signal peptidase cleavage site of pVAX-DEN4 resulted in

no detectable extracellular E proteins from pVAX-DEN4-transfected cells. This

result suggested that the amount of extracellular E proteins secreted by cells

transfected with DNA expressing the DENV prM-E protein genes may be dependent

6

of the efficiency of C/prM and prM/E protein cleavages by host-derived signal

peptidases. Mice immunised with the mutated pVAX-DEN4, which was capable of

expressing large amounts of extracellular E proteins in vitro, produced significantly

higher concentrations of Th1-type anti-DENV-4 antibodies than mice immunised

with the unmodified pVAX-DEN4, but failed to produce detectable levels of anti-

DENV-4 neutralising antibodies.

In contrast, increasing the ratio of CpG-S to CpG-N motifs in the pVAX-DEN2

DNA vaccine by incorporating either an additional CpG-S motif, or an antibiotic

resistance gene with a high ratio of CpG-S to CpG-N motifs, resulted in a significant

increase in both the concentration of Th1-type anti-DENV-2 antibodies and the titres

of anti-DENV-2 neutralising antibodies in immunised mice. This result suggested

that increasing the amount of CpG-S motifs in DENV DNA vaccines may present an

simple and effective approach to increasing the immunogenicity of the DENV DNA

vaccines.

7

TABLE OF CONTENTS

ABSTRACT 4

TABLE OF CONTENTS 7

LIST OF FIGURES 13

LIST OF TABLES 16

LIST OF SYMBOLS AND ABBREVIATIONS 18

STATEMENT OF ORIGINAL AUTHORSHIP 21

ACKNOWLEDGEMENTS 22

CHAPTER 1:

INTRODUCTION AND LITERATURE REVIEW 25

1.1 THE FLAVIVIRUSES

1.1.1 Flavivirus structure and genome organisation

1.1.2 Proteolytic processing of the viral polyprotein

1.1.2.1 Characteristics of signal peptidase cleavage and

regulation

27

27

27

29

1.2 PROPERTIES OF FLAVIVIRAL PROTEINS

1.2.1 Structural proteins

1.2.1.1 Capsid protein

1.2.1.2 Pre-membrane and membrane proteins

1.2.1.3 Envelope protein

Domain I

Domain II

Domain III

Stem-anchor region

1.2.2 Non-structural proteins

1.2.2.1 NS1 protein

1.2.2.2 NS3 protein

1.2.2.3 NS5 protein

1.2.2.4 NS2A, NS2B, NS4A and NS4B proteins

30

30

30

32

33

34

34

35

35

36

36

37

37

38

8

1.3 GENERAL FEATURES OF FLAVIVIRUS REPLICATION

1.3.1 Flavivirus entry, replication and release

1.3.2 Flavivirus subviral particles

38

38

39

1.4 CLINICAL FEATURES OF DENGUE FEVER AND DENGUE

HAEMORRHAGIC FEVER

1.4.1 Dengue fever

1.4.2 Dengue haemorrhagic fever and dengue shock syndrome

42

42

42

1.5 PATHOGENESIS OF DENGUE HAEMORRHAGIC FEVER

AND DENGUE SHOCK SYNDROME

1.5.1 Antibody-dependent enhancement theory

1.5.2 Virulent virus theory

1.5.3 T lymphocyte activation theory

43

43

44

45

1.6 DENGUE VACCINES

1.6.1 Replicating virus vaccines

1.6.1.1 Live attenuated dengue vaccines

Mahidol University live attenuated

tetravalent DENV vaccine

WRAIR live attenuated tetravalent DENV

vaccine

1.6.1.2 Infectious clone-derived vaccines

Live attenuated recombinant flaviviruses

Live chimeric flaviviruses

1.6.1.3 Vaccinia virus-derived vaccines

1.6.2 Non-replicating virus vaccines

1.6.2.1 Inactivated whole dengue virus vaccines

1.6.2.2 Recombinant peptide subunit dengue vaccines

Escherichia coli expression systems

Baculovirus expression systems

1.6.2.3 Recombinant subviral particle vaccines

46

47

47

48

50

52

52

57

61

63

63

64

64

64

65

9

1.6.2.4 DNA vaccines

CpG motifs

69

87

1.7 AIM OF THIS STUDY 90

CHAPTER 2:

MATERIALS AND METHODS 91

2.1 CELL LINES AND MONOCLONAL ANTIBODIES

2.2 DENGUE VIRUSES

2.3 INDIRECT IMMUNOFLUORESCENCE ASSAY

2.4 ANTIBODY CLASS AND SUBCLASS CAPTURE ELISA

2.5 FOCUS-FORMING ASSAY AND FOCUS-FORMING UNIT

REDUCTION NEUTRALISATION TEST (FFURNT)

2.6 POLYACRYLAMIDE GEL ELECTROPHORESIS AND

WESTERN BLOTTING

2.7 RNA EXTRACTION AND REVERSE TRANSCRIPTION-

POLYMERASE CHAIN REACTION (RT-PCR)

2.8 POLYMERASE CHAIN REACTION

2.9 AGAROSE GEL ELECTROPHORESIS AND

QUANTIFICATION OF NUCLEIC ACIDS

2.10 PURIFICATION AND CONCENTRATION OF NUCLEIC

ACIDS FROM AQUEOUS SOLUTIONS

2.11 DNA LIGATION

2.12 TRANSFORMATION OF COMPETENT ESCHERICHIA COLI

CELLS

2.13 PURIFICATION OF PLASMIDS

2.14 OVERLAPPING EXTENSION-POLYMERASE CHAIN

REACTION

2.15 SITE-DIRECTED MUTAGENESIS BY BACK-TO-BACK

PRIMER-POLYMERASE CHAIN REACTION

2.16 DNA SEQUENCING AND ANALYSIS

2.17 CONSTRUCTION OF pDEN1CME, pDEN3E AND pDEN4E

DENGUE REFERENCE DNA CLONES

91

91

93

94

95

97

98

99

99

105

105

105

106

107

109

109

110

10

2.18 TRANSFECTION OF MAMMALIAN CELLS WITH DNA

PLASMIDS

2.19 PURIFICATION OF DENGUE EXTRACELLULAR E

PROTEINS

2.20 TRANSCRIPTION OF GENOMIC-LENGTH DENGUE VIRAL

RNA FROM DNA TEMPLATES

2.21 PRODUCTION OF LIVE RECOMBINANT DENGUE

VIRUSES

2.22 DNA VACCINE FORMULATION AND IMMUNISATION OF

MICE

111

111

111

112

113

CHAPTER 3:

DEVELOPMENT OF A TETRAVALENT DENGUE DNA VACCINE 114

3.1 INTRODUCTION

3.2 RESULTS

3.2.1 Construction and antigenic properties of pVAX-DEN DNA

vaccines

3.2.2 Secretion of DENV extracellular E proteins by pVAX-

DEN transfected mammalian cells

3.2.3 Serological responses of outbred mice to immunisation

with monovalent or tetravalent pVAX-DEN DNA vaccines

3.3 DISCUSSION

114

114

114

118

124

131

CHAPTER 4:

INCREASING THE SECRETION OF RECOMBINANT SUBVIRAL

PARTICLES BY MAMMALIAN CELLS TRANSFECTED WITH THE

DENV-4 DNA VACCINE 135

4.1 INTRODUCTION

4.2 RESULTS

135

135

4.2.1 Construction and antigenic properties of pVAX-D4mutC-

D1, pVAX-D4mutM-D1 and pVAX-D4mutE-D1 DNA

plasmids

135

11

4.2.2 Analysis of the structural motifs and the signal peptidase

cleavage sites of pVAX-D4mutC-D1, pVAX-D4mutE-D1

and pVAX-DEN4

4.2.3 Secretion of DENV extracellular E proteins by pVAX-

D4mutC-D1, pVAX-D4mutM-D1 and pVAX-D4mutE-D1

transfected BHK-21 cells


with pVAX-DEN4 or pVAX-D4mutE-D1 DNA vaccines

4.3 DISCUSSION

137

141

144

146

CHAPTER 5:

EFFECTS OF CpG MOTIFS ON THE IMMUNOGENICITY OF THE

DENV-2 DNA VACCINE IN OUTBRED MICE 149

5.1 INTRODUCTION

5.2 RESULTS

5.2.1 Analysis of CpG motifs in pVAX-DEN DNA vaccines and

antibiotic resistance genes

5.2.2 Construction and antigenic properties of pVAX-D2-CPG,

pDNA-DEN2 and pDNA-D2-AMP DNA vaccines

5.2.3 Secretion of DENV extracellular E proteins by pVAX-D2-

CPG, pDNA-DEN2 and pDNA-D2-AMP transfected

BHK-21 cells


with pVAX-DEN2, pVAX-D2-CPG, pDNA-DEN2 or

pDNA-D2-AMP DNA vaccines

5.3 DISCUSSION

149

149

149

151

153

156

159

CHAPTER 6:

DEVELOPMENT OF DENGUE HYBRID-E PROTEIN DNA

VACCINES 162

6.1 INTRODUCTION

6.2 RESULTS

6.2.1 Construction of intertypic DENV hybrid-E protein genes

162

162

162

12

6.2.2 Construction and antigenic properties of pVAX-Hybrid-E

DNA vaccines

6.2.3 Secretion of DENV extracellular hybrid-E proteins by

pVAX-Hybrid-E transfected BHK-21 cells


with pVAX-DEN or pVAX-Hybrid-E DNA vaccines

6.2.5 Development of live recombinant DENV incorporating

Hybrid-E proteins

6.3 DISCUSSION

167

170

170

176

179

CHAPTER 7:

GENERAL DISCUSSION

CONCLUSION

APPENDIX A:

BUFFERS AND REAGENTS

APPENDIX B:

DEDUCED DNA SEQUENCES OF pVAX-DEN AND pVAX-

HYBRID-E DNA VACCINES (EXCLUDING VECTOR

SEQUENCE)

APPENDIX C:

DEDUCED PROTEIN SEQUENCES OF pVAX-DEN AND pVAX-

HYBRID-E DNA VACCINES (EXCLUDING VECTOR

SEQUENCES)

REFERENCES

184

198

200

204

213

216

13

LIST OF FIGURES

Fig. 1.01 Schematic representation of the proteolytic processing of the

flavivirus polyprotein 28

Fig. 2.01 Schematic representation of the (A) Overlapping Extension-

Polymerase Chain Reaction (OE-PCR) and (B) Back-to-Back

Primer-Polymerase Chain Reaction (BB-PCR) 108

Fig. 3.01 Schematic representation of the location of the primers used to

construct the DENV C-terminal C-prM-E protein genes 116

Fig. 3.02 Genetic map of the recombinant pVAX-DEN1, -DEN2, -

DEN3 and -DEN4 DNA vaccines 117

Fig. 3.03 Indirect immunofluorescence assays of BHK-21 cells

transfected with (A) pVAX-DEN1, (B) pVAX-DEN2, (C)

pVAX-DEN3, (D) pVAX-DEN4 and (E) pVAX1 using Mab

4G2 as the primary antibody 24 hours following transfection 120

Fig. 3.04 Indirect ELISA on the western blot of lysates of pVAX-DEN1

(lane 1), pVAX-DEN2 (lane 3), pVAX-DEN3 (lane 5),

pVAX-DEN4 (lane 7) and pVAX1 (lane 9) transfected BHK-

21 cells 24 hours following transfection and of DENV-1 (lane

2), DENV-2 (lane 4), DENV-3 (lane 6) and DENV-4 (lane 8)

infected BHK-21 cells, using MAb 4G2 as the primary

antibody 121

Fig. 3.05 Analysis of DENV extracellular E proteins recovered from the

t.c.s. of BHK-21 cells transfected with pVAX-DEN DNA

vaccines 48 hours following transfection

122


t.c.s. of L929 mouse cells transfected with pVAX-DEN DNA

vaccines 48 hours following transfection 123

Fig. 3.07 Anti-DENV-1 antibody responses in mice immunised with

pVAX-DEN1 or pVAX-Tetra DNA vaccines

126


pVAX-DEN2 or pVAX-Tetra DNA vaccines 127

14



128



130

Fig. 4.01 Schematic representation of the location of the primers used to

construct pVAX-D4mutC-D1, pVAX-D4mutM-D1 and

pVAX-D4mutE-D1 DNA plasmids

136

Fig. 4.02 Analysis of the n-, h- and c-regions of the signal peptides at

the C/prM cleavage sites of (A) pVAX-DEN4 and (B) pVAX-

D4mutC-D1 (predicted by the SignalP program)

139

Fig. 4.03 Characteristics of the amino acid residues present in the (A)

C/prM cleavage regions of pVAX-DEN4 and pVAX-

D4mutC-D1, (B) prM/M cleavage regions of pVAX-DEN4

and pVAX-D4mutM-D1 and (C) prM/E cleavage regions of

pVAX-DEN4 and pVAX-D4mutE-D1

140

Fig. 4.04 Analysis of the n-, h- and c-regions of the signal peptides at

the prM/E cleavage sites of (A) pVAX-DEN4 and (B) pVAX-

D4mutE-D1 (predicted by the SignalP program)

142


t.c.s. of BHK-21 cells transfected with each of the pVAX-

DEN, pVAX-D4mutC-D1, pVAX-D4mutM-D1 and pVAX-

D4mutE-D1 DNA plasmids 48 hours following transfection

143

Fig. 4.06 Comparison of anti-DENV-4 antibody responses in mice

immunised with pVAX-DEN4 or pVAX-D4mutE-D1 DNA

vaccines

145

Fig. 5.01 Genetic maps of (A) pVAX-D2-CPG, (B) pDNA-DEN2 and

(C) pDNA-D2-AMP

152


t.c.s. of BHK-21 cells transfected with pVAX-DEN2, pVAX-

D2-CPG, pDNA-D2-AMP and pDNA-DEN2 DNA vaccines

48 hours following transfection

155

15

Fig. 5.03 Concentrations of (A) anti-DENV-2 IgG2a, (B) anti-DENV-2

IgG2b and (C) anti-DENV-2 IgG3 antibodies in pooled sera

of mice (n = 4) immunised with pVAX-DEN2, pDNA-D2-

AMP, pVAX-D2-CPG or pDNA-DEN2 DNA vaccines 157

Fig. 5.04 Titres of neutralising antibodies against DENV-2 in pooled

sera of mice (n = 4) immunised with pVAX-DEN2, pVAX-

D2-CPG, pDNA-DEN2 or pDNA-D2-AMP represented as the

highest serum dilution to yield a 50% reduction in 50 focus-

forming units (FFURNT50) 158

Fig. 6.01 Schematic representation of the location of the DENV

genome substitutions and the nomenclature for the Hybrid-E

genes 163

Fig. 6.02 Schematic representation of the primer locations and OE-PCR

amplification strategies used for the construction of (A)

C2M1E122, (B) C2M2E122, (C) C2M2E211, (D)

C2M2E212, (E) C2M3E344, (F) C2M4E433, (G) C2M4E434

and (H) C2M2E322 hybrid-E protein genes 164

Fig. 6.03 Genetic map of the recombinant pVAX-Hybrid-E DNA

vaccines 168


t.c.s. of BHK-21 cells transfected with pVAX-DEN and

pVAX-Hybrid-E DNA vaccines at 48 hours following

transfection 171

16

LIST OF TABLES

TABLE 1.01 Properties of flavivirus recombinant subviral particles

(RSPs) and native virions (Source: Schalich et al., 1996)

41

TABLE 1.02 Summary of the studies conducted using DENV

infectious cDNA clones

53

TABLE 1.03 Summary of studies using flavivirus recombinant

subviral particle vaccines

66

TABLE 1.04 Summary of studies using flavivirus DNA vaccines 71

TABLE 2.01 Summary of the monoclonal antibodies used in this

study

92

TABLE 2.02 Summary of the primers used in this study 100

TABLE 2.03 PCR amplification conditions used in this study 104

TABLE 3.01 Indirect immunofluorescence assays of BHK-21 cells

transfected with pVAX-DEN1-4 DNA vaccines

119


transfected for 24 hours with pVAX-DEN1-4, pVAX-

D4mutC-D1, pVAX-D4mutM-D1 and pVAX-D4mutE-

D1 DNA plasmids

138

TABLE 5.01 Frequency of CpG motifs in (A) pVAX-DEN, (B)

pVAX-Hybrid-E, (C) pVAX-D2-CPG, pDNA-D2-AMP

and pDNA-DEN2 DNA vaccines, and (D) antibiotic

resistance genes

150


transfected for 24 hours with pVAX-DEN1-4, pVAX-

D2-CPG, pDNA-DEN2 and pDNA-D2-AMP DNA

vaccines

154


transfected for 24 hours with pVAX-DEN1-4 and

pVAX-Hybrid-E DNA vaccines

169

17

TABLE 6.02 Serological responses to DENV-1 in mice after

immunisation with two doses (weeks 0 and 4) of

monovalent pVAX-DEN or pVAX-Hybrid-E DNA

vaccines 172




vaccines 174




vaccines 175




vaccines 177

TABLE 6.06 Summary of epitope location for DENV neutralising

monoclonal antibodies deduced from indirect

immunofluorescence assays using pVAX-Hybrid-E

DNA transfected BHK-21 cells 180

18

LIST OF SYMBOLS AND ABBREVIATIONS

Å angstrom 0C degree Celsius

Ab antibody

Abs. absorbance

ADE antibody-dependent enhancement

AGRF Australian Genome Research Facility

AMI Australian Army Malarial Institute

AMV avian myeloblastosis virus

ANGIS Australian National Genomic Information Service

APC antigen presenting cells

AvP Aventis Pasteur

BGH bovine growth hormone

BHK baby hamster kidney (cells)

bp base pairs (nucleotides)

BSA bovine serum albumin

C Capsid (protein)

CDC Center for Disease Control and Prevention

CMV cytomegalovirus

CPE cytopathic effect

CpG cytosine linked to a guanine by a phosphodiester backbone

CpG-S immuno-stimulatory CpG

CpG-N immuno-neutralising CpG

CTL cytotoxic T lymphocyte

DENV dengue virus

DENV-1 dengue virus serotype 1




DHF dengue haemorrhagic fever

DSS dengue shock syndrome

DTT dithiothreithol

19

E envelope (protein)

E.coli Escherichia coli

EDTA ethylene diamine tetraacetic acid

ELISA enzyme-labelled immunosorbent assay

EtBr ethidium bromide

FCS foetal calf serum

FDA Food and Drug Administration

FITC fluoroscein isothiocyanate

FRhL foetal rhesus lung (cells)

GM-CSF granulocyte-monocyte colony stimulating factor

HAI hemmaglutination-inhibiting antibody

hCF human cytotoxic factor

HRP horseradish peroxidase

IFA immunofluorescence assay

IFN interferon

Ig immunoglobulin

IL interleukin

i.m. intramuscular

JEV Japanese encephalitis virus

LAMP lysosome-associated membrane protein

LD lethal dose

M membrane (protein)

MAb monoclonal antibody

MCS multiple cloning site

MHC major histocompatibility complex

MVEV Murray Valley encephalitis virus

NCBI National Center for Biotechnology Information

NT neutralising

NHMRC National Health and Medical Research Council

NS non-structural (protein)

ODN oligodeoxynucleotide

OE-PCR overlapping extension-polymerase chain extension

ORF open reading frame

PAGE polyacrylamide gel electrophoresis

20

PBMC peripheral blood mononuclear cells

PBS phosphate buffered saline

PCR polymerase chain reaction

PDK primary dog kidney (cells)

PEG polyethylene glycol

prM pre-membrane (protein)

PSG penicillin/streptomycin/glutamine solution

RSPs recombinant subviral particles

RT-PCR reverse transcriptase-polymerase chain reaction

SCF soluble complement fixing

SDS sodium dodecyl sulphate

SHA sedimenting hemagglutinin

s.m.b. suckling mouse brain

TAE Tris-acetate/EDTA

TBEV Tick-borne encephalitis virus

TBS Tris-buffered saline

t.c.s. tissue culture supernatant

TGN trans-Golgi network

TM transmembrane

TMB Tetramethylbenzidine

TPA tissue plasminogen activator

U units

UTR untranslated region

v/v volume per volume

WHO World Health Organisation

WNV West Nile virus

WRAIR Walter Reed Army Institute of Research

w/v weight per volume

w/w weight per weight

YARU Yale Arbovirus Research Unit

YFV Yellow fever virus

21

STATEMENT OF ORIGINAL AUTHORSHIP

The work contained in this thesis has not been previously submitted for a degree or

diploma at any other higher education institution. To the best of my knowledge and

belief, the thesis contains no material previously published or written by another

person except where due reference is made.

Steven C. Liew Date

22

ACKNOWLEDGEMENTS

I would like to thank my principal supervisor, Dr. John Aaskov, and my associate

supervisor, Dr. Terry Walsh, for their guidance and support throughout my PhD.

I also would like to thank all the present and past members of the Arbovirology

group at QUT for their support, specially Kym Lowry, Chris Howard, Deema Al-

Sheikhly, Scott Craig, Katie Buzacott, David Rutherford, Michael and Mark Reid. It

was a pleasure and privilege to work with all of you.

I also would like to thank everyone associated with the CMB/CRC laboratories and

all the staff at the School of Life Sciences office. In addition, I would like to thank

the Australian Army Malarial Institute and its staff for providing the facilities to

conduct the animal experimentations for this project.

Finally, I would like to thank my family for their unconditional support throughout

my studies at QUT.

24

DO NOT PRINT (Extra references for endnote):

Form introduction → (Aberle et al., 1999; Allison et al., 2001; Allison et al., 1999; Ashok and Rangarajan, 1999; Ashok and Rangarajan, 2000; Ashok and Rangarajan,

2002; Blaney et al., 2003; Bray and Lai, 1991; Bray et al., 1998; Brinkworth et al., 1999; Butrapet et al., 2000; Cahour et al., 1995; Chambers et al., 1990a; Chambers et

al., 1990b; Chang, 1997; Chang et al., 2000; Chang et al., 2003; Chen et al., 2001a; Chen et al., 1999; Colombage et al., 1998; Davis et al., 2001; Dokland et al., 2004;

Falgout et al., 1989; Gualano et al., 1998; Gubler, 1998; Hall et al., 2003; Heinz and Allison, 2000; Heinz et al., 1995; Hiramatsu et al., 1996; Jones et al., 2003; Kanesa-

thasan et al., 2001; Kaur et al., 2002; Khromykh et al., 2001a; Khromykh et al., 2001b; Kimura and Hotta, 1944; Kinney et al., 1997; Kochel et al., 1997; Kochel et al.,

2000; Konishi and Fujii, 2002; Konishi et al., 2001; Konishi et al., 1992; Konishi et al., 2003; Konishi et al., 1997b; Konishi et al., 1998b; Konishi et al., 1999; Konishi

et al., 2000a; Konishi et al., 2000b; Koonin, 1993; Li et al., 1999a; Lin et al., 1998; Ma et al., 2004; Markoff et al., 1997; Markoff et al., 2002; Matusan et al., 2001a;

Matusan et al., 2001b; Men et al., 1996; Ocazionez Jimenez and Lopes da Fonseca, 2000; Pan et al., 2001; Phillpotts et al., 1996; Porter et al., 1998; Pryor et al., 2001;

Pryor et al., 1998; Putnak et al., 2003; Raviprakash et al., 2000a; Raviprakash et al., 2001; Raviprakash et al., 2000b; Rey et al., 1995; Ryan et al., 1998; Sabin, 1952;

Sabin and Schlesinger, 1945; Schalich et al., 1996; Schmaljohn et al., 1999; Schmaljohn et al., 1997; Tan et al., 1996; Troyer et al., 2001; Zeng et al., 1998; Zhao et al.,

2003)

From methods → (Beasley and Aaskov, 2001; Falconar, 1999; Fiedler and Wirth, 1988; Gentry et al., 1982; Gualano et al., 1998; Gupta and Siber, 1995; Hanahan, 1983;

Igarashi, 1978; Ishimine et al., 1987; Jianmin et al., 1995; Kaufman et al., 1989; Laemmli, 1970; Lanciotti et al., 1997; Lanciotti et al., 1994; Lewis et al., 1992; Morens

et al., 1985; Pletnev et al., 2001; Pletnev et al., 2002; Sambrook and Russell, 2001; Serafin and Aaskov, 2001; Towbin et al., 1979; Trirawatanapong et al., 1992)

From results (intro) → (Aaskov, 2001; Aberle et al., 1999; Anonymous, 1996; Anonymous, 1997a; Bhamarapravati and Sutee, 2000; Bhamarapravati and Yoksan, 1997;

Bielefeldt-Ohmann et al., 1997; Bray et al., 1996; Burke et al., 1988; Chambers et al., 1997; Chang et al., 2003; Cichutek, 2000; Davis et al., 2001; Delenda et al., 1994a;

Donnelly et al., 1998; Elshuber et al., 2003; Gualano et al., 1998; Guirakhoo et al., 2001; Guirakhoo et al., 2002; Guirakhoo et al., 2000; Halstead, 1988; Halstead et al.,

1970; Halstead and O'Rourke, 1977b; Huang et al., 2000; Kanesa-thasan et al., 2001; Kelly et al., 2000; Kinney and Huang, 2001; Konishi et al., 1999; Konishi et al.,

2000a; Konishi et al., 2000b; Ledwith et al., 2000; Manickan et al., 1997; Putnak et al., 1996a; Putnak et al., 1996b; Rothman et al., 2001; Schultz et al., 2000; Serafin

and Aaskov, 2001; Simmons et al., 2001a; Sin and Weiner, 2000; Staropoli et al., 1996; Staropoli et al., 1997; Sugrue et al., 1997; Ulmer et al., 1995; Ulmer et al., 1996;

Vaughn et al., 2000; Velzing et al., 1999; Zhang et al., 1988).

From discussion → (Dimmock, 1993)

25

CHAPTER 1:

INTRODUCTION AND LITERATURE REVIEW

Dengue viruses (DENV) belong to the genus flavivirus, within the family

Flaviviridae. The flavivirus genus is comprised of over 70 serologically related

enveloped viruses with more than half of these being the causative agents for a

number of human diseases (Kuno et al., 1998; Westaway and Blok, 1997). Among

the most important flavivirus pathogens of humans, in terms of disease incidence, are

yellow fever virus (YFV) in the tropical and sub-tropical regions of South America

and Africa, Japanese encephalitis virus (JEV) in southeast Asia, tick-borne

encephalitis virus (TBEV) in Europe and northern Asia and DENV in most tropical

and sub-tropical regions of the world (Gubler, 1998; Monath, 1994). The majority of

flaviviruses are arboviruses (arthropod-borne viruses), which are transmitted to

vertebrates by chronically infected mosquitoes or ticks (Chambers et al., 1990a).

DENV are arboviruses transmitted by mosquitoes of the Aedes genus, predominantly

by Aedes aegypti (Bancroft, 1906). Humans are the principal reservoir for DENV

and are the only host to develop clinical diseases following natural infections

(Gubler, 1998).

DENV are segregated into four antigenically distinct serotypes (DENV-1, DENV-2,

DENV-3 and DENV-4). Infection with any of these viruses can be asymptomatic, or

can cause a spectrum of diseases ranging from mild undifferentiated fever and

dengue fever (DF), to the more severe dengue haemorrhagic fever (DHF) and

dengue shock syndrome (DSS) (Anonymous, 1997a).

DF is an acute febrile disease with a high epidemic potential (Gubler, 1998). Clinical

features of DF include severe headaches, bone or joint and muscular pains, nausea,

vomiting, rash and leukopenia (Anonymous, 1997a; Anonymous, 2000a). DHF is the

more severe form of dengue disease and it is characterised by symptoms that include

a high continuous fever, which last for approximately two to seven days,

haemorrhagic phenomena and haemostatic abnormalities (Anonymous, 1997a;

26

Gubler, 1997). In severe cases of DHF, patients may develop circulatory failure that

can lead to plasma leakage and DSS, which is often fatal (Gubler, 1998). Currently,

DF and DHF/DSS cause more illness and death in humans than any other arbovirus-

associated disease (Anonymous, 1997a).

The prevalence of DF and DHF/DSS cases has increased dramatically in recent

decades. Before 1970, only nine countries had reported DHF epidemics; by 1995, the

number had increased more than four-fold and DENV now threatens the health of

more than 2.5 billion people in tropical and sub-tropical regions of the world

(Anonymous, 1997a; Gubler, 1998). Current estimates suggest that approximately 50

to 100 million cases of DF and more than 250,000 to 500,000 cases of DHF/DSS

occur annually (Rigau-Perez et al., 1998). In addition, DHF has been the leading

cause of hospitalisation and death among children in many southeast Asian countries

since the mid 1970s (Anonymous, 1997b; Gubler, 1997).

Factors responsible for the escalating prevalence of severe dengue disease in recent

years include the increase in human population growth and the associated poorly

planned urbanization, particularly in undeveloped and developing tropical regions of

the world (Anonymous, 1997b; Gubler, 1998), the increase in air travel, and the lack

of effective mosquito control programs and DENV vaccines, which facilitates the

geographic dissemination of both the four DENV serotypes and of their mosquito

vector (Anonymous, 1997a; Chambers et al., 1997; Gubler, 1998).

Approximately half of the human population currently resides in areas populated

with dengue vectors and are at risk of infections with DENV (Anonymous, 1997a).

Therefore, the World Health Organisation (WHO) has declared dengue to be a major

global health problem and the development of safe and effective DENV vaccines a

high priority (Anonymous, 2000b).

27

1.1 THE FLAVIVIRUSES

1.1.1 Flavivirus structure and genome organisation

Mature and infectious flaviviruses are icosahedral virions of approximately 500Å in

diameter with a protein and host-derived lipid bilayer envelope surrounding a

nucleocapsid core of approximately 40Å in diameter (Kuhn et al., 2002). The core

consists of capsid proteins which encapsulate an infectious, single-stranded, positive

sense, RNA genome of approximately 10,700 nucleotides (Chambers et al., 1990a;

Chang, 1997).

The flavivirus genome has a type-I 5’ cap analog (m7GpppA) attached to the 5’-

untranslated region (5’ UTR), followed by a single large open reading frame and the

3’-untranslated region (3’ UTR). The open reading frame is translated into a large

polyprotein, which traverses the membranes of the endoplasmic reticulum (ER)

several times to enable co- and post-translational proteolytic processing by both

host-derived signal peptidases in the ER lumen and virus-derived proteases in the

cytoplasm to produce the capsid (C), the pre-membrane (prM – the precursor form of

the mature membrane (M) protein) and the envelope (E) structural proteins, as well

as the non-structural proteins NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5

(Chambers et al., 1990a; Chang, 1997; Henchal and Putnak, 1990; Mackenzie and

Westaway, 2001).

1.1.2 Proteolytic processing of the viral polyprotein

Flavivirus replication and assembly are dependent on the correct cleavage of the

viral polyprotein (Fig. 1.01). The virus-derived NS2B-NS3 serine protease cleaves in

cis at the NS2A/NS2B and NS2B/NS3 junctions and in trans at the NS3/NS4A and

NS4B/NS5 junctions (Brinkworth et al., 1999; Chambers et al., 1990b; Falgout et

al., 1991; Preugschat et al., 1991; Preugschat et al., 1990). In addition, the NS2B-

NS3 protease is responsible for cleavage within the C, NS3 and NS4A proteins

(Arias et al., 1993; Lin et al., 1993; Lobigs, 1993; Teo and Wright, 1997). The

remaining proteins are cleaved by a number of host-derived proteases.

28

FIG. 1.01 – Schematic representation of the proteolytic processing of the flavivirus polyprotein.

NS2B-NS3 protease (Primary cleavage)

Virus-derived proteases:

NS2B-NS3 protease (Secondary cleavage)

Signal peptidase

Host-derived proteases:

Furin

Unknown protease ( located in endoplasmic reticulum)

Structural Non-structural

COOH NH2 C prM E NS1 NS2A NS2B NS3 NS4A NS4B NS5

ORF 3’ UTR 5’ UTR

Cap C prM E NS1 NS2A NS2B NS3 NS4A NS4B NS5

29

Host-derived signal peptidases mediate the cleavage of the C/prM, prM/E, E/NS1

and NS4A/NS4B junctions (Nowak et al., 1989; Speight et al., 1988), while an

unknown host protease, located in the ER, cleaves the NS1/NS2A junction (Falgout

and Markoff, 1995). Late in virion maturation, the prM protein is cleaved by furin in

the post-Golgi compartment to produce the mature M protein (Stadler et al., 1997).

1.1.2.1 Characteristics of signal peptidase cleavage and regulation

The host-derived signal peptidases cleave following the recognition of characteristic

signal peptides, which precedes the signal peptidase cleavage site (von Heijne,

1983). In general, signal peptides in flavivirus genomes have a low degree of

homology (Stocks and Lobigs, 1998), but they do possess common structural motifs

predicted to be of importance for protein translocation across the ER membrane and

for signal peptidase processing. These structural motifs are characterised by (i) a

positively charged n-region (between five and eight amino acids in length) located at

the N-terminus of the signal peptide, followed by (ii) a hydrophobic central

membrane-spanning h-region (between eight and twelve amino acids in length), and

(iii) a neutral but polar c-region (approximately six amino acids in length) located at

the C-terminus of the signal peptide.

In addition, the boundary between the h- and the c-region is marked generally by

charged or helix-breaking amino acid residues, such as proline or glycine, and the c-

region also is characterised by amino acids that conform to the (-3,-1) rule, which

required the positions -3 and -1, relative to the signal peptidase cleavage site, to be

accommodated by small and neutral amino acid residues, such as alanine, to enable

efficient signal peptidase recognition and cleavage (Nothwehr and Gordon, 1989;

von Heijne, 1984; von Heijne, 1985). No specific pattern of amino acid residues has

been described for the region between positions +1 to +5, although sequences

downstream of the cleavage site have been shown to contribute to the efficiency of

signal peptidase cleavage (Hegner et al., 1992; Stocks and Lobigs, 1998).

The processing of the viral polyprotein is a regulated event in many positive-

stranded RNA viruses (Hellen et al., 1989; Krausslich and Wimmer, 1988;

Palmenberg, 1990; Wellink and van Kammen, 1988), including flaviviruses

(Amberg et al., 1994; Lobigs, 1993; Yamshchikov and Compans, 1993). Studies

30

demonstrated that the cytoplasmic cleavage of the C-terminus of the C protein by the

NS2B-NS3 protease is required before the C/prM cleavage site becomes accessible

for cleavage by signal peptidases in the lumen of the ER (Amberg et al., 1994; Lee et

al., 2000; Lobigs, 1993; Stocks and Lobigs, 1995; Stocks and Lobigs, 1998;

Yamshchikov and Compans, 1993; Yamshchikov and Compans, 1995;

Yamshchikov et al., 1997). This regulation of the cleavage process contradicted the

earlier assumption that signal peptidase cleavage is a rapid and co-translational

process that occurs during the translocation of the polyprotein across the ER

membrane (Rapoport, 1992). In addition, the regulation of C/prM cleavage by the

NS2B-NS3 protease may be responsible for the lack of prM and E protein secretion

by cells transfected with DNA co-expressing the full-length flavivirus C-prM-E

protein genes in the absence of the NS2B-NS3 protease (Allison et al., 1995;

Fonseca et al., 1994; Konishi et al., 1991; Mason et al., 1991; Schalich et al., 1996).

In contrast, cells transfected with the full-length flavivirus prM-E protein genes with

the prM signal sequence were able to secrete prM and E in the absence of the NS2B-

NS3 protease (Gruenberg and Wright, 1992; Heinz et al., 1995; Konishi et al., 2001;

Konishi et al., 1992; Konishi et al., 1997b; Pincus et al., 1992).

1.2 PROPERTIES OF VIRAL PROTEINS

1.2.1 Structural proteins

1.2.1.1 Capsid protein

The C protein is a small protein with a molecular mass of 9 to 12 kDa (112 to 127

amino acids), which forms the structural component of the virus nucleocapsid. There

is less amino acid sequence homology between the C proteins of different

flaviviruses compared to the other two structural proteins (Mandl et al., 1988).

However, conserved hydrophobic and hydrophilic regions are present in all

flavivirus C proteins (Chambers et al., 1990a; Markoff et al., 1997).

Jones et al., (2003) proposed a structure for the flavivirus C protein consisting of

four α-helices based on nuclear magnetic resonance (NMR) analysis of YFV and

DENV-2 C proteins expressed and purified from Escherichia coli (E.coli). This

structure of the C protein was later improved by Ma et al., (2004) who provided the

31

first three-dimensional solution structure of the flavivirus (DENV-2) C protein and

proposed a structure for the C protein that incorporated a large dimerisation surface

that was produced by two pairs of α-helices interspersed by short loops. Dokland et

al., (2004) supported the structure of the C protein proposed from the earlier studies

following the elucidation of the first crystal structure of the flavivirus C protein to

2.8Å resolution, based on the C protein of the Kunjin subtype of the West Nile virus

(WNV).

The high content of basic amino acid residues present in the C protein, which could

enable the protein to neutralise the negatively charged viral RNA, suggested a

possible role for the C protein in the packaging of the viral RNA (Chambers et al.,

1990a; Chang, 1997; Markoff et al., 1997). The C-terminal region of the C protein,

which is highly conserved among flaviviruses, serves as an internal signal sequence

to mediate the translocation of the prM protein into the lumen of the ER and anchors

the C protein to the ER membrane to localise the assembly of the virus nucleocapsid

(Lobigs, 1993; Nowak et al., 1989; Speight et al., 1988).

In addition, Khromykh and Westaway, (1997) demonstrated that the sequence

encoding the first twenty amino acid residues of the C protein were essential for

efficient replication of the flavivirus RNA. Other studies also suggested the presence

of conserved complementary cyclisation sequences (CS) in the 5’ region of the C

protein gene and in the 3’ UTR, which were believed to be essential for flavivirus

RNA replication in vivo as it allowed the cyclisation of the flavivirus RNA through

base-pairing to ensure that full genomic-length virus RNA is replicated (Hahn et al.,

1987; Khromykh et al., 2001a; You et al., 2001).

In addition, studies have demonstated that deletions of up to sixteen amino acid

residues could be introduced into the TBEV C protein (from amino acid position 28

relative to the N-terminus of C) to produce viable and infectious mutant TBEV in

cell culture without impairing RNA replication or translation, or reducing E protein

expression (Kofler et al., 2002; Kofler et al., 2003). Furthermore, although mutated

TBEV containing twenty-one amino acid deletion from position 28 were not

infectious, studies demonstrated that the viability of the virus could be restored by

the introduction of additional second-site mutations within the C protein downstream

32

of the deletion, which increased the hydrophobicity of the mutated C protein (Kofler

et al., 2003). Mice immunised with the mutated TBEV containing the sixteen amino

acid deletion, or containing the twenty-one amino acid deletion with additional

second-site mutations, also develop reduced neuroinvasiveness compared to mice

immunised with wildtype TBEV, which demonstrated the potential for incorporating

amino acid deletion into the flavivirus C protein to produce stable attenuated

flaviviruses suitable for use as live attenuated vaccines (Kofler et al., 2002; Kofler et

al., 2004; Kofler et al., 2003).

1.2.1.2 Pre-membrane and membrane proteins

The prM protein is a glycosylated protein with a molecular mass of 18.1 to 19.1 kDa

(165 to 175 amino acids) and is found in intracellular, fusion-incompetent, immature

virions. The prM protein is the precursor to the non-glycosylated M protein, which

has a molecular mass of 7 to 9 kDa (approximately 75 amino acids), and is found in

extracellular, fusion-competent, mature virions (Chambers et al., 1990a; Chang,

1997).

In immature virions, the prM protein forms a heterodimer with the E protein and the

prM/E heterodimers are arranged into 60 asymmetrical trimeric spikes, which

conceal the fusion peptide on the E protein and protect the immature particles from

undergoing premature and irreversible inactivation by fusion during assembly and

transport through the acidic trans-Golgi network (TGN) (Zhang et al., 2003b).

Shortly before virion release, the prM is cleaved in the TGN by furin to produce

mature virions with M proteins (Murray et al., 1993). Furin cleaves following the

characteristic protein sequence motif Arg-X-Lys/Arg-Arg (X is a variable amino

acid residue, except Cys), although mutagenesis studies demonstrated that the

minimum sequence of Arg-X-X-Arg can be recognised by the enzyme (Molloy et

al., 1999; Molloy et al., 1992; Nakayama, 1997; Plaimauer et al., 2001). The

cleavage by furin results in the removal of the glycosylated N-terminal end of the

prM protein (Chambers et al., 1990a; Chang, 1997; Heinz and Allison, 2000; Heinz

and Allison, 2001) and produces mature virions with a 100-fold increase in virus

infectivity and enables the E protein to hemagglutinate and participate in low pH-

induced fusion with host cell membranes (Heinz and Allison, 2000; Heinz and

33

Allison, 2001). Elshuber et al., (2003) demonstrated that the infectivity of mature

TBEV was dependent on cleavage of the prM protein to the M protein.

1.2.1.3 Envelope protein

The E protein is the major structural protein on the surface of virions. It has a

molecular mass of 55 to 60 kDa (494 to 501 amino acids) and is glycosylated in most

flaviviruses. The E protein is responsible for receptor-mediated attachment of virus

to host cells, low pH-induced fusion of virus to host cell membranes,

hemagglutination of erythrocytes and is the major target for virus neutralising

antibodies (Allison et al., 2001; Allison et al., 1999; Chambers et al., 1990a; Chang,

1997; Heinz and Allison, 2000; Rey et al., 1995).

Nowak and Wengler, (1987) first proposed a physical model for the flavivirus E

protein based on the primary amino acid sequences of the prM/M and E of WNV and

YFV. This model was later improved by Guirakhoo et al., (1989), and Mandl et al.,

(1989) who used monoclonal antibodies to study the physical and antigenic structure

of the TBEV E protein. Rey et al., (1995) then provided the first three-dimensional

structure of the flavivirus (TBEV) E protein based on X-ray crystallography of a

soluble dimeric fragment of the E protein, which was produced by limited trypsin

digestion of purified TBE virions. This stem-anchor free fragment included the

amino acid residues 1 to 395 of the E protein, which constitute most of the

ectodomain (N-terminal 80%) of the E protein. In recent times, the three-

dimensional structures of the immature DENV and YFV particles (Zhang et al.,

2003b) and the mature DENV particle (Kuhn et al., 2002; Zhang et al., 2003a) also

have been resolved by cryoelectron microscopy and image reconstruction

techniques.

The E proteins of mature flavivirus virions consist of a homodimer complex with

two identical monomer subunits arranged in a head-to-tail configuration (Kuhn et al.,

2002; Rey et al., 1995). A stem-anchor region, of approximately 100 amino acids,

extends from each distal end of the dimer (C-terminal of E) to anchor each

ectodomain in the viral lipid membrane (Allison et al., 1999). All of the known

antigenic determinants recognised by virus neutralising antibodies, the putative

receptor-binding site and the putative fusion peptide sequence are found in the

34

ectodomain region of the E protein (Chang, 1997; Rey et al., 1995). Approximately

90 E protein dimers are located on the virion surface (Ferlenghi et al., 2001; Heinz

and Allison, 2000; Kuhn et al., 2002). In addition, the individual E protein monomer

is organised into three distinct domains consisting of: (i) a central N-terminal β-

barrel region (domain I), (ii) an elongated dimerisation region (domain II), and (iii) a

C-terminal immunoglobulin-like region (domain III) (Rey et al., 1995).

Domain I

Domain I is located in the centre of the monomer and is produced from three highly

variable regions on the polypeptide chain (amino acid residues 1 to 51, 137 to 189

and 285 to 302 of TBEV E protein). This domain has an eight-strand up-and-down

β-barrel configuration with the axis of the barrel oriented almost parallel to the viral

lipid membrane. It contains the N-terminus of the E protein, two disulfide bonds that

stabilise the conformation and a single carbohydrate side chain attached at amino

acid residue 154 (Rey et al., 1995).

Domain II

The two large elongated loops, which connect the three regions of domain I, fold

together to form the dimerisation domain designated as domain II (amino acid

residues 52 to 136 and 190 to 284 of TBEV E protein). This domain has an extended

finger-like structure with a base consisting of a short antiparallel β-sheet with two α-

helices located on one surface. The elongated segment of this domain is composed

mostly of β-sheets and includes three disulfide bonds that restrict internal structural

movements. A loop structure, termed the c-d loop, is located at the tip of the domain

and extends far into a pocket created by domains I and III of the other monomer

subunit (Rey et al., 1995). The putative flavivirus fusion peptide sequence (amino

acid residues 98 to 113) is located in this loop region (Allison et al., 2001; Roehrig et

al., 1989; Roehrig et al., 1990).

Fusion peptides are the structural regions of the virus protein that interact with the

host cell membrane to activate the fusion process (Heinz and Allison, 2000). The

peptide sequence, located at the c-d loop, has been hypothesized to represent the

flavivirus fusion peptide because it is rich in glycine residues and moderately

35

hydrophobic, which suggested that it could participate in membrane fusion (Chang,

1997; Rey et al., 1995). It also possesses hinge-like characteristics when exposed to

low pH, which opens up a ligand-binding pocket and elevates the tip of the domain

above the viral membrane to bring the c-d loop into prominence (Heinz and Allison,

2000; Modis et al., 2003; Rey et al., 1995). Furthermore, it is located within a highly

conserved amino acid region of the flavivirus E protein and it also contains the

tetrapeptide Gly-Leu-Phe-Gly, which is identical to the fusion peptide of influenza A

virus HA protein and is similar to sequences found in other viral fusion peptides

(Allison et al., 2001; Heinz and Allison, 2000; Roehrig et al., 1990; Stiasny et al.,

2001).

Domain III

Domain III consists of an immunoglobulin constant domain-like β-barrel

configuration located at the C-terminus of the E protein (amino acid residues 303 to

395 of TBEV E protein). It is separated from domain II by a domain I segment of

about 15 amino acids and is anchored to the end of that segment by a disulfide bond.

The axis of the β-barrel is perpendicular to the virus surface and its tip extends

farther than any other part of the E dimer. Due to its exposed position on the virus

surface, this domain is believed to contain the receptor-binding site to mediate virus

attachment to host cell receptors (Heinz and Allison, 2000; Rey et al., 1995).

Stem-anchor region

The stem-anchor region is located in the remaining C-terminal 20% of the E protein

(from amino acid residue 401 of TBEV E protein). Sequence-based predictions have

postulated that this region contains two potential α-helices (H1pred from amino acid

residues 401 to 413 and H2pred from amino acid residues 431 to 449) flanking a

highly conserved sequence element (CS from amino acid residues 414 to 430) and

two transmembrane regions (TM1 from amino acid residues 450 to 471 and TM2

from amino acid residues 473 to 496) representing the C-terminal double membrane

anchor (Allison et al., 1999; Heinz and Allison, 2000; Stiasny et al., 1996). In

addition, Allison et al., (1999) demonstrated that the low pH-induced irreversible

change of the homodimeric E complex to the homotrimeric conformation during

fusion was dependent on the presence of H1pred, which suggested a possible role for

36

this region in trimerisation during the membrane fusion process. H2pred and TM1 also

were found to be important for the stability of the prM/E heterodimer, suggesting a

possible association of the prM with these regions during virus assembly (Allison et

al., 1999).

1.2.2 Non-structural proteins

1.2.2.1 NS1 protein

NS1 is a glycosylated protein with a molecular mass of 42 to 50 kDa (353 to 354

amino acids). All flaviviruses have twelve conserved cysteine residues located in the

NS1 protein and at least one conserved N-linked glycan at amino acid residue 208 or

209, which is postulated to be crucial for protein processing and secretion (Chambers

et al., 1990a; Chang, 1997).

The NS1 protein exists in different forms when located on the cell surface or

secreted into the extracellular environment of infected cells (Chang, 1997). The

dimeric form of NS1, which is dependent on the preservation of the C-terminal

region of the protein, is located within both the intracellular and extracellular

environments of virus-infected cells. In addition, a secreted and soluble form of NS1,

known as the soluble complement fixing (SCF) antigen, has been shown to elicit the

production of virus-specific antibodies with complement-fixing activity (Chambers

et al., 1990a; Chang, 1997).

Active immunisation with NS1 protein or passive immunisation with anti-NS1

monoclonal antibodies also protected animals against challenge with live

homologous flavivirus (Cane and Gould, 1988b; Gould et al., 1986; Schlesinger et

al., 1986; Schlesinger et al., 1990; Schlesinger et al., 1985; Schlesinger et al., 1987).

These results suggested that the NS1 protein may play an important role in protective

immunity and could serve as an attractive antigen for vaccines (Chambers et al.,

1997; Chang, 1997).

37

1.2.2.2 NS3 protein

NS3 is the second largest flavivirus protein with a molecular mass of 67 to 70 kDa

(618 to 623 amino acids) and has been proposed to possess a multi-functional role in

flavivirus replication and polyprotein processing (Bartelma and Padmanabhan, 2002;

Benarroch et al., 2004; Chambers et al., 1990a; Chang, 1997; Li et al., 1999a;

Matusan et al., 2001b). The N-terminal region of the flavivirus NS3 protein exhibits

significant amino acid sequence and structural homology to the active domain of

trypsin-associated serine proteases (Chambers et al., 1990b; Falgout et al., 1991;

Wengler et al., 1991; Zhang et al., 1992). In particular, the His-53, Asp-77 and Ser-

138 residues are predicted to form the catalytic triad of the protease active site, while

the conserved Asp-131 residue and the sequence Gly-Leu-Tyr-Gly-Asn-Gly (amino

acid residues 151 to 156) are predicted to form the substrate-binding region that

interacts directly with the cleavage site (Chambers et al., 1990b; Ryan et al., 1998).

In addition, the C-terminal region of the flavivirus NS3 protein has been

demonstrated to possess 3 types of enzymatic activities, (i) a helicase activity that is

involved in the unwinding of DNA or RNA structures (Gorbalenya et al., 1989; Li et

al., 1999a), (ii) a nucleoside-5’-triphosphatase (NTPase) activity that hydrolyses

nucleoside triphosphates (Li et al., 1999a; Warrener et al., 1993; Wengler et al.,

1991), and (iii) a RNA-5’-triphosphatase (RTPase) activity that was postulated to be

involved in the capping of the flavivirus RNA genome (Bartelma and Padmanabhan,

2002). Studies have demonstrated that the NTPase and RTPase activities of NS3

share a common active site (Bartelma and Padmanabhan, 2002; Benarroch et al.,

2004).

1.2.2.3 NS5 protein

NS5 is the largest flavivirus protein with a molecular mass of 103 to 104 kDa (900 to

905 amino acids) and exhibits the highest amino acid sequence homology among the

flavivirus proteins (Chang, 1997). The presence of the highly conserved motif Gly-

Asp-Asp in NS5 protein, similar to that found in the RNA polymerase of other

positive strand RNA viruses, suggested a role for the protein as an RNA-dependent

RNA polymerase (Chambers et al., 1990a; Tan et al., 1996). Genetic mutations

introduced into the Gly-Asp-Asp motif and other regions of the NS5 gene have

resulted in the abrogation of the replication ability of the flavivirus RNA (Khromykh

38

et al., 1998; Khromykh et al., 1999). In addition, studies have demonstrated that the

N-terminal region of the flavivirus NS5 protein may participate in the capping of the

viral RNA genome and possess methyltransferase (MTase) activity on the capped

RNA (Egloff et al., 2002; Koonin, 1993).

1.2.2.4 NS2A, NS2B, NS4A and NS4B proteins

NS2A, NS2B, NS4A and NS4B are four relatively small proteins with molecular

masses of 18 to 22 kDa (218 to 231 amino acids), 13 to 15 kDa (130 to 132 amino

acids), 16 to 16.4 kDa (149 to 150 amino acids) and 27 to 28 kDa (248 to 256 amino

acids) respectively (Chambers et al., 1990a; Chang, 1997).

Studies have demonstrated that NS2A may be required for the processing of the NS1

protein (Falgout et al., 1989), while NS2B is part of the NS2B-NS3 protease

(Brinkworth et al., 1999; Chambers et al., 1990b; Clum et al., 1997; Ryan et al.,

1998). Studies also have demonstrated that NS4A may be involved in RNA

replication (Lindenbach and Rice, 1999), while NS4B may be required for flavivirus

replication and mosquito infectivity (Hanley et al., 2003). In addition, NS2A, NS4A

and NS4B appears to be antagonists to host-mediated activation of interferon

responses (Munoz-Jordan et al., 2003).

1.3 GENERAL FEATURES OF FLAVIVIRUS REPLICATION

1.3.1 Flavivirus entry, replication and release

Flaviviruses enter host cells by receptor-mediated endocytosis, which is followed by

endosomal uptake and a low pH-induced fusion event, consisting of a reversible

dissociation of the homodimeric E protein complex followed by an irreversible

structural change to form a more stable homotrimeric complex (Bressanelli et al.,

2004; Heinz and Allison, 2001; Kuhn et al., 2002; Modis et al., 2004; Stiasny et al.,

2001). This results in the exposure of the fusion peptide, located in the E protein,

which then initiates the fusion of the viral membrane with the endosomal membrane

to release the virus nucleocapsid into the cytoplasm where translation of the viral

RNA occurs (Chambers et al., 1990a; Chang, 1997; Heinz and Allison, 2000). In

addition to serving as mRNA, the viral RNA also directs the synthesis of

39

complementary, genome-length negative sense RNA to provide a recycling template

for the transcription of additional positive sense viral RNA (Chang, 1997; Chu and

Westaway, 1985; Heinz and Allison, 2000).

Following RNA replication and translation, immature, fusion-incompetent virions, in

which the E protein forms a heterodimeric complex with prM, are then assembled at

intracellular compartments, presumably by budding into the ER, and transported

through the cellular endocytotic pathway where further processing of the viral

proteins occur, including glycosylation. These immature virions contain 60

asymmetric trimers of prM-E heterodimers (Zhang et al., 2003b).

Shortly before virion release, prM is cleaved by furin in the TGN to generate mature

and infectious, fusion-competent virions, in which two E protein molecules associate

to form a homodimeric complex (Chambers et al., 1990a; Chang, 1997; Heinz and

Allison, 2000; Heinz and Allison, 2001; Rey et al., 1995; Stadler et al., 1997). As a

by-product of virus assembly, slowly sedimenting hemagglutinin (SHA) subviral

particles also are secreted along with complete virions from flavivirus-infected cells

during the course of a typical infection (Heinz and Allison, 2000; Russell et al.,

1980).

1.3.2 Flavivirus subviral particles

Flavivirus SHA subviral particles are non-infectious particles that are

morphologically similar to, but smaller in size, than the native virions and contain

only the transmembrane prM and E proteins embedded in the lipid envelope, with no

nucleocapsid core or RNA genome of the virus (Ferlenghi et al., 2001). Similar

flavivirus recombinant subviral particles (RSPs) also can be generated in mammalian

cells by co-expressing the full-length flavivirus prM-E protein genes with the prM

signal sequence using various recombinant gene expression systems, such as

recombinant vaccinia viruses and DNA expression vectors (Allison et al., 1995;

Gruenberg and Wright, 1992; Heinz et al., 1995; Konishi et al., 2001; Konishi et al.,

1992; Konishi et al., 1997b; Mason et al., 1991; Pincus et al., 1992).

40

In addition to size and sedimentation rate, RSPs also display a lower buoyant density

than native virions (Heinz et al., 1995; Schalich et al., 1996) and contain only 30 E

protein dimers on the particle surface (Table 1.01) (Ferlenghi et al., 2001; Kuhn et

al., 2002). However, RSPs are isometric and possess a host-derived lipid membrane

like native virions, and they also are glycosylated, which suggested that they pass

through the TGN during cellular development (Konishi et al., 1992; Schalich et al.,

1996). In addition, RSPs are functionally active with the ability to hemagglutinate

and fuse with host cell membranes in a manner similar to that of native virions

(Allison et al., 2001; Corver et al., 2000; Heinz and Allison, 2001; Kuhn et al.,

2002; Ocazionez Jimenez and Lopes da Fonseca, 2000; Schalich et al., 1996).

RSPs also possess similar antigenic and immunogenic properties to native virions.

Studies have shown that conformation-dependent neutralising monoclonal antibodies

directed to the E protein, reacted equally with both RSPs and native virions in

immunological assays (Allison et al., 1999; Ferlenghi et al., 2001; Heinz et al.,

1995; Schalich et al., 1996). These observations suggested that flavivirus RSPs could

be an ideal model for the study of flavivirus fusion, as well as the structure and

function of the E protein using a virus-free system (Allison et al., 2001; Schalich et

al., 1996). Furthermore, the ability to develop stably transformed cell lines that

constitutively secrete RSPs has provided a source for producing biosynthetic subunit

flavivirus vaccines and antigens for serodiagnostic assays (Aberle et al., 1999; Davis

et al., 2001; Heinz and Allison, 2000; Heinz et al., 1995; Konishi et al., 2001;

Konishi et al., 1997b).

41

TABLE 1.01 – Properties of flavivirus recombinant subviral particles (RSPs) and native virions

(Source: Schalich et al., 1996)

halla

This table is not available online. Please consult the hardcopy thesis available from the QUT Library

42

1.4 CLINICAL FEATURES OF DENGUE FEVER, DENGUE

HAEMORRHAGIC FEVER AND DENGUE SHOCK SYNDROME

1.4.1 Dengue fever

DF is a self-limited acute febrile disease with a range of clinical symptoms

depending on the age of the patient. Infants and young children usually develop an

undifferentiated fever, often with macular and papular rashes, while older children

and adults usually develop a mild febrile disease, or the classical high fever with

abrupt onset, severe headaches, bone or joint and muscular pains, nausea, vomiting

and rash. Petechiae, leukopenia and lymphadenopathy also are often reported. A

convalescent phase characterised by post-illness depression and fatigue lasting for

several weeks is common, especially in adults (Anonymous, 1997a; George and

Lum, 1997; Gubler, 1998). The case fatality rate of DF is less than 1%, and occurs

usually as a result of severe and uncontrollable bleeding (Anonymous, 1997a).

1.4.2 Dengue haemorrhagic fever and dengue shock syndrome

DHF is a more serious disease resulting from DENV infection. Clinical symptoms of

DHF typically resemble those of DF at the onset. However, as the fever abates, the

condition of DHF patients deteriorates rapidly with symptoms of high continuous

fever (>390C and lasting for two to seven days), haemorrhagic diathesis,

hepatomegaly, and haemostatic abnormalities (Anonymous, 1997a; George and

Lum, 1997; Gubler, 1998; Rigau-Perez et al., 1998). In severe DHF cases, patients

may develop circulatory failure which may lead to fatal hypovolaemic shock and

DSS as a result of increased capillary permeability and plasma leakage (Anonymous,

1997a; Gubler, 1998). Thrombocytopenia, haemoconcentration, and complement

depletion also are often detected in DHF patients (Bokisch et al., 1973).

The case fatality rate of DHF/DSS is generally below 2% in regions where good

intravenous resuscitation facilities are available (Anonymous, 1997a; Dung et al.,

1999; Ngo et al., 2001). However, the mortality can be much higher in regions where

such facilities are lacking, or when DHF/DSS cases remain undiagnosed, such as

during the 1996 Delhi epidemic where the mortality rate increased to 4.2% of the

8,900 reported cases (Dar et al., 1999). In addition, children experiencing severe

DHF appear to be more susceptible to DSS than adults (Gubler, 1998), which could

43

be attributed to the greater permeability of the capillaries in children compared to

adults (Gamble et al., 2000).

1.5 PATHOGENESIS OF DENGUE HAEMORRHAGIC FEVER AND

DENGUE SHOCK SYNDROME

Natural infection with one DENV serotype confers life-long immunity against the

infecting DENV serotype, but only short-term (months) cross-protective immunity

against infection by the other DENV serotypes (Gubler, 1998; Rigau-Perez et al.,

1998; Sabin, 1952). Although the precise mechanism by which DHF/DSS develops

remain undefined, three principal theories have been recognised predominantly as

the major contributors to the pathogenesis of DHF/DSS. These theories include (i)

the antibody-dependent enhancement (ADE) theory, (ii) the virulent virus theory,

and (iii) the T lymphocyte activation theory.

1.5.1 Antibody-dependent enhancement theory

Infection with any of the four DENV serotypes induces the production of both

homotypic and heterotypic antibodies (Halstead and O'Rourke, 1977b; Halstead et

al., 1984). The ADE theory implies that patients experiencing a DENV infection are

at a greater risk of developing DHF/DSS if they possess non-neutralising heterotypic

dengue antibodies, either acquired maternally or from a previous DENV infection

(Halstead, 1988; Halstead and O'Rourke, 1977b; Kliks et al., 1988; Vaughn et al.,

2000). These pre-existing antibodies bind to the DENV from the second infection to

form infectious antibody-virus complexes, which possess the ability to enhance virus

attachment to host cells via cellular Fc-receptors (Halstead et al., 1970; Halstead and

O'Rourke, 1977b; Halstead et al., 1984).

These infected cells then activate pre-existing and cross-reactive CD4+ and CD8+

cytotoxic lymphocytes, which were produced following the initial DENV infection,

and initiates a shift from the predominantly Th1-type immune response observed in

DF cases, to a Th2-type immune response and a subsequent increase in the Th2-

related cytokines, interleukin (IL)-4, IL-6, IL-10, as well as a unique pathogenesis-

related cytokine called human cytotoxic factor (hCF) that is released by CD4+ cells

44

(Chaturvedi et al., 1991a; Chaturvedi et al., 1992; Chaturvedi et al., 1991b;

Chaturvedi et al., 1999). It was proposed that hCF could induce macrophages to

activate complement, release histamine and produce free radicals, such as nitrite,

reactive oxygen and peroxynitrite. The combined effects of hCF and the elevated

expression of Th2-related cytokines result in an increase in vascular permeability,

which leads to haemorrhagic manifestations and DHF/DSS (Chaturvedi et al., 2000;

Chaturvedi et al., 1997; Chaturvedi et al., 1999; Gubler, 1998; Rigau-Perez et al.,

1998).

The evidence that ADE is responsible for the development of DHF/DSS has been

provided by epidemiological studies, which revealed a higher incidence of DHF/DSS

cases in secondary DENV infections than in primary infections. A primary DENV

infection will usually result in DF, however DHF/DSS develops in 2 to 3% of

secondary infections in patients one year or older when the infecting DENV is of a

serotype not previously encountered (Halstead et al., 1970; Halstead and O'Rourke,

1977a; Pang, 1987a; Pang, 1987b). This was observed during the dengue outbreaks

in Cuba where there was an 18 year interval between a DENV-1 outbreak in 1977/78

and a DENV-2 outbreak in 1997, and all patients who developed severe dengue

diseases during the DENV-2 outbreak, including DHF/DSS and fatalities, were born

before the DENV-1 epidemic with nearly all experiencing the secondary DENV

infection. In contrast, almost all patients with primary DENV infections

seroconverted without experiencing disease (Vaughn, 2000). However, although this

evidence suggested an association between ADE and DHF/DSS, it remains unclear

why DHF/DSS constitutes only a minor fraction of the large number of secondary

DENV infections that occur (Gubler, 1998).

1.5.2 Virulent virus theory

The virulent virus theory postulated that the development of DHF/DSS resulted from

infection by a highly virulent strain of DENV (Rosen, 1977). Consistent with this

theory was the study by Rico-Hesse et al., (1997), who demonstrated that although

all four DENV serotypes have been co-circulating in Latin America since the late

1960s, this region was spared epidemics of DHF/DSS until the introduction of a

highly virulent Southeast Asian DENV-2 strain, thought to be of Vietnamese origin,

which displaced the native American DENV-2 strain that had only been associated

45

with less severe dengue diseases, such as DF (Watts et al., 1999). Potential genetic

determinants responsible for the increase in virulence of the Southeast Asian DENV-

2 strain have been located in the E protein (Asn-390 residue), as well as the

downstream and upstream sequences of the 5’ and 3’ UTRs of the DENV genome

respectively (Cologna and Rico-Hesse, 2003; Leitmeyer et al., 1999; Pryor et al.,

2001).

In addition, the same virulent Southeast Asian DENV-2 strain was implicated as the

etiological factor responsible for the Venezuelan epidemic in 1989/90, which

resulted in 6,000 cases of DHF/DSS, although DENV-1 and DENV-4 also were

isolated during the epidemic (Anonymous, 1990). Furthermore, a DENV-3 strain,

presumed to be of Indian or Sri Lankan origin, was postulated to be responsible for

the 1994 DHF/DSS epidemic in Nicaragua, and an Asian DENV-3 strain was

believed to have caused the 1990 DHF/DSS epidemic in Tahiti where previous

epidemics of DENV-1, DENV-2 and DENV-3 resulted in significantly less reported

cases of severe dengue diseases (Chungue et al., 1993; White, 1999).

1.5.3 T lymphocyte activation theory

The T lymphocyte activation theory postulated that the development of DHF/DSS in

secondary DENV infection resulted from activation of memory T lymphocytes

acquired from the primary DENV infection (Kurane et al., 1994; Rothman, 2004;

Rothman and Ennis, 1999). Studies demonstrated that circulating DENV-specific

CD4+ and CD8+ T lymphocytes, produced following a primary DENV infection,

possessed cross-reactive activity against antigenic determinants from heterologous

DENV (Dharakul et al., 1994; Kurane et al., 1995). A major target for cross-reactive

DENV-specific CD4+ and CD8+ T lymphocytes appears to be the highly conserved

DENV non-structural proteins, particularly the NS3 protein (Kurane et al., 1991a;

Lobigs et al., 1994; Mathew et al., 1996; Zivny et al., 1999).

Studies demonstrated that DENV-specific memory T lymphocytes activated by

interaction with DENV-infected antigen presenting cells secrete high levels of

interferon (IFN)-γ (Kurane et al., 1989), interleukin (IL)-2, tumour necrosis factor

(TNF)-α and TNF-β (Gagnon et al., 1999) which may be responsible for increased

plasma leakage in patients with DHF/DSS (Baluna and Vitetta, 1997; Tracey and

46

Cerami, 1993). In addition, activation of DENV-specific memory T lymphocytes

may lead to excessive tissue damage from lysis of DENV-infected target cells

(Gagnon et al., 1996; Green et al., 1993; Kurane et al., 1989; Livingston et al.,

1995), as well as lysis of uninfected (bystander) cells by activating perforin or the

Fas-mediated apoptotic pathway (Gagnon et al., 1999).

The involvement of T lymphocyte activation and cytokine production in the

pathogenesis of DHF/DSS is supported by various studies which demonstrated

increased levels of T lymphocyte activation in patients with DHF/DSS (Kurane et

al., 1991b; Mongkolsapaya et al., 2003; Zivna et al., 2002) and increased serum

levels of TNF-α in patients with DHF (Bethell et al., 1998; Green et al., 1999; Hober

et al., 1993). In addition, studies demonstrated that severity of dengue disease

correlated with circulating levels of soluble CD4, CD8, IL-2 receptors and TNF

receptors (Bethell et al., 1998; Green et al., 1999; Hober et al., 1996; Kurane et al.,

1991b).

On the basis of these theories, it was proposed that the ideal DENV vaccine must be

able to provide concurrent immunisation and life-long protective immunity against

each of the four DENV serotypes in order to avoid sensitising recipients to

developing DHF/DSS, and to provide protection against dengue diseases in endemic

and epidemic areas where multiple DENV serotypes co-circulate (Anonymous,

1997a; Chambers et al., 1997). The vaccine also must be stable and cost effective to

produce, as well as easily administered with minimal booster immunisations to

enable its use in less developed countries (Bhamarapravati and Yoksan, 1997;

Chambers et al., 1997; Kinney and Huang, 2001).

1.6 DENGUE VACCINES

Vaccines against infection by a number of flaviviruses have been available for many

years. These include the live attenuated YFV 17D vaccine (Theiler and Smith,

1937a; Theiler and Smith, 1937b) and the inactivated whole virus vaccines for

TBEV and JEV (Bock et al., 1990; Heinz et al., 1980; Hoke et al., 1988; Poland et

al., 1990). Currently, there is no DENV vaccine available for commercial use.

47

Two major obstacles that have delayed the development of DENV vaccines have

been the need to provide concurrent immunisation against infection by each of the

four DENV serotypes to avoid sensitising vaccine recipients to developing

DHF/DSS (Anonymous, 1997a; Chambers et al., 1997), and the difficulty in

assessing the protective efficacy of DENV vaccine candidates due to the lack of

suitable experimental animal models that can replicate the clinical features of DF or

DHF/DSS observed in humans.

Current attempts at developing DENV vaccines have included the use of traditional

strategies, such as live attenuated virus or inactivated whole virus vaccines, as well

as recombinant strategies, such as infectious clone-derived, live attenuated virus

vaccines, DNA vaccines or vaccines which incorporated various expression systems,

such as vaccinia and baculoviruses, to produce dengue peptide subunits or RSPs

(Chambers et al., 1997; Kinney and Huang, 2001; Pugachev et al., 2003).

1.6.1 Replicating virus vaccines

Immunisation with replicating virus vaccines, such as live attenuated viruses, is

considered the most effective method of inducing both long-term humoral and cell-

mediated immune responses, similar to that acquired from a natural virus infection.

In addition, these vaccines usually require only a single immunisation to induce

complete protection (Thomssen, 1975). However, immunisation with replicating

virus vaccines also introduces a number of safety concerns, such as the possibility of

causing disease when the virus is not sufficiently attenuated, or eliciting weak

immune responses and subsequently incomplete protection against natural virus

infections when the virus is over-attenuated (Salk and Salk, 1984; Thomssen, 1975;

Winther and Dougan, 1984).

1.6.1.1 Live attenuated dengue vaccines

The first attempts to produce live attenuated DENV-1 and DENV-2 vaccines were

conducted independently by Kimura and Hotta (1944), and Sabin and Schlesinger

(1945) respectively, following the first isolation of DENV more than 55 years ago.

However, although both live attenuated DENV-1 and DENV-2 viruses were

produced by serial passage of wildtype viruses in mouse brains, their development as

48

vaccines was not pursued due to the need for extensive purification to remove

contaminating mouse brain antigens from the virus preparation. Two live attenuated

tetravalent DENV vaccines then were developed independently by Mahidol

University in Bangkok, Thailand, and by Walter Reed Army Institute for Research

(WRAIR) in the United States.

Mahidol University live attenuated tetravalent DENV vaccine

The Mahidol University live attenuated tetravalent DENV vaccine consisted of

DENV-1 strain 16007, DENV-2 strain 16681 and DENV-4 strain 1036, which were

attenuated by 13, 53 and 48 serial passages in primary dog kidney (PDK) cells

respectively. The DENV-3 strain 16562 was attenuated by 30 serial passages in

primary African green monkey kidney (PGMK) cells followed by 3 passages in

foetal rhesus lung (FRhL) cells because it did not grow well in PDK cells beyond the

third passage (Bhamarapravati and Yoksan, 1997). After satisfying safety and

immunogenicity studies in both monkeys and human volunteers (Angsubhakorn et

al., 1987a; Angsubhakorn et al., 1987b; Angsubhakorn et al., 1988; Angsubhakorn

et al., 1994; Bhamarapravati and Sutee, 2000; Bhamarapravati et al., 1987; Vaughn

et al., 1996), Aventis Pasteur (AvP) Merrieux Connaught obtained the four DENV

vaccine candidates as a co-development partner for commercial development and

Phase I adult human clinical trials were conducted in the United States by WRAIR to

evaluate the safety and immunogenicity of these vaccine candidates.

No vaccinees from the trial immunised with any of the monovalent DENV vaccine

candidates developed DF or DHF, despite the majority of vaccinees developing mild

and transient symptoms of headache and myalgia, and a few vaccinees also

developed macular and papular rashes, and pruritis. The DENV-3 and DENV-4

vaccines were reported to be more reactogenic than the DENV-1 or DENV-2

vaccines. While all four monovalent DENV vaccines elicited virus-specific antibody

responses, the seroconversion rate was lower in vaccinees immunised with the

DENV-1 vaccine than with the other monovalent DENV vaccines (Kanesa-thasan et

al., 2001).

In contrast, vaccinees from the trial immunised with the tetravalent DENV vaccine

developed more moderate symptoms of headache, malaise, myalgia, pruritis and rash

49

than did the recipients of the monovalent DENV vaccines. Two of the tetravalent

vaccinees also presented with an elevated temperature and a low white blood cell

count ten days following immunisation, which was classified as DF. In addition,

although all tetravalent vaccinees seroconverted, only one of the ten vaccinees

developed neutralising antibodies against all four DENV serotypes, while the other

vaccinees developed predominantly a DENV-3 specific neutralising antibody

response and some vaccinees also produced a minor DENV-1 specific antibody

response. Reverse transcriptase-polymerase chain reaction (RT-PCR) assays

performed with sera from the tetravalent vaccinees indicated extensive viremia with

DENV-3, and peripheral blood mononuclear cells (PBMC) obtained from the

tetravalent vaccinees proliferated to a high level when stimulated with inactivated

DENV-1 or DENV-3 antigens only (Kanesa-thasan et al., 2001; Rothman et al.,

2001).

It was postulated that the preferential replication of DENV-3 observed in tetravalent

vaccinees may have been due to competitive interference between the four

attenuated DENV, and an early entry and/or replication of DENV-3 may have

induced the release of defective interfering virus particles and/or interferons from

infected host cells, which prohibited the entry and/or replication by the other DENV

serotypes (Kanesa-thasan et al., 2001). Additional studies demonstrated that

immunisation with multiple doses of the tetravalent vaccine increased the immune

responses against all four DENV serotypes in vaccinees (Sabchareon et al., 2002).

The safety and immunogenicity of the tetravalent DENV vaccine after a three dose

immunisation schedule also were evaluated in Thai children (Sabchareon et al.,

2004). Thirty-five percent of children immunised with the tetravalent DENV vaccine

developed moderate symptoms of illness following the first immunisation. The most

common symptoms reported by these children were fever, macular or papular rash,

headache, myalgia and pruritus. Following the first immunisation, 19% of children

developed neutralising antibodies against all four DENV serotypes and 54% of

children developed neutralising antibodies against at least three DENV serotypes.

The majority of children (95%) developed neutralising antibodies against DENV-3

following the first immunisation, while only 57%, 49% and 41% of children

developed neutralising antibodies against DENV-1, DENV-2 and DENV-4

50

respectively at this time. Following the second immunisation given three to five

months after the first dose, 66% of children developed neutralising antibodies against

all four DENV serotypes and 89% of children developed neutralising antibodies

against at least three DENV serotypes. Following the third immunisation given eight

to twelve months after the second dose, 100% of children developed neutralising

antibodies against all four DENV serotypes. Only 89% of children immunised with a

second formulation of the tetravalent DENV vaccine containing reduced amounts of

DENV-2 and DENV-4 developed neutralising antibodies against all four DENV

serotypes after three doses of the vaccine.

WRAIR live attenuated tetravalent DENV vaccine

The WRAIR developed a number of attenuated DENV-1 strain 45AZ5, DENV-2

strain S16803, DENV-3 strain CH53489 and DENV-4 strain 341750 vaccine

candidates by serial passages in PDK cells. Safety and immunogenicity studies of

these viruses were conducted in monkeys (Eckels et al., 2003), and in Phase I human

clinical trials at the University of Maryland Center for Vaccine Development (CVD)

and the United States Army Medical Research Institute for Infectious Diseases

(USAMRIID) to identify the superior vaccine candidates for each of the four DENV

serotypes (Edelman et al., 1994; Hoke et al., 1990; Kanesa-Thasan et al., 2003).

In general, the results from these trials indicated an inverse correlation between the

PDK passage level of the vaccine candidate viruses and the infectivity of the viruses

in monkeys and in humans. Humans immunised with the higher PDK passage level

viruses also experienced less severe symptoms, such as fever, rash and headache,

than humans immunised with the lower PDK passage level viruses (Edelman et al.,

1994; Kanesa-Thasan et al., 2003). Based on the results from these studies, the

DENV-1 PDK-20, DENV-2 PDK-50, DENV-3 PDK-20 and DENV-4 PDK-20

viruses attained acceptable levels of reactogenicity and immunogenicity in human

trials and were selected as vaccine candidates for expanded clinical studies and

incorporation into a tetravalent formulation (Kanesa-Thasan et al., 2003).

In an expanded Phase I human clinical study of the selected monovalent DENV

vaccine candidates, the DENV-1 vaccine was demonstrated to be the most

reactogenic after a single immunisation with over 40% of vaccinees experiencing

51

moderate symptoms of myalgia or arthralgia, generalised rash and fever. However,

the DENV-1 vaccine elicited the highest level of seroconversion and titres of virus-

specific neutralising antibodies in vaccinees after a single immunisation than did the

other monovalent DENV vaccine candidates. The DENV-3 and DENV-4 vaccines

were the least reactogenic, but produced low seroconversion rates (50-60%) in

vaccinees. A second immunisation improved the seroconversion rate of the DENV-3

vaccine, but not of the DENV-4 vaccine (Sun et al., 2003).

Vaccinees immunised with the tetravalent DENV vaccine developed moderate

symptoms of generalised rash and fever, and some tetravalent vaccinees also

experienced severe headache or retro-orbital pain. Although all tetravalent vaccinees

seroconverted after a single immunisation, only two of the ten vaccinees developed

neutralising antibodies against all four DENV serotypes. An additional two

tetravalent vaccinees developed neutralising antibodies against all four DENV

serotypes after three immunisations at zero, one and four months (Sun et al., 2003).

Fifteen different tetravalent vaccine formulations of the selected DENV vaccine

candidates, immunised at zero and one month, also failed to induce a tetravalent

neutralising antibody response in all vaccinees. However, two of these formulations

elicited a tetravalent neutralising antibody response in 75% of vaccinees and seven

formulations induced neutralising antibodies against three DENV serotypes in all

vaccinees (Edelman et al., 2003). The DENV-4 vaccine candidate was significantly

the least immunogenic of the four DENV vaccine candidates (Edelman et al., 2003;

Sun et al., 2003). Several tetravalent formulations of the DENV vaccine candidates,

which elicited an acceptable balance of reactogenicity and immunogenicity in

vaccinees, have been identified for expanded Phase II human clinical trials in

collaboration with GlaxoSmithKline Biologicals as a co-development partner

(Edelman et al., 2003).

52

1.6.1.2 Infectious clone-derived vaccines

The development of efficacious live attenuated virus vaccines can be problematic

due to the ability of live viruses to revert to virulence in vaccine recipients (Bonaldo

et al., 2000; Chambers et al., 1999). However, the stability of a live attenuated virus

can be increased by introducing multiple genetic markers associated with virus

attenuation and/or abrogating genetic markers associated with virus virulence into

the genome of virus. Two major advances in recombinant DNA technology have

made it possible to develop such stable live attenuated flavivirus vaccines.

Live attenuated recombinant flaviviruses

The first major advance, which forms the basis of what is now known as infectious

clone technology, involved the production of infectious RNA viruses by transfection

of cultured cells with viral RNA genomes derived from in vitro transcription of virus

infectious clones (Racaniello and Baltimore, 1981). Currently, infectious clones for

several flaviviruses have been developed, including TBEV (Gritsun and Gould,

1998; Mandl et al., 1997), Murray Valley encephalitis virus (MVEV) (Hurrelbrink et

al., 1999), WNV (Yamshchikov et al., 2001b), YFV (Rice et al., 1989), JEV

(Sumiyoshi et al., 1992), Kunjin virus (KUNV) (Khromykh and Westaway, 1994),

DENV-1 (Polo et al., 1997), DENV-2 (Bray and Lai, 1991; Gualano et al., 1998;

Kapoor et al., 1995; Kinney et al., 1997; Puri et al., 2000; Sriburi et al., 2001) and

DENV-4 (Cahour et al., 1995). Infectious KUNV also has been produced by

immunising animals with DNA that is capable of expressing the full-length RNA

genome of the virus (Hall et al., 2003).

Mutant flaviviruses, developed by site-specific genetic manipulation of the infectious

clones, also have provided opportunities to elucidate the molecular basis of virus

virulence, attenuation, host range restriction and virus replication (Table 1.02). The

knowledge acquired from these studies has enabled the development of more stable

live attenuated flaviviruses, including DENV.

53

TABLE 1.02 – Summary of the studies conducted using DENV infectious cDNA clones

Dengue Virus Summary of results

References

Dengue virus type 1 strain Western Pacific • Substitution of nt pos. 73-79 of DENV-1 3’UTR with nt pos. 73-79 of DENV-2 3’UTR produced mutant DENV-1 with efficient replication in LLC-MK2 but not in C6/36 cultured cells.

(Markoff et al., 2002)

Dengue virus type 2 strain New Guinea C (mouse neurovirulent mutant)

• Genetic determinants responsible for mouse neurovirulence were mapped to the C/prM/E structural protein genes. (Bray and Lai, 1991)

Dengue virus type 2 strain New Guinea C (mouse neurovirulent mutant)

• Mutant DENV-2 with amino acid substitutions at positions 383-385 of the E protein (Glu-Pro-Gly) were resistant to neutralisation by a DEN2-specific monoclonal antibody (MAb 3H5). The mutant DENV-2 also were less neurovirulent for mice.

(Hiramatsu et al., 1996)

Dengue virus type 2 strain New Guinea C

• Substitutions of Asp for Glu, and Lys for Glu at positions 71 and 126 of the E protein respectively produced mutant DENV-2 that exhibited mouse neurovirulence phenotype similar to DENV-2 mouse neurovirulent mutants.

(Bray et al., 1998)

Dengue virus type 2 strain New Guinea C • Substitution of Lys for Glu at position 126 of the E protein produced mutant DENV-2 that exhibited mouse neurovirulence phenotype similar to DEN2 mouse neurovirulent mutants.

(Gualano et al., 1998)

Dengue virus type 2 strain New Guinea C • Substitution of Ile for Ser at position 164 of the prM protein reduced the efficiency of prM/E cleavage and produced mutant DENV-2 with reduced mouse neurovirulence and titre (5 to 10-fold reduction).

• Substitution of Leu for Thr at position 166 of the prM protein abrogated the prM/E cleavage and did not produce

any detectable virus. • Substitution of Ala for Asn at position 207 of NS1 resulted in the removal of the second glycosylation site of the

protein and produced mutant DENV-2 viruses with reduced ability to grow in cultured cell, as well as exhibiting reduced mouse neurovirulence.

(Pryor et al., 1998)

Dengue virus type 2 strain 16681 • A genetic determinant of attenuation was mapped to the 5’UTR. (Kinney et al., 1997)

Dengue virus type 2 strain 16681 • Substitution of T for C at position 57 of the 5’UTR produced mutant DENV-2 with reduced plaque size, replication in C6/36 cultured cells and mouse neurovirulence.

• Substitution of Asp for Gly at position 53 of the NS1 protein produced mutant DENV-2 with temperature sensitivity

and reduced plaque size, replication in C6/36 cultured cells and mouse neurovirulence. • Substitution of Val for Glu at position 250 of the NS3 protein produced mutant DENV-2 with temperature

sensitivity and reduced plaque size and mouse neurovirulence.

(Butrapet et al., 2000)

54

TABLE 1.02 (cont.) – Summary of the studies conducted using DENV infectious cDNA clones


References

Dengue virus type 2 strain New Guinea C • Substitution of stem loop (93 nucleotides) of DENV-2 3’UTR with stem loop (96 nucleotides) of WNV 3’UTR, or nt pos. 7-17 and 63-73 of DENV-2 3’UTR with nt pos. 7-16 and 67-75 of WNV 3’UTR produced mutant DENV-2 with highly reduced ability to replicate in C6/36 and LLC-MK2 cultured cells compared to wildtype DENV-2.

• No viable virus was produced by the substitution of nt pos. 1-17 and 63-93 of DENV-2 3’UTR with nt pos. 1-16 and

67-96 of WNV 3’UTR, or nt pos. 1-17 and 63-79 of DENV-2 3’UTR with nt pos. 1-16 and 67-80 of WNV 3’UTR. • Substitution of nt pos. 18-62 of DENV-2 3’UTR with nt pos. 17-66 of WNV 3’UTR produced mutant DENV-2 with

slightly reduced ability to replicate in C6/36 and LLC-MK2 cultured cells compared to wildtype DENV-2. • Substitution of nt pos. 80-93 of DENV-2 3’UTR with nt pos. 81-96 of WNV 3’UTR produced mutant DENV-2 that

replicated efficiently in C6/36 and LLC-MK2 cultured cells, while substitution of nt pos. 1-7 and 73-79 of DENV-2 3’UTR with nt pos. 1-7 and 75-80 of WNV 3’UTR only produced mutant DENV-2 that replicated efficiently in LLC-MK2 cultured cells.

(Zeng et al., 1998)

Dengue virus type 2 strain New Guinea C • Substitution of Asp for Asn at position 390 of the E protein produced mutant DENV-2 with reduced ability to replicate in monocyte-derived macrophages.

(Pryor et al., 2001)

Dengue virus type 2 strain New Guinea C • Substitutions of Lys-Arg-Glu at positions 63, 64 and 66 for Ala, or Glu-Glu-Glu at positions 91, 93 and 94 for Ala of the NS3 protein produced mutant DENV-2 with reduced yield and plaque size.

• Substitutions of Glu-Lys-Glu at positions 169, 170 and 173 for Ala, or Glu-Asp-Asp at positions 179, 180 and 181

for Ala of the NS3 protein produced mutant DENV-2 with reduced plaque size.

(Matusan et al., 2001a)

Dengue virus type 2 strain New Guinea C • Substitutions of Ala for Gly and Ala for Lys at positions 198 and 199 of the NS3 protein respectively abrogated both ATPase and helicase activity and failed to produce any viable virus.

• Substitutions of Ala for Arg at positions 457 and 458, or Arg-Lys-Asn-Gly-Lys at positions 376-380 for Ala, of the

NS3 protein abrogated helicase activity and failed to produce viable virus. • Substitutions of Asp-Glu-Glu at positions 334-336 for Ala of the NS3 protein produced mutant DENV-2 with a

temperature-sensitive phenotype.

(Matusan et al., 2001b)

55

TABLE 1.02 (cont.) – Summary of the studies conducted using DENV infectious cDNA clones


References

Dengue virus type 4 strain 814669 • Deletion of nt pos. 18-43 in the long stem loop structure of the 5’UTR was still able to produce viable DENV-4. • Deletion of nt pos. 82-87 in the 5’UTR resulted in low RNA translation (approximately 25% of wildtype virus) and

produced mutant DENV-4 that failed to produce plaques on C6/36 cultured cells and was unable to replicate in A. aegypti and A. albopictus mosquitos following intrathoracic inoculation.

(Cahour et al., 1995)

Dengue virus type 4 strain 814669 • Sizable regions at nt pos. 113 or more upstream of the 3’ terminus of the 3’UTR could be deleted without loss of virus viability. However, deletion at nt pos. 172-107 did not produce viable virus.

• All viable mutant DENV-4 produced with deletion in 3’UTR exhibited a spectrum of growth restriction in cell

culture as indicated by plaque size and development, as well as one step growth analysis.

(Men et al., 1996)

Dengue virus type 4 strain 814669 • Mutant DENV-4 produced by a 30 nucleotide deletion at nt pos. 172-143 in the 3’UTR demonstrated a slight reduction in ability to replicate in C6/36 but not Vero cultured cells. The mutant DENV-4 also exhibited a reduced capacity for infecting the midgut and for causing a disseminated infection in mosquitoes infected by artificial membrane feeding.

(Troyer et al., 2001)

Dengue virus type 4 strain 814669 • 8 Vero cell adaptation mutant DENV-4 were produced by incorporating amino acid substitution Ile for Thr at position 1597, Ser for Pro at position 1632, Val for Ala at position 2351, Leu for Ser at position 2354, Leu for Phe at position 2354, Gly for Ser at position 2361, Ala for Val at position 2482, or Lys for Arg at position 2510. These mutant DENV-4 produced plaques with increase diameter in Vero cells but not C6/36 cells.

• The mutant DENV-4 incorporating the amino acid substitution Ile for Thr at position 1597, or Ser for Pro at position

1632 also demonstrated reduced replication in suckling mouse brain indicating attenuation. None of the other mutant DENV-4 significantly increased the level of replication in suckling mouse brain.

(Blaney et al., 2003)

Abbreviations: nt pos. – Nucleotide position; C6/36 – Aedes albopictus mosquito larvae cells; LLC-MK2 – Macaca mulatta (Rhesus monkey) kidney cells; Vero – Cercopithecus aethiops (African green monkey) kidney cells.

56

Markoff et al., (2002) and Zeng et al., (1998) demonstrated that substituting genomic

regions in the 3’UTR of DENV-1 and DENV-2 with the corresponding regions of

DENV-2 and WNV respectively, produced mutant viruses with reduced ability to

replicate in A. albopictus mosquito (C6/36) cells. The mutant DENV-1 also

exhibited an attenuated phenotype compared to the parental wildtype DENV-1

following immunisation of rhesus monkeys. Monkeys immunised with the mutant

DENV-1 also produced similar titres of virus-specific neutralising antibodies to

monkeys immunised with parental DENV-1, and were protected against challenge

with high doses of parental DENV-1, as indicated by the absence of viremia and a

significant increase in neutralising antibody titres.

Similarly, a mutant DENV-2, produced by a nucleotide substitution in the 5’UTR

and amino acid substitutions in the NS1 and NS3 proteins, exhibited reduced ability

to replicate in C6/36 cells (Butrapet et al., 2000). Furthermore, mice immunised with

the mutant DENV-2 developed significantly less neurovirulent symptoms compared

to mice immunised with parental wildtype DENV-2.

Mutant DENV-1 (Whitehead et al., 2003a), DENV-2 (Blaney et al., 2004b) and

DENV-4 (Men et al., 1996) also were produced by deleting a 30 nucleotide region

from the 3’UTR of the virus. However, although the mutant DENV-1, DENV-2 and

DENV-4 exhibited an attenuated phenotype following immunisation of rhesus

monkeys, the immunised monkeys produced lower titres of homologous DENV

serotype-specific neutralising antibodies than monkeys immunised with the parental

wildtype DENV-1, DENV-2 or DENV-4 respectively (Blaney et al., 2004b; Men et

al., 1996; Whitehead et al., 2003a). In addition, 14 of 20 human volunteers

immunised with the mutant DENV-4 developed viremia following immunisation and

50% of vaccinees also developed a transient rash. Nevertheless, all vaccinees

seroconverted with the production of virus-specific neutralising antibodies (Durbin

et al., 2001). Mutant DENV-3 containing a 30 nucleotide deletion in the 3’UTR

failed to exhibit an attenuated phenotype compared to wildtype DENV-3 (Blaney et

al., 2004a).

Furthermore, the incorporation of either a Ser to Leu substitution at amino acid

position 158 of NS3, or a Lys-His to Ala-Ala substitution at amino acid position

57

200-201 of NS5, into the mutant DENV-4 containing the 30 nucleotide deletion in

the 3’ UTR produced mutant DENV-4 that exhibited greater attenuation following

immunisation of rhesus monkeys than the parental mutant DENV-4 containing the

30 nucleotide deletion in the 3’ UTR only (Hanley et al., 2004).

Live chimeric flaviviruses

The second major advance in the development of stable live attenuated flavivirus

vaccines involved the construction of chimeric flaviviruses by combining the

properties associated with the structural proteins of one flavivirus, such as virus

attachment and the majority of virus neutralisation epitopes, with the properties

associated with the non-structural proteins and UTRs of a heterologous flavivirus

that possesses desirable vaccine phenotypes, such as reduced virus replication and/or

attenuation (Bray et al., 1996; Chambers et al., 1999; Huang et al., 2000).

Bray et al., (1996) constructed chimeric DENV-1/4 and DENV-2/4 by substituting

the DENV-4 C-prM-E protein genes or the DENV-4 prM-E protein genes with the

corresponding genes from DENV-1 or DENV-2 respectively. All monkeys

immunised with chimeric DENV-1/4 or DENV-2/4 viruses developed neutralising

antibodies against DENV-1 or DENV-2 respectively, but not against DENV-4, and

these immunised monkeys also failed to develop viremia when challenged with

DENV-1 or DENV-2 respectively.

A chimeric DENV-1/2 also was developed by substituting the C-prM-E protein

genes of DENV-2 with the corresponding genes from DENV-1 (Huang et al., 2000).

The chimeric DENV-1/2 exhibited phenotypic characteristics similar to the parental

attenuated DENV-2, such as a reduced ability to replicate in C6/36 cells and the

attenuation phenotype, as indicated by the absence of neurovirulent symptoms

following immunisation of suckling mice. All mice immunised with chimeric

DENV-1/2 seroconverted and produced DENV-1 specific neutralising antibodies.

Chimeric DENV-1/2, DENV-3/2 and DENV-4/2 also were developed by substituting

the prM-E protein genes of DENV-2 with the corresponding genes from DENV-1,

DENV-3 or DENV-4 respectively (Huang et al., 2003). All mice immunsed with

chimeric DENV-1/2 produced DENV-1 specific neutralising antibodies and survived

58

challenge with a lethal modified strain of DENV-1 (Mochizuki strain). Mice

immunised with chimeric DENV-3/2 or DENV-4/2 produced neutralising antibodies

against DENV-3 and DENV-4 respectively. In addition, mice immunised with a

tetravalent formulation consisting of DENV-1/2, DENV-3/2, DENV-4/2 and the

parental DENV-2 backbone virus produced neutralising antibodies against all four

DENV serotypes.

A number of chimeric DENV-2/4 also were developed by substituting either the

DENV-4 C-prM-E protein genes or the DENV-4 prM-E protein genes with the

corresponding genes from DENV-2 (Whitehead et al., 2003b). Both chimeric

DENV-2/4 viruses exhibited an attenuated phenotype following immunisation of

rhesus monkeys compared to parental wildtype DENV-2 or DENV-4, as indicated by

decreases in mean peak viremia titre, duration of viremia and mean serum

neutralising antibody titre against DENV-2. In addition, both chimeric DENV-2/4

viruses demonstrated reduced infectivity and dissemination in Aedes aegypti than the

parental wildtype DENV-2 or DENV-4.

Acambis (Pty, Ltd) also has developed a number of live chimeric flaviviruses

(ChimeriVax) by substituting the prM-E protein genes of the YFV 17D vaccine virus

infectious clone with the corresponding genes from heterologous flaviviruses

(Arroyo et al., 2001b; Chambers et al., 1999; Guirakhoo et al., 2001; Guirakhoo et

al., 2000). Currently, ChimeriVax viruses for JEV (ChimeriVax-JEV), WNV

(ChimeriVax-WNV) and each of the four DENV serotypes (ChimeriVax-DENV-1 to

-4) have been produced and evaluated as potential vaccine candidates.

ChimeriVax-JEV was produced by incorporating the prM-E protein genes of JEV

SA14-14-2 vaccine strain into the YFV 17D backbone (Chambers et al., 1999). Mice

and rhesus monkeys immunised with ChimeriVax-JEV produced high titres of virus-

specific neutralising antibodies against JEV, but not against YFV, and immunised

animals also were protected from developing encephalitis and viremia following

intracerebral challenge with a lethal dose of JEV, which demonstrates the high

immunogenicity of ChimeriVax-JEV (Arroyo et al., 2001a; Chambers et al., 1999;

Guirakhoo et al., 1999; Monath et al., 2000; Monath et al., 1999).

59

Human clinical trials of ChimeriVax-JEV also were conducted to evaluate the issue

of anti-vector immunity, which could reduce the efficacy of ChimeriVax-derived

virus vaccines in individuals with pre-existing immunity against YFV (Monath et al.,

2002). Pre-existing immunity against a flavivirus, either acquired through

immunisation or a natural infection, could interfere with the immune response

against a heterologous flavivirus depending on the degree of antigenic similarity

between the two viruses. Prior immunity against DENV and certain other

flaviviruses are known to provide cross-protection and reduce the development of

viremia against YFV (Henderson et al., 1970; Theiler and Anderson, 1975), while

prior immunity against JEV does not reduce viremia against YFV (Sweet et al.,

1962). With ChimeriVax-derived viruses, the humoral and cell-mediated immune

responses, such as cytolytic antibodies and/or cytotoxic T-lymphocytes (CTLs),

directed against the NS1 or NS3 proteins of the YFV 17D backbone in individuals

with prior immunity against YFV, could induce early cross-protection following

ChimeriVax virus immunisation. This would reduce the level of virus-infected cells

and viremia, which then could limit antigen expression and the development of

immunity against the heterologous prM-E proteins (Guirakhoo et al., 2001; Monath

et al., 2002).

However, all vaccinees, regardless of YFV-immune status, seroconverted after a

single ChimeriVax-JEV immunisation and developed neutralising antibodies against

JEV, but not YFV. A low-grade viremia of ChimeriVax-JEV also was detected in

80% of vaccinees, which was similar to the levels of YFV detected in YFV-

nonimmune individuals immunised with YFV 17D vaccine. In addition, YFV-

immune individuals developed a more rapid and higher level of JEV-specific

antibody response than YFV-nonimmune individuals following ChimeriVax-JEV

immunisation. These results suggested that ChimeriVax-JEV is a well tolerated and

highly immunogenic candidate vaccine, which is comparable to the YFV 17D

vaccine. It also demonstrated that pre-existing immunity against YFV does not

reduce the immune response to ChimeriVax-JEV immunisation. In contrast, pre-

existing immunity to YFV appeared to enhance the development of JEV-specific

neutralising antibodies in an anamnestic-like response (Monath et al., 2002).

60

ChimeriVax-DENV also have been developed for each of the four DENV serotypes

by incorporating the prM-E protein genes of DENV-1 836-1 Philippine strain,

DENV-2 PUO218 Thailand strain, DENV-3 PaH881/88 Thailand strain and DENV-

4 814669 Caribbean strain into the YFV 17D backbone. In addition, a tetravalent

formulation, incorporating each of the four monovalent ChimeriVax-DENV, have

been produced (Guirakhoo et al., 2001; Guirakhoo et al., 2000).

Both monovalent and tetravalent ChimeriVax-DENV vaccines exhibited similar

levels of attenuation in mice and rhesus monkeys to the YFV 17D, but were

significantly more attenuated than the homologous wildtype DENV. Monkeys

immunised with the tetravalent vaccine also produced neutralising antibodies to all

four DENV serotypes, and developed viremia with a greater mean titre and duration

compared to monkeys immunised with YFV 17D vaccine. However, monkeys

immunised with a second dose of the tetravalent vaccines six months later failed to

developed viremia, which suggested in vivo virus neutralisation by homologous

virus-specific neutralising antibodies (Guirakhoo et al., 2001; Guirakhoo et al.,

2002; Guirakhoo et al., 2004; Guirakhoo et al., 2000).

The majority of monkeys immunised with the tetravalent vaccine also were protected

against challenge with each of the four wildtype DENV serotypes as indicated by the

absence of viremia following challenge (Guirakhoo et al., 2004). In addition, anti-

vector immunity was not observed following immunisation of YFV-immune and

YFV-nonimmune monkeys with ChimeriVax-DENV. Studies showed no statistically

significant differences in DENV-specific neutralising antibody responses between

YFV-immune and YFV-nonimmune monkeys after immunisation with the

tetravalent vaccine six months following YFV immunisation, with the exception of

the antibody responses against DENV-3, which was found to be significantly higher

in YFV-immune monkeys (Guirakhoo et al., 2001; Monath et al., 2002).

ChimeriVax-WNV also has been developed by incorporating the prM-E protein

genes of WNV NY-99 strain into the YFV 17D backbone. Safety and

immunogenicity studies of ChimeriVax-WNV in experimental animal models are

currently underway (Arroyo et al., 2001b; Tesh et al., 2002).

61

1.6.1.3 Vaccinia virus-derived vaccines

Recombinant vaccinia viruses are able to replicate at the site of inoculation and

express multiple proteins in a context that will elicit both humoral and cell-mediated

immune responses. Furthermore, they exhibit stability, which allows for easy

transport and minimal storage requirements, and are cost-effective to manufacture,

which would facilitate their development in less developed countries (Kinney and

Huang, 2001; Panicali et al., 1983; Perkus et al., 1985; Smith and Moss, 1983).

Recombinant vaccinia viruses expressing flavivirus proteins derived from St. Louis

encephalitis virus (SLEV) (Venugopal et al., 1995), JEV (Konishi and Mason, 1993;

Konishi et al., 1991; Mason et al., 1991), YFV (Pincus et al., 1992) and DENV

(Bray et al., 1989; Fonseca et al., 1994) have been developed. Studies demonstrated

that mice immunised with vaccinia viruses incorporating the C-terminal C-prM-E

flavivirus genes, which resulted in the in situ synthesis and secretion of RSPs,

produced high titres of virus-specific neutralising and hemagglutination-inhibiting

antibodies that were capable of protecting immunised mice against challenge with

live homologous viruses (Bray et al., 1989; Fonseca et al., 1994; Konishi et al.,

1991; Pincus et al., 1992). In contrast, recombinant vaccinia viruses incorporating

other combinations of flavivirus genes have, in general, failed to elicit high levels of

virus-specific antibodies in mice and immunised mice also were not protected

against challenge with live homologous viruses (Bray et al., 1989; Konishi et al.,

1991; Pincus et al., 1992).

Although vaccinia virus-derived vaccines offer several advantages, potential risks of

utilising these vaccines exist, including the possibility of inducing vaccinia-

associated diseases in humans and for contact transmission across the broad

vertebrate host range of the virus (Konishi et al., 1997a; Konishi et al., 1994; Men et

al., 2000; Nam et al., 1999). These issues were addressed by the development of the

highly attenuated vaccinia virus strains NYVAC, MVA and ALVAC (Carroll and

Moss, 1997; Tartaglia et al., 1992; Taylor et al., 1994).

NYVAC and MVA were derived from the Copenhagen and Ankara strain of

vaccinia viruses respectively. NYVAC was developed by deleting genes associated

with virus virulence, replication and host range (Tartaglia et al., 1992), and MVA

62

was attenuated by serial passages in primary chick embryo fibroblasts (CEF) cells

(Carroll and Moss, 1997). ALVAC was derived from a canarypox strain of avipox

virus, which replicates only in avian species, and therefore is naturally defective in

its ability to replicate in mammalian species (Taylor et al., 1994).

MVA-derived JEV, DENV-2 and DENV-4 virus vaccines have been developed by

incorporating the prM-E protein genes of JEV (Nam et al., 1999) and the C-terminal

truncated E protein genes of DENV-2 and DENV-4 respectively (Men et al., 2000).

Mice immunised with MVA-JEV vaccine developed virus-specific neutralising

antibodies and were protected against challenge with a lethal dose of JEV (Nam et

al., 1999). However, only mice immunised with MVA-DENV-2 developed virus-

specific neutralising antibodies, while mice immunised with MVA-DENV-4 failed to

produce detectable levels of neutralising antibodies. In addition, rhesus monkeys

immunised with three doses of MVA-DENV-2 were completely protected from

developing viremia when challenged with live DENV-2 (Men et al., 2000).

NYVAC- and ALVAC-derived JEV vaccines also have been developed by

incorporating the C-terminal C-prM-E-NS1-NS2A protein genes of JEV (Konishi et

al., 1997a; Konishi et al., 1994; Raengsakulrach et al., 1999). Mice and rhesus

monkeys immunised with these recombinant vaccinia viruses developed virus-

specific neutralising antibodies and also were protected from developing encephalitis

following challenge with a lethal dose of JEV.

In addition, the NYVAC-JEV and ALVAC-JEV vaccines were assessed in Phase I

human clinical trials to evaluate the potential of inducing anti-vector immunity in

individuals who have been immunised or exposed previously with vaccinia viruses

(Chambers et al., 1997; Kinney and Huang, 2001). Although both the NYVAC-JEV

and ALVAC-JEV vaccines appeared to be safe and well tolerated in humans, the

NYVAC-JEV vaccine induced only JEV-specific neutralising antibodies in vaccinia-

nonimmune individuals, while vaccinia-immune individuals failed to produce

detectable levels of neutralising antibodies against JEV. In contrast, individuals

immunised with the ALVAC-JEV vaccine developed poor neutralising antibody

responses against JEV, regardless of their vaccinia virus immune status (Kanesa-

thasan et al., 2000; Konishi et al., 1998a). These results suggested that pre-existing

63

immunity to vaccinia viruses may suppress the production of neutralising antibodies

against the foreign proteins expressed by the recombinant vaccinia virus.

Consequently, individuals with pre-existing immunity to vaccinia viruses may be at a

disadvantage for vaccinia-derived vaccines (Kanesa-thasan et al., 2000).

1.6.2 Non-replicating virus vaccines

Non-replicating virus vaccines, such as inactivated whole virus or peptide subunit

vaccines, carry little risk of infection but are generally limited in their ability to

induce a strong and effective immune response (Thomssen, 1975). Non-replicating

vaccines preferentially elicit only short-term humoral immune responses, but are

usually inefficient at eliciting cell-mediated immune responses, which are required to

eliminate viruses that have established intracellular infections. In addition, these

vaccines usually require multiple immunisations to maintain a state of adequate

protective immunity in recipients, which makes their application complicated in

diverse geographical locations and in less developed countries (Chambers et al.,

1997; Kinney and Huang, 2001).

1.6.2.1 Inactivated whole dengue virus vaccines

Both formalin- and gamma irradiation-inactivated DENV-2 have been developed

and evaluated as potential vaccine candidates (Putnak et al., 1996b). Mice

immunised with gamma irradiation-inactivated DENV-2 produced lower titres of

virus-specific neutralising and hemagglutination inhibiting antibodies than mice

immunised with formalin-inactivated DENV-2. However, mice and rhesus monkeys

immunised repeatedly with formalin-inactivated DENV-2 were only partially

protected from challenge with live homologous DENV and developed viremia with

reduced duration and titre compared to unimmunised control animals (Putnak et al.,

1996a; Putnak et al., 1996b). This suggested that frequent booster immunisations

with these vaccines would be required to ensure complete protection against DENV

infections (Chambers et al., 1997).

64

1.6.2.2 Recombinant peptide subunit dengue vaccines

Escherichia coli expression systems

A number of studies have described the use of Escherichia coli (E.coli) expression

systems to produce high yields of recombinant flavivirus proteins, including those

derived from YFV (Cane and Gould, 1988a) and JEV (Chia et al., 2001; Seif et al.,

1995). The production of DENV proteins in E.coli have included Domain III of the E

protein (Simmons et al., 2001a; Simmons et al., 2001b) and a truncated E/NS1

protein, which consisted of the C-terminal 204 amino acids of the E protein

combined with the N-terminal 65 amino acids of the NS1 protein (Srivastava et al.,

1995). Mice and rhesus monkeys immunised repeatedly with these proteins elicited

transient immune responses, consisting of both virus-specific neutralising and

haemagglutination-inhibiting antibodies. However, immunised animals exhibited no

reduction in the duration or titre of viremia compared to unimmunised control

animals when challenged with live homologous DENV. This suggested that repeated

immunisations with these proteins would be necessary to maintain a state of

protective immunity against DENV infections (Chambers et al., 1997).

Baculovirus expression systems

The use of baculoviruses to express recombinant proteins has a number of

advantages, such as the ability to process the recombinant proteins in a manner that

is similar to the processing of native proteins (Trent et al., 1997). A number of

studies have utilised baculovirus expression systems to produce high yields of

recombinant flavivirus proteins, including those derived from SLEV (Venugopal et

al., 1995), TBEV (Marx et al., 2001), YFV (Despres et al., 1991; Shiu et al., 1991),

JEV (McCown et al., 1990) and DENV.

DENV proteins that have been produced using baculoviruses included full-length E

proteins (Kelly et al., 2000; Velzing et al., 1999; Zhang et al., 1988), C-terminal

truncated E proteins (Delenda et al., 1994a; Delenda et al., 1994b; Staropoli et al.,

1996; Staropoli et al., 1997), NS1 protein (Qu et al., 1993), and a hybrid E protein

consisting of the N-terminal 288 amino acids of DEN2 combined with the C-

terminal 135 amino acids of DEN3 (Bielefeldt-Ohmann et al., 1997). Although

repeated immunisation of both mice and rhesus monkeys with a number of these

recombinant proteins elicited the production of virus-specific neutralising antibodies,

65

immunised animals developed viremia when challenged with live homologous

DENV. This suggested that regular booster immunisations with these proteins would

be required to ensure complete protection against DENV infections (Chambers et al.,

1997).

1.6.2.3 Recombinant subviral particle vaccines

The discovery that flavivirus RSPs could mimic the antigenic structure and function

of native virions has raised considerable interest in their use as vaccines (Heinz and

Allison, 2000). Flavivirus RSPs for JEV (Konishi et al., 2001; Konishi et al., 1992;

Konishi et al., 1997b; Mason et al., 1991); YFV (Pincus et al., 1992); TBEV (Heinz

et al., 1995) and DENV-2 (Gruenberg and Wright, 1992; Konishi and Fujii, 2002)

have been produced using various gene expression systems, such as recombinant

vaccinia viruses and DNA expression vectors. Mice immunised with flavivirus RSPs

produced both humoral and cell-mediated immune responses that were capable of

protecting immunised animals against challenge with lethal doses of live

homologous virus and preventing the onset of viremia (Table 1.03).

The ability of flavivirus RSPs to elicit both humoral and cell-mediated immune

responses has been attributed, in part, to their ability to induce fusion following

endocytosis by host cells in a manner similar to that of native flavivirus virions

(Schalich et al., 1996). This enabled the RSPs to be processed and presented on

MHC class I molecules, which results in the activation of cell-mediated immune

responses and the production of CD8+ CTLs. In addition, the uptake of RSPs by

antigen presenting cells (APCs) elicits humoral immune responses and the

production of virus-specific neutralising antibodies (Aberle et al., 1999; Heinz and

Allison, 2000; Heinz et al., 1995; Konishi et al., 1992; Konishi et al., 1997b).

In addition to being highly immunogenic, RSP-derived vaccines exhibit the safety of

non-replicating virus vaccines with no risk of infection or reversion to virulence due

to the absence of pathogen-derived replication components (Heinz and Allison,

2000). RSPs also are highly stable with no detectable decrease in hemagglutinating

activity following incubation at 40C for 7 days or 280C for 3 days (Konishi et al.,

1992).

66

TABLE 1.03 – Summary of studies using flavivirus recombinant subviral particle vaccines

Flavivirus

Vector used / Cell line transfected

Immunisation schedule route/dose (duration p.i.)

Host animal immunised

Summary of results References

Dengue virus type 2

DNA plasmid / CHO-K1 cells

(a) s.c. / 2x 100ng of RSP with Freund’s complete and incomplete adjuvants respectively (0, 2 weeks)

(b) s.c. / 2x 400ng of

RSP with Freund’s complete and incomplete adjuvants respectively (0, 2 weeks)

3 week old female BALB/c mice

• Mice immunised by (a) and (b) produced DENV-2-specific NT antibody titres of 1:20 and 1:40 (PRNT80) respectively.

• Mice immunised by (a) and (b) and challenged with DENV-2 virus

(1.5x107 PFU) inoculated i.p. developed DENV-2-specific NT antibody titres of 1:320 and 1:640 respectively after 7 days post-challenge.

(Konishi and Fujii, 2002)

Tick borne encephalitis virus

DNA plasmid / COS-1 cells

s.c. / 2x 0.8μg of RSP with 0.2% Al(OH)3 adjuvant (0, 2 weeks)

Male and female Swiss albino mice

• Mice immunised with RSPs produced similar titres of TBEV-specific antibodies compared to mice immunised with a formalin inactivated virus.

• All immunised mice survived challenge with TBEV virus (500 LD50)

inoculated i.p.

(Heinz et al., 1995)

Japanese encephalitis virus

Vaccinia / Hela cells

(a) s.c. / 1μg of RSP with Freund’s complete adjuvant

(b) s.c. / 10μg of RSP

with Freund’s complete adjuvant

(c) i.p. / 1μg of RSP

3 week old outbred Swiss mice

• JEV-specific NT and HAI antibodies were detected in immunised mice at 3 weeks post-immunisation. NT (PRNT90) and HAI antibody titres for mice immunised by (a) were 1:20 and 1:10 respectively, and for mice immunised by (b) were 1:80 and 1:40 respectively. NT antibody titre for mice immunised by (c) was 1:10 and no HAI antibodies were detected in these mice.

• Approximately 60% of mice immunised by (a) and all mice immunised

by (b) survived pass 21 days post-challenge when challenged with JEV virus (4.9x105 LD50) inoculated i.p., while no mice immunised by (c) survived pass 15 days post-challenge.

(Konishi et al., 1992)

67

TABLE 1.03 (cont.) – Summary of studies using flavivirus recombinant subviral particle vaccines

Flavivirus






Vaccinia / Hela cells

(a) i.p. / 1μg or 2μg of RSP

(b) i.p. / 2x 1μg or 2μg

of RSP (0, 3 weeks) (c) i.p. / 3x 2μg of RSP

(0, 3, 6 weeks)

6 - 8 week old male BALB/c mice

• JEV-specific NT antibody titre of 1:40 (PRNT90) was detected in mice immunised by (b) but not by (a) with 1μg of RSP at 3 weeks post-immunisation.

• Immunisation induced long-lasting memory T-cells that proliferated after

stimulation with fixed and live antigens. At 3 weeks post-immunisation, spleen cells derived from mice immunised by (b) with 1μg of RSP had significant positive proliferative responses to fixed lysate antigen, but mice immunised by (a) with 1μg of RSP did not.

• At 10 months post-immunisation, spleen cells derived from mice

immunised by (a) or (b) with 2μg of RSP had significant positive proliferative responses against live JEV and RSP. Significant positive proliferative responses to fixed lysate antigen also were observed in mice immunised by (b) but not by (a) with 2μg of RSP. JEV-infected mice had positive responses against the fixed lysate and live virus but not against RSP.

• Memory CTLs were detected in mice immunised by (c) from a cell

depletion test conducted using in vitro stimulation of mice spleen cells with live JEV. Treatment with complement alone showed 27.9% lysis and treatment with anti-CD3 and complement reduced cytotoxic activity to 13.4%. Treatment with anti-NK and complement also reduced cytotoxic activity to 17.5%.


68

TABLE 1.03 (cont.) – Summary of studies using flavivirus recombinant subviral particle vaccines

Flavivirus






(1) DNA plasmida / CHO-K1 cells

(2) Vaccinia /

Hela cells

(a) s.c. / 1μg of RSP by (1) with Freund’s complete adjuvant

(b) s.c. / 2x 1μg of RSP

by (1) with Freund’s complete and incomplete adjuvants respectively (0, 2 weeks)

(c) s.c. / 1μg of RSP by

(2) with Freund’s complete adjuvant

(d) s.c. / 2x 1μg of RSP

by (2) with Freund’s complete and incomplete adjuvants respectively (0, 2 weeks)

3 week old female ICR mice

• JEV-specific NT antibodies were not detected in mice immunised by (a) and (c). NT antibodies were detected in mice immunised by (b) and (d) with titres of 1:80 and 1:160 (PRNT90) respectively following the second immunisation.

• 50% and 29% of mice immunised by (a) and (c) respectively survived

pass 21 days post-challenge when challenged with JEV (1x105 LD50) inoculated i.p. No mice immunised by (b) or (d) were challenged.


a This JEV DNA plasmid construct contains a mutated prM furin cleavage site to suppress the cleavage of prM to M which abrogates the fusogenic activity of the resulting RSP. Abbreviations: CHO-K1 – Cricetulus griseus (Chinese hamster) ovary cells; COS-1 – Cercopithecus aethiops (African green monkey) kidney cells; Hela – Homo sapiens (human) cervix cells; HAI – hemmagglutination-inhibiting; i.p.- intraperitoneal inoculation; LD – lethal dose; NT – neutralising; s.c. – subcutaneous inoculation.

69

1.6.2.4 DNA vaccines

DNA immunisation was first introduced by Wolff et al., (1990) who demonstrated

that intramuscular immunisation of mice with “naked DNA” induced a specific

immune response to the protein encoded by the DNA. Since this observation, various

studies have demonstrated the ability of DNA vaccines to stimulate both long-term

cell-mediated and humoral immune responses, similar to that induced by replicating

vaccines (reviewed in (Schultz et al., 2000)).

Cell-mediated immune responses are stimulated following immunisation with DNA

because the proteins encoded by the DNA are synthesized and processed

endogenously by the host cell, which allows the proteins to be presented on MHC

class I molecules to facilitate the priming of cell-mediated immune responses and the

production of specific CD8+ CTLs.

In addition, the DNA vaccine-encoded proteins released by transfected cells are able

to be processed by APCs and presented to MHC class II molecules to stimulate

humoral immune responses and the production of antigen-specific neutralising

antibodies. These levels of immunity are rarely observed following immunisation

with other non-replicating vaccines (Donnelly et al., 1998; Liu et al., 1998; Otten et

al., 2000; Ulmer et al., 1995; Ulmer et al., 1996; Weeratna et al., 2000).

Similar to the safety of other non-replicating vaccines, DNA vaccines do not carry

the risk of infection or the possibility of reversion to virulence due to the absence of

pathogen-derived replication components (Cichutek, 2000; Manickan et al., 1997;

Sin and Weiner, 2000). DNA vaccines also are extremely stable, which allows for

easy transport and minimal storage requirements, and are cost-effective to produce in

bacterial systems, which would facilitate their development and application in less

developed countries (Cichutek, 2000; Donnelly et al., 1997; Manickan et al., 1997;

Sin and Weiner, 2000; Ulmer et al., 1996).

However, DNA immunisation also introduces a number of theoretical concerns, such

as the potential for the immunised DNA to integrate into the chromosomes of the

host cell, which may result in the development of malignant tumours through the

activation of oncogenes or the inactivation of tumour suppressor genes. Other

70

concerns include the possibility of inducing immunological tolerance due to the

long-term production of DNA vaccine-encoded proteins and the production of anti-

DNA antibodies, which may contribute to the development of autoimmune disorders

(Cichutek, 2000; Ledwith et al., 2000; Robertson and Griffiths, 1998; Robertson,

1994; Smith, 1994). Currently, no evidence has been found during pre-clinical

animal or human clinical trials to validate these concerns (Calarota et al., 1998;

Cichutek, 2000; Klinman et al., 1997a; MacGregor et al., 1998).

In addition, studies suggested that if chromosomal integration occurred at all, the

frequency would be at least three orders of magnitude below the spontaneous

mutation frequency, which indicates a negligible risk of incurring deleterious

mutations through chromosomal integration of the immunised DNA (Ledwith et al.,

2000). Furthermore, it was postulated that the probability of chromosomal

integration of the immunised DNA resulting in the development of malignant

tumours would be extremely low because such events would occur at random sites

within the chromosome and not every integration event would activate the multi-step

processes of oncogenesis or inactivate tumour suppressor genes (Robertson and

Griffiths, 1998; Temin, 1990; Temin, 1998; Wurm and Petropoulos, 1994).

A number of candidate flavivirus DNA vaccines have been developed and evaluated

in various experimental animal models (Table 1.04). In general, DNA vaccines that

incorporated the C-terminal C-prM-E flavivirus genes have been effective at

inducing both humoral and cell-mediated immune responses that were capable of

protecting immunised animals against challenge with live homologous flaviviruses.

The strong immune responses elicited by these DNA vaccines were attributed to the

ability of transfected host cells to synthesize and secrete RSPs following

immunisation (Aberle et al., 1999; Davis et al., 2001; Konishi et al., 1999; Konishi

et al., 2000a; Konishi et al., 2000b). In addition, specific motifs present in the

bacterial-derived DNA vaccines possessed the ability to activate the mammalian

immune response (Krieg et al., 1995).

71

TABLE 1.04 - Summary of studies using flavivirus DNA vaccines

Flavivirus

Viral genes incorporated




Dengue virus type 1

(1) prM-E (2) prM-Etrunc

(92% N-ter) (3) prM-Etrunc

(80% N-ter) (4) Etrunc (80%

N-ter)

i.d. / 4x 100μg of DNA (0,11, 21, 51 days)

3 week old BALB/cJ mice

• Detectable levels of DENV-1-specific antibodies were only present in mice immunised with (1) and (4) 30 days after the initial immunisation. NT antibodies were also detected in these immunised mice.

• DENV-1-specific NT antibody titres of 1:40 (PRNT50) and 1:10 to 1:40

were detected in mice immunised with (1) or (2) respectively at 76, 253 and 342 days after the initial immunisation.

(Raviprakash et al., 2000a)

Dengue virus type 1

prM-E (a) i.m. / 3x 1mg of DNA (0, 1, 5 months)

(b) i.d. / 4x 1mg of

DNA (0, 1, 5, 12 months)

7-24 year old rhesus macaques monkeys

• DENV-1-specific antibodies were detected in monkeys immunised by (a) at 1 month after initial immunisation and an increase in antibody response was observed following subsequent boosting. DENV-1-specific antibody titres in monkeys immunised by (b) were lower and declined at a faster rate compared to monkeys immunised by (a).

• DENV-1-specific NT antibody titres of 1:20 to 1:360 (PRNT50) were

detected in monkeys immunised by (a) at 6 months after initial immunisation, but declined over time. Monkeys immunised by (b) had lower NT antibody titres ranging from 0 to 1:20 at the same period.

• 4 of 8 monkeys immunised by (a) failed to develop viremia following

challenge with DENV-1 (1.25x104 PFU) inoculated s.c. 9 months after initial immunisation, while the remaining 4 immunised monkeys developed reduced viremia for 2 or 3 days. No significant reduction in viremia was observed in monkeys immunised by (b) following challenged. All challenged monkeys exhibited a rapid increase in IgG antibody production.

(Raviprakash et al., 2000b)

Dengue virus type 1

prM-E (a) i.d. / 3x 1mg of DNA (0, 4, 20 weeks)

(b) i.m. / 3x 1mg of

DNA (0, 4, 20 weeks)

Naïve adult male and female Aotus nancymae monkeys

• DENV-1-specific NT antibodies were present in all monkeys immunised by (a) after 3 months. No NT antibodies were detected in monkeys immunised by (b).

• One third of immunised monkeys failed to develop viremia following

challenge with DENV-1 (1.25x104 PFU) inoculated s.c., while the others exhibited a reduction in viremia.

(Kochel et al., 2000)

72

TABLE 1.04 (cont.) - Summary of studies using flavivirus DNA vaccines

Flavivirus





Dengue virus type 1

(1) prM-E (2) DNA plasmid

with GM-CSF gene

(3) DNA plasmid

with human immuno-stimulatory sequences

(a) i.d. / 3x 1mg of DNA (0, 1, 5 months)

(b) i.d. by g.g. / 3x 1mg

of DNA (0, 1, 5 months)

5-15 year old male and female Aotus nancymae monkeys

• All monkeys immunised by (a) with (1) produced DENV-1-specific antibodies after the initial immunisation and 3 of 4 monkeys produced DENV-1-specific NT antibodies (PRNT50) after the final immunisation. 1 of 4 immunised monkeys developed detectable viremia when challenged at 6 months with DENV-1 (2x104 PFU) inoculated s.c.

• All monkeys immunised by (a) with (1) and (2) produced DENV-1-

specific antibodies after the initial immunisation and 3 of 4 monkeys produced DENV-1-specific NT antibodies after the final immunisation. 1 of 4 immunised monkeys developed detectable viremia when challenged at 6 months with DENV-1 (2x104 PFU) inoculated s.c.

• All monkeys, except one, immunised by (a) with (1) and (3) produced

DENV-1-specific antibodies after the initial immunisation and 3 of 4 monkeys produced DENV-1-specific NT antibodies after the final immunisation. 3 of 4 immunised monkeys developed detectable viremia when challenged at 6 months with DENV-1 (2x104 PFU) inoculated s.c.

• All monkeys immunised by (a) with (1), (2) and (3) produced DENV-1-

specific antibodies after the initial immunisation and 7 of 8 monkeys produced DENV-1-specific NT antibodies after the final immunisation. 1 of 4 immunised monkeys developed detectable viremia when challenged at 6 months with DENV-1 (2x104 PFU) inoculated s.c. No immunised monkeys developed detectable viremia when challenged at 11 months.

• All monkeys immunised by (b) with (1), (2) and (3) produced DENV-1-

specific antibodies after the initial immunisation and all monkeys produced DENV-1-specific NT antibodies after the final immunisation. No immunised monkeys developed detectable viremia when challenged at 6 months with DENV-1 (2x104 PFU) inoculated s.c. 1 of 4 immunised monkeys developed viremia when challenged at 11 months.

(Raviprakash et al., 2003)

73


Flavivirus





Dengue virus type 1 Dengue virus type 2 Japanese encephalitis virus

(1) prM-E (DENV-1)

(2) prM-E

(DENV-2) (3) prM-E (JEV)

(a) i.m. / 2x 100µg of DNA (0, 2 weeks)

(b) i.m. by jet injector /

2x 100µg of DNA (0, 2 weeks)

4 week old ICR and ddY mice

• Mice immunised with (1) by (a) or (b) developed highest DENV-1-specific NT antibody titres of 1:20 or 1:640 (PRNT90) respectively at 8 weeks after initial immunisation. These titres remained until 18 weeks after initial immunisation.

• Mice immunised with (2) by (a) or (b) developed highest DENV-2-

specific NT antibody titres of 1:160 or 1:640 respectively at 5 weeks after initial immunisation. These titres were 1:20 and 1:640 respectively at 18 weeks after initial immunisation.

• Mice immunised with (3) by (a) or (b) developed highest JEV-specific

NT antibody titres of 1:320 or 1:2,560 respectively at 5 weeks after initial immunisation. These titres were 1:80 and 1:640 at 18 weeks after initial immunisation.


Dengue virus type 2

prM-Etrunc (92% N-ter)

(a) i.d. / 4x 200μg of DNA (0, 9, 22, 57 days)

(b) i.d. / 2x 200μg of

DNA (0, 9 days)

3 week old BALB/c mice

• DENV-2-specific and NT antibodies were detected in mice immunised by (a) after the second and final immunisations respectively.

• No mice immunised by (b) survived challenge with DENV-2 (100 LD50)

inoculated i.c.

(Kochel et al., 1997)

Dengue virus type 2

(1) prM-Etrunc (92% N-ter)

(2) pUC19 DNA plasmid

i.d. / 3.1µg, 12.5µg, 50µg or 200µg of DNA

3 week old female BALB/cJ mice

• Mice immunised with 3.1µg or 12.5µg of (1) produced less DENV-specific antibodies than mice co-immunised with the same dose of (1) and (2). Mice immunised with 50µg or 200µg of (1) produced more DENV-specific antibodies than mice co-immunised with the same dose of (1) and (2).

• Mice co-immunised with 3.1µg of (1) and (2) up to 100µg produced

DENV-specific antibody and NT antibody (PRNT50) responses that were proportional to the amount of (2) used for immunisation. No DENV-2-specific NT antibodies were detected in mice immunised without (2).

• 60% of mice immunised with 12.5µg of (1) and 100µg of (2) survived

pass 21 days when challenged with DENV-2 (100 LD50) inoculated i.c.

(Porter et al., 1998)

74


Flavivirus





Dengue virus type 2

Etrunc (94% N-ter)

i.m. / 3x 100μg of DNA (0, 10, 30 days)


• Immunised mice did not produce detectable levels of DENV-2-specific antibodies. Lymphocytes from immunised mice did not produce detectable cytokine activity after stimulation with purified DENV-2.

• 20% of immunised mice survived past 21 days when challenged with a

lethal dose of DENV-2 (1x107 PFU) inoculated i.c.

(Ocazionez Jimenez and Lopes da Fonseca, 2000)

Dengue virus type 2

prM-E (a) i.m. / 2x 1, 10 or 100μg of DNA (0, 2 weeks)

(b) i.m. / 3x 1, 10 or

100μg of DNA (0, 2, 3 weeks)

6 week old male BALB/c mice

• DENV-2-specific NT antibody titres of 1:10 (PRNT90) were detected in mice immunised by (a) or (b) with 100μg of DNA. No NT antibodies were detected in other immunised mice.

• Immunisation induced a strong memory B cell anamnestic response

following challenge with DENV-2 (3x105 PFU) inoculated i.p. Mice immunised by (a) or (b) with 100μg of DNA had elevated NT antibody titres on day 4 (≥ 1:40) and day 8 (≥ 1:80) post-challenge. No NT antibodies were detected in other immunised mice following challenge.

(Konishi et al., 2000a)

Dengue virus type 2

prM-E (absorbed with gold particle)

(a) i.d. by g.g. / 0.5µg of DNA

(b) i.d. by g.g. / 2x

0.5µg of DNA (0, 4 weeks)

(c) i.d. by g.g. / 4x 2µg

of DNA (0, 2, 4, 6 months)

(d) i.d. by g.g. / 2x 1µg

of DNA (0, 2 months)

(e) i.d. by g.g. / 1µg of

DNA

4-6 week old BALB/c mice 4-6 week old Swiss Webster mice Indian rhesus macaques monkeys

• Swiss Webster mice immunised by (a) developed DENV-2-specific NT antibodies with titres of 1:50 to 1:380 (PRNT50).

• Spleen cells from BALB/c mice immunised by (b) were able to elicit

CTL responses after stimulation with DENV-2 prM and E antigens. • Monkeys immunised by (c) developed DENV-2-specific NT antibodies

with titres of 1:40 to 1:170 (PRNT50) at 2 months after 2 immunisations but titres failed to increase following the third and fourth immunisations. 1 of 3 monkeys immunised by (c) developed viremia following challenge with DENV-2 (1x104 PFU) inoculated s.c. at 1 month after immunisation.

• 1 of 3 monkeys immunised by (d) developed DENV-2-specific NT

antibodies and 1 of 3 developed viremia following challenge with DENV-2 (1x104 PFU) inoculated s.c. at 1 month or 7 months after immunisation.

• No monkeys immunised by (e) developed detectable DENV-2-specific

NT antibodies and all developed viremia following challenge with DENV-2 (1x104 PFU) inoculated s.c. at 1 month after immunisation.

(Putnak et al., 2003)

75


Flavivirus





Dengue virus type 2

(1) prM-E (2) prM-E (90%

N-ter DENV-2 E + 10% C-ter JEV E)

(3) prM-E (80%

N-ter DENV-2 E + 20% C-ter JEV E)

i.m. / 2x 100µg of DNA (0, 3 weeks)

3 week old female ICR mice

• 20%, 50% and 100% of mice immunised with (1), (2) or (3) respectively seroconverted by 3 weeks post-immunisation. 40%, 100% and 100% of mice immunised with (1), (2) or (3) respectively seroconverted by 9 weeks post-immunisation.

• Approximately 10% and 80% of mice immunised with (1) or (3)

respectively produced anti-DENV-2 NT antibody titres at nine weeks following immunisation. No mice immunised with (2) produced NT antibodies.

• No mice immunised with (1), (2) or (3) produced anti-JEV NT

antibodies.

(Chang et al., 2003)

Dengue virus type 2

(1) NS1 (2) DNA plasmid

with IL-2 gene (3) DNA plasmid


with IL-12 gene

(5) DNA plasmid

with GM-CSF gene

i.m. / 3x 80μg of DNA (0, 1, 2 weeks)

3 or 6 week old female C3H mice 5-6 week old ICR mice and female mice

• 30% of mice immunised with (1) developed hind leg paralysis 21 days after challenge with DENV-2 (5x106 PFU) inoculated i.v. and 90% of these mice survived past 21 days following challenge.

• Splenocytes from mice immunised with (1) demonstrated dose-dependent

proliferative responses when stimulated with recombinant NS1 protein. • 3 of 4 female ICR mice immunised with (1) and mated with un-

immunised male ICR mice produced newborn mice that survived past 21 days when challenged with DENV-2 (2.5x106 PFU) inoculated s.c.

• 20% of mice co-immunised with (1) and (4) developed hind leg paralysis

21 days after challenge with DENV-2 (107 PFU) inoculated i.v. and 80% of these mice survived past 21 days following challenge. Mice immunised with (1) and either (2), (3) or (5), were not as protected against developing morbidity (hind leg paralysis) or mortality as mice immunised with (1) and (4).

(Wu et al., 2003)

76


Flavivirus





Dengue virus type 2

(1) prM-E

(2) prM-E-LAMPa

(3) DNA plasmid with GM-CSF gene

i.d. / 3x 50µg of DNA (1, 11, 21 days)

Mice (age and strain not reported)

• No mice immunised with (1), and all mice immunised with (2) had detectable anti-DENV antibodies on day 30.

• All mice immunised with (1) or (2) produced high titres of anti-DENV

antibodies on day 30 when co-immunised with (3). • No DENV-2-specific NT antibodies were detected in mice immunised

with (1) up to day 120. Mice immunised with (2) had low NT antibody levels from day 30-120. Mice immunised with (1) or (2) produced high NT antibody titres from day 30-120 when co-immunised with (3).

(Raviprakash et al., 2001)


prM-E (a) i.m. / 1x 0.1µg, 1µg, 10µg or 100μg of DNA

(b) i.m. / 2x 10μg or

100μg of DNA (0, 2 weeks)

(c) i.d. / 2x 10μg or


6 week old male BALB/c mice (a) 4 week old female ICR mice (a, b, c)

• All ICR mice immunised by (a) failed to produce detectable JEV-specific NT antibodies prior to challenge. 80% of ICR mice immunised by (a) with 100µg of DNA survived pass 21 days when challenged with JEV (1x104 LD50) inoculated i.p. and produce NT antibody titre of 1:160 (PRNT90) at this point. No ICR mice immunised by (a) with 0.1 to 10µg of DNA survived challenge.

• All ICR mice immunised by (b) or (c) produced low JEV-specific NT

antibody titres ranging from 1:10 to 1:20 prior to challenge. All of these mice survived pass 21 days when challenged with JEV inoculated i.p. and produced NT antibody titres ranging from 1:160 to 1:640 at this point.

• BALB/c mice immunised by (b) with 100μg of DNA induced and

maintained detectable memory B cells and CTLs for at least 6 months. • All BALB/c mice immunised by (a) with 100µg of DNA survived pass

21 days when challenged with JEV inoculated i.p. at 1 to 6 months after immunisation and produced NT antibody titres ranging from 1:640 to 1:1,280 at this point.



(1) prM-E

(2) E

(3) NS1

i.m. / 2x 100μg of DNA (0, 2 weeks)

4-5 week old outbred Swiss mice

• 50%, 56%, and 38% of mice immunised with (1) or (3), (1) and (3), and (2) respectively survived past 20 days when challenged with JEV (10 LD50) inoculated i.c. However, vaccination with a commercial formalin inactivated JEV vaccine provided better protection against i.c. virus challenge than DNA vaccination.

(Ashok and Rangarajan, 2000)

77


Flavivirus






E (a) i.m. / 2x 50μg of DNA (0, 2 weeks)

(b) i.n. / 5x 20μg of

DNA (0, 1, 2, 3, 4 weeks)

4-6 week old male outbred Swiss mice

• No virus-specific antibodies were detected in any of the immunised mice. • Lymphocytes from immunised mice produced high levels of IFNγ when

stimulated with purified JEV. No IL-4 expression was detected. • 51% and 59% of mice immunised by (a) and (b) respectively survived

past 15 days when challenged with JEV (10 LD50) inoculated i.c.



prM-E (a) i.m. / 50μg of DNA (b) i.m. / 100μg of DNA (c) i.m. / 2x 100μg of

DNA (0, 3 weeks)

3 day old mixed-sex ICR outbred mice (a, b) 3 week old female ICR outbred mice (a, b, c)

• JEV-specific antibodies were present in all 3 week old mice immunised by (b) or (c) at 3 weeks after the first immunisation. Antibody titres were similar irrespective of the number of doses given. 90-100% of all 3 day old and 3 week old mice immunised by (a) or (b) presented with JEV-specific antibody titres of ≥1:1600.

• All 3 day old mice immunised by (a) or (b) survived past 21 days when

challenged with JEV (5x104 PFU) inoculated i.p. • Passive protection by maternal antibodies were examined by mating 3

week old female mice immunised by (b) or (c) with non-immunised male mice followed by challenge of pups with JEV (5x103 PFU) inoculated i.p. Survival rate of pups was proportional to maternal NT antibody titres.

(Chang et al., 2000)


(1) prM-E (2) prM (3) Etrunc (50%

N-ter) (4) Etrunc (50%

C-ter)

(a) i.m. / 10μg of DNA (b) i.m. / 100μg of DNA (c) i.m. / 2x 10μg of

DNA (0, 2 weeks) (d) i.m. / 2x 100μg of

DNA (0, 2 weeks)

4 week old female ICR mice 6 week old male BALB/c mice

• 4 of 5 ICR mice immunised by (b) and all mice immunised by (d) survived past 21 days when challenged with JEV (1x104 LD50) inoculated i.p. Mice immunised by (d) developed JEV-specific NT antibody titres of 1:640 to 1:1280 (PRNT90) at this point. None of the mice immunised by (a) or (c) survived challenge. Anti-NS1 antibodies were present in post-challenge sera of all mice that had survived virus challenge indicating viremia.

• BALB/c mice immunised with (1) or (3) by (b) displayed memory CTLs

before challenge with JEV (1x104 LD50) inoculated i.p. However only mice immunised with (1) exhibited active CTLs 4 days after virus challenge and survived past 21 days. CTLs could not be detected in BALB/c mice immunised with (2) or (4) by (b).


78


Flavivirus






(1) E (2) Etrunc (N-ter

398aa) (3) TPAb-E (4) TPAb-Etrunc

(N-ter 398aa)

i.m. / 2x 100μg of DNA (0, 2 weeks)

4-6 week old outbred Swiss male mice

• 39%, 42%, 40%, and 71% of mice immunised with (1), (2), (3), and (4) respectively survived past 15 days when challenged with JEV (10 LD50) inoculated i.c. However, vaccination with a commercial formalin inactivated JEV vaccine afforded better protection against i.c. virus challenge than DNA vaccination.



(1) C

(2) E

(3) NS1-NS2A

(4) NS3

(5) NS5

(a) i.m. / 3x 100μg of DNA (0, 3, 6 weeks)

(b) i.d. by g.g. / 3x 1μg

of DNA (0, 3, 6 weeks)

6-8 week old female C3H/HeN, BALB/c and ICR mice

• 89% and 91% of C3H/HeN mice immunised with (2) by (a) and (b) respectively survived past 30 days when challenged with JEV (50 LD50) inoculated i.p., while 27% of C3H/HeN mice immunised with (5) by (b) survived the challenge. 15% and 6% of C3H/HeN mice immunised with (3) by (a) and (b) respectively survived challenge, while 10% of C3H/HeN mice immunised with (4) by (a) survived challenge. No other groups of immunised mice survived challenge.

• Only C3H/HeN mice immunised with (2) produced JEV-specific

antibodies. C3H/HeN mice immunised with (2) by (a) produced high titres of IgG2a with no detectable IgG1 anti-E antibodies, while C3H/HeN mice immunised with (2) by (b) produced high titres of IgG1, but low IgG2a anti-E antibodies. C3H/HeN mice sub-lethally immunised with JEV (6.0x105 PFU) by i.p. produced high titres of IgG2a, but low IgG1 anti-E antibodies, while C3H/HeN mice immunised with commercial formalin-inactivated JEV vaccine by i.p. produced low but equal titres of IgG1 and IgG2a anti-E antibodies.

• BALB/c mice immunised with (2) by (a) seroconverted and produced a

more rapid and higher titre of JEV-specific antibodies than ICR mice immunised with (2) by (a).

• 100% and 60% of BALB/c and ICR mice respectively immunised with

(2) by (a) survived past 30 days when challenged with JEV (50 LD50) inoculated i.p.

(Chen et al., 1999)

79


Flavivirus






E


(b) i.m. supplemented

with electric pulses / 3x 100μg of DNA (0, 3, 6 weeks)

6-8 week old female C3H/HeN mice 6-8 week old female C3H/HeN mice pre-treated with cardiotoxin 1 week prior to immunisations

• Quadricep muscles removed from cardiotoxin-treated mice, but not from -untreated mice, at 48 hours after immunisation by (a) had low levels of JEV E protein expression. Quadricep muscles removed from cardiotoxin-untreated and -treated mice at 48 hours after immunisation by (b) had high levels of JEV E protein expression.

• Cardiotoxin-untreated mice immunised by (a) did not produce detectable

anti-E antibodies at week 8. Cardiotoxin-untreated and -treated mice immunised by (b) produced high titres of anti-E antibodies at week 8.

• No cardiotoxin-untreated mice immunised by (a) survived past 10 days

when challenged with JEV (50x LD50) inoculated i.p. and 60% and 100% of cardiotoxin-treated mice immunised by (a) and (b) respectively survived past 10 days when challenged with JEV.

• Cardiotoxin-untreated mice immunised by (a) or (b) produced high titres

of IgG2a, but low IgG1 anti-E antibodies.

(Wu et al., 2004)


(1) E (2) DNA plasmid


with IL-12 gene

(a) i.m. / 3x 100µg of DNA (0, 3, 6 weeks)

(b) i.m. / 2x 100µg of

DNA (0, 3 weeks) (c) i.m. / 100µg of DNA

6-8 week old female C3H/HeN mice

• Mice immunised by (a) with (1), or (1) and (2), produced high titres of JEV-specific antibodies. Only 70% of mice immunised with (1) and (3) seroconverted and produced low titres of JEV-specific antibodies.

• Mice immunised with (1) by (a) produced predominantly IgG2a anti-E

antibodies with no detectable IgG1 antibodies. Mice immunised with (1) and (3) by (a) and (a), (b) or (c) respectively abrogated the IgG2a antibody response. Co-immunisation of (1) and (3) by (a) also suppressed cellular T cell proliferation in response to specific JEV antigen stimulation.

• 100%, 80% and 30% of mice immunised by (a) with (1), (1) and (2), or

(1) and (3) survived past 30 days when challenged with JEV (50 LD50) inoculated i.p. In addition, 40% of mice immunised by (a) with (1), and (b) with (3), survived challenge, while 20% of mice immunised by (a) with (1), and (c) with (3), survived challenge.

(Chen et al., 2001)

80


Flavivirus






(1) prM-Ec (2) prM-Ec-

colloidal gold (3) prM-Ed-

colloidal gold

(a) i.v. / 2x 50µg of DNA (0, 9 days)

(b) i.v. / 3x 50µg of

DNA (0, 9, 22 days) (c) i.d. / 3x 50µg of

DNA (0, 9, 22 days) (d) i.m. / 3x 50µg of

DNA (0, 9, 22 days) (e) i.p. / 3x 50µg of

DNA (0, 9, 22 days) (f) i.v. / 3x 0.5µg or

5µg of DNA (0, 9, 22 days)

(g) i.d. / 3x 0.5µg or

5µg of DNA (0, 9, 22 days)

(h) i.v. / 2x 0.5µg or

5µg of DNA (0, 9 days)

(i) i.d. / 2x 0.5µg, 5µg

or 50µg of DNA (0, 9 days)

(j) i.v. / 2x 50µg of

DNA (0, 22 days)


• Co-administration of DNA with colloidal gold accelerated the production of anti-JEV antibodies. Mice immunised with (1) by (a) produced detectable levels of anti-JEV and NT antibodies on days 22 and 35 respectively. Mice immunised with (2) by (a) produced detectable levels of anti-JEV and NT antibodies on days 14 and 22 respectively. No significant differences in serum antibody concentration were detected in mice immunised with (1) or (2) at 35 days after initial immunisation.

• Mice immunised with (2) by (b) or (c) developed a more rapid and

longer-lasting NT antibody response than mice immunised with (2) by (d) or (e).

• No significant differences was observed in the anti-JEV antibody

responses from mice immunised with (2) by (b), or (f). • No significant differences was observed in the anti-JEV antibody

responses from mice immunised with (2) by (c) or (g). • All mice immunised with (2) or (3) by (a), (h) or (i) survived past 21 days

when challenged with JEV (1x105 LD50 ) inoculated i.p. and produced JEV-specific NT antibody titres ranging from 1:400 to 1:560 (PRNT90).

• Mice immunised with (1) or (2) by (j) produced anti-JEV antibodies

predominantly of the IgG2a and IgG1 isotypes respectively.

(Zhao et al., 2003)

81


Flavivirus






prM-E (a) i.m. / 2x 100μg of DNA (0, 2 weeks)

(b) i.m. / 2x 100μg of

DNA (0, 3 weeks) (c) i.d. / 2x 100μg of

DNA (0, 3 weeks) (d) i.m. / 2x 450μg of

DNA (0, 3 weeks) (e) i.d. / 2x 450μg of

DNA (0, 3 weeks)

6 week old male BALB/c mice (a) 8-12 week old male and female swine (b, c, d, e)

• Mice immunised by (a) produced JEV-specific NT antibody titre of 1:10 (PRNT90) at 2 weeks after the second immunisation, which was equivalent to that obtained by immunisation with a commercial formalin-inactivated JEV vaccine. 5 of 6 mice immunised by (a) survived past 21 days when challenged with JEV (5x104 LD50) inoculated i.p.

• Swine immunised by (b) develop detectable levels of JEV-specific NT

and HAI antibodies 1 week after the second immunisation. • Swine immunised by (d) developed JEV-specific NT and HAI titres of

1:10 and 1:80 to 1:160 at 2 weeks after the first immunisation and 1 week after the second immunisation respectively. Swine immunised by (c) and (e) displayed a similar time course but with lower levels of NT and HAI antibody titres than by (b) and (d) respectively.

• Immunised swine were able to induce long-lasting and elevated levels of

virus-specific memory B and helper T cells following boosting with commercial formalin inactivated JEV vaccine. NT and HAI antibodies were detected past 245 days following boosting.

• Serum antibody titres in swine were consistently higher than those

detected in mice.

(Konishi et al., 2000b)


(1) prM-E (2) NS1 (3) NS1-

NS2Atrunc (N-ter 60aa)

i.m. / 3x 80μg of DNA (0, 2, 4 weeks)

3-4 week old female outbred ICR mice

• Low levels of JEV-specific NT antibody titres were detected in mice immunised with (1) and no NT antibodies were detected in other mice. High and low titres of NS1-specific antibodies were detected in mice immunised with (2) and (3) respectively.

• Antisera from mice immunised with (2) exhibited antibody-dependent

complement-mediated cytolysis of virus-infected cells. • 70% and 90% of mice immunised with (1) and (2) respectively survived

past 21 days when challenged with JEV (10 LD50) inoculated i.p, while mice immunised with (3) failed to survive.

(Lin et al., 1998)

82


Flavivirus







(N-ter 398aa)




4 -5 week old inbred BALB/c mice

• Anti-JEV and anti-E IgG antibodies were detected in mice immunised by (a) or (b) with (1) or (2) at 21 days after the first immunisation. Antibody responses increased following booster immunisations.

• Anti-E IgG titres of mice immunised by (a) with (1) or (2) were similar to

the titres of mice immunised with a commercial formalin-inactivated JEV vaccine. In addition, these titres were 2.5-fold higher than the titres present in mice immunised by (b) with (1) or (2).

• Mice immunised by (a) with (1) or (2) induced a predominant anti-E

IgG2a response with the ratio of IgG2a:IgG1 at 10 and 1.5 respectively. Mice immunised by (b) with (1) or (2) induced a predominant anti-E IgG1 response with the ratio of IgG1:IgG2a at 9 and 1.6 respectively. Mice immunised with a commercial formalin inactivated JEV vaccine induced a similar response for IgG1 and IgG2a.

• Mice immunised by (a) with (1) induced very low levels of IL-4 and very

high levels of IFN-γ, while mice immunised by (a) with (2) induced very low levels of IL-4 and low levels of IFN-γ. Mice immunised by (b) with (1) induced high levels of IL-4 and very low levels of IFN-γ, while mice immunised by (b) with (2) induced high levels of IL-4 and low levels of IFN-γ. IL-5 was not detected in any immunised mice.

• Approximately 60% of mice immunised by (a) or (b) with (1) or (2)

survived past 28 days when challenged with JEV (20 LD50) inoculated i.c.

(Kaur et al., 2002)

83


Flavivirus






E (a) i.m. / 100µg of DNA (b) i.m. / 2x 100µg of

DNA (0, 3 weeks) (c) i.m. / 3x 100µg of

DNA (0, 3, 6 weeks) (d) i.d. by g.g. / 1µg of

DNA (e) i.d. by g.g. / 2x 1µg

of DNA (0, 3 weeks) (f) i.d. by g.g. / 3x 1µg


6-8 week old female C3H/HeN mice

• All mice immunised by (a), (b) or (c) produced JEV-specific antibodies. 17%, 50% and 100% of mice immunised by (d), (e) or (f) produced JEV-specific antibodies.

• 83%, 100% and 100% of mice immunised by (a), (b) and (c) respectively

survived past 30 days when challenged with JEV (50 LD50) inoculated i.p. In contrast, 17%, 50% and 88% of mice immunised by (d), (e) and (f) respectively survived challenge.

• Spleen cells from mice immunised by (c) or (f) demonstrated cellular T

cell proliferation in response to specific JEV antigen stimulation. • 75% and 67% of irradiated naïve mice immunised by i.v. with immune

sera from mice immunised by (c) and (f) respectively survived past 30 days when challenge with JEV (50 LD50) inoculated i.p. In contrast, no irradiated naïve mice immunised by i.v. with splenocytes from mice immunised by (c) and (f) respectively survived challenge.

(Pan et al., 2001)

West Nile virus

prM-E (a) i.m. / 0.1, 1, 10 or 100μg of DNA

(b) i.m. supplemented

with electric pulses / 0.1, 1, or 10μg of DNA

(c) i.m. / 1mg of DNA

3 week old female ICR outbred mice (a, b) Various ages of mixed-bred mare and gelding horses (c)

• All mice immunised by (a) developed WNV-specific IgG and NT antibodies with titres ranging from 1:640 to 1:1280, and 1:80 (PRNT90) respectively at 3 weeks post-immunisation. All mice immunised by (b) developed NT antibodies with titres ranging from 1:40 to 1:160 at 6 weeks post-immunisation.

• All mice immunised by (a) or (b) survived past 21 days when challenged

with WNV (1x103 LD50) inoculated i.p. and developed NT antibody titres ranging from 1:320 to 1:640.

• No horses immunised by (c) developed detectable viremia or fever 14

days after challenged with WNV, which was inoculated from bites by 14 or 15 Aedes albopictus mosquitoes that had been infected with WNV 12 days prior to challenge. An anamnestic NT antibody response was not observed in these horses.

(Davis et al., 2001)

84


Flavivirus





Kunjin virus Complete virus genome

(a) i.m. / 0.1µg of DNA

(b) i.m. / 1µg of DNA

(c) i.m. / 10µg of DNA

4-5 week old BALB/c mice

• Live infectious KUNV were detected in sera of mice immunised by (a) or (b) at 4 and 3 days after immunisation respectively.

• Mice immunised by (a), (b) or (c) produced KUNV-specific antibodies

with titres of 1:160, 1:320 and 1:320 respectively, and KUNV-specific NT antibodies with titres of 1:10, 1:20 and 1:20 respectively. 40%, 100% and 80% of mice immunised by (a), (b) or (c) respectively survived challenge with KUNV (1,000 i.u.) inoculated i.c.

• Mice immunised by (a), (b) or (c) produced WNV-specific antibodies

with titres of 1:80 for all three immunisation doses; and WNV-specific NT antibodies with titres of 1:10, 1:20 and 1:20 respectively. 66% and 100% of mice immunised by (a) and (b) respectively survived challenge with WNV (20 i.u.) inoculated i.c. 92% of mice immunised by (a) or (b) survived challenge with WNV (20 i.u.) inoculated i.p.

(Hall et al., 2003)

St Louis encephalitis virus

prM-E (a) i.m. / 50μg of DNA

(b) i.m. / 50μg and


3-4 week old female Porton TO weanling mice

• SLEV-specific antibodies were detected following immunisation. No increase in antibody titres was observed following the boost. No SLEV-specific NT antibodies were detected.

• 9 of 12, and 4 of 7 mice immunised by (a) and (b) respectively survived

past 18 days when challenged with SLEV (30 LD50) inoculated s.c.

(Phillpotts et al., 1996)

Tick-borne encephalitis virus

(1) NS1 (TBEV) (2) NSI (N-ter

62aa of TBEV + C-ter 290aa of DENV-2)

(3) NS1 (N-ter

258aa of TBEV + C-ter 94aa of DENV-2)



• 7 of 8 and 3 of 8 mice immunised with (1) survived past 21 days when challenged with TBEV (100 LD50) inoculated i.p. and with DENV-2 (100 LD50) inoculated i.c. respectively.

• 2 of 8 and 1 of 8 mice immunised with (2) survived past 21 days when

challenged with TBEV (100 LD50) inoculated i.p. and with DENV-2 (100 LD50) inoculated i.c. respectively.

• 1 of 8 and 1 of 8 mice immunised with (3) survived past 21 days when

challenged with TBEV (100 LD50) inoculated i.p. and with DENV-2 (100 LD50) inoculated i.c. respectively.

(Timofeev et al., 2004)

85


Flavivirus





Tick-borne encephalitis virus


(without C-ter 62aa)

(3) E (4) Etrunc

(without C-ter 62aa)

(a) i.m. / 2x 100μg of DNA (0, 4 weeks)


of DNA (0, 4 weeks)

6-8 week old female BALB/c mice

• High titres of TBEV-specific antibodies (1:20,800) were only detected in mice immunised with (1) by either (a) or (b). Similarly, only these mice were able to produce detectable levels of TBEV-specific NT and HAI antibodies with identical titres of 1:80 and 1:320 respectively. All mice immunised with (1) by (a), and all mice immunised by (b) seroconverted.

• All mice immunised with (1) survived past 28 days when challenged with

TBEV (1x103 LD50) inoculated i.p., while less than 50% of mice immunised with (2), (3), or (4) survived challenge. Mice immunised with (1) by (a) or (b) had similar TBEV-specific antibody titre in post-challenge sera to the corresponding pre-challenge sera and no NS-specific antibodies were detected in the post-challenge sera. However, NS-specific antibodies were detected in post-challenge sera of mice immunised with (2), (3), or (4) indicating replication of challenge virus.

• In general, mice immunised by (a) produced high IgG2a:IgG1 ratios and

high levels of IFN-γ. Mice immunised by (b) produced high IgG1:IgG2a ratios and high levels of IL-4 and IL-5.

(Aberle et al., 1999)

Murray Valley encephalitis virus

prM-E (a) i.m. / 4x 100μg of DNA (0, 4, 7, 10 weeks)

(b) i.m. / 4x 100μg of

DNA (0, 4, 8, 11 weeks)

(c) i.m. / 2x 125μg of

DNA (0, 6 weeks) (d) i.d. by g.g. / 1-2μg

and 0.5-1μg of DNA (0, 4 weeks)

4-6 week old female BALB/c mice (a, b, c) 4-6 week old female BALB/c, CBA/H, C57BI/6 mice (d)

• Immunisation by (a), (b), (c), and (d) induced a progressively higher titre and earlier onset of MVEV-specific antibody response respectively. MVEV-specific NT antibodies were detected in mice immunised by (d) but not with the others.

• Immunisation by i.m. elicited a predominantly IgG2a antibody response

while immunisation by gene gun elicited predominantly IgG1 antibody response with some IgG2a and IgG2b antibodies also apparent.

• 100% and 80% of mice immunised by gene gun and i.m. respectively

survived past 21 days when challenged with MVEV (1x108 PFU) inoculated i.p.

(Colombage et al., 1998)

86


Flavivirus





Central European encephalitis virus Russian spring summer encephalitis virus

(1) prM-E (CEEV)

(2) prM-E

(RSSEV)

(a) i.d. by g.g. / 2x 1μg of DNA (0, 4 weeks)

(b) i.d. by g.g. / 3x

0.5μg of DNA (0, 4, 8 weeks)


• All mice immunised with (2) by (a) had detectable antibodies to RSSEV and CEEV prior to the second immunisation. All mice immunised with (1), (2), or (1) and (2) by (b) had detectable antibodies to RSSEV and CEEV prior to the second immunisation. CEEV-specific NT antibody titres were generally higher in mice immunised with (1), or (1) and (2) than those immunised with (2) only.

• All mice immunised with (1), (2), or (1) and (2) by (a) or (b) survived

challenge with CEEV or RSSEV (100 LD50) inoculated i.p. and NT antibody titres of mice were identical or lower than pre-challenge titres.

(Schmaljohn et al., 1997)

Central European encephalitis virus Russian spring summer encephalitis virus

(1) prM-E (CEEV)

(2) prM-E

(RSSEV)

i.d. by g.g. / 3x 2.5μg of DNA (0, 30, 70 days)

Adult rhesus macaques monkeys

• Monkeys immunised with (1) and (2) produced high NT antibody titres that were able to provide cross protection to RSSEV and CEEV respectively. Monkeys immunised with both (1) and (2) developed higher titres of NT antibodies to CEEV and RSSEV than those immunised with only (1) or (2). NT antibody titres were similar to that induced by immunising with a commercial formalin-inactivated TBEV vaccine.

• Passive s.c. transfer of sera from monkeys immunised with both (1) and

(2) protected mice from challenge with CEEV or RSSEV (100 LD50) inoculated i.p. Low to undetectable levels of circulating NT antibodies was present in mice 1 hour after passive transfer.

(Schmaljohn et al., 1999)

a Produced by substituting the C-terminal 129 base pairs of the E gene with 120 base pairs of sequence encoding the membrane anchor and cytoplasmic domains of lysosome-

associated membrane protein. b Inclusion of DNA sequences encoding the secretory signal sequence of tissue plasminogen activator. c Inclusion of a G poly A terminator sequence. d Inclusion of a SV40 poly A terminator sequence. Abbreviations: aa – amino acids; C-ter – C-terminus; g.g. – gene gun inoculation; GM-CSF – mouse granulocyte-monocyte colony stimulating factor; HAI – hemmagglutination-inhibiting; i.d. – intradermal inoculation; IFN – interferon; IL – interleukin; i.m. – intramuscular inoculation; i.n. – intranasal inoculation; i.v. intravenous inoculation; LAMP – lysosome-associated membrane protein; LD – lethal dose; NT – neutralising; N-ter – N-terminus; PFU – plaque forming units; s.c. – subcutaneous inoculation; TPA – tissue plasminogen activator.

87

CpG motifs

Various studies have demonstrated that DNA from bacteria, but not from vertebrates,

possessed the ability to activate the mammalian immune response (Krieg et al.,

1995; Tokunaga et al., 1984; Yamamoto et al., 1992) due to the presence of

unmethylated dinucleotide CpG motifs (cytosine linked to a guanine by a

phosphodiester backbone), which are relatively prevalent in the bacterial genome

with a frequency of approximately 1/16 dinucleotide bases. In contrast, CpG motifs

are heavily suppressed in vertebrate genomes, with a frequency of 1/50 to 1/60

dinucleotide bases, and are mostly methylated at the 5’ cytosine base, which

abrogates the immuno-stimulatory effects induced by the CpG motifs (Cardon et al.,

1994; Chen et al., 2001b; Han et al., 1994; Karlin et al., 1994b; Klinman et al.,

1997b; Krieg et al., 1998; Krieg et al., 1995).

Suppression of CpG motifs also was observed in the genomes of most of the smaller

eukaryotic viruses (<30 kbp in length), but not in most of the larger eukaryotic

viruses (≥ 30 kbp in length) (Karlin et al., 1994a). The immuno-stimulatory effects

of bacterial DNA also could be reproduced by single-stranded synthetic

oligodeoxynucleotides (ODN) containing the CpG motifs (Krieg et al., 1995).

Studies have demonstrated that the degree of immune stimulation by CpG motifs

was dependent on the identity of the bases flanking the CpG dinucleotide (Krieg et

al., 1995). Immuno-stimulatory CpG motifs (CpG-S) for activating mouse or rabbit

immune cells have the characteristic base sequence of (5’)purine-purine-CG-

pyrimidine-pyrimidine(3’), with the most potent sequence having been identified as

GACGTT, while the sequence GTCGTT was shown to be the optimal motif for

activating the immune cells of humans and other vertebrates (Hartmann and Krieg,

2000; Krieg, 2002; Krieg et al., 1995).

Various studies also have identified immuno-neutralising CpG motifs (CpG-N) that

have the potential to inhibit the stimulatory effects of CpG-S. The CpG-N motifs

were proposed to be direct repeats of CpG motifs, as well as CpG motifs that were

preceded by a cytosine and/or followed by a guanine base. These CpG-N motifs also

represented most of the CpG motifs found in the human genome (Han et al., 1994;

Krieg et al., 1998; Stunz et al., 2002). In addition, Stunz et al., (2002) demonstrated

88

that guanine-rich regions (G triads or tetrads) in single-stranded ODNs were highly

effective inhibitors of CpG-S-mediated immune activation, which may be attributed

to their ability to form higher order intermolecular structures (Bates et al., 1999;

Benimetskaya et al., 1997).

Current evidence suggest that CpG motifs do not activate immune cells by binding to

a sequence-specific cell surface receptor, but that activation is triggered following

cellular uptake and internalisation of the CpG motifs into an acidified endosomal

vesicle (Krieg, 2002). Studies using Toll-like receptor-9 (TLR9)-deficient (TLR9-/-)

mice demonstrated that CpG-S-mediated immune activation was dependent on

recognition by TLR9, although no direct binding of CpG motifs to TLR9 has been

demonstrated (Hemmi et al., 2003; Hemmi et al., 2000; Vollmer et al., 2004). TLR9

is a member of the large Toll-like receptor (TLR) family of pattern-recognition

receptors (PRRs) and is currently known to be expressed in the endosomal

membranes of B cells and CD123+ plasmacytoid dendritic cells (DC) in humans, and

also in the myeloid DC, monocytes and macrophages in mice (Ahmad-Nejad et al.,

2002; Hornung et al., 2002). In contrast to splenocytes and peritoneal macrophages

obtained from wildtype mice, the splenocytes and peritoneal macrophages from

TLR9-/- mice were unable to proliferate or produce detectable levels of TNF-α, IL-6

and IL-12 respectively, in response to CpG-S stimulation. Increased cellular

expression of MHC-II also was not observed in the DC or B cells from TLR9-/- mice

following CpG-S stimulation, in contrast to DC and B cells from wildtype mice

(Hemmi et al., 2000).

Studies using myeloid differentiation marker 88 (MyD88)-deficient (MyD88-/-) mice

also demonstrated that the immuno-stimulatory activity of CpG-S was dependent on

the expression of the cytoplasmic adapter molecule MyD88, which is induced by

TLR9 to activate various components of the adaptive immune response (Hacker et

al., 2000; Hemmi et al., 2003). In contrast to splenocytes and peritoneal

macrophages from wildtype mice, splenocytes and peritoneal macrophages from

MyD88-/- mice were unable to proliferate or produce detectable levels of TNF-α

respectively, in response to CpG-S stimulation (Hacker et al., 2000). Studies also

demonstrated that the immuno-stimulatory effects induced by CpG-S could be

abrogated by specific inhibitors of endosomal acidification and/or maturation, such

89

as monensin, chloroquine and bafilomycin A, which suggested that internalization

and acidification of the CpG motifs within the endosome may be required to initiate

the downstream CpG-induced immuno-stimulatory signals (Macfarlane and Manzel,

1998; Yi et al., 1998b).

Most of the immuno-stimulatory effects induced by CpG-S in mice also appear to be

present in humans (Krieg, 2002). Studies demonstrated that optimal CpG-S motifs

are efficient mitogens for stimulating B cell proliferation and also in preventing B

cell apoptosis by up-regulating the expression of oncogenes, such as c-myc, and

down-regulating the Fas-mediated apoptotic pathway (Wang et al., 1997; Yi et al.,

1998a; Yi et al., 1996b). CpG-S motifs also induce B cells to secrete IL-6 and IL-10,

enhance the expression of the Fcγ receptor, MHC-II, CD80 and CD86, and increase

IgM production (Krieg, 2002; Redford et al., 1998; Yi et al., 1996a; Yi et al.,

1996c). CpG-S motifs also induce monocytes and macrophages to secrete TNF-α,

IL-12 and IFN-α and -β, which induces NK cells to increase lytic activity and secrete

IFN-γ to enhance the protective immune responses (Ballas et al., 1996; Chace et al.,

1997; Hartmann and Krieg, 1999; Yamamoto et al., 1992). In addition, stimulation

of immature DC by CpG-S motifs induces their maturation, increases their surface

expression of MHC-II and CD86, and promotes secretion of IL-6, IL-12, TNF-α and

IFN-α and –β, which can also stimulate NK cells to produce IFN-γ (Hartmann et al.,

1999; Jakob et al., 1998; Krug et al., 2001).

The cytokine milieu generated in response to CpG-S in mice also promotes the

differentiation of naïve CD4+ helper T cells into a predominantly Th1-type immune

response with the production of IFN-γ and TNF-β, which then up-regulates the class-

switching of IgM production by B cells to the Th1-type antibody subclasses,

characterised by IgG2a, IgG2b and IgG3, while suppressing the IL-4 induced Th2-

type immune response and the production of the Th2-type antibody subclasses,

characterised by IgG1 and IgE (Krieg, 2002; Liu et al., 2003). In addition, studies

demonstrated that CpG motifs can increase the expression of the transcription factor

T-bet (Th1 gene regulator) mRNA in B cells, which promotes the production of

IgG2a and inhibits the production of IgG1 and IgE (Liu et al., 2003).

90

1.7 AIM OF THIS STUDY

An effective DENV vaccine must provide concurrent immunisation against each of

the four DENV serotypes in order to avoid sensitising recipients to developing

DHF/DSS. However, a problem already encountered with the development of live

attenuated tetravalent DENV vaccines has been the difficulty in eliciting adequate

immune responses against each of the four DENV serotypes in human hosts

(Bhamarapravati and Yoksan, 1997; Edelman et al., 2003; Kanesa-thasan et al.,

2001; Sun et al., 2003). This may have been due to variations in the antigenicity

and/or the replication rates of the four DENV serotypes. The utilisation of non-

replicating DNA vaccines would avoid the issue of different replication rates.

Currently, only DENV-1 and DENV-2 DNA vaccines have been evaluated.

The aim of this project was to develop DENV vaccine for each of the four DENV

serotypes that could be incorporated into a tetravalent formulation to provide

concurrent immnisation against all four DENV serotypes. In support of this aim, the

following DENV vaccines were developed and their immunogenicity was evaluated

in outbred mice:

1. a tetravalent DENV DNA vaccine consisting of a DNA vaccine for each of

the four DENV serotypes;

2. a number of DENV-4 DNA vaccines to investigate the correlation between

RSP secretion in vitro and the immunogenicity of the DENV-4 DNA

vaccine;

3. a number of DENV-2 DNA vaccines to investigate the influence of CpG

motifs on the immunogenicity of the DENV-2 DNA vaccine;

4. a number of DNA vaccines incorporating DENV prM and hybrid-E protein

genes derived from multiple DENV serotypes.

91

CHAPTER 2:

MATERIALS AND METHODS

2.1 CELL LINES AND MONOCLONAL ANTIBODIES

Baby Hamster Kidney-21 (BHK-21) clone-15 (Morens et al., 1985), C6/36 (Aedes

albopictus) mosquito (Igarashi, 1978), L929 (Mus musculus) mouse and various

hybridoma cell lines (Table 2.01) were propagated in RPMI-1640 medium

(Invitrogen, USA) supplemented with 5-10% v/v heat-inactivated foetal calf serum

(FCS) (CSL Limited, Australia) and 100units/ml penicillin G, 0.1mg/ml

streptomycin sulfate, 0.3mg/ml L-glutamine (PSG) (Invitrogen, USA). Mammalian

and hybridoma cells were grown at 370C in an atmosphere of 5% v/v CO2/air and

C6/36 cells were grown at 300C in an atmosphere of 2.5% v/v CO2/air. Medium from

cultures of hybridoma cells was used as a source of monoclonal antibodies (MAbs).

2.2 DENGUE VIRUSES

The strains of DENV used in this study were the DENV-1 Hawaii, DENV-2 New

Guinea C (NGC), DENV-3 H87, DENV-3 PRS225489 Burma and DENV-4 H241.

Stocks of DENV were prepared by infecting monolayers of BHK-21 or C6/36 cells

(80-90% confluent) with approximately 1ml of virus inoculum per 25cm2 of cell

monolayer for 2 to 4 hours at the appropriate temperature (see Section 2.1). The

virus inoculum was discarded and serum-free RPMI-1640 with PSG was added to

the cell monolayers, which were incubated as described above. Cultures were

examined daily for the presence of cytopathic effects (CPE).

When infected cell monolayers exhibited greater than 75% CPE, or seven days post-

infection (whichever occurred first), the tissue culture supernatant (t.c.s.) from the

virus-infected cells was recovered and centrifuged at 230g for 5 minutes at room

temperature to remove cell debris. Heat-inactivated FCS was added to the clarified

t.c.s. to produce a final concentration of 30% v/v FCS and aliquoted in 1ml volumes

for storage at -800C until required.

92

TABLE 2.01 – Summary of the monoclonal antibodies used in this study

Monoclonal

Antibody Isotype Specificity

Reactive Protein /

Epitope location Function(s) References

4G2 IgG2a All flaviviruses E / E349-359 (DEN2)

and/or E169 (DEN2)

and/or E275 (DEN2)

Neut. and HI (Gentry et al., 1982)

(Falconar, 1999)

(Serafin and Aaskov, 2001)

6B6C1 IgG2a All flavivirus E / n.d. Neut. (Roehrig, 1982)

2H2 IgG2a All DENV

serotypes

M / M40-49 (DEN2) Neut. (Gentry et al., 1982)

(Falconar, 1999)

(Kaufman et al., 1989)

15F3 IgG2a DENV-1 Non-structural / n.d. n.d. (Gentry et al., 1982)

3H5 IgG1 DENV-2 E / E383-385 (DEN2)

and/or E386-397

(DEN2)

Neut. (Gentry et al., 1982)

(Trirawatanapong et al., 1992)

(Hiramatsu et al., 1996)

5D4 IgG1 DENV-3 Non-structural / n.d. n.d. (Gentry et al., 1982)

1H10 IgG1 DENV-4 E / n.d. Neut. (Gentry et al., 1982)

D1-M10 IgM DENV-1 and 3 E / E279 (DEN1) Neut. and HI (Beasley and Aaskov, 2001)

D1-M17 IgM DENV-1 and 2 E / E293 (DEN1) Neut. and HI (Beasley and Aaskov, 2001)

D1-M40 IgM DENV-1, 2 and 3 E / n.d. Neut. (Beasley and Aaskov, 2001)

6B2 IgM DENV-2 E / E311 (DEN2) Neut. and HI (Jianmin et al., 1995)

(Lok et al., 2001)

10F2 IgM DENV-2 E / E69 (DEN2)

and/or E71 (DEN2)

and/or E112 (DEN2)

and/or E124 (DEN2)

Neut. and HI (Jianmin et al., 1995)

(Lok et al., 2001)

17F3-D8 IgG2a All flaviviruses E / n.d. Neut. and HI (Serafin and Aaskov, 2001)

1H9 IgM DENV-3 E / E386 (DEN3) Neut. and HI (Serafin and Aaskov, 2001)

11D5-D7 IgG1 DENV-3 E / n.d. Neut. and HI (Serafin and Aaskov, 2001)

F1G2 IgM DENV-4 E / n.d. Neut. and HI Not published a

13H8 IgG1 DENV-4 E / n.d. Neut. Not published a

18F5 IgG2a DENV-4 E / n.d. Neut. and HI Not published a

a Monoclonal antibodies were kindly provided by C. Howard at the School of Life Sciences,

Queensland University of Technology (QUT), Australia. Abbreviations: HI – haemagglutination inhibition; n.d. – not determined; Neut. – neutralization.

93

High titre stocks of DENV were prepared by first centrifuging the t.c.s. from virus-

infected cells in a Beckman JA10 rotor (Beckman Instruments, USA) at 16,000g for

45 minutes at 40C to remove residual cell debris. The supernatant was recovered and

stirred gently overnight at 40C in the presence of 40% w/v polyethylene glycol

(PEG)-6,000 and 15% w/v NaCl. Virus particles were pelleted by centrifugation in a

JA10 rotor at 16,000g for 1 hour at 40C. Virus pellets were resuspended in borate

saline buffer (0.12M NaCl, 0.05M H3BO3, 0.024M NaOH [pH 9.0]) and aliquoted in

0.5ml volumes for storage at -800C until required.

2.3 INDIRECT IMMUNOFLUORESCENCE ASSAY

Cells used in indirect immunofluorescence assay (IFA) were recovered from

monolayers by trypsinisation and pelleted by centrifugation at 230g for 5 minutes at

room temperature. The cell pellets were resuspended in PBS buffer (0.137M NaCl,

0.00268M KCl, 0.01M Na2HPO4, 0.00176M KH2PO4), and 50µl aliquots were

applied to individual wells of an IFA slide (ICN Biomedicals, USA) and allowed to

stand for 20 minutes at room temperature. Excess fluid was removed and the cells

were air-dried and fixed with ice-cold acetone for 5 minutes.

Fifty microliters of primary antibody solution were applied to the cells in each well

on the slide and incubated at room temperature for 45 minutes. Slides were washed 3

times in PBS for 5 minutes each, after which 50µl of fluoroscein isothiocyanate

(FITC)-conjugated anti-mouse IgG antibodies (Dako, Denmark) or anti-mouse IgM

antibodies (Southern Biotechnology Associates, USA), diluted in PBS buffer, were

applied to the appropriate wells of the slide and incubated at room temperature for 45

minutes. Slides were washed and a coverslip was mounted on the slide with DABCO

(1,4-Diazabicyclo[2.2.2]octane) mounting medium (Sigma-Aldrich, USA).

Fluorescent cells were examined using an ultraviolet microscope (Leica,

Switzerland) and photographed using the Nikon Digital Still Camera DXM1200

(Nikon, Japan) with the Nikon ACT-1 Version 2.12 program (Nikon, Japan). The

percentage of cells exhibiting fluorescence was scored as follows: 1-25% = 1+, 26-

50% = 2+, 51-75% = 3+, 76-100% = 4+.

94

2.4 ANTIBODY CLASS AND SUBCLASS CAPTURE ELISA

The concentrations of DENV serotype-specific class and subclass antibodies in

mouse serum were determined using an antibody class and subclass capture ELISA

essentially as described by Gupta and Siber, (1995). Individual wells on

MAXISORP ELISA U-plates (Nunc, USA) were coated with 50µl of PEG-

concentrated DENV stocks (see Section 2.2), diluted in borate saline buffer, and

incubated at 40C overnight. The contents of each well were discarded and plates

were washed 2 times in PBS buffer using an automated plate washer (Thermo

Labsystems, USA). One hundred microliters of blocking solution (2% w/v skim

milk, PBS) was added to each well and incubated at 370C for 2 hours to inhibit non-

specific binding by antibody. The contents of all wells were discarded and plates

were washed 5 times in PBS-Tween buffer (0.2% v/v Tween-20, PBS) and once in

PBS buffer. Fifty microliters of primary antibody solution (pooled mouse serum

diluted in PBS-Tween buffer containing 5% v/v Milk diluent Blocking Solution

Concentrate (PBS-Tween/milk), or undiluted hybridoma t.c.s.) was added to

duplicate or triplicate wells and plates were incubated at 40C overnight.

The contents of wells were discarded and plates were washed 5 times in PBS-Tween

buffer and once in PBS buffer. Fifty microliters of horseradish peroxidase (HRP)-

conjugated anti-mouse Ig class or subclass-specific antibodies (The Binding Site,

UK), diluted 1/1,000 in PBS-Tween/milk, were added to the appropriate wells and

incubated at 370C for 1 hour. The contents of all wells were discarded and plates

were washed 5 times in PBS-Tween buffer and once in PBS buffer. Fifty microliters

of Tetramethylbenzidine (TMB) ELISA substrate/chromogen (ELISA Systems,

Australia) was added to each well and colour development allowed to proceed at

room temperature. The reaction was terminated by adding 50µl of 3M HCl to each

well and absorbances were determined on a Biomek plate reader (Beckman

Instruments, USA) at a wavelength of 490nm with a reference wavelength of 650nm.

To facilitate the quantification of class and subclass antibodies, an Fab-capture

ELISA, using known concentrations of purified normal mouse Ig class or subclass

antibody standards, was performed in parallel with the indirect ELISA described

above. Individual wells were coated with 50µl of anti-mouse Ig Fab-specific

antibodies (Sigma-Aldrich, USA), which were prepared at a concentration of 10 to

95

12.5μg/ml in borate saline buffer, and incubated at 40C overnight. The contents of all

wells were discarded and plates were washed, incubated in blocking solution and

washed again as described above. Fifty microliters of purified mouse IgM, IgG,

IgG1, IgG2a, IgG2b, or IgG3 antibodies (The Binding Site, UK), which were diluted

appropriately in PBS-Tween/milk, were added to duplicate wells and plates were

incubated at 40C overnight. The mouse Ig antibody standards were detected using

HRP-conjugated anti-mouse Ig class or subclass-specific antibodies as described

above. Statistical significance of antibody responses was determined by the unpaired

two-tailed Student t test with P<0.05 being considered statistically significant.

2.5 FOCUS-FORMING ASSAY AND FOCUS-FORMING UNIT REDUCTION

NEUTRALISATION TEST (FFURNT)

Titres of DENV and of anti-DENV neutralising antibodies were determined using

the focus-forming assay (Ishimine et al., 1987) and FFURNT (Pletnev et al., 2001;

Pletnev et al., 2002) respectively. One millilitre of a suspension of BHK-21 cells

(approximately 2x105 cells/ml) containing 2% v/v heat-inactivated FCS with PSG

supplement was seeded into wells of a flat-bottom 24-well tissue culture plate (Nunc,

USA) and grown at 370C in 5% v/v CO2/air overnight. The medium in the wells was

discarded immediately prior to performing the focus-forming assay or FFURNT.

For focus-forming assays, serial 10-fold dilutions of virus suspension were prepared

in RPMI-1640 containing 2% heat-inactivated FCS with PSG supplement and 200μl

were inoculated into duplicate wells of the tissue culture plate containing the

monolayer of BHK-21 cells. Plates were incubated at 370C in 5% v/v CO2/air for 2

hours for virus to absorb to the cells and all wells were overlaid with 1ml of a 1.5%

w/v solution of carboxy-methyl cellulose (CMC; BDH Laboratory Supplies, U.K.)

and RPMI-1640 containing 2% v/v heat-inactivated FCS with PSG. Plates then were

incubated for 3 days (for DEN2, 3 and 4 viruses) or 4 days (for DEN1 virus) at 370C

in 5% v/v CO2/air.

The contents of all wells were discarded and the cell monolayers were washed once

with PBS and fixed for 30 minutes at room temperature with 1ml of formaldehyde

solution (5% v/v formaldehyde, PBS). Cell monolayers were washed twice with PBS

96

buffer and 1ml of blocking solution (2% w/v skim milk, PBS) was added to each

well and plates were incubated for 1 hour at room temperature to inhibit non-specific

binding by antibody. The contents of all wells were discarded and 200µl of HRP-

conjugated anti-flavivirus MAb 6B6C1 (Panbio, Australia), diluted 1:5000 in

blocking solution, was added to each well and incubated for 1 hour at room

temperature. The contents of all wells were discarded and cell monolayers were

washed three times in PBS. Two hundred microliters of TMB Stabilized Substrate

(Promega, USA) were added to all wells. After foci of infected cells were visible, the

cell monolayers were rinsed once with sterile water and foci of infected cells were

counted. Virus titres were expressed as focus-forming units per millilitre (FFU/ml)

of virus inoculum.

For FFURNT, pooled mouse serum was heat inactivated at 560 C for 30 minutes and

diluted 1:10 with RPMI-1640 containing 2% FCS and PSG supplement. Serial two-

fold dilutions of this inactivated serum were prepared in RPMI-1640 containing 2%

heat-inactivated FCS with PSG supplement and 100μl of the dilutions were mixed

with an equal volume of virus suspension (50 FFU) and incubated at 370 C for 1

hour. The serum/virus suspensions were inoculated onto duplicate monolayers of

BHK-21 cells and incubated at 370C in 5% v/v CO2/air for 2 hours for virus to

absorb to cells. All wells were overlaid with 1ml of a 1.5% w/v solution of CMC and

RPMI-1640 containing 2% heat-inactivated FCS with PSG. Plates were incubated

for 3 days (for DENV-2, 3 and 4) or 4 days (for DENV-1) at 370C in 5% v/v CO2/air

and infected cells were detected as described above. The neutralising antibody titre

was determined as the highest serum dilution to yield a 50% reduction in 50 focus-

forming units (FFURNT50).

97

2.6 POLYACRYLAMIDE GEL ELECTROPHORESIS AND WESTERN

BLOTTING

Sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) and

western blotting were performed essentially as first described by Laemmli (1970)

and Towbin et al., (1979) respectively.

Viral proteins were derived from either PEG-concentrated virions (see Section 2.2)

or from lysates of virus infected cells, which were recovered from monolayers by

trypsinisation and pelleted by centrifugation at 230g for 5 minutes at room

temperature. Cell pellets were resuspended in cell lysate extraction buffer (1% v/v

Triton-X 100, 0.1% SDS) (1ml for a 25cm2 T flask, 3ml for a 80cm2 T flask, or 5ml

for a 175cm2 T flask) and incubated at 370C for 20 minutes. The cell suspension was

centrifuged at ≥12,000g for 20 minutes at 40C to remove residual cell debris. The

supernatant was recovered and aliquoted in 0.5ml volumes for storage at -800C until

required.

Samples were prepared in SDS-PAGE loading buffer (50mM Tris-HCL [pH 6.8],

2% v/v SDS, 10% v/v Glycerol, 0.1% w/v Bromophenol Blue, without

meceptoethanol) and boiled for 5 minutes before loading. Proteins were separated by

electrophoresis through a discontinuous (5% stacking and 12% resolving gel)

polyacrylamide gel, consisting of a 29:1 acrylamide:bisacrylamide concentration, in

a Mini-Protean II Electrophoresis Cell gel apparatus (Biorad, USA). Electrophoresis

was performed at room temperature in Tris-Glycine buffer (25mM Tris, 0.25M

glycine, 0.1% v/v SDS) at 50 volts through the stacking gel, followed by 100 volts

through the resolving gel. A pre-stained molecular weight standard (Invitrogen,

USA) was included in each gel to facilitate the estimation of the size of proteins.

Following electrophoresis, proteins in the gels were transferred onto a PROTRAN

nitrocellulose membrane (Schleicher and Schuell, Germany) using a Mini Trans-Blot

Electrophoretic Transfer Cell apparatus (Biorad, USA). Protein transfer was

performed in pre-chilled transfer buffer (10mM 3-Cyclohexylamino-1-

propanesulfonic acid [pH 11], 10% v/v methanol, 0.001% v/v SDS) at 200mA for 3

hours. The nitrocellulose membranes were washed 3 times in TBS-Tween buffer

(50mM Tris-HCl [pH 7.5], 0.15M NaCl, 0.2% v/v Tween-20) for 10 minutes each,

98

followed by once in TBS buffer (50mM Tris-HCl [pH 7.5], 0.15M NaCl) for 10

minutes on an orbital shaker at 125 rpm. The membranes were incubated in blocking

solution (2% w/v skim milk, TBS) overnight at 40C with gentle rocking to inhibit

non-specific binding. The membranes were incubated in primary antibody solution,

diluted in blocking solution, for 1 hour at room temperature with gentle rocking.

Membranes were washed, as described above, to remove any unbounded antibodies,

and incubated in HRP-conjugated anti-mouse Ig antibodies (Dako, Denmark), which

was diluted 1/1,000 in blocking solution, for 1 hour at room temperature with gentle

rocking. Membranes then were washed again, as described above, and the Lumi-

Light Plus Western Blotting chemiluminescence substrate/chromogen solution

(Roche, Germany), which was prepared according to the manufacturer’s instructions,

was applied directly onto the membranes and rocked gently for 2 minutes at room

temperature. Excess substrate/chromogen solution was drained from the membranes

and proteins emitting chemiluminescence were detected on AGFA Curix-blue HC-S

Plus X-ray film (AGFA, Belgium), which was developed using the AGFA CP1000

automatic film processor (AGFA, Belgium). When required, densitometry analysis

of western blots was performed using the Totallab Version 1.10 program (Nonlinear

Dynamics, UK).

2.7 RNA EXTRACTION AND REVERSE TRANSCRIPTION-POLYMERASE

CHAIN REACTION (RT-PCR)

DENV genomic RNA was extracted from 140μl of DENV-infected t.c.s. using the

QIAamp Viral RNA Mini kit (Qiagen, USA) according to the manufacturer’s

instructions. Complementary DNA (cDNA) was synthesized from viral RNA by RT-

PCR, which was performed in an initial reaction volume of 13µl containing 1-5µl of

RNA and 1nmol of random hexamer primers (Roche, Germany). The reaction was

heated at 720C for 10 minutes and cooled on ice for 3 minutes. RT-PCR buffer

(50mM Tris-HCl [pH 8.5], 8mM MgCl2, 30mM KCl, 1mM dithiothreithol (DTT))

(Promega, USA), 0.75mM of dNTPs (Roche, Germany), 40 units of RNase inhibitor

(Roche, Germany) and 12.5 units of AMV Reverse Transcriptase (Promega, USA)

were added to the reaction to produce a final volume of 20µl and the reaction was

incubated at 550C for 10 minutes followed by 450C for 1 hour.

99

2.8 POLYMERASE CHAIN REACTION

Polymerase chain reactions (PCRs) were performed using either Pwo DNA

polymerases (Roche, Germany) or Elongase enzyme mix (Taq/Pyrococcus species

GB-D thermostable DNA polymerase mixture) (Invitrogen, USA). Both of these

polymerases have a 3’ to 5’ exonuclease proof-reading activity to minimise the

incorporation of mismatched nucleotides during amplification. PCR reactions for

amplification of DNA products less than 6kbp in size were prepared in a volume of

50µl containing 60ρmoles of each primer, 1X PCR buffer (10mM Tris-HCl [pH

8.85], 25mM KCl, 5mM (NH4)2SO4, 2mM MgSO4) (Roche, Germany), 0.3mM

dNTPs and 2.5 units of Pwo DNA polymerase.

PCR reactions for amplification of DNA products between 8kbp and 12kbp in size

were prepared in a volume of 50µl containing 15ρmoles of each primer, PCR buffer

B (60mM Tris-SO4 [pH 9.1], 18mM (NH4)2SO4, 2mM MgSO4) (Invitrogen, USA),

0.3mM dNTPs and 1μl of Elongase enzyme mix. Primers and amplification

conditions used for all PCRs are listed in Table 2.02 and Table 2.03 respectively.

2.9 AGAROSE GEL ELECTROPHORESIS AND QUANTIFICATION OF

NUCLEIC ACIDS

DNA and RNA samples were analysed by electrophoresis on non-denaturing agarose

gels in TAE buffer (40mM Tris acetate [pH 7.5], 2mM EDTA) essentially as

described by Sambrook and Russell, (2001). Samples were prepared in loading

buffer (25mM EDTA [pH 8.0], 30% v/v glycerol, 0.04% w/v Bromophenol Blue)

and 1μg/ml of ethidium bromide (EtBr) was included on each gel. A molecular

weight standard (Roche, Germany) also was included to facilitate the estimation of

the size and concentration of the nucleic acid products in the gels. Nucleic acid

products were visualised on an ultraviolet transilluminator (AGP Technologies,

USA), and images then were captured by the Grab-IT 2.0 Image Capture program

(AGP Technologies, USA). When required, DNA products were purified from

agarose gels using the High Pure PCR Product Purification kit (Roche, Germany)

according to the manufacturer’s instructions.

100

TABLE 2.02 - Summary of the primers used in this study

Primers Sense Nucleotide Sequence (5' - 3') a Location Reference

GENERIC DENGUE PRIMER: DEN-CAPSID + TCAATATGCTGAAACGCGNGAGAAACCG 134-161 This study DENGUE 1 SEROTYPE-SPECIFIC PRIMERS D1-136F + GAAGGGCGATCGGTGCGGGCCTCTT 136-163 This study D1-153F + AGCAGGAATTTTGGCTAGATGGGGC 153-177 This study D1-312R - GAACGCCAGGGCTGTGGGCAGAGC 312-288 This study D1-314F + CACTATAGAGTTGTTAGTCTACGTGGACCG 314-343 This study D1-686F + GTCGCACTGGCACCACACGTAGGGC 686-710 This study D1-764F + CAAATACAAAAAGTGGAGACCTGGGC 764-789 This study D1-832R - TGCTAGAAAAAGGGCTATCACCGTG 832-808 This study D1-843F + GCACATGCCATAGGAACATCC 843-863 This study D1-1133F + ACACAAGGAGAAGCCACGCTGGTGG 1133-1157 This study D1-1207R - GCCTCTGTCCACGAACGTTCGTCGA 1207-1183 This study D1-1573F + CGGGGGCTTCAACATCCCAAGAGAC 1573-1597 This study D1-1742R - AATTGTTGTCGTTCCAGACGTTTGG 1742-1718 This study D1-1991F + AGAAAAACCAGTCAACATTGAAGCG 1991-2015 This study D1-2148R - TGGCCATCCTTCGTGCTCCACGGGC 2148-2124 This study D1-2337F + ATGACGTGTATCGCAGTTGGCATGG 2337-2361 This study D1-2420R - TTTCCAGTTGATTACACATCCCGAG 2420-2396 This study D1-2467R - GACTTCATTGGTGACAAAAATGCCGC 2467-2443 This study D1-2686R - GCCAAGATTCCACTAACGTCTCCTACGACC 2686-2657 This study D1-2772R - CTGCTCCTATGATTTTGGCTTTTCCCCAGC 2772-2743 This study DENGUE 2 SEROTYPE-SPECIFIC PRIMERS: D2-96F + GATGAATAACCAACGAAAAAAGGCG 96-120 This study D2-237R - GAACAGTTTTAATGGTCCTCGTCCC 237-213 This study D2-381F + GAACAGGAGACGCAGAACTGCAGGC 381-405 This study D2-437F + CGTTCCATTTAACCACACGTAACGG 437-461 This study D2-566R - TCACCAAGGTCCATGGCCATGAGGG 566-542 This study D2-789F + GAAACATGCCCAGAGAATTGAAACT 789-813 Lewis et al., 1992 D2-882R - ATGTGTCGTTCCTATGGTGTATGCC 882-858 This study D2-996F + GGTTGACATAGTCTTAGAACATGGAAG 996-1022 Lewis et al., 1992 D2-1211F + GCAAACACTCCATGGTGGACAGAGG 1211-1235 Lewis et al., 1992 D2-1227R - CCACATCCATTTCCCCATCCTCTGTCC 1227-1201 Lewis et al., 1992 D2-1546F + AAGCTTGGCTGGTGCACAGGCAATGGTT 1546-1573 Lewis et al., 1992 D2-1567R - TGGCAACGGCAGGTCTAGGAACCATTG 1567-1540 Lewis et al., 1992 D2-1863F + GAAGGAAATAGCAGAAACACAACATGG 1863-1889 Lewis et al., 1992 D2-1888R - CCCTTCATATTGTACTCTGATAACTATTGTTCC 1888-1856 Lewis et al., 1992 D2-2170F + ATGGCCATTTTAGGTGACACAGCTTGGGA 2170-2198 Lewis et al., 1992 D2-2200R - TGTAAACACTCCTCCCAGGGATCCAAA 2200-2174 Lewis et al., 1992 D2-2398F + TATTTGGGAGTTATGGTGCAGGCCG 2398-2422 This study D2-2481F + CATCACAGACAACGTGCACACATGG 2481-2505 This study D2-2504R - GGGGATTCTGGTTGGAACTTGTATTGTTCTGTCC 2504-2471 Lewis et al., 1992 D2-2632R - TTTGTTTCCACATCAGATTTTCCAG 2632-2608 This study D2-2809F + AACCAGACCTTTCTCATTGATGGCC 2809-2833 This study D2-2920R - TATTGGTTGGTGAATACTCCAAAGCC 2920-2896 This study D2-3202F + CATACACAAACAGCAGGACCATGGC 3202-3226 This study D2-3383R - AGCGGTGGTAATGTGCAAGATCGGC 3383-3359 This study D2-3638F + GAAGAGTGATGGTTATGGTGGGCGC 3638-3662 This study D2-3762R - ACTTCTCAAGAGTAGTCCAGCTGC 3762-3738 This study D2-4052F + TACCATTAGCATTGACGATCAAGGG 4052-4076 This study D2-4182R - CAAAATGCTCACCATCCCGACTGCC 4182-4158 This study D2-4480F + ACGGCACGAGCATGGTACCTGTGGG 4480-4504 This study D2-4599R - CTTGATTCTATAGGCTCCATCTTCC 4599-4575 This study D2-4882F + GGAACCATAGGTGCCGTATCTCTGG 4882-4906 This study

101

TABLE 2.02 (cont.) - Summary of the primers used in this study


D2-5041R - CTTCAATACTTTTTTCAGTCTGGGC 5041-5017 This study D2-5324F + GGCTGCTATCACCAGTTAGAGTGCC 5324-5348 This study D2-5452R - CAGCTGCCTCACCCATCTCTACTCG 5452-5428 This study D2-5742F + AACTGACATTTCAGAAATGGGTGCC 5742-5766 This study D2-5862R - CATAGGTCCTGCCAGGATCACCCGC 5862-5838 This study D2-6138F + AGGAGACCTACCAGTCTGGTTGGCC 6138-6162 This study D2-6322R - AGATCCTGGCATCCAACCATCTGGG 6322-6298 This study D2-6505F + GCTCTCAGTGAACTGCCGGAGACCC 6505-6529 This study D2-6648R - AGCCGTGATTATGCAGCACATTCCC 6648-6624 This study D2-6933F + AGCATGGACGCTGTATGCTGTGGCC 6933-6957 This study D2-7063R - TCCCAAGACCCATTAACACTGTGGC 7063-7039 This study D2-7333F + CAAGTAATGCTCCTAGTCCTCTTCG 7333-7357 This study D2-7487R - ATTGACACTGCAATGGTAGTGTTCC 7487-7463 This study D2-7719F + GGACCATCACGCTGTGTCGCGAGGC 7719-7743 This study D2-7839R - ATAGTATGACCAGCCTCCTCTGCCG 7839-7815 This study D2-8109F + AAAGGTTCTCAACCCATACATGCCC 8109-8133 This study D2-8263R - CTGATGACACTATGTTCCCGGAGGC 8263-8239 This study D2-8506F + CAAACTGGATCAGCATCATCCATGG 8506-8530 This study D2-8630R - ACGCGCTGTTGTCCAAATGGAGTCG 8630-8606 This study D2-9012F + AAACATGTGTGTATAACATGATGGG 9012-9036 This study D2-9055R - GATCTTCATTCAAGAATCCTAGGCC 9055-9031 This study D2-9306F + TGTGCAAAGACCAACACCAAGAGGC 9306-9330 This study D2-9462R - GCTTTTGAAGACTCCTTCTCCCTCC 9462-9438 This study D2-9761F + AAGATGAACTGATTGGTAGAGCCCG 9761-9785 This study D2-9901R - CATTAGCCGCCAGCCTGAGGTCACG 9901-9877 This study D2-10170F + AAATCAAGTTAGATCCCTTATAGGC 10170-10194 This study D2-10320R - GCTTAATCCGACCTGACTTCTAGCC 10320-10296 This study D2-10582F + ACTAGAGGTTAGAGGAGACCCCCCC 10582-10606 This study D2-10806R - ATGACCATGATTACGCCAAGCGCGC 10806-10782 This study DENGUE 3 SEROTYPE-SPECIFIC PRIMERS: D3-278F + CGCGGATCCACAGCAGGAGTCTTGGCTAGATGGGG 278-303 Lanciotti et al., 1994 D3-722F + GCTCCCCATGTCGGCATGGGACTGG 722-746 Lanciotti et al., 1994 D3-788R - TCCAAGCTCCTTCAGATGACATCCA 788-764 Lanciotti et al., 1994 D3-992F + TGGGTTGACGTGGTGCTCGAGCACGG 992-1017 Lanciotti et al., 1994 D3-1072R - CTGAAGCTCTATGTCCAGCGTGGG 1072-1049 Lanciotti et al., 1994 D3-1259F + GGCAAGGGAAGCTTGGTGACATGCGC 1259-1284 Lanciotti et al., 1994 D3-1331F + AGAACCTCAAATACACCGTCAT 1331-1353 Lanciotti et al., 1994 D3-1559R - TGGTTAACGGCAGGTTCTAGGAACCATTG 1585-1559 Lanciotti et al., 1994 D3-1685F + CTAGGATCTCAAGAAGGAGCAATGCA 1685-1710 Lanciotti et al., 1994 D3-1703F + GCAATGCATACAGCACTGACAGGAGC 1703-1728 This study D3-1796R - TGAGTCTACATTTTAAGTGCCCCGC 1796-1772 This study D3-1819R - CATCCCTTTGAGTTTCAATTTGTCCAT 1819-1793 Lanciotti et al., 1994 D3-1908F + AAGGGGAAGATGCACCCTGCAAGATTCC 1908-1935 Lanciotti et al., 1994 D3-2190R - TCCCAAGCTGTGTCTCCCAGAATGGCCAT 2190-2162 Lanciotti et al., 1994 D3-2550R - CGCGGATCCATGGCTGTTGCCACTCTTTGGGGGA 2550-2515 Lanciotti et al., 1994 DENGUE 4 SEROTYPE-SPECIFIC PRIMERS: D4-742F + TGGGATTGGAAACAAQGAGCTGAGACATGGATGTC 742-776 Lanciotti et al., 1994 D4-903F + TTTGTCCTAATGATGCTGGTCGCCCCATC 903-931 Lanciotti et al., 1994 D4-1200R - GGTCCTGTTCCTTCAGATAAGGCTCTCCTTG 1200-1170 Lanciotti et al., 1994 D4-1236F + GGGTGGGGCAATGGCTGTGGCTTGTTTGG 1236-1264 Lanciotti et al., 1994 D4-1416F + ATAACCCCCAGGTCACCATCGG 1416-1437 Lanciotti et al., 1994 D4-1461R - ATTTGACTTCCACCGATGGTGACCTAGGAGTTAT 1461-1428 Lanciotti et al., 1994 D4-1569F + CAATGGTTTTTGAATCTGCCTCTTCCATGG 1569-1598 Lanciotti et al., 1994 D4-1838R - CGTGTATGACATTCCCTTGATTCTCAATTTCTCCA 1838-1804 Lanciotti et al., 1994

102



D4-1916F + TGAAGGTGCCGGAGCTCCGTGTAAAGTCCC 1916-1945 Lanciotti et al., 1994 D4-2219F + GTTCACATCATTGGGAAAGGCTGTGCACCA 2219-2248 Lanciotti et al., 1994 D4-2471R - GCTTCCACACTTCAATTCTTTCCCACTCCA 2471-2442 Lanciotti et al., 1994 D4-2536R - GGGGACTCTGGTTGAAATTTGTACTGTTCTGTCCA 2536-2502 Lanciotti et al., 1994 DENGUE DNA VACCINE PLASMID PRIMERS b, c: D1MEstart + AGAATGGAGCGATCAAAGTGTTGCTAGCTTTCAAGAAA Figure 3.01 This study ACCATGGCAAACATGTTGAAC D1MEstop - GCCTCTCGAGTTGATTACACATCCCGATTAYGCSTGAAC Figure 3.01 This study D2MEstart + AATCAAAAGCCATTAATGTTTTGCTAGCGTTCAGGAAA Figure 3.01 This study ACCATGGGAAGGATGCTG D2MEstop - TCAGTTCTTTGTGGTACCAGTGTACAACGCAACCACTTT Figure 3.01 This study AGGCYTGYACC D3MEstart + AAGGTCTTAAAAGGCTAGCAGAAGACCATGGCAAACATG Figure 3.01 This study CTGAGCATTATCAACAAACGG D3MEstop - TCTTTGCGGTACCAGTTTATTGTACACCCCATTTAAGCT Figure 3.01 This study TGCACCACG D4MEstart + AAAATAAGGCCATCAAGATACTGCTAGCATTCAGGAAG Figure 3.01 This study ACCATGGGCCGCATGCTGAAC D4MEstop - CCCACTCGAGGACACCGCACAACCCGTTTATGCGTGAACT Figure 3.01 This study GTG OVERLAPPING EXTENSION HYBRID DENGUE PRIMERS d: DEN23-E3 + GCAGGCTGAGGATGGacaaattggaactcaaggg Figure 6.02 This study DEN32-E4 - tgagttccaatttgtCCATCCTCAGCCTGCACTT Figure 6.02 This study DEN32-E5 + AGTCGTGGTACAAGCcgatagtggttgcgttgtg Figure 6.02 This study DEN23-E6 - acgcaaccactatcgGCTTGTACCACGACTCCTA Figure 6.02 This study DEN23-E7 + GCTCCTTCAATGACAatgagatgtgtgggagtag Figure 6.02 This study DEN32-E8 - tcccacacatctcatTGTCATTGAAGGAGCGACA Figure 6.02 This study DEN32-E9 + GTAGACTTAAGATGGacaaactacagctcaaagg Figure 6.02 This study DEN23-E10 - tgagctgtagtttgtCCATCTTAAGTCTACATTT Figure 6.02 This study DEN21-E25 + GCTCCTTCAATGACAatgcgatgcgtgggaat Figure 6.02 This study DEN12-E26 - tcccacgcatcgcatTGTCATTGAAGGAGCGA Figure 6.02 This study DEN14-E27 + AAACTGACCTTAAAAggaatgtcatacacgat Figure 6.02 This study DEN41-E28 - cgtgtatgacattccTTTTAAGGTCAGTTTGT Figure 6.02 This study DEN42-E29 + TTCACAGTTCACGCAgatagtggttgcgttgt Figure 6.02 This study DEN24-E30 - aacgcaaccactatcTGCGTGAACTGTGAAAC Figure 6.02 This study DEN24-E31 + GCTCCTTCAATGACAatgcgatgcgtgggagt Figure 6.02 This study DEN42-E32 - tcccacgcatcgcatTGTCATTGAAGGAGCGA Figure 6.02 This study DEN41-E33 + AAATTGAGAATTAAGgggatgtcatatgtgat Figure 6.02 This study DEN14-E34 - cacatatgacatcccCTTAATTCTCAATTTCT Figure 6.02 This study DEN12-E35 + GTCATGGTTCAGGCGgatagtggttgcgttgt Figure 6.02 This study DEN21-E36 - aacgcaaccactatcCGCCTGAACCATGACTC Figure 6.02 This study DEN21-E37 + AAACTACAGCTCAAAgggatgtcatatgtgat Figure 6.02 This study DEN12-E38 - cacatatgacatcccTTTGAGCTGTAGTTTGT Figure 6.02 This study DEN12-E39 + AGGATGGCCATCCTAggtgacacagcttggga Figure 6.02 This study DEN21-E40 - ccaagctgtgtcaccTAGGATGGCCATCCTTC Figure 6.02 This study DEN21-E41 + CCAACAGTGATGGCGttccatctgaccacacg Figure 6.02 This study DEN12-E42 - tgtggtcagatggaaCGCCATCACTGTTGGAA Figure 6.02 This study DEN12-E43 + AAACTGACCTTAAAAggaatgtcatactctat Figure 6.02 This study DEN21-E44 - agagtatgacattccTTTTAAGGTCAGTTTGT Figure 6.02 This study DEN24-E45 + CCAACAGTGATGGCGttttccttgtcaacaag Figure 6.02 This study DEN42-E46 - tgttgacaaggaaaaCGCCATCACTGTTGGAA Figure 6.02 This study DEN43-E47 + AAATTGAGAATCAAGgggatgagctatgcaat Figure 6.02 This study DEN34-E48 - tgcatagctcatcccCTTGATTCTCAATTTCT Figure 6.02 This study

103



DEN34-E49 + ACAGCCTGGGACTTTggttccgttggtggact Figure 6.02 This study DEN43-E50 - tccaccaacggaaccAAAGTCCCAGGCTGTGT Figure 6.02 This study DEN32-E51 + GTCGTGGTGCAAGCTgatagtggttgcgttgt Figure 6.02 This study DEN23-E52 - aacgcaaccactatcAGCTTGCACCACGACCC Figure 6.02 This study DEN23-E53 + CCAACAGTGATGGCGttccacttaacttcacg Figure 6.02 This study DEN32-E54 - tgaagttaagtggaaCGCCATCACTGTTGGAA Figure 6.02 This study DEN34-E55 + AAATTGGAACTCAAGggaatgtcatacacgat Figure 6.02 This study DEN43-E56 - cgtgtatgacattccCTTGAGTTCCAATTTGT Figure 6.02 This study DEN43-E57 + ACAGCTTGGGATTTTggatcagtgggtggtgt Figure 6.02 This study DEN34-E58 - accacccactgatccAAAATCCCAAGCTGTTT Figure 6.02 This study DENGUE CLEAVAGE SITE PRIMERS: D4CPRM-D1-F + (Phosphate)TTTCACTTGACCACAAGAGATGGCGAA Figure 4.01 This study D4CPRM-D1-R - (Phosphate)CGCCAGTGCGGTGGGCAGCAAGCACAGC Figure 4.01 This study D4PRMM-D1-F + (Phosphate)TCAGTAGCCCTAGCCCCACATTCA Figure 4.01 This study D4PRMM-D1-R - (Phosphate)GCGCTTGTCCCGTCTGTGTTCCCC Figure 4.01 This study D4ME-D1-F + (Phosphate)ATGCGATGCGTGGGAATAGGGAAC Figure 4.01 This study D4ME-D1-R - (Phosphate)GGCCATGGATGGTGTGACCAGCATCATT Figure 4.01 This study DENGUE CpG PRIMERS: DEN2CPG-F + (Phosphate)GAAAGAGACGTTGGTCACTTTCAAAAATCCC Figure 5.01 This study DEN2CPG-R - (Phosphate)TGTATCCAATTTGATCCTTGTGTGTCCGCTCC Figure 5.01 This study DEN2AMP-F + (Phosphate)AACGCAGGAAAGAACATGTGAGCAAAAGGC Figure 5.01 This study DEN2AMP-R - (Phosphate)AGCCATAGAGCCCACCGCATCCCCAGCATGC Figure 5.01 This study CLONING PLASMID PRIMERS c: T7 Promoter N/A TAATACGACTCACTATAGGG Plasmid Invitrogen, USA SP6 Promoter N/A GATTTAGGTGACACTATAG Plasmid Invitrogen, USA M13 Forward N/A GTAAAACGACGGCCAG Plasmid Invitrogen, USA M13 Reverse N/A CAGGAAACAGCTATGAC Plasmid Invitrogen, USA CMV Forward N/A CGCAAATGGGCGGTAGGCGTG Plasmid Invitrogen, USA BGH Reverse N/A TAGAAGGCACAGTCGAGG Plasmid Invitrogen, USA BGHPoly-R N/A GCAATTTCCTCATTTTATTAGGAAAGG Plasmid This study

a Dengue nucleotide sequences utilised for the construction of primers were obtained from: DENV-1 accession no. U88535; DENV-2 accession no. AF038403; DENV-3 accession no. M93130; DENV-4 accession no. AF326825. b Italicised nucleotides represent translation initiation and termination codons which have been introduced for gene expression. c Undelined nucleotides represent restriction enzyme sites which have been introduced to facilitate DNA cloning. d Primer sequences represented in different cases to denote nucleotide sequences derived from different dengue virus serotypes.

104

TABLE 2.03 – PCR amplification conditions used in this study

Condition 1: Amplification of DNA products less than 6kb using Pwo DNA polymerases:

1. Initial denaturation 920C - 2 minutes;

2. 40 amplification cycles of:

i. denaturation 920C - 40 seconds;

ii. annealing 500–600C - 40 seconds a;

iii. extension 680C - 1 minute (for products less than 1 kb) or;

680C - 2 minutes (for products between 1 to 2 kb) b or;

680C - 2.5 minutes (for products between 2 to 3.5 kb) b or;

680C - 4 minutes (for products between 3.5 to 6 kb) b, c ;

3. Final extension 680C - 10 minutes.

Condition 2: Amplification of DNA products between 8 and 12kb using Elongase polymerase: c, d

1. Initial denaturation 940C - 30 seconds;

2. 30 amplification cycles of:

i. denaturation 940C - 30 seconds;

ii. annealing and 680C - 8 minutes (for products between 8 to 10 kb) e or;

extension 680C - 10 minutes (for products between 10 to 12 kb) e ;

3. Final extension 680C - 10 minutes.

a Temperature depended on annealing temperature of primers. b Extension period for these reactions was increased by 30 seconds after every 10 cycles. c For these reactions, the thermostable DNA polymerases were only added once the block temperature

had reached 920C for the initial denaturation cycle (hot start). d Primers for these reactions were designed to have annealing temperatures (Tm) greater than 700C. e Extension period for these reactions was increased by 1 minute after every 10 cycles.

105

DNA and RNA samples also were quantitated at a wavelength of 260nm using a

Beckman ultraviolet DU-640 spectrophotometer (Beckman Instruments, USA)

essentially as described by Sambrook and Russell, (2001).

2.10 PURIFICATION AND CONCENTRATION OF NUCLEIC ACIDS

FROM AQUEOUS SOLUTIONS

DNA and RNA were purified and concentrated from aqueous solutions using the

phenol/chloroform extraction and ethanol precipitation protocols as described by

Sambrook and Russell (2001). Briefly, samples were first extracted with 1 volume of

phenol/chloroform/isoamyl alcohol (25:24:1), followed by extraction with 1 volume

of chloroform/isoamyl alcohol (24:1). Following the final extraction, 0.1 volume of

3M Sodium Acetate (pH 5.2) and 2.5 volume of 100% ethanol were added to the

aqueous phase and incubated at –800C for a minimum of 1 hour. Nucleic acids were

precipitated by centrifugation at ≥12,000g for 30 minutes at 40C. The resultant

pellets were washed with pre-chilled 70% v/v ethanol/H2O and precipitated again by

high-speed centrifugation for 30 minutes at 40C. The resultant pellets were dried

under vacuum and resuspended in sterile nuclease-free water or an appropriate

nuclease-free buffer.

2.11 DNA LIGATION

Ligation reactions were prepared in a volume of 10 to 15µl containing vector to

insert molar ratios of 1:3-1:5, ligation buffer (30mM Tris-HCl [pH 7.8], 10mM

MgCl2, 10mM DTT, 1mM ATP, 5% w/v PEG) (Promega, USA), and 3 to 4.5 units

of T4 DNA ligase (Promega, USA) unless otherwise specified. Ligation reactions

were incubated overnight at 140 to 160C.

2.12 TRANSFORMATION OF COMPETENT ESCHERICHIA COLI CELLS

Unless otherwise specified, DNA plasmids were transformed into competent

Escherichia coli (E. coli) DH5α (Invitrogen, USA) or JM109 (Promega, USA) cells

by either of two standard cloning methods described by Sambrook and Russell

(2001). The first method involved the transformation of E. coli cells by heat shock

treatment as described by Hannahan (1983). For this procedure, the DNA ligation

reaction was added to chemically competent E. coli DH5α or JM109 cells in a

volume not exceeding 10% of the volume of the competent cells. The DNA/cell

106

mixture was incubated on ice for 20 minutes, after which it was transferred rapidly to

a pre-heated 420C circulating water bath for 45 seconds without shaking. Reactions

then were transferred rapidly onto ice for 2 minutes, followed by the immediate

addition of 1ml of post-transformation growth media (2%w/v tryptone, 0.5%w/v

yeast extract, 10mM NaCl, 2.5mM KCl, 20mM Mg2+ stock, 20mM Glucose [pH

7.0]) at room temperature and incubated at 370C for 90 minutes with agitation (~225

rpm) to allow the bacterial cells to recover and to express the antibiotic resistance

marker encoded by the plasmid. Transformed bacterial cells were pelleted by

centrifugation at ≥12,000g for 30 seconds at room temperature, after which

approximately 95% of the culture medium was discarded. The bacterial pellet was

resuspended in the remaining media and plated onto an appropriate antibiotic

selection agar plate and incubated at 370C overnight in an inverted position.

The second method involved transformation of E. coli cells by electroporation as

first described by Fiedler and Wirth, (1988). For this procedure, the DNA was

precipitated from the ligation reaction using the standard ethanol precipitation

protocol (see Section 2.10) and added to electroporation competent E. coli DH5α

cells in a volume not exceeding 10% of the volume of the competent cells. The

DNA/cell mixture was transferred to a 0.2cm gap Gene Pulser electroporation

cuvette (Biorad, USA), which had been pre-chilled on ice. The cuvette containing

the DNA/cell mixture was transferred to an EC100 Electroporator (Quantum

Scientific, Australia) and pulsed at 1,800volts and 25μF (220Ω) at room

temperature. One millilitre of post-transformation growth media at room temperature

was added immediately to the cuvette and the transformed bacterial cells were

cultured on agar plates containing the appropriate antibiotic as described above.

2.13 PURIFICATION OF PLASMIDS

Small-scale (miniprep) purification of plasmids from transformed bacterial cells was

performed using the standard alkaline lysis protocol described by Sambrook and

Russell (2001). Approximately 1.5 to 2ml of transformed bacterial cell culture was

pelleted by centrifugation at ≥ 12,000g for 5 minutes at room temperature. The

culture medium was discarded and the bacterial pellet was resuspended in 100µl of

pre-chilled Cell Resuspension buffer (50mM Glucose, 25mM Tris-HCl [pH 8.0],

107

10mM EDTA [pH 8.0]). Two hundred microliters of Cell Lysis buffer (1% w/v SDS,

0.2M NaOH) were added and the cell suspension was mixed thoroughly by inverting

the tubes several times and then incubated for 5 minutes at room temperature. One

hundred and fifty microliters of pre-chilled Neutralisation buffer (3M Potassium and

5M Acetate [pH 4.8]) and 150µl of pre-chilled chloroform were added to the cell

suspension and again mixed thoroughly by inversion. The cell suspension was

centrifuged at 16,000g for 5 minutes at room temperature. Following centrifugation,

the supernatant was recovered and mixed with 2.5 volumes of 100% ethanol.

Plasmids were pelleted by centrifugation at 16,000g for 5 minutes at room

temperature, after which the supernatant was discarded and the precipitate was

washed by adding 1ml of pre-chilled 70% ethanol and the plasmids pelleted again by

centrifugation at 16,000g for 5 minutes at room temperature. The supernatant was

discarded and the plasmid pellet dried under vacuum and resuspended in 50µl of

sterile water containing 10µg/ml of RNaseA enzyme.

Large-scale purification of plasmid DNA was performed by anion-exchange

chromatography using the Endofree Plasmid Midi, Maxi or Mega kits (Qiagen,

USA) according to manufacturer’s instructions.

2.14 OVERLAPPING EXTENSION-POLYMERASE CHAIN REACTION

Each overlapping extension-polymerase chain reaction (OE-PCR) procedure utilised

two rounds of PCR (Fig. 2.01A). The first round involved two separate PCRs, each

incorporating a flanking primer (a or d) and an overlapping primer (b or c) to

amplify two precursor products (AB and CD) from two separate DNA templates.

The overlapping primers overlapped and complement each other, with half of the

primer being homologous to one DNA template, while the other half was

homologous to the other template. Following first round PCRs, the precursor

products were analysed on agarose gels (see Section 2.9) from which the DNA

products of interest were purified before being used as templates in the second round

of PCR.

108

A. B.

FIG. 2.01 – Schematic representation of the (A) Overlapping Extension-Polymerase Chain Reaction (OE-PCR) and (B) Back-to-Back Primer-Polymerase Chain Reaction (BB-PCR)

Product ABCD

Primer a

Product CDProduct AB

Primer b

5’ 3’

5’ 3’

3’ 5’

3’ 5’

Primer c

Primer d

DNA Template 2

Primer a

Primer d

1st Round PCR

2nd Round PCR

DNA Template 1

1st Round PCR

Parental Plasmid Template

BB-Forward primer with desirable mutations

(Phosphorylated)

BB-Reverse primer (Phosphorylated)

Mutated Plasmid 1. PCR.

2. Dpn I digestion

3. Self-ligate DpnI-digested

PCR product.

109

In the second round PCR, equal molar ratios of the two purified precursor products

were utilised with both of the flanking primers (a and d) to enable amplification of

the overlapping PCR product (ABCD), which consisted of a fusion between the two

precursor products at the complementary overlapping region. PCR reactions for the

OE-PCR were prepared as described in Section 2.9 and all primers and PCR

conditions utilised are as described in Table 2.02 and Table 2.03 respectively.

2.15 SITE-DIRECTED MUTAGENESIS BY BACK-TO-BACK PRIMER-

POLYMERASE CHAIN REACTION

Site-directed mutagenesis (insertions, deletions or substitutions of single or multiple

nucleotides) of previously characterised plasmids was accomplished by back-to-back

primer-polymerase chain reaction (BB-PCR) (Fig. 2.01B). BB-PCR amplification

was performed with a circular DNA plasmid, containing the insert of interest, as

template and two “back-to-back” primers designed with the first 5’ nucleotide of

each primer adjacent to each other. In addition, at least one of the primers was

phosphorylated at the 5’ end and also contained the desired mutation(s). PCR

reactions for the BB-PCR were prepared as described in Section 2.9 and all primers

and PCR conditions utilised are described in Table 2.02 and Table 2.03 respectively.

Following PCR, the cDNA was treated with restriction enzyme DpnI (Roche,

Germany), according to manufacturer’s instructions, to digest the parental plasmid

template and minimise the cloning of the parental DNA plasmid. The DpnI-treated

PCR product was self-ligated by the addition of ligation buffer and T4 DNA ligase

and transformed into competent E. coli cells (see Sections 2.11 and 2.12) to produce

the plasmid containing the desired mutation(s).

2.16 DNA SEQUENCING AND ANALYSIS

Reactions for the sequencing of DNA plasmids and PCR products were prepared in a

volume of 10μl consisting of approximately 100-500ηg of DNA, 3.2ρmoles of

sequencing primer (Table 2.02) and either 4μl or 2µl of the ABI Prism BigDye

Terminator chemistry (Version 2) or (Version 3.1) (Applied Biosystems, USA)

respectively. PCR used to amplify sequencing products employed 25 cycles of 960C

for 30 seconds, 500C for 15 seconds, and 600C for 4 minutes.

110

Unincorporated dye terminators were removed from the sequencing reactions by gel-

filtration technology using the DyeEx Spin kit (Qiagen, USA) according to the

manufacturer’s instructions. Automated DNA sequencing was performed using the

ABI 377 automatic DNA sequencer (Applied Biosystems, USA) by the Australian

Genome Research Facility (AGRF), (Brisbane, Australia). DNA and deduced protein

sequence analysis and alignments were performed using programs available from the

Australian National Genomic Information Service (ANGIS)

(http://www.angis.org.au) and DNASTAR (DNASTAR, Inc., USA).

2.17 CONSTRUCTION OF pDEN1CME, pDEN3E and pDEN4E DENGUE

REFERENCE DNA CLONES

A number of DENV reference DNA clones were prepared to provide a characterised

DNA template for use as positive controls in PCR and in the generation of various

DENV constructs. These included the DNA clones pDEN1CME, which contained

the full-length C, prM and E genes of DENV-1 (Hawaii), pDEN3E, which contained

the full-length E gene of DENV-3 (PRS225489 Burma), and pDEN4E, which

contained the full-length E gene of DENV-4 (H241).

The pDEN1CME DNA clone was constructed by amplifying the DENV-1 C, prM

and E genes of DEN1 using cDNA derived from RT-PCR (see Section 2.7) as the

template and the primers DEN-CAPSID and D1-2467R (Table 2.02). The amplified

PCR product was cloned into the pCR-Blunt cloning vector (Invitrogen, USA). The

pDEN3E DNA plasmid was constructed by amplifying the DENV-3 E gene using

cDNA derived from RT-PCR as the template and the primers D3-722F and D3-

2550R (Table 2.02). The pDEN4E DNA plasmid was constructed by amplifying the

DENV-4 E gene using cDNA derived from RT-PCR as the template and the primers

D4-742F and D4-2536R (Table 2.02). The amplified DENV-3 and DENV-4 PCR

products were ligated to the pGEMT-Easy cloning vector (Promega, USA) and

transformed into competent E. coli cells (see Sections 2.11 and 2.12). The nucleotide

sequences of all DNA clones were deduced by DNA sequencing (see Section 2.16).

111

2.18 TRANSFECTION OF MAMMALIAN CELLS WITH DNA PLASMIDS

The transfections of mammalian cells with DNA were performed using the cationic

lipid reagent, Lipofectamine 2000 (LF2000) (Invitrogen, USA). The DNA samples

were resuspended in sterile PBS buffer.

Cells were grown until the cell monolayer was 90-95% confluent. The t.c.s. then was

discarded and the monolayer was washed once with serum-free RPMI-1640 medium.

DNA plasmid and LF2000 were diluted separately in serum-free RPMI-1640

medium (20μg of DNA diluted in 0.5ml of medium per 25cm2 of cell monolayer and

30μg of LF2000 diluted in 0.5ml of medium per 25cm2 of cell monolayer) and

incubated at room temperature for 5 minutes. The diluted DNA and LF2000 were

combined and incubated at room temperature for 20 minutes to facilitate the

formation of DNA-LF2000 complexes. The DNA/LF2000 inoculum was added to

the cell monolayer in serum-free RPMI-1640 (2ml per 25cm2 of cell monolayer) and

incubated at 370C in an atmosphere of 5% v/v CO2/air for 6 hours with occasional

rocking. Serum-free RPMI-1640 was added (7ml per 25cm2 of cell monolayer) and

cells were incubated at 370C in an atmosphere of 5% v/v CO2/air.

2.19 PURIFICATION OF DENGUE EXTRACELLULAR E PROTEINS

DENV extracellular E proteins were purified from cultures of DNA-transfected

mammalian cells by first centrifuging the t.c.s. at 16,000g for 30 minutes at 40C to

remove residual cell debris. The supernatant was recovered and ultra-centrifuged in a

70.1Ti rotor (Beckman Instruments, USA) at 44,000rpm (~180,000g) for 4 hours at

40C. The resulting pellet was resuspended in pre-chilled TAN buffer (0.05M

triethanolamine [pH 8.0], 0.1M NaCl) and stored at -800C until required.

2.20 TRANSCRIPTION OF GENOMIC-LENGTH DENGUE VIRAL RNA

FROM DNA TEMPLATES

Transcription of viral genomic-length DENV RNA was performed using the T7

RiboMAX large scale RNA production system (Promega, USA) according to the

manufacturer’s instructions. Reactions for transcription were prepared in a volume of

20µl containing 5µg of the DNA template, 7.5mM each of rATP, rCTP, rUTP and

rGTP, 1mM of m7G(5’)ppp(5’)G RNA cap structure analog (Promega, USA) and

112

2µl of T7 enzyme mix (T7 RNA polymerase, rRNasin Ribonuclease Inhibitor and

Yeast Inorganic Pyrophosphatase) (Promega, USA). Reactions were incubated at

370C for 3 hours, after which the template DNA was removed by digestion with 5

units of DNase I (1 unit per µg of template DNA) at 370C for 15 minutes. The RNA

was precipitated using the standard phenol/chloroform extraction and ethanol

precipitation protocols (see Section 2.10). The resulting RNA pellet was dried under

vacuum and resuspended in sterile nuclease-free water. The approximate yield of the

derived RNA transcripts was quantitated spectrophotometrically at 260nm (see

Section 2.9). RNA samples were stored at -800C until required.

2.21 PRODUCTION OF LIVE RECOMBINANT DENGUE VIRUSES

The transfections of transcribed viral RNA into BHK-21 cells to produce live

recombinant DENV was performed essentially as described by Gualano et al.,

(1998). BHK-21 cells were grown until the cell monolayers were 80-90% confluent.

Cells were trypsinised and washed twice with pre-chilled PBS and resuspended in

pre-chilled PBS buffer at a concentration of 1x107 cells/ml. Five hundred microliters

of the cell suspension were aliquoted into 0.4cm gap Gene Pulser electroporation

cuvettes (Biorad, USA) and placed on ice. Approximately 10-20µg of transcribed

viral RNA and 50µg of yeast tRNA (Roche, Germany) were immediately added to

the cell suspension in the cuvette and the cuvette was incubated on ice for a further

10 minutes. The cuvette containing the RNA/cell mixture was transferred to an

EC100 Electroporator (Quantum Scientific, Australia) and pulsed at 400volts and

1260µF (220Ω) at room temperature. After electroporation, the cuvette containing

the DNA/cell mixture was incubated on ice for 10 minutes, after which 1ml of

RPMI-1640 containing 10% v/v heat-inactivated FCS with PSG supplement was

added to the cuvette and its contents transferred to a tissue culture vessel and

incubated at 370C in an atmosphere of 5% v/v CO2/air.

When the monolayers of transfected cells were confluent (approximately 24-48

hours post-transfection), the culture medium was replaced with RPMI-1640

containing 5% v/v heat-inactivated FCS with PSG. Transfected cells were incubated

at 370C in an atmosphere of 5% v/v CO2/air for 7-10 days, after which the t.c.s. was

harvested and a portion of it was used as inoculum to infect C6/36 cells (see Section

2.2), while the remaining t.c.s. was stored at -800C until required for further

113

experiments. Transfected cells also were analysed by indirect IFAs to detect the

production of viral proteins (see Section 2.3).

2.22 DNA VACCINE FORMULATION AND IMMUNISATION OF MICE

The immunogenicity of DNA vaccines was evaluated by immunising groups of four

to six week old, female outbred “Quackenbush” mice (Animal Resources Centre,

Perth, Australia) intramuscularly (i.m.) with DNA vaccines purified using the

Endofree Plasmid Mega kit (Qiagen, USA) (see Section 2.13) and resuspended in

sterile PBS buffer (pH 7.4) to a DNA concentration of 1.0mg/ml. Tetravalent

formulations of DNA vaccines were prepared by combining equivalent amounts of

each of the four monovalent DNA vaccines to produce a DNA concentration of

1.0mg/ml. Mice were bled from the tail while under carbon dioxide anaesthesia. All

mice experiments were conducted at the Australian Army Malarial Institute (AMI)

animal research facility (Brisbane, Australia) under permit AMI 9/2002.

114

CHAPTER 3:

DEVELOPMENT OF A TETRAVALENT DENGUE DNA VACCINE

3.1 INTRODUCTION

This chapter describes the construction of a DNA vaccine for each of the four DENV

serotypes and the evaluation of their immunogenicity, as monovalent and tetravalent

formulations, in outbred mice.

3.2 RESULTS

3.2.1 Construction and antigenic properties of pVAX-DEN DNA vaccines

DNA vaccines corresponding to each of the four DENV serotypes (pVAX-DEN1,

DEN2, DEN3 and DEN4) were constructed by inserting the genes coding for the C-

terminal 25 amino acids of the C, the prM and the E proteins (C-terminal C-prM-E)

of the four DENV serotypes into the pVAX1 vector (Invitrogen, USA). The pVAX1

vector was designed specifically for DNA immunisation and incorporated the

kanamycin resistance gene as a selective marker to avoid the use of β-lactam

antibiotics, such as ampicillin, for selection, because β-lactam antibiotics may elicit

allergic responses in some humans. In addition, DNA sequences not required for

replication of pVAX1 in bacteria, or for the expression of the recombinant protein in

mammalian cells, have been removed to reduce the risk of chromosomal integration

by the immunised DNA into the human genome (Invitrogen, USA).

The C-terminal C-prM-E gene construct for each of the four DENV serotypes was

generated by PCR using forward and reverse primers, which incorporated an in-

frame translation initiation and termination codon respectively, as well as restriction

enzyme sites for BsrGI (sequence TGTACA), NheI (sequence GCTAGC), KpnI

(sequence GGTACC), and XhoI (sequence CTCGAG) to facilitate the cloning of the

DENV gene constructs into pVAX1.

115

In addition, the Kozak translation initiation sequence was introduced into the

forward primer (Fig. 3.01). The DNA templates used for these PCRs were derived by

RT-PCR of the viral RNA from DENV-1 (Hawaii), DENV-3 (H87) and DENV-4

(H241) (see Section 2.7) and from a DENV-2 (NGC) infectious clone (pDVWS601

(Gualano et al., 1998), kindly provided by Prof. P. Wright at the Department of

Microbiology, Monash University, Australia).

The DENV-1 and DENV-4 C-terminal C-prM-E gene constructs were amplified

using the primers D1MEstart and D1MEstop, and D4MEstart and D4MEstop

respectively (Table 2.02). The gene constructs were digested with NheI and inserted

into the NheI-PmeI site of pVAX1 (see Sections 2.11 to 2.13) to produce pVAX-

DEN1 and pVAX-DEN4 respectively (Fig. 3.02).

The DENV-2 C-terminal C-prM-E gene construct was amplified using the primers

D2MEstart and D2MEstop (Table 2.02) and inserted into the pGEMT-Easy cloning

vector (Promega, USA) to produce the intermediate DNA plasmid pGEM-D2. The

pGEM-D2 then was digested with NheI and KpnI and inserted into the NheI-KpnI

site of pVAX1 to produce pVAX-DEN2 (Fig. 3.02).

A number of attempts to amplify the C-terminal C-prM-E gene construct of the

DENV-3 genome were unsuccessful. Therefore, this construct was prepared from

two separate PCR products using primers D3MEstart and D3-1796R, and D3-1703F

and D3MEstop respectively (Table 2.02), which then were connected by OE-PCR

(see Section 2.14) using the primers D3MEstart and D3MEstop. The complete

DENV-3 gene construct was inserted into the pGEMT-Easy cloning vector to

produce the intermediate plasmid pGEM-D3. This was digested with NheI and KpnI

enzymes and inserted into the NheI-KpnI site of pVAX1 to produce pVAX-DEN3

(Fig. 3.02). Each of the pVAX-DEN DNA vaccines were sequenced to confirm their

integrity (see Section 2.16) (Appendix B and C).

116

FIG. 3.01 – Schematic representation of the location of the primers used to construct the DENV C-terminal C-prM-E protein genes

VMVQA VMVQA VVVQA FTVHA

↑ E495

(E493)b

MRCVG MRC IG MRCVG MRCVG ↑ E1

TPSMA APSMT TPSMA APSYG

↑ P166

(M75)a

FHLTT FHLTT FHLTS FHLST ↑ P1

prM Protein E Protein 25 amino acids of C Protein

• • • •

PTA LA PTVMA PAT LA PTAMA

↑ C114

pVAX-DEN1 pVAX-DEN2 pVAX-DEN3 pVAX-DEN4

NMLSI RMLNI NMLSI RMLNI ↑ C90

MA MG MA MG

NH2

a Amino acid position of the M protein following maturation b Amino acid position of the DENV-3 E protein Note: Highlighted amino acid sequences denote non-authentic DENV sequences

Amino acid position:

A C C A T G G X X

Kozak sequence and start codon

3’ 5’ Forward Primer

Restriction enzyme sites

T A A 3’ 5’ Reverse Primer

stop codon

Restriction enzyme sites

117

FIG. 3.02 – Genetic map of the recombinant pVAX-DEN1, -DEN2, -DEN3 and -DEN4 DNA vaccines

Kanamycin resistance gene

pUC origin

DENV E protein gene DENV prM

protein gene

DENV prM signal sequence BGH

Polyadenylation Signal

CMV Promoter

T7 Promoter

Stop codon

Start codon pVAX-DEN1 (5,002 bp) pVAX-DEN2 (5,032 bp) pVAX-DEN3 (5,071 bp) pVAX-DEN4 (5,000 bp)

Nhe I (DENV-1, -2, -3 and -4)

Pme I (DENV-1 and -4) Kpn I (DENV-2 and -3)

118

The integrity of conformational epitopes on the prM/M and E proteins expressed by

the four pVAX-DEN DNA vaccines in mammalian cells was investigated by indirect

IFAs using MAbs that recognised conformational epitopes. MAbs 4G2 (flavivirus

cross-reactive, anti-E), 2H2 (DENV cross-reactive, anti-M) and homologous DENV

serotype-specific MAbs reacted with BHK-21 cells transfected separately with each

of the four pVAX-DEN DNA vaccines (see Section 2.18) in indirect IFAs 24 hours

following transfection (Table 3.01). MAbs 4G2 and 2H2 also reacted with all

pVAX-DEN1-4 transfected cells 48 hours following transfection. The transfection

efficiency of pVAX-DEN-transfected cells (as a percentage of cells which fluoresced

in IFA) was approximately 25% (Fig. 3.03). None of the MAbs reacted with pVAX-

DEN1-4 transfected cells five days following transfection. None of the MAbs

reacted with cells transfected with the pVAX1 control plasmid. MAbs 4G2, 2H2,

and homologous DENV serotype-specific MAbs also reacted with all DENV

infected BHK-21 cells. The molecular mass (55-60 kDa) of the DENV E proteins in

the lysates of pVAX-DEN1-4 transfected BHK-21 cells one day following

transfection was similar to that of the E proteins in the lysates of BHK-21 cells

infected with the corresponding DENV serotypes (Fig. 3.04).

3.2.2 Secretion of DENV extracellular E proteins by pVAX-DEN transfected

mammalian cells

Two days following transfection, attempts were made to recover DENV extracellular

E proteins from the t.c.s. of BHK-21 and L929 cells transfected with equivalent

concentrations of each of the pVAX-DEN DNA vaccines (see Section 2.19).

Extracellular E proteins were analysed by SDS-PAGE and western blotting using

MAb 4G2 (see Section 2.6) (Figs. 3.05A and 3.06A). PEG-precipitated DENV

virions were analysed in parallel.

The molecular mass (55-60 kDa) of the extracellular E proteins secreted by pVAX-

DEN1-4 transfected BHK-21 or L929 cells was similar to those of the corresponding

PEG-precipitated DENV virions (Figs. 3.05A and 3.06A). Bands with molecular

mass of approximately 110-120 kDa that reacted with MAb 4G2 also were present in

pVAX-DEN1 or pVAX-DEN3 transfected BHK-21 or L929 cells, and PEG-

precipitated DENV-1 or DENV-3 virions, which may represent E protein dimers.

119

TABLE 3.01 – Indirect immunofluorescence assays BHK-21 cells transfected with pVAX-DEN1-4 DNA vaccines

a See Table 2.01 for the identity of proteins and virus(es) recognised by monoclonal antibodies. Abbreviations: NA – not applicable; NEG – negative; n.t. – not tested.

Monoclonal antibodies used in indirect immunofluorescence assays a Virus/DNA plasmid used to

infect/transfect BHK-21 cells Days post-transfection 4G2 2H2 17F3-D8 D1-M17 3H5 1H9 1H10

DENV-1 Hawaii NA 4+ 4+ 4+ 4+ NEG NEG NEG

DENV-2 NGC NA 4+ 4+ 3+ NEG 4+ NEG NEG

DENV-3 H87 NA 4+ 4+ 3+ NEG NEG 4+ NEG

DENV-4 H241 NA 4+ 4+ 4+ NEG NEG NEG 4+

pVAX-DEN1 1 1+ 1+ 1+ 1+ NEG NEG NEG

pVAX-DEN2 1 1+ 1+ 1+ NEG 1+ NEG NEG

pVAX-DEN3 1 1+ 1+ 1+ NEG NEG 1+ NEG

pVAX-DEN4 1 1+ 1+ 1+ NEG NEG NEG 1+

pVAX1 (Control) 1 NEG NEG NEG NEG NEG NEG NEG

pVAX-DEN1 2 1+ 1+ n.t. n.t. n.t. n.t. n.t. pVAX-DEN2 2 1+ 1+ n.t. n.t. n.t. n.t. n.t. pVAX-DEN3 2 1+ 1+ n.t. n.t. n.t. n.t. n.t. pVAX-DEN4 2 1+ 1+ n.t. n.t. n.t. n.t. n.t. pVAX1 (Control) 2 NEG NEG n.t. n.t. n.t. n.t. n.t. pVAX-DEN1 5 NEG NEG n.t. n.t. n.t. n.t. n.t. pVAX-DEN2 5 NEG NEG n.t. n.t. n.t. n.t. n.t. pVAX-DEN3 5 NEG NEG n.t. n.t. n.t. n.t. n.t. pVAX-DEN4 5 NEG NEG n.t. n.t. n.t. n.t. n.t. pVAX1 (Control) 5 NEG NEG n.t. n.t. n.t. n.t. n.t.

120

A. B.

C. D.

E.

FIG. 3.03 – Indirect immunofluorescence assays of BHK-21 cells transfected with (A) pVAX-DEN1, (B) pVAX-DEN2, (C) pVAX-DEN3, (D) pVAX-DEN4 and (E) pVAX1 using MAb 4G2 as the primary antibody 24 hours following transfection.

121

FIG. 3.04 – Western blot of lysates of pVAX-DEN1 (lane 1), pVAX-DEN2 (lane 3), pVAX-DEN3 (lane 5), pVAX-DEN4 (lane 7) and pVAX1 (lane 9) transfected BHK-21 cells 24 hours following transfection and of DENV-1 (lane 2), DENV-2 (lane 4), DENV-3 (lane 6) and DENV-4 (lane 8) infected BHK-21 cells, using MAb 4G2 as the primary antibody.

63.8 kDa

182.9 kDa

80.9 kDa

26.0 kDa

49.5 kDa

37.4 kDa

E

1 2 3 4 5 6 7 8 9

122

A.

B.

1.00

0.70 0.70

0.12

0.000.00

0.20

0.40

0.60

0.80

1.00

pVAX-DEN1 pVAX-DEN2 pVAX-DEN3 pVAX-DEN4 pVAX1(Control)

FIG. 3.05 – Analysis of DENV extracellular E proteins recovered from the t.c.s. of BHK-21 cells transfected with pVAX-DEN DNA vaccines 48 hours following transfection. (A) Western blot of DENV extracellular E proteins recovered from pVAX-DEN1 (lane 1), pVAX-DEN2 (lane 3), pVAX-DEN3 (lane 5), pVAX-DEN4 (lane 7) and pVAX1 (lane 9) transfected cells and of PEG-precipitated DENV-1 (lane 2), DENV-2 (lane 4), DENV-3 (lane 6) and DENV-4 (lane 8) using MAb 4G2. (B) Densitometric analysis of the intensity of the extracellular E protein bands from pVAX-DEN1, pVAX-DEN2, pVAX-DEN3 and pVAX-DEN4 compared to that of pVAX-DEN1.

63.8 kDa

182.9 kDa

80.9 kDa

26.0 kDa

49.5 kDa

37.4 kDa

14.9 kDa

Rat

io o

f the

inte

nsity

of E

to

pV

AX

-DEN

1 E

E

1 2 3 4 5 6 7 8 9

123

A.

B.

0.00

0.79 0.81

1.00

0.33

0.00

0.20

0.40

0.60

0.80

1.00

pVAX1(Control)


FIG. 3.06 – Analysis of DENV extracellular E proteins recovered from the t.c.s. of L929 mouse cells transfected with pVAX-DEN DNA vaccines 48 hours following transfection. (A) Western blot of DENV extracellular E proteins recovered from pVAX-DEN1 (lane 2), pVAX-DEN2 (lane 4), pVAX-DEN3 (lane 6), pVAX-DEN4 (lane 8) and pVAX1 (lane 1) transfected cells and of PEG-precipitated DENV-1 (lane 3), DENV-2 (lane 5), DENV-3 (lane 7) and DENV-4 (lane 9) using MAb 4G2. (B) Densitometric analysis of the intensity of the extracellular E protein bands from pVAX-DEN1, pVAX-DEN2, pVAX-DEN3 and pVAX-DEN4 compared to that of pVAX-DEN3.

63.8 kDa

182.9 kDa

80.9 kDa

26.0 kDa

49.5 kDa

37.4 kDa

14.9 kDa

1 2 3 4 5 6 7 8 9

Rat

io o

f the

inte

nsity

of E

to

pV

AX

-DEN

3 E

E

124

BHK-21 and L929 cells transfected with pVAX-DEN1, pVAX-DEN2 or pVAX-

DEN3 secreted more extracellular E proteins than cells transfected with pVAX-

DEN4. Similar results were obtained when the experiment was repeated on two other

occasions in BHK-21 cells and on one other occasion in L929 cells.

Densitometric analysis of a representative western blot indicated that the ratio of the

intensity of the extracellular E protein bands derived from pVAX-DEN2, pVAX-

DEN3 and pVAX-DEN4 transfected BHK-21 cells, to that of the extracellular E

protein band derived from cells transfected with pVAX-DEN1, were 0.70, 0.70 and

0.12 respectively (Fig. 3.05B). Densitometric analysis of a representative western

blot indicated that the ratio of the intensity of the extracellular E protein bands

derived from pVAX-DEN1, pVAX-DEN2 and pVAX-DEN4 transfected L929 cells,

to that of the extracellular E protein band derived from cells transfected with pVAX-

DEN3, were 0.79, 0.81 and 0.33 respectively (Fig. 3.06B).

3.2.3 Serological responses of outbred mice to immunisation with monovalent or

tetravalent pVAX-DEN DNA vaccines

The immunogenicity of the four pVAX-DEN DNA vaccines, both as monovalent

and tetravalent (pVAX-Tetra) formulations, was evaluated by immunising outbred

mice (see Section 2.22). Two groups of four mice were immunised i.m. with 100μg

of each of the pVAX-DEN DNA vaccines or pVAX1 at day 0. One group of mice

then was bled on days 7, 14 and 28, while the second group of mice was boosted i.m.

at day 28 with a second 100μg dose of the same DNA. The second group of mice

then was bled on days 35, 42 and 56.

Two groups of four mice were immunised i.m. with the tetravalent formulation at

days -2 and 0 with 200µg doses of pVAX-Tetra per day. One group of mice then was

bled on days 7, 14 and 28. The second group of mice was boosted i.m. at days 26 and

28 with 200μg doses of DNA per day and bled on days 35, 42 and 56.

125

Mice immunised with pVAX-DEN1 or pVAX-Tetra produced anti-DENV-1 IgM

and IgG antibodies, which were detectable at one, and two to four weeks following

the first immunisation respectively (Fig. 3.07A and B). The concentrations of anti-

DENV-1 IgG2a and IgG2b antibodies were higher than that of the anti-DENV-1

IgG1 antibody. In addition, the concentration of anti-DENV-1 IgG2a antibodies

increased significantly following the second immunisation. No anti-DENV-1 IgG3

antibodies were detected in the sera of these mice.

Mice immunised with pVAX-DEN1 or pVAX-Tetra also produced neutralising

antibodies against DENV-1 with titres of 20 and 10 respectively (FFURNT50) four

weeks after the initial immunisation (Fig. 3.07C). These titres increased four-fold to

80 and 40 respectively one week after the second immunisation and decreased to 40

and 20 respectively two weeks after the second immunisation. The neutralising

antibody titres were the same at six and eight weeks following the initial

immunisation.


and IgG antibodies, which were detectable one and two weeks following the first

immunisation respectively (Fig. 3.08A and B). The concentrations of anti-DENV-2

IgG2a and IgG2b antibodies were higher than the concentrations of anti-DENV-2

IgG1 antibody. In addition, the anti-DENV-2 IgM, IgG2a and IgG2b antibody

responses in mice immunised with pVAX-Tetra increased significantly following the

second immunisation. Mice immunised with pVAX-DEN2 failed to produce

detectable titres of anti-DENV-2 neutralising antibodies, while mice immunised with

pVAX-Tetra produced anti-DENV-2 neutralising antibodies with titres of 10 at six

and eight weeks following the initial immunisation (Fig. 3.08C).

Mice immunised with pVAX-DEN3 or pVAX-Tetra produced anti-DENV-3 IgG

antibodies one week after the initial immunisation (Fig. 3.09A and B). The IgG

antibody responses were characterised by high concentrations of anti-DENV-3

IgG2a and IgG2b antibodies, and low concentrations of anti-DENV-3 IgG1

antibodies.

126

A.

0

50

100

150

200

250

300

350

400

450

B.

0

50

100

150

200

250

300

350

400

450

C.

pVAX-DEN1pVAX-TetrapVAX1 (Control)

FIG. 3.07 – Anti-DENV-1 antibody responses in mice immunised with pVAX-DEN1 or pVAX-Tetra DNA vaccines. Concentration of anti-DENV-1 antibodies in pooled sera of mice (n = 4) immunised with one dose on or two doses of (A) pVAX-DEN1 and (B) pVAX-Tetra with * indicating a significant increase (p<0.05) in the antibody responses following the second immunisation at week 4. (C) Titres of neutralising antibodies against DENV-1 in pooled sera of mice (n = 4) immunised with pVAX-DEN1 or pVAX-Tetra represented as the highest serum dilution to yield a 50% reduction in 50 focus-forming units (FFURNT50).

Con

cn o

f ant

ibod

y (μ

g/L)

(M

ean ±

1 SD

) IgM IgG1 IgG2a IgG2b IgG3

1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8

Time post-immunisation (weeks)

IgM IgG1 IgG2a IgG2b IgG3

1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8


4 5 6 7 8

Con

cn o

f ant

ibod

y (μ

g/L)

(M

ean ±

1 SD

)

≥160

80

40

20

10

<10

Neu

tralis

ing

antib

ody

titre

(F

FUR

NT 5

0)


*

*

127

A.

0

50

100

150

200

250

300

350

400

450

B.

0

50

100

150

200

250

300

350

400

450

C.



Con

cn o

f ant

ibod

y (μ

g/L)

(M

ean ±

1 SD

)


1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8



1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8


4 5 6 7 8

≥160

80

40

20

10

<10

Con

cn o

f ant

ibod

y (μ

g/L)

(M

ean ±

1 SD

)

Neu

tralis

ing

antib

ody

titre

(F

FUR

NT 5

0)


* *

*

*

128

A.

0

50

100

150

200

250

300

350

400

450

B.

0

50

100

150

200

250

300

350

400

450

C.



Con

cn o

f ant

ibod

y (μ

g/L)

(M

ean ±

1 SD


1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8



1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8


4 5 6 7 8

≥160

80

40

20

10

<10

Con

cn o

f ant

ibod

y (μ

g/L)

(M

ean ±

1 SD

)

Neu

tralis

ing

antib

ody

titre

(F

FUR

NT 5

0)


*

*

*

*

129

The IgG2a antibody responses also increased significantly following the second

immunisation. In addition, the concentration of anti-DENV-3 IgG3 antibodies in

mice immunised with pVAX-DEN3 increased significantly following the second

immunisation. No anti-DENV-3 IgM antibodies were detected in mice immunised

with pVAX-DEN3 or pVAX-Tetra.

Mice immunised with pVAX-DEN3 or pVAX-Tetra also produced neutralising

antibodies against DENV-3 with titres of 20 (FFURNT50) four weeks after the initial

immunisation (Fig. 3.09C). These titres increased four-fold to 80 one week after the

second immunisation.

The titres of anti-DENV-3 neutralising antibodies in mice immunised with pVAX-

DEN3 remained constant between five and eight weeks following the initial

immunisation, while the titres of anti-DENV-3 neutralising antibodies in mice

immunised with pVAX-Tetra decreased to 40 at six and eight weeks following the

initial immunisation.


antibodies one week after the initial immunisation (Fig. 3.10A and B). The

concentration of anti-DENV-4 IgM antibodies in mice immunised with pVAX-

DEN4 increased significantly following the second immunisation. However, mice

immunised with pVAX-DEN4 or pVAX-Tetra produced predominantly low titres of

anti-DENV-4 IgG antibody responses. The exception was the anti-DENV-4 IgG2b

antibody response in mice immunised with pVAX-Tetra, which increased

significantly following the second immunisation. No neutralising antibodies against

DENV-4 were detected in the sera of mice immunised with pVAX-DEN4 or pVAX-

Tetra (Fig. 3.10C).

No mice immunised with pVAX1 produced detectable levels of IgM, IgG, or

neutralising antibodies (results not shown) against any of the four DENV serotypes.

130

A.

0

50

100

150

200

250

300

350

400

450

B.

0

50

100

150

200

250

300

350

400

450

C.


FIG. 3.10 – Anti-DENV-4 antibody responses in mice immunised with pVAX-DEN4 or pVAX-Tetra DNA vaccines. Concentration of anti-DENV-4 antibodies in pooled sera of mice (n = 4) immunised with one dose n or two doses of (A) pVAX-DEN4 and (B) pVAX-Tetra with * indicating a significant increase (p<0.05) in the antibody responses following the second immunisation at week 4. (C) Titres of neutralising antibodies against DENV-4 in pooled sera of mice (n = 4) immunised with pVAX-DEN4 or pVAX-Tetra represented as the highest serum dilution to yield a 50% reduction in 50 focus-forming units (FFURNT50).

Con

cn o

f ant

ibod

y (μ

g/L)

(M

ean ±

1 SD


1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8



1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8


4 5 6 7 8

≥160

80

40

20

10

<10

Con

cn o

f ant

ibod

y (μ

g/L)

(M

ean ±

1 SD

)

Neu

tralis

ing

antib

ody

titre

(F

FUR

NT 5

0)


*

*

*

131

3.3 DISCUSSION

Each of the pVAX-DEN DNA vaccines expressed antigenic prM/M and E proteins

in transfected BHK-21 cells. The reaction of conformation-dependent flavivirus

cross-reactive and DENV serotype-specific MAbs to the prM/M or E proteins with

pVAX-DEN transfected BHK-21 cells in indirect IFAs confirmed the preservation of

conformational cross-reactive and homotypic epitopes on the prM/M and E proteins

expressed by these DNA vaccines. This is an important factor in the immunogenicity

of these DNA vaccines because the majority of the neutralisation epitopes present on

the flavivirus E protein are conformation-dependent (Heinz et al., 1983; Roehrig et

al., 1998).

The failure of MAbs to react with pVAX-DEN transfected cells in indirect IFAs five

days following transfection suggested that optimal expression of prM/M and E

proteins in cells transfected with these DNA vaccines occurred in under five days.

This was consistent with the study by Chang et al., (2003), who demonstrated that

the optimal expression of DENV-2 and JEV prM and E proteins in COS-1 cells,

transfected with DNA plasmids encoding the corresponding flavivirus genes, was

approximately 48 hours following DNA transfection.

Extracellular E proteins, recovered from the tissue culture supernatant of pVAX-

DEN transfected cells by ultracentrifugation, possessed similar molecular masses to

the E proteins of the corresponding PEG-precipitated native DENV particles. This

result suggested that the E proteins expressed by the four pVAX-DEN DNA

vaccines were synthesized and cleaved in a manner similar to that of native DENV E

proteins. In addition, the ability to purify extracellular E proteins from the tissue

culture supernatant of pVAX-DEN transfected cells by ultracentrifugation suggested

that the extracellular E proteins were assembled and secreted in the form of RSPs.

Various studies demonstrated that co-expressing the full-length flavivirus prM-E

protein genes with the prM signal sequence, resulted in the processing, self-assembly

and extracellular release of the prM and E proteins in the form of RSPs, as

determined by sedimentation analysis or electron microscopy (Gruenberg and

Wright, 1992; Heinz et al., 1995; Konishi et al., 2001; Konishi et al., 1992; Konishi

132

et al., 1997b; Pincus et al., 1992). In contrast, co-expressing the full-length C-prM-E

protein genes without the other viral proteins, such as the viral-derived NS2B-NS3

protease or RNA, or expressing the E protein without the prM protein, resulted in

little or no extracellular release of the E protein in vitro (Allison et al., 1995;

Fonseca et al., 1994; Konishi et al., 1991; Mason et al., 1991; Schalich et al., 1996).

Furthermore, expressing a truncated E protein gene with the removal of the two C-

terminal transmembrane regions (TM1 and TM2) resulted in the release of non-

particulate and non-glycosylated E protein with reduced functional and antigenic

properties (Aberle et al., 1999; Allison et al., 1995; Allison et al., 1999).

Mice immunised intramuscularly with each of the four pVAX-DEN or pVAX-Tetra

DNA vaccines produced predominantly Th1-type anti-DENV antibody responses,

characterised by high levels of anti-DENV IgG2a and IgG2b antibodies, but low

levels of anti-DENV IgG1 antibodies. The Th1-type antibody responses observed in

mice immunised with the pVAX-DEN or pVAX-Tetra DNA vaccines may have

been induced by the presence of various CpG-S motifs in the DNA sequences of the

four pVAX-DEN DNA vaccines (see Table 5.01). A detailed discussion of these

results is provided in the general discussion.

Mice immunised with the tetravalent DENV DNA vaccine produced high titres of

anti-DENV-1 and anti-DENV-3 neutralising antibodies (titres of 80 to ≥160,

FFURNT50), which were comparable to the titres of anti-DENV-1 and anti-DENV-3

neutralising antibodies elicited by mice immunised with identical doses of pVAX-

DEN1 or pVAX-DEN3 respectively. These results suggested that pVAX-DEN1 and

pVAX-DEN3 could provide effective protection against infection by DENV-1 and

DENV-3 respectively, either in a monovalent or polyvalent formulation.

However, mice immunised with the tetravalent DENV DNA vaccine failed to

produce high titres of anti-DENV-2 or anti-DENV-4 neutralising antibodies, which

correlated with the neutralising antibody responses elicited by mice immunised with

identical doses of pVAX-DEN2 or pVAX-DEN4 respectively. Such a tetravalent

DENV DNA vaccine would not be suitable for use because the absence of

neutralising antibody responses against all four DENV serotypes may be a risk factor

for developing severe dengue diseases (DHF and DSS) following wildtype DENV

133

infection (Halstead and O'Rourke, 1977b; Rosen, 1977). A detailed discussion of

these results also is provided in the general discussion.

This present study demonstrated that BHK-21 cells transfected separately with

pVAX-DEN1, pVAX-DEN2 or pVAX-DEN3 secreted higher amounts of

extracellular E proteins than cells transfected with pVAX-DEN4, despite the fact that

the cells were transfected with equivalent amounts of DNA. Similar levels of

extracellular E protein secretion also were observed in L929 mouse cells transfected

separately with each of the four pVAX-DEN DNA vaccines, which suggested that

the low amount of extracellular E proteins secreted by pVAX-DEN4 transfected

BHK-21 cells was not restricted by the nature of the cell line used for transfection.

Differences in the amount of extracellular E proteins secreted by cells transfected

with pVAX-DEN1, pVAX-DEN2 or pVAX-DEN3 were less distinctive and

consistent.

The inability of mammalian cells transfected with pVAX-DEN4 to secrete large

amounts of extracellular E proteins may be responsible for the poor immunogenicity

of pVAX-DEN4 in outbred mice. Konishi et al., (2003) demonstrated that the

amount of RSPs secreted by mammalian cells transfected with three different DNA

vaccines (JEV, DENV-1 and DENV-2) in vitro, correlated with the neutralising

antibody titres against the corresponding viruses elicited by mice immunised with

the DNA vaccines. In addition, Chang et al., (2003) demonstrated that mammalian

cells transfected with a DENV-2/JEV DNA vaccine, constructed by substituting the

stem-anchor region of the DENV-2 E protein with the corresponding region from

JEV, secreted higher amounts of RSPs than cells transfected with the unmodified

DENV-2 DNA vaccine. A greater number of mice immunised with the DENV-

2/JEV DNA vaccine seroconverted with anti-DENV-2 neutralising antibodies than

mice immunised with the unmodified DENV-2 DNA vaccine.

Various studies have demonstrated that the identity of the stem-anchor region of

DENV may influence the efficiency of RSP secretion by mammalian cells

transfected with DNA expressing the DENV prM-E protein genes (Chang et al.,

2003; Purdy and Chang, 2005). Purdy and Chang (2005) demonstrated that

mammalian cells transfected with DENV-1/JEV or DENV-2/JEV DNA vaccines,

134

constructed by substituting 20% of the stem-anchor region of the DENV E protein

with the corresponding region from JEV, secreted higher amounts of RSPs than cells

transfected with the unmodified DENV-1 or DENV-2 DNA vaccine respectively. In

contrast, mammalian cells transfected with DENV-4/JEV DNA vaccine, with 20% of

the stem-anchor region of DENV-4 E protein substituted for the corresponding

region from JEV, secreted lower amounts of RSPs than cells transfected with the

unmodified DENV-4 vaccine. Furthermore, various studies have demonstrated that

the nature of the signal peptide sequence at the flavivirus C/prM or prM/E cleavage

site may influence the efficiency of C/prM or prM/E protein cleavage by host-

derived signal peptidases, which influenced the amount of extracellular prM and/or E

proteins secretion (Pryor et al., 1998; Stocks and Lobigs, 1998).

The four pVAX-DEN DNA vaccines contained identical transcriptional and

translational regulatory elements, and do not express DENV proteins that require

processing by viral-derived proteases. Therefore, possible explanations for the low

amount of extracellular E proteins secreted by pVAX-DEN4 transfected cells may be

the identity of the stem-anchor region of the DENV-4 E protein, and/or less efficient

host-mediated cleavage of the DENV-4 C/prM, prM/M and/or prM/E proteins

expressed by pVAX-DEN4, than the other DENV serotypes.

135

CHAPTER 4:

INCREASING THE SECRETION OF RECOMBINANT SUBVIRAL

PARTICLES BY MAMMALIAN CELLS TRANSFECTED WITH THE

DENV-4 DNA VACCINE

4.1 INTRODUCTION

This chapter describes the construction of pVAX-DEN4 DNA vaccine derivatives to

investigate whether the small amount of extracellular E proteins secreted by

mammalian cells transfected with pVAX-DEN4 in vitro, compared to cells

transfected with the other pVAX-DEN DNA vaccines, was due to inefficient

cleavage of either the C/prM, prM/M, or prM/E proteins expressed by pVAX-DEN4.

It also describes attempts to determine whether the poor immunogenicity of the

pVAX-DEN4 DNA vaccine in outbred mice was due to an inability of cells

transfected with pVAX-DEN4 to secrete large amounts of extracellular E proteins.

4.2 RESULTS

4.2.1 Construction and antigenic properties of pVAX-D4mutC-D1, pVAX-

D4mutM-D1 and pVAX-D4mutE-D1 DNA plasmids

The pVAX-D4mutC-D1, pVAX-D4mutM-D1 and pVAX-D4mutE-D1 DNA

plasmids were constructed by substituting the C/prM, prM/M or prM/E cleavage

sites of pVAX-DEN4 (between amino acids -5 and +5 relative to the cleavage site),

with the corresponding cleavage sites from pVAX-DEN1 (Fig. 4.01). Mammalian

cells transfected with pVAX-DEN1 secreted large amounts of extracellular E

proteins and pVAX-DEN1 also was highly immunogenic in mice. The pVAX-

D4mutC-D1, pVAX-D4mutM-D1 and pVAX-D4mutE-D1 DNA plasmids were

constructed by BB-PCR (see Section 2.15) using the phosphorylated primer pairs

D4CPRM-D1-F and D4CPRM-D1-R, D4PRMM-D1-F and D4PRMM-D1-R, and

D4ME-D1-F and D4ME-D1-R respectively (Table 2.02).

136

FIG. 4.01 – Schematic representation of the location of the primers used to construct pVAX-D4mutC-D1, pVAX-D4mutM-D1 and pVAX-D4mutE-D1 DNA plasmids


pVAX-D4mutC-D1 pVAX-D4mutM-D1 pVAX-D4mutE-D1

VMVQA VMVQA VVVQA FTVHA FTVHA FTVHA FTVHA

↑ E495

(E493)b

MRCVG MRC IG MRCVG MRCVG MRCVG MRCVG MRCVG ↑ E1

TPSMA APSMT TPSMA APSYG APSYG APSYG TPSMA

↑ prM166 (M75)a

SVALA SVALV SVALA SVALT SVALT SVALA SVALT ↑ prM92 (M1)a

FHLTT FHLTT FHLTS FHLST FHLTT FHLST FHLST ↑ prM1

prM Protein E Protein 25 amino acids of C Protein

• • • • • • •

RRDKR RREKR RRDKR RREKR RREKR RRDKR RREKR

↑ prM91

PTA LA PTVMA PAT LA PTAMA PTA LA PTAMA PTAMA

↑ C114

NMLSI RMLNI NMLSI RMLNI RMLNI RMLNI RMLNI ↑ C90

MA MG MA MG MG MG MG

NH2

Amino acid position:

a Amino acid position in the M protein following maturation b Amino acid position in the DENV-3 E protein Note: Shaded amino acid sequences denotes non-authentic DENV amino acid residues

137

Following PCR, the cDNA was digested with DpnI and ligated to produce pVAX-

D4mutC-D1, pVAX-D4mutM-D1 or pVAX-D4mutE-D1 (see Sections 2.11 to 2.13).

Each of the DNA plasmids was sequenced to confirm its integrity (see Section 2.16).


pVAX-D4mutC-D1, pVAX-D4mutM-D1 and pVAX-D4mutE-D1 in mammalian

cells was investigated by indirect IFAs using conformational-dependent MAbs.

MAbs 4G2 and 2H2 reacted with BHK-21 cells transfected for 24 hours with pVAX-

DEN1-4, pVAX-D4mutM-D1 or pVAX-D4mutE-D1 in indirect IFAs (Table 4.01).

MAb 1H10 also reacted with cells transfected with pVAX-DEN4, pVAX-D4mutM-

D1 and pVAX-D4mutE-D1. However, none of the MAbs reacted with cells

transfected with pVAX-D4mutC-D1. MAbs 4G2 and 2H2 also reacted with all

DENV infected cells and MAb 1H10 reacted with DENV-4 infected cells.

4.2.2 Analysis of the structural motifs and the signal peptidase cleavage sites of

pVAX-D4mutC-D1, pVAX-D4mutE-D1 and pVAX-DEN4

To investigate the characteristics of the signal peptides present in the C/prM and

prM/E cleavage sites of pVAX-D4mutC-D1, pVAX-D4mutE-D1 and pVAX-DEN4,

the structural motifs and the theoretical signal peptidase cleavage site scores (c-

scores) of the cleavage sites were analysed using the SignalP Version 3.0 program

(http://www.cbs.dtu.dk/services/SignalP/), which was designed to predict the N-

terminal signal peptides of signal peptidase I cleavage sites based on the neural

network and hidden Markov model algorithms (Bendtsen et al., 2004). Higher c-

scores suggest higher efficiency in signal peptidase cleavage. None of the amino

acid substitutions in pVAX-D4mutC-D1 or pVAX-D4mutE-D1 resulted in the

introduction of additional, or alternative, signal peptidase cleavage sites.

The signal peptides for the C/prM cleavages sites of pVAX-DEN4 and pVAX-

D4mutC-D1 consisted of h- and c-regions that were nine and five amino acids in

length respectively (Figs. 4.02A and B). The c-regions of these signal peptides

atypically were hydrophobic, especially in pVAX-D4mutC-D1, but they were

consistent with the (-3, -1) rule with an Ala residue located at both of these positions

(Fig. 4.03A).

138

TABLE 4.01 – Indirect immunofluorescence assays of BHK-21 cells transfected for 24 hours with pVAX-DEN1-4, pVAX-D4mutC-D1, pVAX-D4mutM-D1 and pVAX-D4mutE-D1 DNA plasmids

a See Table 2.01 for the identity of proteins and virus(es) recognised by monoclonal antibodies. Abbreviations: NEG – negative.

Monoclonal antibodies used in indirect immunofluorescence assays a Virus/DNA plasmid used to infect/transfect BHK-21 cells 4G2 2H2 1H10

DENV-1 Hawaii 4+ 4+ NEG

DENV-2 NGC 4+ 4+ NEG

DENV-3 H87 4+ 4+ NEG

DENV-4 H241 4+ 4+ 4+

pVAX-DEN1 1+ 1+ NEG

pVAX-DEN2 1+ 1+ NEG

pVAX-DEN3 1+ 1+ NEG

pVAX-DEN4 1+ 1+ 1+

pVAX-D4mutC-D1 NEG NEG NEG pVAX-D4mutM-D1 1+ 1+ 1+ pVAX-D4mutE-D1 1+ 1+ 1+ pVAX1 (Control) NEG NEG NEG

139

A.

B.

FIG. 4.02 – Analysis of the n-, h- and c-regions of the signal peptides at the C/prM cleavage sites of (A) pVAX-DEN4 and (B) pVAX-D4mutC-D1 (predicted by the SignalP program)

140

A. B. C. Symbols: ↓, furin or signal peptidase cleavage site; +, positive amino acid residue; –, negative amino acid residue; p, polar (uncharged) amino acid residue; n, non-polar (aliphatic) amino acid residue; a, aromatic amino acid residue. FIG. 4.03 – Characteristics of the amino acid residues present in the (A) C/prM cleavage regions of pVAX-DEN4 and pVAX-D4mutC-D1, (B) prM/M cleavage regions of pVAX-DEN4 and pVAX-D4mutM-D1 and (C) prM/E cleavage regions of pVAX-DEN4 and pVAX-D4mutE-D1. The theoretical signal peptidase cleavage site scores (c-score) were determined by the SignalP program.

pVAX-DEN4 DCWCNLTSAWVMYGTCTQSGERRREKR SVALT -pappnppnanpanpppppn-+++-++ pnnnp

↓

pVAX-D4mutM-D1 DCWCNLTSAWVMYGTCTQSGERRRDKR SVALA -pappnppnanpanpppppn-+++-++ pnnnn

↓

pVAX-DEN4 MGRMLNILNGRKRSTMTLLCLIPTAMA FHLST pn+pnpnnpn+++ppppnnpnnnpnpn a+npp

↓ (c-score = 0.876)

pVAX-D4mutC-D1 MGRMLNILNGRKRSTMTLLCLIPTALA FHLTT pn+pnpnnpn+++ppppnnpnnnpnnn a+npp

↓ (c-score = 0.828) c-region h-region

c-region h-region

pVAX-DEN4 MAYMIGQTGIQRTVFFVLMMLVAPSYG MRCVG pnapnnppnnp+pnaannppnnnnpan p+pnn

↓ (c-score = 0.910)

pVAX-D4mutE-D1 MAYMIGQTGIQRTVFFVLMMLVTPSMA MRCVG pnapnnppnnp+pnaannppnnpnppn p+pnn

↓ (c-score = 0.970)

c-region h-region

c-region h-region

141

The c-scores for the C/prM cleavage sites of pVAX-DEN4 and pVAX-D4mutC-D1

were 0.876 and 0.828 respectively.

The signal peptides for the prM/E cleavages sites of pVAX-DEN4 and pVAX-

D4mutE-D1 consisted of h- and c-regions that also were nine and five amino acids in

length respectively (Figs. 4.04A and B). The c-region of pVAX-DEN4 atypically

was hydrophobic and contained a Ser and a Gly residue at positions -3 and -1

respectively (Fig. 4.03C). In contrast, the c-region of pVAX-D4mutE-D1 was polar

and contained a Ser and an Ala residue at positions -3 and -1 respectively. The c-

scores for the prM/E cleavage sites of pVAX-DEN4 and pVAX-D4mutE-D1 were

0.910 and 0.970 respectively.

4.2.3 Secretion of DENV extracellular E proteins by pVAX-D4mutC-D1,

pVAX-D4mutM-D1 and pVAX-D4mutE-D1 transfected BHK-21 cells


E proteins from the t.c.s. of BHK-21 cells transfected with equivalent concentrations

of pVAX-D4mutC-D1, pVAX-D4mutM-D1, pVAX-D4mutE-D1 or pVAX-DEN1-4

(see Section 2.19). Extracellular E proteins were analysed by SDS-PAGE and

western blotting using MAb 4G2 (see Section 2.6) (Fig. 4.05A).


D4mutM-D1 and pVAX-D4mutE-D1 transfected cells was similar to those of the

extracellular E proteins secreted by pVAX-DEN4 transfected cells. Cells transfected

with pVAX-D4mutM-D1 secreted similar amounts of extracellular E proteins to

cells transfected with pVAX-DEN4. Cells transfected with pVAX-D4mutE-D1

secreted similar amounts of extracellular E proteins to cells transfected with pVAX-

DEN1, but more than the amount of extracellular E proteins secreted by cells

transfected with pVAX-DEN4. Cells transfected with pVAX-D4mutC-D1 did not

secrete detectable amounts of extracellular E proteins. Similar results were obtained

when the experiment was repeated on two other occasions.

142

A.

B.

FIG. 4.04 – Analysis of the n-, h- and c-regions of the signal peptides at the prM/E cleavage sites of (A) pVAX-DEN4 and (B) pVAX-D4mutE-D1 (predicted by the SignalP program)

143

A.

B.

0.71

0.54

1.00

0.12

0.00

0.22

0.76

0.000.00

0.20

0.40

0.60

0.80

1.00

pVAX-DEN1

pVAX-DEN2

pVAX-DEN3

pVAX-DEN4

pVAX-D4mutC-

D1

pVAX-D4mutM-

D1

pVAX-D4mutE-

D1

pVAX1(Control)

FIG. 4.05 – Analysis of DENV extracellular E proteins recovered from the t.c.s. of BHK-21 cells transfected with each of the pVAX-DEN, pVAX-D4mutC-D1, pVAX-D4mutM-D1 and pVAX-D4mutE-D1 DNA plasmids 48 hours following transfection. (A) Western blot of DENV extracellular E proteins recovered from pVAX-DEN1 to -DEN4 (lanes 1 to 4), pVAX-D4mutC-D1 (lane 5), pVAX-D4mutM-D1 (lane 6), pVAX-D4mutE-D1 (lane 7) and pVAX1 (lane 8) transfected cells using MAb 4G2. (B) Densitometric analysis of the intensity of the extracellular E protein bands from pVAX-DEN1, pVAX-DEN2, pVAX-DEN4, pVAX-D4mutC-D1, pVAX-D4mutM-D1 and pVAX-D4mutE-D1 compared to that of pVAX-DEN3.

63.8 kDa

113.7 kDa 80.9 kDa

26.0 kDa

49.5 kDa

37.4 kDa

Rat

io o

f the

inte

nsity

of E

to

pV

AX

-DEN

3 E

1 2 3 4 5 6 7 8

E

144

Densitometric analysis of a representative western blot indicated that the ratio of the

intensity of the extracellular E protein bands derived from pVAX-DEN1, pVAX-

DEN4, pVAX-D4mutM-D1 and pVAX-D4mutE-D1 transfected cells were 0.71,

0.12, 0.22 and 0.76 respectively, to that of the extracellular E protein band derived

from cells transfected with pVAX-DEN3 (Fig. 4.05B).

4.2.4 Serological responses of outbred mice to immunisation with pVAX-DEN4

or pVAX-D4mutE-D1 DNA vaccines

The immunogenicity of pVAX-DEN4 and pVAX-D4mutE-D1 was evaluated by

immunising groups of four outbred mice (see Section 2.22) with 100μg of DNA at

days 0 and 28, and the mice were bled on days 35, 42 and 56.

The anti-DENV-4 antibody responses detected in the sera of mice immunised with

either pVAX-D4mutE-D1 or pVAX-DEN4 increased following the second

immunisation at week four (Fig. 4.06A). Both mice immunised with either pVAX-

DEN4 or pVAX-D4mutE-D1 produced anti-DENV-4 IgM antibodies following the

second immunisation. Mice immunised with pVAX-D4mutE-D1 produced

significantly higher concentrations of anti-DENV-4 IgG2a antibodies than mice

immunised with pVAX-DEN4. Eight weeks following the initial immunisation, mice

immunised with pVAX-DEN4 also produced anti-DENV-4 IgG3 antibodies, while

mice immunised with pVAX-D4mutE-D1 produced anti-DENV-4 IgG2b antibodies.

No anti-DENV-4 IgG1 antibodies were detected in the sera of mice immunised with

either pVAX-DEN4 or pVAX-D4mutE-D1. No anti-DENV-4 neutralising antibodies

were detected in the sera of mice following immunisation with either pVAX-DEN4

or pVAX-D4mutE-D1 (Fig. 4.06B).

145

A.

0

20

40

60

80

100

120

140

160

180

200

B.

0

1

2

3

4

5

6

5 6 7 8

pVAX-DEN4pVAX-D4mutE-D1

FIG. 4.06 – Comparison of anti-DENV-4 antibody responses in mice immunised with pVAX-DEN4 or pVAX-D4mutE-D1 DNA vaccines. (A) Concentration of anti-DENV-4 antibodies in pooled sera of mice (n = 4) immunised with pVAX-DEN4 or pVAX-D4mutE-D1 with * indicating a significant difference (p<0.05) between the antibody responses. (B) Titres of neutralising antibodies against DENV-4 in pooled sera of mice (n = 4) immunised with pVAX-DEN4 and pVAX-D4mutE-D1 represented as the highest serum dilution to yield a 50% reduction in 50 focus-forming units (FFURNT50).

5 6 7 8

≥160

80

40

20

10

<10

Neu

tralis

ing

antib

ody

titre

(F

FUR

NT 5

0)



5 6 7 8 5 6 7 8 5 6 7 8 5 6 7 8 5 6 7 8


Con

cn o

f ant

ibod

y (μ

g/L)

(M

ean ±

1 SD

)

*

*

*

*

*

*

*

146

4.3 DISCUSSION

BHK-21 cells transfected with pVAX-D4mutM-D1, which incorporated the prM/M

cleavage site of DENV-1, secreted approximately similar amounts of extracellular E

proteins than cells transfected with the parental pVAX-DEN4. This demonstrated

that the substitutions of Glu and Thr with Asp and Ala at positions -3 and +5

respectively (relative to the DENV-4 prM/M cleavage site), did not greatly influence

the amount of extracellular E proteins secreted by pVAX-DEN4 transfected cells.

This result was not unexpected because studies have shown that the furin protease

cleaves following the characteristic amino acid cleavage motif Arg-X-Lys/Arg-Arg

(X is a variable residue, except Cys) (Molloy et al., 1999; Molloy et al., 1992;

Plaimauer et al., 2001) and the substitution of Glu with Asp at position -3 in pVAX-

D4mutM-D1 did not alter the overall charge of the furin cleavage motif.

Furthermore, the two amino acid substitutions in pVAX-D4mutM-D1 (Glu and Thr

with Asp and Ala at positions -3 and +5 respectively) did not alter the amino acid

residues predicted to be of importance for efficient furin cleavage, which were (i)

Arg residues at positions -1 and -4, (ii) the presence of at least two basic amino acid

residues at positions -2, -4 or -6, and (iii) the absence of a hydrophobic aliphatic

amino acid residue at position +1 (Nakayama, 1997). In contrast, Pletnev et al.,

(1993) demonstrated that the substitution of Ser with Val at position +1, which

altered the polarity of the furin cleavage motif, produced mutant TBEV/DENV-2

chimeric viruses with reduced ability to replicate in LLC-MK2 and C6/36 cells. In

addition, the substitutions of Arg and Ser with Val at positions -2 and +1

respectively, which altered the charge and polarity of the furin cleavage motif, failed

to produce viable TBEV/DENV-2 chimeric viruses (Pletnev et al., 1993). Keelapang

et al., (2004) also demonstrated that the substitution of the DENV-2 prM/M cleavage

site, between position -13 to -1, with the corresponding region from TBEV, which

removed the amino acid residue at position -5, produced mutant DENV-2 with

reduced furin activity. In contrast, the substitution of the DENV-2 prM/M cleavage

site, between position -13 to -1, with the corresponding region from JEV or YFV,

which incorporated additional charged amino acid residues, produced mutant

DENV-2 with enhanced furin activity (Keelapang et al., 2004).

147

The cleavage of the flavivirus C/prM and prM/E proteins is accomplished by signal

peptidases in the lumen of the ER (Nowak et al., 1989; Speight et al., 1988). Signal

peptidases cleave following the recognition of signal peptides, which are

characterised by (i) a positively charged n-region (between five to eight amino acids

in length) located at the N-terminus of the signal peptide, followed by (ii) a

hydrophobic central membrane-spanning h-region (between eight to twelve amino

acids in length), and (iii) a neutral but polar c-region (approximately six amino acids

in length) located at the C-terminus of the signal peptide that conformed to the (-3,-

1) rule, which required the positions -3 and -1, relative to the signal peptidase

cleavage site, to be accommodated by small and neutral amino acid residues, such as

alanine, to enable efficient signal peptidase recognition and cleavage (Nothwehr and

Gordon, 1989; von Heijne, 1984; von Heijne, 1985).

BHK-21 cells transfected with pVAX-D4mutE-D1, which incorporated the prM/E

cleavage site of DENV-1, secreted higher amounts of extracellular E proteins than

cells transfected with the parental pVAX-DEN4, but similar to the amount of

extracellular E proteins secreted by pVAX-DEN1 transfected cells. This result

demonstrated that the substitutions of Ala, Tyr and Gly with Thr, Met and Ala at

positions -5, -2 and -1 respectively (relative to the DENV-4 prM/E cleavage site),

which increased the polar nature of the signal peptide c-region, resulted in a

corresponding increase in the amount of extracellular E proteins secreted by pVAX-

D4mutE-D1 transfected cells. These substitutions also increased the c-score for the

DENV-4 prM/E cleavage site from 0.910 to 0.970, which suggested an increase in

the efficiency of signal peptidase cleavage as a result of these substitutions.

In contrast, BHK-21 cells transfected with pVAX-D4mutC-D1, which incorporated

the C/prM cleavage site of DENV-1, did not produce detectable amounts of

extracellular E proteins. This result demonstrated that the substitutions of Met and

Ser with Leu and Thr at positions -2 and +4 respectively (relative to the DENV-4

C/prM cleavage site), which decreased the polar nature of the signal peptide c-

region, resulted in a corresponding decrease in the amount of extracellular E proteins

secreted by pVAX-D4mutC-D1 transfected cells. These substitutions also decreased

the c-score for the DENV-4 C/prM cleavage site from 0.876 to 0.828, which

148

suggested a decrease in the efficiency of signal peptidase cleavage as a result of

these substitutions.

These results suggested that the amount of extracellular E proteins secreted by cells

transfected with DNA encoding the DENV-4 C-terminal C-prM-E protein genes may

have been dependent on the efficiency of C/prM and prM/E protein cleavage by

host-derived signal peptidases, which is influenced by the neutral, but polar, nature

of the signal peptide c-region (von Heijne, 1984). These results supported the

findings of Stocks and Lobigs (1998), who demonstrated that increasing the polar

nature of the signal peptide c-region of the MVEV C/prM cleavage site increased the

efficiency of MVEV C/prM protein cleavage by signal peptidases. It also supports

the findings of Pryor et al., (1998), who demonstrated a decrease in the efficiency of

signal peptidase-mediated DENV-2 prM/E protein cleavage following the

substitutions of the native amino acid residues at positions -3 or -1 with non-polar, or

positively charged, amino acid residues.

Outbred mice immunised with pVAX-D4mutE-D1 produced significantly higher

concentrations of anti-DENV-4 IgG2a and IgG2b antibodies than mice immunised

with pVAX-DEN4. However, mice immunised with pVAX-DEN4 produce

significantly higher concentrations of anti-DENV-4 IgM antibodies than mice

immunised with pVAX-D4mutE-D1. These results suggested that the ability of

pVAX-D4mutE-D1 to express large amounts of extracellular E proteins may have

increased the efficiency of class-switching from IgM to IgG production in the B cells

of pVAX-D4mutE-D1 immunised mice. This may have been due to an increase in

the efficiency of extracellular E protein uptake and presentation to MHC-II

molecules by APCs, which subsequently increased the efficiency of CD4+ helper T

cell-mediated activation of humoral immune responses. However, the anti-DENV-4

antibodies produced by mice immunised with pVAX-D4mutE-D1 or pVAX-DEN4

were unable to neutralise DENV-4. A detailed discussion of these results is provided

in the general discussion.

149

CHAPTER 5:

EFFECTS OF CpG MOTIFS ON THE IMMUNOGENICITY OF THE DENV-

2 DNA VACCINE IN OUTBRED MICE

5.1 INTRODUCTION

This chapter describes the construction of pVAX-DEN2 DNA vaccine derivatives to

examine the influence of CpG-S (immuno-stimulatory) and CpG-N (immuno-

neutralising) motifs on the immunogenicity of pVAX-DEN2 in outbred mice.

5.2 RESULTS

5.2.1 Analysis of CpG motifs in pVAX-DEN DNA vaccines and antibiotic

resistance genes

Each of the pVAX-DEN DNA vaccines contained one GACGTT and two GTCGTT

CpG-S motifs, which were derived from pVAX1 (Table 5.01A). In addition, pVAX-

DEN1 contained two GACGTT, two AACGTT and one GTCGTT CpG-S motifs.

The pVAX-DEN2 contained one GTCGTT CpG-S motif, which was derived from

the corresponding DENV cDNA sequence. Each of the pVAX-DEN DNA vaccines

also contained a number of CpG-N motifs characterised by direct repeats of CpG

(CGCG) and CpG preceded by a cytosine and/or followed by a guanine base

(CCGN, NCGG, CCGG), which were derived predominantly from pVAX1.

In a comparison of the CpG motifs present in the antibiotic resistance genes

commonly found in DNA cloning vectors (Table 5.01B), the ampicillin resistance

(ampR) gene contained approximately 30% less CpG-N motifs and more CpG-S

motifs (four AACGTT and one GTCGTT) than the aminoglycoside antibiotic

resistance genes, such as the kanamycin resistance (kanR) or neomycin resistance

(neoR) genes. However, the kanR and neoR genes contained a GACGTT CpG-S

motif that was not present in the ampR gene. Approximately 35% of the CpG-N

motifs in pVAX1 were due to the presence of the kanR gene.

150

TABLE 5.01 – Frequency of CpGa motifs in (A) pVAX-DEN DNA vaccines, (B) antibiotic resistance genes, and (C) pVAX-D2-CPG, pDNA-D2-AMP and pDNA-DEN2 DNA vaccines

A.

pVAX-DEN1 pVAX-DEN2 pVAX-DEN3 pVAX-DEN4 pVAX1 Size of DNA 5,002 bp 5,032 bp 5,071 bp 5,000 bp 2,999 bp CpG-S motifs:

- GACGTT - AACGTT - GTCGTT

2 / 1 (3) 1 / 1 (2) 0 / 3 (3)

1 / 0 (1) 0 / 0 (0) 0 / 3 (3)

1 / 0 (1) 0 / 0 (0) 0 / 2 (2)

1 / 0 (1) 0 / 0 (0) 0 / 2 (2)

1 / 0 (1) 0 / 0 (0) 0 / 2 (2)

CpG-N motifs:

– CCGN b – NCGG b – CCGG – CGCG

42 / 51 (93) 51 / 42 (93) 15 / 15 (30) 10 / 10 (20)

36 / 49 (85) 49 / 36 (85) 15 / 15 (30)

8 / 8 (16)

42 / 54 (96) 54 / 42 (96) 13 / 13 (26) 11 / 11 (22)

36 / 49 (85) 49 / 36 (85) 18 / 18 (36)

8 / 8 (16)

35 / 42 (77) 42 / 35 (77) 13 / 13 (26)

8 / 8 (16)

B.

Ampicillin ORF c Kanamycin ORF d Neomycin ORF c

Size of DNA 862 bp 796 bp 796 bp CpG-S motifs:


0 / 0 (0) 2 / 2 (4) 0 / 1 (1)

1 / 0 (1) 0 / 0 (0) 0 / 0 (0)

1 / 0 (1) 0 / 0 (0) 0 / 0 (0)

CpG-N motifs:


7 / 11 (18) 11 / 7 (18) 5 / 5 (10) 2 / 2 (4)

14 / 12 (26) 12 / 14 (26)

8 / 8 (16) 2 / 2 (4)

14 / 12 (26) 12 / 14 (26)

8 / 8 (16) 3 / 3 (6)

C.

pVAX-D2-CPG pDNA-D2-AMP pDNA-DEN2 Size of DNA 5,032 bp 5,112 bp 7,461 bp CpG-S motifs:


2 / 0 (2) 0 / 0 (0) 0 / 3 (3)

0 / 0 (0) 2 / 2 (4) 2 / 2 (4)

2 / 0 (2) 2 / 2 (4) 3 / 2 (5)

CpG-N motifs:


36 / 49 (85) 49 / 36 (85) 15 / 15 (30)

8 / 8 (16)

39 / 38 (77) 38 / 39 (77) 11 / 11 (22)

9 / 9 (18)

73 / 73 (146) 73 / 73 (146) 24 / 24 (48) 19 / 19 (38)

a Number of CpG motifs in the positive strand/negative strand of the DNA. Numbers in parentheses

are total number of CpG motifs in both strands of the DNA. b Not ccgg motifs. c DNA sequences obtained from pcDNA3.1 cloning vector (Invitrogen, USA). d DNA sequences obtained from pVAX1 cloning vector (Invitrogen, USA).

151

5.2.2 Construction and antigenic properties of pVAX-D2-CPG, pDNA-DEN2

and pDNA-D2-AMP DNA vaccines

The pVAX-D2-CPG DNA vaccine was constructed by BB-PCR (see Section 2.15)

using pVAX-DEN2 as the DNA template and the phosphorylated primers

DEN2CPG-F and DEN2CPG-R (Table 2.02). The primer DEN2CPG-F contained

the GACGTT motif in its nucleotide sequence, which resulted in the substitution of

this CpG-S motif into the DENV-2 E protein gene at nucleotide positions 705 to 710

(wildtype sequence GACATT), without changing the sequence of the E protein

encoded by pVAX-DEN2. Following PCR, the cDNA was digested with DpnI and

ligated to produce pVAX-D2-CPG (see Sections 2.11 to 2.13) (Fig. 5.01A).

The pDNA-DEN2 DNA vaccine was constructed by amplifying the DENV-2 C-

terminal C-prM-E gene construct using the DENV-2 infectious cDNA clone

(pDVWS601) as the DNA template and the primers D2MEstart and D2MEstop

(Table 2.02). Following PCR, the cDNA was inserted into the pGEMT-Easy cloning

vector (Promega, USA) (see Sections 2.11 to 2.13) to produce the intermediate DNA

plasmid pGEM-D2. The pGEM-D2 was digested with NheI and KpnI and inserted

into the NheI-KpnI site of pcDNA3.1 (Invitrogen, USA) to produce pDNA-DEN2

(Fig. 5.01B).

To eliminate the number of nucleotides in the DNA vaccine as a confounding

variable, the pDNA-D2-AMP DNA vaccine was constructed by BB-PCR using

pDNA-DEN2 as the DNA template and the primers DEN2AMP-F and DEN2AMP-

R (Table 2.02). This resulted in the deletion from pVAX-DEN2 of a 2,347 bp region,

which contained the f1 origin, the neoR gene flanked by the SV40 early promoter

and the poly-adenylation signal that were derived from the pcDNA3.1 cloning

vector. In addition, it removed one GTCGTT, two GACGTT and approximately 48%

of the CpG-N motifs presence in pDNA-DEN2 (Table 5.01C). Following PCR, the

cDNA was digested with DpnI and ligated to produce pDNA-D2-AMP (see Sections

2.11 to 2.13) (Fig. 5.01C). Each of the DNA plasmids was sequenced to confirm its

integrity (see Section 2.16) and the number of CpG-S and CpG-N motifs present in

these DNA plasmids were calculated (Table 5.01C).

152

A. B. C. FIG. 5.01 – Genetic maps of (A) pVAX-D2-CPG, (B) pDNA-DEN2 and (C) pDNA-D2-AMP


pUC origin

DENV E protein gene DENV prM protein gene

DENV signal sequence BGH


CMV Promoter

T7 Promoter

Stop codon

Start codon pVAX-D2-CPG

(5,032 bp)

(E 705nt) G AC GTT (E 710nt)

Ampicillin resistance gene pUC origin

DENV E protein gene

DENV prM protein gene

DENV signal sequence

BGH Polyadenylation Signal

CMV Promoter

T7 Promoter

Stop codon

Start codon pDNA-DEN2 (7,461 bp)

Neomycin resistance gene

(flanked by SV40 origin and

polyadenylation signal)

f1 origin

Ampicillin resistance gene

pUC origin

DENV E protein gene

DENV prM protein gene

DENV signal sequence BGH


CMV Promoter

T7 Promoter

Stop codon

Start codon pDNA-D2-AMP

(5,112 bp)

153


pVAX-D2-CPG, pDNA-DEN2 and pDNA-D2-AMP in mammalian cells was

investigated by indirect IFAs using conformation-dependent MAbs. MAbs 4G2, 2H2

and 17F3-D8 reacted with BHK-21 cells transfected for 24 hours with pVAX-

DEN1-4, pVAX-D2-CPG, pDNA-DEN2 or pDNA-D2-AMP in indirect IFAs (Table

5.02). MAb 3H5 also reacted with cells transfected with pVAX-DEN2, pVAX-D2-

CPG, pDNA-D2ME and pDNA-D2-AMP. MAbs 4G2, 2H2 and 17F3-D8 reacted

with all DENV infected cells and MAb 3H5 reacted with DENV-2 infected cells.

5.2.3 Secretion of DENV extracellular E proteins by pVAX-D2-CPG, pDNA-

DEN2 and pDNA-D2-AMP transfected BHK-21 cells



of pVAX-DEN2, pVAX-D2-CPG, pDNA-DEN2 or pDNA-D2-AMP (see Section

2.19). Extracellular E proteins were analysed by SDS-PAGE and western blotting

using MAb 4G2 (see Section 2.6) (Fig. 5.02A).


D2-CPG, pDNA-DEN2 and pDNA-D2-AMP transfected cells was similar to the

extracellular E proteins secreted by pVAX-DEN2 transfected cells. Cells transfected

with pDNA-D2-AMP secreted less extracellular E proteins than cells transfected

with pVAX-DEN2, pVAX-D2-CPG or pDNA-DEN2. Densitometric analysis

indicated that the ratio of the intensity of the extracellular E protein bands derived

from pVAX-DEN2, pDNA-D2-AMP and pDNA-DEN2 transfected cells were 0.83,

0.22 and 0.69 respectively, to that of the extracellular E protein band derived from

cells transfected with pVAX-D2-CPG (Fig. 5.02B). This experiment was not

repeated.

154

TABLE 5.02 – Indirect immunofluorescence assays of BHK-21 cells transfected for 24 hours with pVAX-DEN1-4, pVAX-D2-CPG, pDNA-DEN2 and pDNA-D2-AMP DNA vaccines


Monoclonal antibodies used in indirect immunofluorescence assays a Virus/DNA plasmid used to infect/transfect BHK-21 cells 4G2 2H2 17F3-D8 3H5

DENV-1 Hawaii 4+ 4+ 3+ NEG

DENV-2 NGC 4+ 4+ 3+ 4+

DENV-3 H87 4+ 4+ 3+ NEG

DENV-4 H241 4+ 4+ 3+ NEG

pVAX-DEN1 1+ 1+ 1+ NEG

pVAX-DEN2 1+ 1+ 1+ 1+



pVAX-D2-CPG 1+ 1+ 1+ 1+

pDNA-DEN2 1+ 1+ 1+ 1+

pDNA-D2-AMP 1+ 1+ 1+ 1+

pVAX1 (Control) NEG NEG NEG NEG

155

A.

B.

0.83

1.00

0.22

0.69

0.000.00

0.20

0.40

0.60

0.80

1.00

pVAX-DEN2 pVAX-D2-CPG pDNA-D2-AMP pDNA-DEN2 pVAX1 (Control)

FIG. 5.02 – Analysis of DENV extracellular E proteins recovered from the t.c.s. of BHK-21 cells transfected with pVAX-DEN2, pVAX-D2-CPG, pDNA-D2-AMP and pDNA-DEN2 DNA vaccines 48 hours following transfection. (A) Western blot of DENV extracellular E proteins recovered from pVAX-DEN2 (lane 1), pVAX-D2-CPG (lane 2), pDNA-D2-AMP (lane 3), pDNA-DEN2 (lane 4) and pVAX1 (lane 5) transfected cells using MAb 4G2. (B) Densitometric analysis of the intensity of the extracellular E protein bands from pVAX-DEN2, pDNA-D2-AMP and pDNA-DEN2 compared to that of pVAX-D2-CPG.

63.8 kDa

182.9 kDa

80.9 kDa

26.0 kDa

49.5 kDa

37.4 kDa

14.9 kDa

E

1 2 3 4 5 R

atio

of t

he in

tens

ity o

f E

to p

VA

X-D

2-C

pG E

156

5.2.4 Serological responses of outbred mice to immunisation with pVAX-DEN2,

pVAX-D2-CPG, pDNA-DEN2 and pDNA-D2-AMP DNA vaccines

The immunogenicity of pVAX-DEN2, pVAX-D2-CPG, pDNA-DEN2 and pDNA-

D2-AMP was evaluated by immunising groups of four outbred mice (see Section

2.22) with 100μg of DNA at days 0 and 14, and the mice were bled on days 21, 28

and 42.

Mice immunised with pVAX-DEN2, pVAX-D2-CPG, pDNA-DEN2 or pDNA-D2-

AMP produced anti-DENV-2 IgG2a antibodies three weeks after the initial

immunisation (Fig. 5.03A). At four and six weeks after immunisation, mice

immunised with pVAX-D2-CPG or pDNA-D2-AMP produced significantly higher

concentrations of anti-DENV-2 IgG2a antibodies than mice immunised with pVAX-

DEN2 or pDNA-DEN2. In addition, the concentrations of anti-DENV-2 IgG2a

antibodies were significantly higher in the sera of mice immunised with pDNA-D2-

AMP than in the sera of mice immunised with pVAX-D2-CPG. Anti-DENV-2

IgG2b antibodies also were detected in the sera of mice immunised with pDNA-D2-

AMP three, four and six weeks after immunisation, and in the sera of mice

immunised with pVAX-D2-CPG six weeks after immunisation (Fig. 5.03B). No

anti-DENV-2 IgG2b antibodies were detected in the sera of mice immunised with

pVAX-DEN2 or pDNA-DEN2. Mice immunised with pVAX-D2-CPG or pDNA-

D2-AMP also produced anti-DENV-2 IgG3 antibodies eight weeks following

immunisation (Fig 5.03C). No anti-DENV-2 IgM or IgG1 antibodies were detected

in the sera of mice at five, six or eight weeks after immunisation with pVAX-DEN2,

pVAX-D2-CPG, pDNA-DEN2 or pDNA-D2-AMP.

Mice immunised with pVAX-D2-CPG or pDNA-D2-AMP also produced

neutralising antibodies against DENV-2 with titres of 10 (FFURNT50) four weeks

after the initial immunisation (Fig. 5.04). The neutralising antibody titre detected in

mice immunised with pVAX-D2-CPG increased to 20 six weeks after immunisation,

while the neutralising antibody titre detected in mice immunised with pDNA-D2-

AMP remained constant up to six weeks after immunisation. No neutralising

antibodies against DENV-2 were detected in the sera of mice at three, four or six

weeks after immunisation with pVAX-DEN2 or pDNA-DEN2.

157

A.

0

20

40

60

80

100

120

140

160

180

200

Week 3 Week 4 Week 6

B.

0

20

40

60

80

100

120

140

160

180

200


C.

0

20

40

60

80

100

120

140

160

180

200


FIG. 5.03 – Concentrations of (A) anti-DENV-2 IgG2a, (B) anti-DENV-2 IgG2b and (C) anti-DENV-2 IgG3 antibodies in pooled sera of mice (n = 4) immunised with pVAX-DEN2 , pDNA-D2-AMP , pVAX-D2-CPG , or pDNA-DEN2 DNA vaccines. Significant difference (p<0.05) between the antibody responses is indicated by square brackets. No anti-DENV-2 IgM or anti-DENV-2 IgG1 antibodies were detected in these mice.

Con

cn o

f IgG

2a a

ntib

ody

(μg/

L)

(Mea

n ±

1 SD

) C

oncn

of I

gG2b

ant

ibod

y (μ

g/L)

(M

ean ±

1 SD

) C

oncn

of I

gG3

antib

ody

(μg/

L)

(Mea

n ±

1 SD

)

Time post-immunisation



158

0

1

2

3

4

5

6

1 2 3 4

pVAX-DEN2pDNA-D2-AMPpVAX-D2-CPGpDNA-DEN2

FIG. 5.04 – Titres of neutralising antibodies against DENV-2 in pooled sera of mice (n = 4) immunised with pVAX-DEN2, pVAX-D2-CPG, pDNA-DEN2 or pDNA-D2-AMP represented as the highest serum dilution to yield a 50% reduction in 50 focus-forming units (FFURNT50).

Week 3 Week 4 Week 5 Week 6

≥160

80

40

20

10

<10

Neu

tralis

ing

antib

ody

titre

(F

FUR

NT 5

0)

Time Post-Immunisation

159

5.3 DISCUSSION

A number of CpG-S and CpG-N motifs were present in the DNA sequences of the

four pVAX-DEN DNA vaccines. While the ability to incorporate additional CpG-S

motifs to DNA vaccines is usually restricted by the sequence of the protein

expressed by the DNA vaccine, the removal of all CpG-N motifs from DNA

vaccines also is not feasible because a number of them are located in the plasmid

origin of replication (pUC origin), where single base substitutions can substantially

reduce the replication and growth of the DNA plasmid in the bacterial host. The type

of antibiotic resistance gene in the vector also contribute significantly to the number

of CpG motifs. The ampR gene contained approximately 30% less CpG-N motifs

and more CpG-S motifs than the resistance genes of the aminoglycoside antibiotics,

such as kanR and neoR. This suggested that substituting the kanR or neoR gene for

the ampR gene in DNA vaccines might favour the activation of immune cells from

mammalian hosts.

BHK-21 cells transfected with pVAX-D2-CPG, which contained an additional

GACGTT CpG-S motif, secreted similar amounts of extracellular E proteins to cells

transfected with pVAX-DEN2, which suggested that the inclusion of GACGTT to

the DNA sequence of pVAX-DEN2 did not affect the ability of the DNA vaccine to

express extracellular E proteins in vitro. However, cells transfected with pDNA-D2-

AMP secreted lower amounts of extracellular E proteins than cells transfected with

the parental pDNA-DEN2 plasmid. This was unexpected because the 20μg dose of

pDNA-DEN2 (7,461bp) used for transfection contained only 69% as many DNA

plasmid copies as the same dose of pDNA-D2-AMP (5,112bp) used for transfection.

Similarly, the observation that pDNA-D2-AMP transfected cells secreted lower

amounts of extracellular E proteins than pVAX-DEN2 transfected cells was

unexpected because these DNA plasmids contained similar transcriptional and

translational regulatory elements and also were similar in size. Although pDNA-D2-

AMP was slightly larger than pVAX-DEN2 (5,032bp), the 20μg dose of pDNA-D2-

AMP used for transfection would have contained 98% as many DNA plasmid copies

as the same dose of pVAX-DEN2. This suggested that the slightly lower copy

number of pDNA-D2-AMP used for transfection was unlikely to have been

responsible for the reduction in extracellular E protein secretion by cells transfected

160

with pDNA-D2-AMP. In addition, the removal of the f1 origin and the neomycin

resistance gene flanked by the SV40 promoter and polyadenylation signal in the

construction of pDNA-D2-AMP, which mediate the rescue of single-stranded DNA

and enable the selection of transfected mammalian cells respectively, were not

considered to be responsible for the reduction in extracellular E protein secretion as

these components also were absent from pVAX-DEN2.

Currently, the mechanism responsible for the reduction in extracellular E protein

secretion by pDNA-D2-AMP transfected cells is unclear. However, the high ratio of

CpG-S to CpG-N in pDNA-D2-AMP, due to the presence of the ampR gene, may

have induced the production of type-I interferons (IFNs), which could impede

mRNA and protein synthesis (Wang et al., 1992) and reduce the amount of

extracellular E proteins secreted by pDNA-D2-AMP transfected cells. A similar

result also was observed by Sato et al., (1996), who detected lower β-galactosidase

(β-Gal) expression in mammalian cells transfected with a β-Gal expressing DNA

plasmid containing the ampR gene, compared to cells transfected with a similar

DNA plasmid containing the kanR gene. Furthermore, the addition of neutralising

antibodies against IFN-α increased the β-Gal expression in cells transfected with the

β-Gal plasmid containing the ampR gene, while the addition of IFN-α reduced β-Gal

expression by 40% in cells transfected with the β-Gal plasmid containing the kanR

gene (Sato et al., 1996). However, IFN was unlikely to have influenced the secretion

of extracellular E proteins in cells transfected with the other pVAX-DEN DNA

plasmids, due to (i) the presence of the kanR gene and the subsequent lower ratio of

CpG-S to CpG-N motifs compared to the pDNA-D2-AMP plasmid, and (ii) the

observation that cells transfected with pVAX-DEN1 secreted high amounts of

extracellular E proteins, despite pVAX-DEN1 containing a higher ratio of CpG-S to

CpG-N than the other pVAX-DEN DNA vaccines.

Mice immunised with pVAX-D2-CPG or pDNA-D2-AMP produced significantly

higher concentrations of anti-DENV-2 IgG2a, IgG2b and IgG3 antibodies than mice

immunised with pVAX-DEN2 or pDNA-DEN2. Anti-DENV-2 neutralising

antibodies also were detected in the sera of mice immunised with pVAX-D2-CPG or

pDNA-D2-AMP four weeks after the initial immunisation, but not in the sera of

mice immunised with pVAX-DEN2 or pDNA-DEN2. These results suggested that

161

the addition of a single optimal mouse CpG-S motif (pVAX-D2-CPG), or increasing

the ratio of CpG-S to CpG-N motifs (pDNA-D2-AMP), were effective at increasing

both the level of anti-DENV-2 Th1-type antibody (IgG2a and IgG2b) and

neutralising antibody responses in immunised mice. A detailed discussion of these

results is provided in the general discussion.

162

CHAPTER 6:

DEVELOPMENT OF DENGUE HYBRID-E PROTEIN DNA VACCINES

6.1 INTRODUCTION

This chapter describes the construction of eight intertypic DENV hybrid-E protein

genes consisting of domains I and II, domain III and/or the stem-anchor region

derived from multiple DENV serotypes. The hybrid-E protein genes were

incorporated into DNA vaccines and their immunogenicity was evaluated in outbred

mice. Attempts also were made to develop live recombinant DENV incorporating the

hybrid-E proteins using a DENV-2 infectious cDNA clone as a biological backbone.

6.2 RESULTS

6.2.1 Construction of intertypic DENV hybrid-E protein genes

Eight intertypic DENV hybrid-E protein genes were constructed by substituting

either domains I and II, domain III, and/or the stem-anchor region from the E protein

of one DENV serotype for the corresponding region from another DENV serotype

(Fig. 6.01). The DENV hybrid-E protein genes were labelled with numbers

following the C and M denoting the DENV serotypes from which the C and prM

genes were derived. The three numbers following the E denote the DENV serotype

from which domains I and II, domain III and the stem-anchor regions were derived

respectively.

The cDNA corresponding to the C, prM and E protein genes was produced by PCR

using the DNA clones pDEN1CME, pDVWS601 (DENV-2 infectious clone),

pDEN3E and pDEN4E as templates, as well as cDNA from DENV-3 (H87) and

DENV-4 (H241), which were derived by RT-PCR (see Section 2.7). The appropriate

amplified cDNAs were connected by OE-PCR (see Section 2.14) using the primers

and OE-PCR amplification strategies illustrated in Fig. 6.02, to produce the eight

DENV hybrid-E protein genes.

163

FIG. 6.01 - Schematic representation of the location of the DENV genome substitutions and the nomenclature for the Hybrid-E genes

DSGC DSGC DMGC DTGC

MVQA MVQA VVQA TVHA

↑ E495

(E493)b

Domains I and II Domain III Stem- anchor

GMSY GMSY GMSY GMSY ↑ E296 (E294)b

LTLK LQLK LELK LRIK

↑ E295

(E293)b

MRCV MRCI MRCV MRCV ↑ E1

PSMA PSMT PSMA PSYG

↑ prM166 (M75)a

E prM NS1 C NH2

FHLT FHLT FHLT FHLS ↑ prM1

TALA TVMA ATLA

TAMA

DEN1 DEN2 DEN3 DEN4

GDTA GDTA GDTA GETA ↑ E416 (E414)b

MAIL MAIL MAIL MAIL

↑ E415

(E413)b Amino acid position:

a Amino acid position in the M protein b Amino acid position in the DENV-3 E protein c x represents the DENV serotype from which the region designated was derived

C x M x E x x xc Construct nomenclature:

164

A. B. C. FIG. 6.02 – Schematic representation of the primer locations and OE-PCR amplification strategies used for the construction of (A) C2M1E122, (B) C2M2E122, (C) C2M2E211, (D) C2M2E212, (E) C2M3E344, (F) C2M4E433, (G) C2M4E434 and (H) C2M2E322 hybrid-E protein genes.

2nd OE-PCR

1st OE-PCR

Domains I and II Domain IIIStem- anchor

E prM NS1 C

Bsr G1 Nhe 1

PCR

D2-96F DEN12-E42

DEN21-E41

DEN12-E43

DEN21-E44

D2-2632R

D2-96F

D2-96F DEN21-E44

D2-2632R

2nd OE-PCR

1st OE-PCR


E prM NS1 C

Bsr G1 Nhe 1

PCR

D2-96F DEN12-E26

DEN21-E25

DEN12-E43

DEN21-E44

D2-2632R

D2-96F

DEN21-E25

D2-2632R

D2-2632R

2nd OE-PCR

1st OE-PCR


E prM NS1 C

Bsr G1 Nhe 1

PCR

D2-96F DEN12-E38

DEN21-E37

DEN12-E35

DEN21-E36

D2-2632R

D2-96F

DEN21-E37

D2-2632R

D2-2632R

165

D. E. F. FIG. 6.02 – Cont.

2nd OE-PCR

1st OE-PCR


E prM NS1 C

Bsr G1 Nhe 1

PCR

D2-96F DEN12-E38

DEN21-E37

DEN12-E39

DEN21-E40

D2-2632R

D2-96F

DEN21-E37

D2-2632R

D2-2632R

2nd OE-PCR

1st OE-PCR


E prM NS1 C

Bsr G1 Nhe 1

PCR

D2-96F DEN32-E54

DEN23-E53

DEN34-E55

DEN43-E56 D2-2632R

D2-96F D2-2632R

DEN24-E30

DEN42-E29

D2-96F DEN43-E56

DEN34-E55D2-2632R

2nd OE-PCR

1st OE-PCR


E prM NS1 C

Bsr G1 Nhe 1

PCR

D2-96F DEN42-E46

DEN24-E45

DEN43-E47

DEN34-E48 D2-2632R

D2-96F D2-2632R

DEN23-E52

DEN32-E51

D2-96F DEN34-E48

DEN43-E47D2-2632R

166

G. H. FIG. 6.02 – Cont.

2nd OE-PCR

1st OE-PCR


E prM NS1 C

Bsr G1 Nhe 1

PCR

D2-96F DEN32-E8

DEN23-E7

DEN32-E9

DEN23-E10

D2-2632R

D2-96F

DEN23-E7

D2-2632R

D2-2632R

3rd OE-PCR

1st OE-PCR


E prM NS1 C

Bsr G1 Nhe 1

PCR

D2-96F DEN42-E46

DEN24-E45

DEN43-E47

DEN34-E48

D2-2632R

D2-96F D2-2632R

DEN43-E50

DEN34-E49

DEN42-E29

DEN24-E30

D2-2632R DEN34-E49

D2-96F DEN34-E48

2nd OE-PCR D2-2632R

DEN43-E47

DENV-1 Hawaii strain DENV-2 New Guinea C strain DENV-3 H87 strain DENV-3 PRS225489 strain DENV-4 H241 strain

167

6.2.2 Construction and antigenic properties of pVAX-Hybrid-E DNA vaccines

DNA vaccines incorporating each of the DENV hybrid-E protein genes were

constructed by inserting the C-terminal C (25 amino acids)-prM-Hybrid-E protein

gene into the pVAX1 vector (Invitrogen, USA). The C-terminal C-prM-Hybrid-E

gene constructs were generated by PCR using the forward primer D2MEstart and the

appropriate reverse primer corresponding to the DENV serotype from which the

stem-anchor region was derived. The DNA constructs were digested with NheI and

inserted into the NheI-PmeI site of pVAX1 (see Sections 2.11 to 2.13) to produce the

eight pVAX-Hybrid-E DNA vaccines (Fig. 6.03). Each of the pVAX-Hybrid-E DNA

vaccines was sequenced to confirm its integrity (see Section 2.16) (Appendix B and

C).


the pVAX-Hybrid-E DNA vaccines in mammalian cells was investigated by indirect

IFAs using conformation-dependent MAbs. MAbs 4G2, 17F3-D8 and 2H2 reacted

with BHK-21 cells transfected for 24 hours with each of the pVAX-DEN or pVAX-

Hybrid-E DNA vaccines in indirect IFAs (Table 6.01).

In addition, DENV-1 specific MAbs D1-M10, D1-M17 and D1-M40 reacted with

cells transfected with pVAX-DEN1, pVAX-C2M2E212 and pVAX-C2M2E211.

MAbs 3H5 and 6B2 reacted with cells transfected with pVAX-DEN2, pVAX-

C2M1E122, pVAX-C2M2E122 and pVAX-C2M2E322. DENV-2 specific MAb

10F2 reacted with cells transfected with pVAX-DEN2, pVAX-C2M2E212 and

pVAX-C2M2E211.

DENV-3 specific MAbs 11D5-D7 and 1H9 reacted with cells transfected with

pVAX-DEN3, pVAX-C2M4E434 and pVAX-C2M4E433. DENV-4 specific MAbs

1H10 and 13H8 reacted with cells transfected with pVAX-DEN4, pVAX-

C2M4E434 and pVAX-C2M4E433. DENV-4 specific MAbs F1G2 and 18F5 reacted

with cells transfected with pVAX-DEN4 and pVAX-C2M3E344. None of the MAbs

reacted with cells transfected with the other pVAX-DEN or pVAX-Hybrid-E DNA

vaccines other than those specified. MAbs 4G2, 2H2, 17F3-D8 and homologous

DENV serotype-specific MAbs also reacted with all DENV infected BHK-21 cells.

None of the MAbs reacted with pVAX1-transfected cells.

168

pVAX-Hybrid-E DNA vaccines Size (bp)

pVAX-C2M2E322 5,002 pVAX-C2M2E212 4,978 pVAX-C2M2E211 4,991 pVAX-C2M1E122 5,010 pVAX-C2M2E122 4,976 pVAX-C2M4E434 5,150 pVAX-C2M4E433 4,997 pVAX-C2M3E344 4,994

FIG. 6.03 – Genetic map of the recombinant pVAX-Hybrid-E DNA vaccines


pUC origin

Dengue Virus Hybrid-E

Protein Dengue Virus prM Protein

Dengue Virus Signal Sequence BGH


CMV Promoter

T7 Promoter

Stop codon

Start codon Nhe I

Pme I

pVAX-Hybrid-E DNA vaccines

169

TABLE 6.01 – Indirect immunofluorescence assays of BHK-21 cells transfected for 24 hours with pVAX-DEN1-4 and pVAX-Hybrid-E DNA vaccines


Monoclonal antibodies used in indirect immunofluorescence assays a Virus/DNA plasmid used to

infect/transfect BHK-21 cells 4G2 2H2 17F3-D8

D1-M10

D1-M17

D1-M40 3H5 6B2 10F2 11D5-

D7 1H9 1H10 F1G2 13H8 18F5

DENV-1 Hawaii 4+ 4+ 4+ 4+ 4+ 4+ NEG NEG NEG NEG NEG NEG NEG NEG NEG

DENV-2 NGC 4+ 4+ 3+ NEG 1+ 1+ 4+ 3+ 3+ NEG NEG NEG NEG NEG NEG

DENV-3 H87 4+ 4+ 3+ 1+ NEG 1+ NEG NEG NEG 4+ 4+ NEG NEG NEG NEG

DENV-4 H241 4+ 4+ 4+ NEG NEG NEG NEG NEG NEG NEG NEG 4+ 4+ 4+ 4+

pVAX-DEN1 1+ 1+ 1+ 1+ 1+ 1+ NEG NEG NEG NEG NEG NEG NEG NEG NEG pVAX-DEN2 1+ 1+ 1+ NEG NEG NEG 1+ 1+ 1+ NEG NEG NEG NEG NEG NEG pVAX-DEN3 1+ 1+ 1+ NEG NEG NEG NEG NEG NEG 1+ 1+ NEG NEG NEG NEG pVAX-DEN4 1+ 1+ 1+ NEG NEG NEG NEG NEG NEG NEG NEG 1+ 1+ 1+ 1+

pVAX-C2M2E212 1+ 1+ 1+ 1+ 1+ 1+ NEG NEG 1+ NEG NEG NEG NEG NEG NEG pVAX-C2M2E211 1+ 1+ 1+ 1+ 1+ 1+ NEG NEG 1+ NEG NEG NEG NEG NEG NEG pVAX-C2M1E122 1+ 1+ 1+ NEG NEG NEG 1+ 1+ NEG NEG NEG NEG NEG NEG NEG pVAX-C2M2E122 1+ 1+ 1+ NEG NEG NEG 1+ 1+ NEG NEG NEG NEG NEG NEG NEG pVAX-C2M2E322 1+ 1+ 1+ NEG NEG NEG 1+ 1+ NEG NEG NEG NEG NEG NEG NEG pVAX-C2M4E434 1+ 1+ 1+ NEG NEG NEG NEG NEG NEG 1+ 1+ 1+ NEG 1+ NEG pVAX-C2M4E433 1+ 1+ 1+ NEG NEG NEG NEG NEG NEG 1+ 1+ 1+ NEG 1+ NEG pVAX-C2M3E344 1+ 1+ 1+ NEG NEG NEG NEG NEG NEG NEG NEG NEG 1+ NEG 1+ pVAX1 (Control) NEG NEG NEG NEG NEG NEG NEG NEG NEG NEG NEG NEG NEG NEG NEG

170

6.2.3 Secretion of DENV extracellular hybrid-E proteins by pVAX-Hybrid-E

transfected BHK-21 cells



of pVAX-DEN1-4 and with each of the pVAX-Hybrid-E DNA vaccines (see Section

2.19). Extracellular E proteins were analysed by SDS-PAGE and western blotting

using MAb 4G2 (see Section 2.6) (Fig. 6.04). Extracellular hybrid-E proteins with

molecular masses of 55-60kDa were recovered from cells transfected with each of

the pVAX-Hybrid-E DNA vaccines, except from cells transfected with pVAX-

C2M2E122.

6.2.4 Serological responses of outbred mice to immunisation with pVAX-DEN

or pVAX-Hybrid-E DNA vaccines

The immunogenicity of each of the pVAX-DEN and pVAX-Hybrid-E DNA

vaccines was evaluated by immunising groups of four outbred mice (see Section

2.22) with 100μg of DNA at days 0 and 28, and mice were bled on days 35, 42 and

56.

All groups of mice immunised with each of the pVAX-DEN or pVAX-Hybrid-E

DNA vaccines produced detectable anti-DENV-1 IgM and/or IgG antibodies one

week after the second immunisation (Table 6.02). Mice immunised with pVAX-

DEN1 produced higher and more robust titres of anti-DENV-1 neutralising

antibodies (≥ 160 between weeks five to eight) than mice immunised with the other

DNA vaccines. Mice immunised with pVAX-C2M1E122, pVAX-C2M2E122 or

pVAX-C2M2E211 also produced high titres of anti-DENV-1 neutralising antibodies

(titre ≥160) at eight, five to six, and six to eight weeks following immunisation

respectively. Mice immunised with pVAX-C2M4E433 also produced high titres of

anti-DENV-1 neutralising antibodies (titre 40) eight weeks following immunisation.

Mice immunised with the other pVAX-DEN or pVAX-Hybrid-E DNA vaccines

failed to produce anti-DENV-1 neutralising antibodies with titres higher than 20 at

five, six or eight weeks following immunisation.

171

FIG. 6.04 – Analysis of DENV extracellular E proteins recovered from the t.c.s. of BHK-21 cells transfected with pVAX-DEN and pVAX-Hybrid-E DNA vaccines at 48 hours following transfection. Western blots of DENV extracellular E proteins recovered from pVAX-DEN1 (lane 1), pVAX-C2M2E212 (lane 2), pVAX-C2M2E211 (lane 3), pVAX-C2M1E122 (lane 4), pVAX-C2M2E122 (lane 5), pVAX-DEN2 (lanes 6 and 11), pVAX-C2M4E434 (lane 7), pVAX-C2M4E433 (lane 8), pVAX-C2M3E344 (lane 9), pVAX-C2M2E322 (lane 10), pVAX-DEN3 (lane 12), pVAX-DEN4 (lane 13) and pVAX1 (lane 14) using Mab 4G2.

E

E

63.8 kDa

182.9 kDa

80.9 kDa

49.5 kDa

37.4 kDa

26.0 kDa

63.8 kDa

182.9 kDa

80.9 kDa

49.5 kDa

37.4 kDa

26.0 kDa

1 2 3 4 5 6

7 8 9 10 11 12 13 14

172

TABLE 6.02 – Serological responses to DENV-1 in mice after immunisation with two doses (weeks 0 and 4) of monovalent pVAX-DEN or pVAX-Hybrid-E DNA vaccines

Anti-DENV-1 serological responses

Week 5 Week 6 Week 8 DNA Vaccine

ELISA (mean ± 1 SD) FFURNT50 ELISA (mean ± 1 SD) FFURNT50 ELISA (mean ± 1 SD) FFURNT50

IgM (μg/L) IgG (μg/L) IgM (μg/L) IgG (μg/L) IgM (μg/L) IgG (μg/L)

pVAX-DEN1 29 ± 8 988 ± 1 ≥160 38 ± 7 875 ± 85 ≥160 37 ± 4 1035 ± 154 ≥160

pVAX-DEN2 30 ± 8 n.d. 10 n.d. 144 ± 47 10 n.d. 253 ± 30 20

pVAX-DEN3 6 ± 0 787 ± 53 20 n.d. 829 ± 95 20 5 ± 1 811 ± 129 20

pVAX-DEN4 4 ± 2 122 ± 16 <10 15 ± 5 114 ± 13 <10 50 ± 1 57 ± 12 <10

pVAX-C2M1E122 64 ± 3.50 292 ± 12 <10 46 ± 1 520 ± 8 <10 69 ± 13 676 ± 80 ≥160

pVAX-C2M2E122 42 ± 1 17 ± 2 ≥160 32 ± 4 16 ± 0 ≥160 37 ± 0 20 ± 4 20

pVAX-C2M2E211 58 ± 3 26 ± 7 20 61 ± 5 26 ± 6 ≥160 96 ± 3 17 ± 1 ≥160

pVAX-C2M2E212 43 ± 1 n.d. <10 50 ± 11 n.d. <10 n.d. n.d. <10

pVAX-C2M2E322 n.d. 36 ± 11 <10 n.d. n.d. <10 n.d. n.d. <10

pVAX-C2M3E344 25 ± 10 21 ± 0 <10 19 ± 5 n.d. 20 44 ± 1 n.d. <10

pVAX-C2M4E433 20 ± 3 9 ± 2 <10 25 ± 9 8 ± 2 <10 28 ± 8 7 ± 1 40

pVAX-C2M4E434 79 ± 5 9 ± 4 <10 75 ± 5 n.d. <10 83 ± 4 23 ± 11 20

Abbreviations: n.d. – not detected.

173



week following the second immunisation, except for mice immunised with pVAX-

DEN2 and pVAX-C2M2E322 (Table 6.03). Mice immunised with pVAX-DEN2

failed to produce detectable anti-DENV-2 IgM antibodies five, six or eight weeks

after immunisation, but produced anti-DENV-2 IgG antibodies six weeks after

immunisation. Mice immunised with pVAX-C2M2E322 produced both anti-DENV-

2 IgM and IgG antibodies six weeks after immunisation.

All groups of mice immunised with pVAX-DEN or pVAX-Hybrid-E DNA vaccines

failed to produce anti-DENV-2 neutralising antibodies with titres higher than 10 at

five, six or eight weeks following immunisation, except for mice immunised with

pVAX-C2M1E122, which produced anti-DENV-2 neutralising antibodies with titres

of 10 and 40 at six and eight weeks following immunisation respectively.

Mice immunised with pVAX-DEN1, pVAX-DEN3, pVAX-DEN4, pVAX-

C2M1E122, pVAX-C2M2E122, pVAX-C2M4E433 or pVAX-C2M4E434 produced

detectable anti-DENV-3 IgM and/or IgG antibodies one week after the second

immunisation at week five (Table 6.04). Mice immunised with pVAX-C2M2E211,

pVAX-C2M2E212 or pVAX-C2M2E322 produced detectable anti-DENV-3 IgM or

IgG antibodies eight weeks after immunisation, while mice immunised with pVAX-

DEN2 or pVAX-C2M3E344 failed to produce detectable anti-DENV-3 IgM or IgG

antibodies at five, six or eight weeks following immunisation.

Mice immunised with pVAX-DEN3 produced higher anti-DENV-3 neutralising

antibodies than mice immunised with the other DNA vaccines, with titres of 40, 80

and ≥160 at five, six and eight weeks following the initial immunisation respectively.

In addition, mice immunised with pVAX-C2M3E344 produced high titres of anti-

DENV-3 neutralising antibodies (titre 40) six weeks following immunisation. Mice

immunised with the other pVAX-DEN or pVAX-Hybrid-E DNA vaccines failed to

produce anti-DENV-3 neutralising antibodies with titres higher than 20 five, six or

eight weeks following immunisation.

174






pVAX-DEN1 17 ± 2 377 ± 27 <10 25 ± 3 348 ± 27 <10 43 ± 8 409 ± 27 <10

pVAX-DEN2 n.d. n.d. <10 n.d. 108 ± 8 <10 n.d. 176 ± 10 <10

pVAX-DEN3 10 ± 4 433 ± 30 <10 2 ± 0 401 ± 15 <10 5 ± 1 397 ± 20 <10

pVAX-DEN4 n.d. 143 ± 5 <10 9 ± 0 240 ± 6 <10 22 ± 1 98 ± 8 <10

pVAX-C2M1E122 66 ± 5 n.d. <10 25 ± 1 n.d. 10 48 ± 9 50 ± 8 40

pVAX-C2M2E122 n.d. 18 ± 1 <10 27 ± 1 17 ± 1 <10 36 ± 4 16 ± 1 <10

pVAX-C2M2E211 57 ± 5 34 ± 5 <10 41 ± 11 31 ± 1 <10 61 ± 1 37 ± 30 <10

pVAX-C2M2E212 49 ± 5 n.d. <10 55 ± 0 n.d. <10 43 ± 0 n.d. <10

pVAX-C2M2E322 n.d. n.d. <10 20 ± 2 29 ± 17 <10 26 ± 0 24 ± 8 <10

pVAX-C2M3E344 20 ± 1 n.d. <10 20 ± 0 n.d. <10 34 ± 2 n.d. <10

pVAX-C2M4E433 36 ± 1 6 ± 1 <10 32 ± 3 7 ± 0 <10 29 ± 1 8 ± 5 <10

pVAX-C2M4E434 49 ± 6 n.d. <10 32 ± 0 n.d. <10 45 ± 4 22 ± 5 <10


175






pVAX-DEN1 2 ± 1 210 ± 45 <10 n.d. 202 ± 9 10 n.d. 182 ± 17 20

pVAX-DEN2 n.d. n.d. 10 n.d. n.d. 20 n.d. n.d. <10

pVAX-DEN3 n.d. 260 ± 2 40 n.d. 278 ± 12 80 n.d. 240 ± 7 ≥160

pVAX-DEN4 1 ± 0 155 ± 0 <10 n.d. 159 ± 13 <10 3 ± 0 145 ± 2 <10

pVAX-C2M1E122 24 ± 1 n.d. <10 n.d. n.d. <10 n.d. n.d. 10

pVAX-C2M2E122 n.d. 16 ± 1 <10 n.d. 15 ± 0 10 n.d. 16 ± 1 <10

pVAX-C2M2E211 n.d. n.d. <10 n.d. n.d. 20 n.d. 20 ± 3 10

pVAX-C2M2E212 n.d. n.d. <10 n.d. n.d. <10 27 ± 1 n.d. <10

pVAX-C2M2E322 n.d. n.d. <10 n.d. n.d. <10 n.d. 30 ± 4 <10

pVAX-C2M3E344 n.d. n.d. <10 n.d. n.d. 40 n.d. n.d. 10

pVAX-C2M4E433 n.d. 12 ± 5 10 n.d. 6 ± 0 20 n.d. 8 ± 4 10

pVAX-C2M4E434 7 ± 0 n.d. <10 4 ± 1 n.d. 10 5 ± 1 n.d. <10


176



week after the second immunisation (Table 6.05). Mice immunised with pVAX-

C2M4E434 produced higher anti-DENV-4 neutralising antibodies than mice

immunised with the other DNA vaccines, with titres of 20, 40 and ≥ 160 at five, six

and eight weeks following the initial immunisation respectively. In addition, mice

immunised with pVAX-C2M4E433 produced anti-DENV-4 neutralising antibody

titres of 80, 80 and 10 five, six and eight weeks following immunisation respectively.

Mice immunised with pVAX-C2M3E344 produced high titres of anti-DENV-4

neutralising antibodies (titre 40) six weeks following immunisation. Mice immunised

with the other pVAX-DEN or pVAX-Hybrid-E DNA vaccines failed to produce

anti-DENV-4 neutralising antibodies with titres higher than 20 five, six or eight

weeks after immunisation.

6.2.5 Development of live recombinant DENV incorporating Hybrid-E proteins

The DENV-2 (NGC) infectious clone pDVWS601 was used as a backbone for the

development of live recombinant DENV incorporating the DENV hybrid-E protein

genes. The DENV C-prM-hybrid-E protein genes (see Section 6.2.1) and the

pDVWS601 plasmid were digested with BsrGI and NheI, and purifed in agarose gels

(see Section 2.9). The digested DENV C-prM-hybrid-E protein genes then were

inserted into the BsrGI-NheI site of the digested pDVWS601 plasmid to produce

DNA clones incorporating the various DENV hybrid-E protein genes (see Sections

2.11 to 2.13).

All DNA clones incorporating the DENV hybrid-E protein genes recovered from E.

coli transformed by heat shock treatment or by electroporation (see Section 2.12)

contained one or more deleterious mutations. These included point mutations, which

resulted in the introduction of stop codons (nonsense mutations), as well as deletions

of one or more nucleotides, which resulted in genetic frame-shifts and the

subsequent abrogation of the viral genomic coding sequence. None of these DNA

clones produced infectious viral RNA transcripts following in vitro transcription (see

Section 2.20) and transfection into BHK-21 cells (see Section 2.21).

177






pVAX-DEN1 47 ± 0 187 ± 26 10 59 ± 0 192 ± 8 10 65 ± 10 213 ± 16 <10

pVAX-DEN2 9 ± 1 n.d. <10 n.d. n.d. <10 n.d. n.d. <10

pVAX-DEN3 21 ± 4 117 ± 5 10 15 ± 1 113 ± 16 20 24 ± 3 129 ± 10 20

pVAX-DEN4 n.d. 119 ± 2 <10 15 ± 4 73 ± 35 <10 63 ± 5 23 ± 1 <10

pVAX-C2M1E122 96 ± 9 n.d. <10 54 ± 1 n.d. <10 104 ± 15 31 ± 5 <10

pVAX-C2M2E122 81 ± 5 26 ± 6 <10 81 ± 10 24 ± 5 <10 22 ± 10 27 ± 6 <10

pVAX-C2M2E211 97 ± 5 19 ± 0 <10 86 ± 3 18 ± 2 10 137 ± 3 17 ± 2 <10

pVAX-C2M2E212 85 ± 1 n.d. <10 99 ± 6 n.d. <10 86 ± 7 n.d. <10

pVAX-C2M2E322 8 ± 0 n.d. <10 26 ± 10 25 ± 11 <10 17 ± 9 n.d. <10

pVAX-C2M3E344 52 ± 1 n.d. 20 52 ± 5 n.d. 40 75 ± 3 n.d. 10

pVAX-C2M4E433 84 ± 1 11 ± 6 80 58 ± 6 n.d. 80 85 ± 5 20 ± 11 10

pVAX-C2M4E434 110 ± 1 5 ± 3 20 107 ± 7 16 ± 6 40 137 ± 1 58 ± 16 ≥160


178

Furthermore, attempts at propagating the transformed bacterial cultures at lower

temperatures (250C and 300C) failed to produce any hybrid-E infectious DNA clones

without deleterious mutations. Similarly, the use of other competent E. coli strains,

such as Max Efficiency STBL-2 (Invitrogen, USA) or STBL-4 (Invitrogen, USA),

which were designed specifically for the cloning of unstable retroviral inserts, or the

use of Epicurian Coli XL10-Gold ultra-competent cells (Stratagene, USA), which

were designed specifically for the cloning of large DNA plasmids, failed to produce

any hybrid-E infectious DNA clones without deleterious mutations.

179

6.3 DISCUSSION

This present study developed a number of DNA vaccines incorporating DENV prM

and hybrid-E protein genes derived from multiple DENV serotypes. The hybrid-E

protein genes were constructed by substituting complete domains from the DENV E

protein, rather than individual epitopes involved in virus neutralisation, to (i) provide

sufficient E protein from each of the DENV serotypes to enable recognition by

multiple populations of MHC molecules, and (ii) to minimise the risk of abrogating

the immune responses to a DENV serotype as a result of conformational changes to

the neutralisation epitope. Furthermore, studies with polioviruses have demonstrated

that the substitution of single epitopes into hybrid proteins has resulted generally in

the loss of their conformation and immunogenicity (Burke et al., 1988; Kitson et al.,

1991; Minor et al., 1990; Minor et al., 1991).

The reaction of conformation-dependent flavivirus cross-reactive and DENV

serotype-specific MAbs to the prM/M or E proteins with pVAX-Hybrid-E

transfected BHK-21 cells in indirect IFAs confirmed the preservation of

conformational cross-reactive and homotypic epitopes on the prM/M and hybrid-E

proteins expressed by these DNA vaccines. In addition, the location of the epitopes

recognised by the DENV serotype-specific MAbs was deduced from their reactivity

pattern with specific pVAX-Hybrid-E transfected cells in indirect IFAs (Table 6.06).

The reaction of 1H10 and 13H8 with pVAX-C2M4E433-transfected cells, but not

pVAX-C2M3E344-transfected cells, suggested that 1H10 and 13H8 recognised

epitopes located on domains I or II of the DENV-4 E proteins. The reaction of FIG2

and 18F5 with pVAX-C2M3E344-transfected cells, but not pVAX-C2M4E433-

transfected cells, suggested that FIG2 and 18F5 recognised epitopes located on

domain III of the DENV-4 E protein. The reaction of D1-M40 with pVAX-

C2M2E212-transfected cells, but not pVAX-C2M1E122-transfected cells, suggested

that D1-M40 recognised an epitope located on domain III of the DENV-1 E protein.

The reaction of 11D5-D7 with pVAX-C2M4E434-transfected cells, but not pVAX-

C2M3E344-transfected cells, suggested that 11D5-D7 recognised an epitope located

on domain III of the DENV-3 E protein. The location of the epitopes recognised by

these MAbs has not been previously reported.

180

TABLE 6.06 – Summary of epitope location for DENV neutralising monoclonal antibodies deduced

from indirect immunofluorescence assays using pVAX-Hybrid-E DNA transfected BHK-21 cells

DENV Neutralising Monoclonal Antibody Deduced epitope location

4G2 Not determined (Flavivirus cross-reactive MAb)

2H2 Not determined (Dengue cross-reactive MAb)

17F3-D8 Not determined (Flavivirus cross-reactive MAb)

D1-M10 DENV-1 E protein – Domain III



3H5 DENV-2 E protein – Domain III

6B2 DENV-2 E protein – Domain III

10F2 DENV-2 E protein – Domains I or II

11D5-D7 DENV-3 E protein – Domain III

1H9 DENV-3 E protein – Domain III

1H10 DENV-4 E protein – Domains I or II

F1G2 DENV-4 E protein – Domain III

13H8 DENV-4 E protein – Domains I or II

18F5 DENV-4 E protein – Domain III

181

Furthermore, the reaction of 10F2 with pVAX-C2M2E211-transfected cells, but not

pVAX-C2M1E122-transfected cells, suggested that 10F2 recognised epitopes

located on domains I or II of the DENV-2 E protein. The reaction of 3H5 and 6B2

with pVAX-C2M1E122-transfected cells, but not pVAX-C2M2E212-transfected

cells, suggested that 3H5 and 6B2 recognised epitopes located on domain III of the

DENV-2 E protein. The reaction of 1H9 with pVAX-C2M4E434-transfected cells,

but not pVAX-C2M3E344-transfected cells, suggested that 1H9 recognised an

epitope located on domain III of the DENV-3 E protein. These results concurred

with the epitope location for these MAbs published previously (Gentry et al., 1982;

Hiramatsu et al., 1996; Lok et al., 2001; Serafin and Aaskov, 2001; Trirawatanapong

et al., 1992). Such epitope mapping could not be undertaken with the DENV cross-

reactive MAbs 4G2, 17F3-D8 or 2H2 due to their ability to recognise multiple

DENV serotypes.

However, the reaction of D1-M10 and D1-M17 with pVAX-C2M2E212-transfected

cells, but not pVAX-C2M1E122-transfected cells, suggested that D1-M10 and D1-

M17 recognised epitopes located on domain III of the DENV-1 E protein. This was

inconsistent with the study of Beasley and Aaskov (2001), who reported that D1-

M10 and D1-M17 recognised epitopes located at amino acid residues E279 (domain

II) and E293 (domain I) of the DENV-1 E protein respectively, which were

determined by DNA sequencing of neutralisation escape mutant viruses that were

selected using the corresponding MAbs. However, both D1-M10 and D1-M17 also

reacted with C6/36 cells infected with the corresponding neutralisation escape

mutant virus in indirect IFAs, which suggested that the amino acid changes observed

at E279 and E293 in the corresponding neutralisation escape mutant virus may not

represent the antibody binding site for these MAbs (Beasley and Aaskov, 2001).

Instead, the amino acid changes at E279 or E293 may have induced conformational

changes within the DENV-1 E protein, which abrogated virus neutralisation induced

by the binding of D1-M10 or D1-M40 to their actual epitopes at a distant location.

This mechanism of virus escape from antibody-mediated neutralisation was

described by Dimmock (1993), and has been reported for the neutralisation escape

mutant flaviviruses JEV (Cecilia and Gould, 1991), TBEV (Holzmann et al., 1997),

and YFV (Buckley and Gould, 1985).

182

Using conventional cloning strategies, attempts also were made to clone the DENV

hybrid-E protein genes into a full-length infectious clone of DENV-2 to produce

infectious viruses incorporating the hybrid-E proteins. Although a number of full-

length clones were produced, they all contained one or more deleterious mutations,

such as the introduction of stop codons (nonsense mutations), or deletions of one or

more nucleotides resulting in genetic frame-shifts. RNA transcripts produced in vitro

from these clones were not infectious following transfection into BHK-21 cells.

Currently, the reasons for this are not fully understood. One explanation is that the

propagation of these clones, encoding the hybrid-E protein and other flavivirus

genes, in the bacterial cells resulted in the expression of products that were toxic to

the bacterial host. Consequently, the selective pressure imposed by the toxic

products on the bacteria resulted in (i) the death of transformed bacterial cells, or (ii)

the introduction of stabilising mutations into the flavivirus DNA sequence encoded

by the plasmids (eg. stop codons or deletions), which subsequently produced DNA

templates that were not viable for the production of infectious RNA transcripts.

Several strategies were utilised in an attempt to overcome this problem, such as

propagating the transformed bacterial cultures at lower temperatures to reduce the

expression of toxic products, or propagating the clones in other strains of E. coli

designed specifically for the cloning of large and unstable retroviral inserts.

However, these strategies also failed to produce infectious hybrid-E DNA clones that

were free of deleterious mutations. It is possible that screening of more clones would

eventually lead to the detection of an infectious clone without deleterious mutations,

but this was not feasible in the time available for this study.

While some studies have successfully produced infectious flavivirus clones (Gualano

et al., 1998; Khromykh and Westaway, 1994; Kinney et al., 1997; Lai et al., 1991;

Sriburi et al., 2001), others have experienced difficulty in cloning full-length

flavivirus genes. Full-length infectious clones of some flaviviruses were either

impossible to produce, or once produced were unstable and subsequently difficult to

maintain in bacterial hosts, due to the production of toxic products and their

predisposition for acquiring undesirable mutations and/or spontaneous

recombination (Kapoor et al., 1995; Polo et al., 1997; Puri et al., 2000; Rice et al.,

1989; Sumiyoshi et al., 1992).

183

Consequently, many studies have utilised other strategies to circumvent these

problems, including (i) the in vitro ligation of restriction enzyme-digested DNA

fragments to construct full-length templates for transcription (Arroyo et al., 2001b;

Chambers et al., 1999; Guirakhoo et al., 2001; Guirakhoo et al., 2000; Kapoor et al.,

1995; Mandl et al., 1997; Rice et al., 1989; Sumiyoshi et al., 1992), (ii) the fusion of

overlapping PCR fragments to produce full-length templates for transcription

(Charlier et al., 2003; Gritsun and Gould, 1995), (iii) insertion of introns into the

flavivirus coding sequence (Yamshchikov et al., 2001a), or (iv) using modified or

non-bacterial cloning systems to produce full-length infectious flavivirus clones

(Polo et al., 1997; Puri et al., 2000; Yun et al., 2003; Zhang et al., 2001). The use of

these strategies could be implemented in future attempts to produce full-length

infectious clones of DENV incorporating the hybrid-E protein genes.

Mice immunised with pVAX-C2M1E122 produced strong neutralising antibody

responses against both DENV-1 and DENV-2 (highest titres of ≥160 and 40

respectively), which suggested that this DNA vaccine may provide concurrent

protective immunity against both DENV-1 and DENV-2. In addition, mice

immunised with pVAX-C2M3E344 produced strong neutralising antibody responses

against both DENV-3 and DENV-4 (highest titres of 40), which suggested that this

DNA vaccine may provide concurrent protective immunity against both DENV-3

and DENV-4. Mice immunised with the other pVAX-Hybrid-E DNA vaccines failed

to produce high titres of neutralising antibodies against multiple DENV serotypes. A

detailed discussion of these results is provided in the general discussion.

184

CHAPTER 7:

GENERAL DISCUSSION

A natural infection with one DENV serotype confers life-long immunity against

clinical re-infection by that same serotype, but not against infection with the other

serotypes (Halstead et al., 1970; Halstead and O'Rourke, 1977b). A major obstacle to

the development of DENV vaccines has been the need to immunise concurrently

against all four DENV serotypes in order to avoid sensitising human recipients to

ADE. However, a problem already encountered with the development of live

attenuated tetravalent DENV vaccines has been the difficulty in eliciting adequate

immune responses against each of the four DENV serotypes in human hosts

(Bhamarapravati and Yoksan, 1997; Edelman et al., 2003; Kanesa-thasan et al.,

2001; Sun et al., 2003). This could have been due to variations in the antigenicity

and/or the replication rates of the four DENV serotypes incorporated into these

tetravalent DENV vaccines (Edelman et al., 2003; Kanesa-thasan et al., 2001; Sun et

al., 2003). The utilisation of non-replicating vaccines, such as DNA vaccines, would

avoid the issue of different replication rates. In addition, unlike other non-replicating

vaccines, DNA vaccines are able to stimulate both humoral and cell-mediated

immune responses (reviewed in (Schultz et al., 2000)). However, only DENV-1 and

DENV-2 DNA vaccines have been evaluated.

In this present study, a number of monovalent DENV DNA vaccines were developed

and their immunogenicity was evaluated in outbred mice. In addition, the

immunogenicity of a tetravalent DENV DNA vaccine, composed of a DNA vaccine

encoding the prM-E protein genes from each of the four DENV serotypes (pVAX-

DEN1-4), was evaluated. Mice immunised with the tetravalent DENV DNA vaccine

produced high titres of anti-DENV-1 and anti-DENV-3 neutralising antibodies (titres

of 80 to ≥160, FFURNT50), which were comparable to the titres of anti-DENV-1 and

anti-DENV-3 neutralising antibodies elicited by mice immunised with identical

doses of the monovalent pVAX-DEN1 or pVAX-DEN3 DNA vaccines respectively.

However, mice immunised with the tetravalent DENV DNA vaccine failed to

produce high titres of anti-DENV-2 or anti-DENV-4 neutralising antibodies, which

185

correlated with the neutralising antibody responses elicited by mice immunised with

identical doses of the monovalent pVAX-DEN2 or pVAX-DEN4 DNA vaccines

respectively. Such a tetravalent DENV DNA vaccine would not be suitable for use

because the absence of neutralising antibody responses against all four DENV

serotypes may be a risk factor for developing severe dengue diseases (DHF and

DSS) following wildtype DENV infection (Halstead and O'Rourke, 1977b; Rosen,

1977). Nevertheless, the results from this present study suggested that the pVAX-

DEN1 and pVAX-DEN3 DNA vaccines could provide effective protection against

infection by the corresponding DENV serotypes.

The titres of anti-DENV-1 neutralising antibodies elicited by mice immunised with

pVAX-DEN1 also were similar to those reported by others with mice immunised

intradermally or intramuscularly with similar DENV-1 DNA vaccines, encoding the

DENV-1 prM-E protein genes (titres of 40, PRNT50 (Raviprakash et al., 2000a), and

20, PRNT90 (Konishi et al., 2003)). Monkeys immunised intradermally or

intramuscularly with similar DENV-1 DNA vaccines also produced anti-DENV-1

neutralising antibodies and developed viremia with reduced titres when challenged

with DENV-1 (1.25x104 or 2x104 PFU) subcutaneously (Kochel et al., 2000;

Raviprakash et al., 2003; Raviprakash et al., 2000b) (see Table 1.04).

However, attempts by others to develop DENV-2 DNA vaccines have resulted in

various degrees of success (see Table 1.04). Mice immunised intramuscularly or

intradermally with DENV-2 DNA vaccines, encoding the DENV-2 prM-E protein

genes, produced low or undetectable titres of anti-DENV-2 neutralising antibodies

(Chang et al., 2003; Konishi et al., 2000a; Raviprakash et al., 2001). However,

Konishi et al., (2003) demonstrated that mice immunised with a DNA vaccine,

encoding the DENV-2 prM-E protein genes, using a jet injector elicited higher titres

of anti-DENV-2 neutralising antibodies (titre of 640, PRNT90) than mice immunised

intramuscularly with identical doses of the DENV-2 DNA vaccine (titre of 20,

PRNT90) eighteen weeks after initial immunisation. High titres of anti-DENV-2

neutralising antibodies also were elicited in mice immunised intradermally using a

gene gun with a similar DENV-2 DNA vaccine coated onto gold particles (Putnak et

al., 2003). Currently, the reason for this is not clear. However, the alternative

methods of DNA vaccine delivery (jet injector or gene gun) may have increased the

186

efficiency of DNA uptake and expression of vaccine-encoded antigens by host

antigen-presenting cells (APCs), which increased the humoral immune responses and

the production of anti-DENV-2 neutralising antibodies. The use of these alternative

methods of DNA vaccine delivery also may increase the anti-DENV neutralising

antibody responses in mice to immunisation with the pVAX-DEN2 or pVAX-DEN4

DNA vaccines produced in the present study.

However, the absence of anti-DENV-2 and anti-DENV-4 neutralising antibodies in

mice immunised with pVAX-DEN2 and pVAX-DEN4 respectively, may not

necessarily indicate that these DNA vaccines are incapable of providing protection

against infection by the corresponding DENV. Mice immunised intradermally or

intramuscularly with JEV, SLEV or MVEV DNA vaccines were protected from

death following challenge with lethal doses of homologous flaviviruses, despite the

absence of a virus-specific neutralising antibody response prior to the challenge

(Ashok and Rangarajan, 1999; Colombage et al., 1998; Konishi et al., 1998b;

Phillpotts et al., 1996). This protection may have been due to the induction of virus-

specific cytolytic T cell responses following DNA immunisation.

A prominent feature of DNA vaccines is their ability to elicit cell-mediated immune

responses due to endogenous synthesis of vaccine-encoded proteins (Donnelly et al.,

1997). Virus-specific CTLs are considered to play an important role in the immune

responses against flavivirus infections based on the observations that adoptive

transfer of JEV-specific CTLs could protect mice against lethal challenge with JEV

(Murali-Krishna et al., 1996), and increased morbidity and mortality in CD8-

deficient (CD8-/-) mice compared to wildtype mice following infection with WNV,

despite the presence of similar titres of neutralising antibodies in these mice

(Shrestha and Diamond, 2004). Konishi et al., (1998) also demonstrated that in vitro

JEV stimulation of splenocytes, derived from mice immunised intramuscularly with

a DNA vaccine encoding the JEV prM-E protein genes, resulted in the proliferation

of JEV-specific memory CD8+ CTLs against JEV-infected primary mouse kidney

(PMK) cells, despite the absence of JEV-specific neutralising antibodies. However,

it remains unclear whether a tetravalent DENV DNA vaccine, which could induce

strong cell-mediated immune responses against each of the four DENV serotype,

187

would provide sufficient protection in humans against infection by each of the four

DENV serotypes in the absence of a tetravalent neutralising antibody response.

Mice immunised intramuscularly with each of the four pVAX-DEN or pVAX-Tetra

DNA vaccines produced predominantly Th1-type anti-DENV antibody responses,

characterised by high levels of anti-DENV IgG2a and IgG2b antibodies, but low

levels of anti-DENV IgG1 antibodies. Th1-type antibody responses also were

observed in mice immunised with live DNA or RNA viruses, including the

flaviviruses MVEV (Colombage et al., 1998), JEV (Chen et al., 1999) or DENV-2

(Smucny et al., 1995), regardless of the route of immunisation (Coutelier et al.,

1987). In contrast, mice immunised with soluble protein antigens, such as DENV-2

recombinant proteins (Smucny et al., 1995), elicited predominantly Th2-type

immune responses characterised by high levels of antigen-specific IgG1 antibodies,

but low levels of antigen-specific IgG2a and IgG2b antibodies (Coutelier et al.,

1987). Mice immunised with polysaccharide antigens elicited predominantly

antigen-specific IgG3 antibodies (Perlmutter et al., 1978).

Similar to live virus immunisations, intradermal or intramuscular needle

immunisation of mice with DNA vaccines, including various flavivirus DNA

vaccines, elicited predominantly Th1-type antibody responses (Aberle et al., 1999;

Chen et al., 2001a; Chen et al., 1999; Colombage et al., 1998; Feltquate et al., 1997;

Kaur et al., 2002; Pertmer et al., 1996; Raz et al., 1996; Sato et al., 1996; Weiss et

al., 2002; Wu et al., 2004). In contrast, intradermal or intramuscular gene gun

immunisation of mice with DNA vaccines, including various flavivirus DNA

vaccines, coated onto gold particles elicited predominantly Th2-type antibody

responses (Aberle et al., 1999; Chen et al., 1999; Colombage et al., 1998; Feltquate

et al., 1997; Kaur et al., 2002; Pertmer et al., 1996; Vinner et al., 1999; Weiss et al.,

2002). Currently, the mechanism responsible for the different Th-type immune

responses observed in mice following needle or gene gun DNA immunisation has

not been fully elucidated. However, studies with bacterial-derived DNA suggested

that the induction of a Th1-type immune response in mice immunised with DNA

vaccines using needles may be due to the presence of unmethylated CpG motifs in

the DNA sequences of the DNA vaccines (Liu et al., 2003).

188

Various studies demonstrated that DNA from bacteria, but not from vertebrates,

stimulated mammalian immune responses due to the presence of unmethylated CpG

motifs (Krieg et al., 1995; Tokunaga et al., 1984; Yamamoto et al., 1992). In

contrast, CpG motifs are mostly methylated in vertebrate genomes, which abrogated

the ability of these motifs to stimulate mammalian immune responses (Chen et al.,

2001b). The degree of immune stimulation by CpG motifs also was dependent on the

identity of the bases flanking the CpG motif. Immuno-stimulatory CpG motifs

(CpG-S) for stimulating immune cells from mice have the characteristic base

sequence of (5’)purine-purine-CG-pyrimidine-pyrimidine(3’), while immuno-

neutralising CpG motifs (CpG-N) were proposed to be direct repeats of CpG motifs,

as well as CpG motifs that were preceded by a cytosine and/or followed by a guanine

base (Krieg et al., 1998; Krieg et al., 1995; Stunz et al., 2002).

Activation of immune responses by CpG-S motifs may be dependent on the presence

of TLR9 following studies with TLR9-deficient (TLR9-/-) mice. Splenocytes and

peritoneal macrophages from TLR9-/- mice were unable to proliferate or produce

detectable levels of TNF-α, IL-6 and IL-12 respectively following CpG-S

stimulation, in contrast to splenocytes and peritoneal macrophages obtained from

wildtype mice (Hemmi et al., 2000). However, no direct binding of CpG motifs to

TLR9 has been demonstrated (Hemmi et al., 2003; Hemmi et al., 2000; Vollmer et

al., 2004). Studies demonstrated that CpG-S motifs induced B cell proliferation and

expression of MHC-II molecules. In addition, mice immunised with DNA

incorporating CpG-S motifs produced a predominantly Th1-type immune response

with increased expression of IFN-γ and TNF-β, as well as high concentrations of

IgG2a, IgG2b and IgG3 antibodies (Krieg, 2002; Liu et al., 2003; Redford et al.,

1998; Yi et al., 1996a; Yi et al., 1996c).

Therefore, the Th1-type antibody responses observed in mice immunised with the

monovalent pVAX-DEN1-4 or pVAX-Tetra DNA vaccines may have been induced

by the presence of the various mouse CpG-S motifs (GACGTT and AACGTT) and

the vertebrate CpG-S motif (GTCGTT) in the DNA sequences of the four pVAX-

DEN DNA vaccines (see Table 5.01). In contrast, the presence of CpG-N motifs in

the DNA sequences of these DNA vaccines did not appear to interfere with the CpG-

S induced Th1-type antibody responses in immunised mice. This result was

189

consistent with the study of Krieg et al., (1998), who demonstrated that mice co-

immunised intramuscularly with recombinant Hepatitis B surface antigen (HbsAg)

and oligodeoxynucleotides (ODNs) containing one CpG-S motif and a number of

different CpG-N motifs still produced a Th1-type antibody response, but at a

significantly lower titre than mice co-immunised intramuscularly with HbsAg and

ODNs containing the single CpG-S motif without the CpG-N motifs. Sato et al.,

(1996) also demonstrated that mice immunised intradermally with a DNA vaccine

containing a low ratio of CpG-S to CpG-N motifs still produced Th1-type cytokine

responses, characterised by high levels of IFN-γ and low levels of IL-4, but at lower

levels than mice immunised intradermally with a DNA vaccine containing a higher

ratio of CpG-S to CpG-N motifs.

Currently, the mechanism by which gene gun immunisation of DNA vaccines is able

to induce Th2-type immune responses, despite the presence of CpG-S motifs in the

DNA vaccines, has not been defined. It was postulated that inoculation with gold

particles may have resulted in the stimulation of a specific subset of dendritic cells,

which could have activated specific signals to override the CpG-S mediated Th1-

type immune response and promote a Th2-type immune response in immunised

animals (Weiss et al., 2002). This was supported by the observation that the Th1-

type immune response induced by intradermal needle immunisation of a DNA

vaccine could be switched to a Th2-type immune response by co-immunisation with

non-DNA coated gold particles at the same inoculation site, but not at a different

inoculation site (Weiss et al., 2002). In addition, Zhao et al., (2003) demonstrated

that intravenous immunisation of mice with a JEV DNA vaccine, with and without

gold particles, elicited predominantly anti-JEV IgG1 and IgG2a antibodies

respectively.

Current evidence suggested that there was no association between the induction of a

particular Th-type immune response in mice following immunisation with flavivirus

DNA vaccines and the production of flavivirus-specific neutralising antibody

responses. This present study, and others, demonstrated that gene gun or

intramuscular immunisation of mice or monkeys with DENV or other flavivirus

DNA vaccines, which elicited predominantly Th2-type and Th1-type antibody

responses respectively, elicited strong neutralising antibody responses against the

190

corresponding flaviviruses (see Table 1.04). In addition, Aberle et al., (1999)

demonstrated that gene gun or intramuscular immunisation of mice with a DNA

vaccine, encoding the TBEV prM-E protein genes, elicited identical titres of Th2-

type and Th1-type TBEV-specific antibodies (titres of 20,800), which included

identical titres of neutralising (titres of 80, PRNT50) and hemagglutination-inhibiting

(titres of 320) antibodies. Furthermore, all mice immunised using a gene gun or

intramuscularly with the TBEV DNA vaccine seroconverted and survived for more

than 28 days when challenged with TBEV (1x103 LD50) intraperitoneally. These

results suggested that both Th1-type and Th2-type subclass antibodies may possess

efficient neutralising or hemagglutination-inhibiting activities against flaviviruses

and that both Th1-type and Th2-type immune responses can provide effective

protection against challenge with live flaviviruses.

In addition to alternative methods of DNA vaccine delivery, several studies were

successful in increasing the immunogenicity of DNA vaccines by co-immunising

with DNA encoding the genes of various cytokines. Raviprakash et al., (2001)

demonstrated that mice co-immunised intradermally with a DENV-2 DNA vaccine

and DNA expressing the mouse granulocyte-macrophage colony stimulating factor

(GM-CSF) elicited higher titres of anti-DENV-2 neutralising antibodies than mice

immunised with the DENV-2 DNA vaccine alone. The improvement in the

immunogenicity of DNA vaccines co-immunised with GM-CSF may have been due

to the local infiltration of APCs, particularly CD11c+ immature dendritic cells,

induced by GM-CSF (Haddad et al., 2000).

Various studies also have investigated the influence of Th1-type and Th2-type

cytokines on the immune responses induced by DNA vaccines. CTLs derived from

splenocytes of mice co-immunised intramuscularly with a human immunodeficiency

virus-1 (HIV-1) DNA vaccine and DNA expressing either the pro-inflammatory

cytokine TNF-α, or various Th1-type cytokines (IL-12 or IL-15), demonstrated

increased lysis of mammalian cells expressing HIV-1 antigens than CTLs derived

from splenocytes of mice immunised with the HIV-1 DNA vaccine alone. Mice co-

immunised intramuscularly with the HIV-1 DNA vaccine and DNA expressing

various Th2-type cytokines (IL-4, IL-5 or IL-10) also elicited higher HIV-1-specific

antibody responses than mice immunised with the HIV-1 DNA vaccine alone (Kim

191

et al., 1998). Mice co-immunised intramuscularly with a herpes simplex virus-1

(HSV-1) DNA vaccine and DNA expressing IL-18 (Th1-type cytokine) also

produced higher concentrations of HSV-1-specific antibodies, and the cytokines IL-2

and IFN-γ than mice immunised with the DNA vaccine alone (Zhu et al., 2003).

A number of studies also were successful at increasing the humoral immune

responses in mice to DNA immunisation by increasing the efficiency of antigen

presentation to MHC-II molecules. Raviprakash et al., (2001) demonstrated that

mice immunised with a DENV-2 DNA vaccine incorporating the gene encoding for

the C-terminal sequence of lysosome-associated membrane protein (LAMP)

produced higher titres of anti-DENV-2 neutralising antibodies than mice immunised

with the DENV-2 DNA vaccine without the LAMP gene. The expression of the C-

terminal sequence of LAMP may have enabled the vaccine-encoded antigen to be

targeted to the lysosomal membrane, which increased the efficiency of antigen

presentation to MHC-II restricted CD4+ helper T cells resulting in strong antibody

responses. In addition, DNA vaccines incorporating the secretory signal sequence of

tissue plasminogen activator (TPA), which directed the vaccine-encoded antigen to

the ER secretory pathway, elicited increased antigen-specific antibody and cell-

mediated immune responses in immunised mice (Ashok and Rangarajan, 2002;

Delogu et al., 2002; Li et al., 1999b). The increased extracellular secretion of

vaccine-encoded antigens may have resulted in an increase in antigen uptake by

APCs, which enhanced the presentation of antigens to MHC-II molecules.

Several studies demonstrated that mammalian cells transfected with DNA, encoding

the flavivirus C-terminal C-prM-E protein genes, were capable of secreting RSPs

into the extracellular environment (Allison et al., 1995; Gruenberg and Wright,

1992; Heinz et al., 1995; Konishi et al., 2001; Konishi et al., 1992; Konishi et al.,

1997b; Mason et al., 1991; Pincus et al., 1992). Secretion of large amounts of RSPs

may correlate with the ability of DNA vaccines to induce strong neutralising

antibody responses due to increased antigen presentation to MHC-II molecules. This

would enhance the activation of CD4+ helper T cells and humoral immune responses.

Konishi et al., (2003) demonstrated that the amount of RSPs secreted by mammalian

cells transfected with three different DNA vaccines (JEV, DENV-1 and DENV-2),

correlated with the neutralising antibody titres against the corresponding viruses

192

elicited by mice immunised with the DNA vaccines. In addition, Chang et al., (2003)

increased the amount of RSPs secreted by mammalian cells transfected with a

DENV-2 DNA vaccine by substituting the stem-anchor region of the DENV-2 E

protein with the corresponding region from JEV. A greater number of mice

immunised with the DENV-2/JEV DNA vaccine seroconverted with anti-DENV-2

neutralising antibodies than mice immunised with the unmodified DENV-2 DNA

vaccine.

In this present study, mammalian cells transfected in vitro with the pVAX-DEN4

DNA vaccine secreted lower amounts of extracellular E proteins, believed to be in

the form of RSPs, than cells transfected with the other pVAX-DEN DNA vaccines.

The inability of pVAX-DEN4-transfected cells to secrete large amounts of

extracellular E proteins may have resulted in the poor immunogenicity of the pVAX-

DEN4 DNA vaccine in outbred mice. Therefore, an attempt was made to increase

the immunogenicity of the pVAX-DEN4 DNA vaccine by increasing the amount of

extracellular E proteins secreted by mammalian cells tranfected with pVAX-DEN4.

The amount of extracellular E proteins secreted by pVAX-DEN4-transfected cells

increased when the signal peptide c-region of the DENV-4 prM/E cleavage site was

made more polar. Mice immunised with this modified pVAX-DEN4 DNA vaccine

(pVAX-D4-mutE-D1), which was capable of expressing large amounts of

extracellular E proteins in vitro, produced significantly higher concentrations of anti-

DENV-4 IgG antibodies than mice immunised with the unmodified pVAX-DEN4.

However, mice immunised with pVAX-DEN4 produced significantly higher

concentrations of anti-DENV-4 IgM antibodies than mice immunised with pVAX-

D4mutE-D1. These results suggested that the ability of pVAX-D4mutE-D1 to

express large amounts of extracellular E proteins may have increased the efficiency

of class-switching from IgM to IgG production in the B cells of pVAX-D4mutE-D1

immunised mice. This may have been due to an increase in the efficiency of

extracellular E protein uptake and presentation to MHC-II molecules by APCs,

which subsequently increased the efficiency of CD4+ helper T cell-mediated

activation of humoral immune responses. However, the anti-DENV-4 antibodies

produced by mice immunised with pVAX-D4mutE-D1 or pVAX-DEN4 were unable

to neutralise DENV-4. Nevertheless, the observation that increasing the polar nature

193

of the signal peptide c-region of the DENV-4 prM/E cleavage site could produce an

increase in the amount of extracellular E protein secretion in vitro suggested that

incorporating the reverse of these changes into a full-length DENV-4 infectious

clone may produced DENV-4 with reduced titre, which could then be used as

attenuated DENV-4 in live vaccines.

A number of studies also have demonstrated that the levels of antigen-specific

antibodies elicited by mice following intradermal or intramuscular DNA

immunisation could be increased either by (i) incorporating a single CpG-S motif

(Sato et al., 1996), or multiple CpG-S motifs into the DNA sequences of the DNA

vaccines (Krieg et al., 1998; Sato et al., 1996), or (ii) co-immunising the DNA

vaccine with DNA containing a number of CpG-S motifs (Klinman et al., 1997b;

Kojima et al., 2002; Porter et al., 1998; Sato et al., 1996). In addition, other studies

found that the removal of CpG-N motifs from DNA vaccines increased the levels of

antigen-specific antibodies in mice (Krieg et al., 1998). Studies also found that

increasing the ratio of CpG-S to CpG-N motifs resulted in a corresponding increase

in the ratio of antigen-specific IgG2a to IgG1 antibodies (Krieg et al., 1998), and an

increase in IFN-γ production and antigen-specific cytotoxic T cell activity (Kojima

et al., 2002; Sato et al., 1996).

In this present study, an attempt was made to increase the immunogenicity of the

pVAX-DEN2 DNA vaccine by increasing the ratio of CpG-S to CpG-N motifs.

Modified pVAX-DEN2 DNA vaccines incorporating either (i) an additional

GACGTT CpG-S motif (pVAX-D2-CPG), which was identified as an optimal CpG-

S motif for activating immune cells from mouse (Krieg et al., 1995), or (ii) a higher

ratio of CpG-S to CpG-N motifs following the substitution of a kanR gene with an

ampR gene (pDNA-D2-AMP), induced higher levels of Th1-type antibody and

neutralising antibody responses against DENV-2 in mice, than mice immunised with

the unmodified pVAX-DEN2 DNA vaccine. These results suggested that increasing

the ratio of CpG-S to CpG-N motifs in DENV DNA vaccines was able to increase

the immunogenicity of these DNA vaccines in mice.

In contrast, Colombage et al., (1998), and Raviprakash et al., (2003), found that co-

immunisation of mice or monkeys with MVEV or DENV-1 DNA vaccines

194

respectively, and with a DNA plasmid containing multiple CpG-S motifs, either did

not increase, or in some cases decreased, the antibody responses against the

corresponding viruses compared to mice or monkeys immunised with the DNA

vaccine alone (see Table 1.04). The co-immunisation with two DNA plasmids may

have resulted in competitive inhibition between the DNA vaccine plasmid encoding

the flavivirus genes, and the DNA plasmid encoding the CpG-S motifs, resulting in

(i) a decreased expression of the flaviviral proteins encoded by the DNA vaccine,

and/or (ii) a decreased opportunity for the CpG-S motifs to activate the immune cells

prior to host-mediated degradation of both the DNA plasmids within the host. This

was not an issue with the pVAX-D2-CPG or pDNA-D2-AMP DNA vaccines

developed in this present study because both the CpG-S motifs and the DENV-2

prM-E protein genes were expressed within the one DNA plasmid. In addition, the

observation that the pDNA-D2-AMP plasmid containing the ampR gene was more

immunogenic in mice than the pVAX-DEN2 plasmid containing the kanR gene

supported the findings of Krieg et al., (1998), who found that mice immunised with a

Hepatitis B DNA vaccine containing a modified kanR gene, in which fifteen CpG-N

motifs from the kanR gene were removed without changing the protein sequence,

elicited higher titres of virus-specific antibodies than mice immunised with the same

DNA vaccine containing the authentic kanR gene.

Although this present study demonstrated that incorporating either a single, or

multiple, CpG-S motifs to DENV DNA vaccines may be a simple and effective

approach to increasing the immunogenicity of the vaccines, a number of studies have

demonstrated that CpG-S motifs may be species specific (Hartmann and Krieg,

2000; Krieg, 2002; Krieg et al., 1995), which suggested that relevant host-specific

CpG motifs would need to be incorporated in DNA vaccines. In addition, Krieg et

al., (1998) demonstrated that incorporating large numbers of CpG-S motifs into a

DNA vaccine did not increase the antigen-specific antibody responses in mice

following DNA immunisation. This may have been due to (i) the production of high

levels of type-1 IFNs and/or other pro-inflammatory cytokines by DNA-transfected

cells in vivo, which directly inhibited mRNA and protein synthesis of vaccine-

encoded antigens, and/or (ii) the elevated cytotoxic T cell responses due to excessive

CpG-S activation, which eliminated DNA-transfected cells resulting in decrease

antigen expression (Krieg et al., 1998; Sato et al., 1996; Yew et al., 2002). This

195

suggested that the ratio of CpG-S to CpG-N motifs in DNA vaccines may have to be

optimised experimentally to produce the desired increase in immune responses

following DNA immunisation.

In addition to DNA vaccines incorporating authentic DENV prM-E protein genes,

this present study developed a number of DNA vaccines incorporating DENV

hybrid-E protein genes derived from multiple DENV serotypes to evaluate if such

DNA vaccines could elicit neutralising antibody responses against multiple DENV

serotypes. The availability of such DNA vaccines would reduce the number of DNA

vaccines that would need to be included in a vaccine formulation to provide effective

protection against all four DENV serotypes. This also would reduce the cost of the

vaccine and facilitate its development and application in less developed countries.

Currently, only one study has described the development of an intertypic DENV

hybrid-E protein, which was expressed in baculoviruses and consisted of domains I

and II of DENV-2 and domain III of DENV-3 without the stem-anchor region

(Bielefeldt-Ohmann et al., 1997). However, outbred mice immunised with this

hybrid-E protein produced only low titres of anti-DENV-2 neutralising antibodies,

despite the presence of both DENV-2 and DENV-3 specific antibody responses in

immunised mice and the presence of characterised DENV-2 and DENV-3 specific

neutralisation epitopes located on domains I and II of DENV-2 (Jianmin et al., 1995;

Lok et al., 2001), and domain III of DENV-3 (Serafin and Aaskov, 2001)

respectively.

Mice immunised with the pVAX-C2M1E122 hybrid-E DNA vaccine produced

strong neutralising antibody responses against both DENV-1 and DENV-2 (highest

titres of ≥160 and 40 respectively), which suggested that this DNA vaccine may

provide concurrent protective immunity against both DENV-1 and DENV-2. In

addition, mice immunised with the pVAX-C2M3E344 hybrid-E DNA vaccine

produced strong neutralising antibody responses against both DENV-3 and DENV-4

(highest titres of 40), which suggested that this DNA vaccine may provide

concurrent protective immunity against both DENV-3 and DENV-4.

196

In contrast, mice immunised with the other pVAX-Hybrid-E DNA vaccines failed to

produce high titres of neutralising antibodies against multiple DENV serotypes,

despite the retention of conformational cross-reactive and homotypic epitopes on the

prM/M and hybrid-E proteins expressed by these hybrid-E DNA vaccines. The

reason for this is not entirely clear. However, the prM/M and/or hybrid-E proteins

expressed by these DNA vaccines may have contained subtle conformational

changes due to the presence of heterologous DENV protein sequences, which

subsequently reduced their antigenicity in mice. It is possible that the development

of DNA vaccines incorporating hybrid-E protein genes derived from other

combinations of DENV serotypes would identify additional DNA vaccines that also

could elicit high titres of neutralising antibodies against multiple DENV serotypes in

mice. However, this was not feasible in the time available for this study.

Mice immunised with a number of the pVAX-Hybrid-E DNA vaccines also

produced high titres of neutralising antibodies against individual DENV serotypes.

Mice immunised with pVAX-C2M1E122, pVAX-C2M2E122 or pVAX-C2M2E211

produced high titres of anti-DENV-1 neutralising antibodies (titres of ≥160,

FFURNT50), which were comparable to the titres of anti-DENV-1 neutralising

antibodies elicited in mice immunised with pVAX-DEN1. In addition, mice

immunised with pVAX-C2M1E122 produced higher titres of anti-DENV-2

neutralising antibodies than mice immunised with pVAX-DEN2. Similarly, mice

immunised with pVAX-C2M3E344, pVAX-C2M4E434 or pVAX-C2M4E433

produced higher titres of anti-DENV-4 neutralising antibodies than mice immunised

with pVAX-DEN4. These results suggested that these pVAX-Hybrid-E DNA

vaccines could provide effective protection against infection by the corresponding

DENV serotypes.

However, the observation that mice immunised with a number of the pVAX-Hybrid-

E DNA vaccines produced higher titres of anti-DENV-2 or anti-DENV-4

neutralising antibodies than mice immunised with pVAX-DEN2 or pVAX-DEN4

respectively, which encoded the complete prM-E protein genes of the corresponding

DENV serotype, was unexpected. The reason for this is unclear, but the following

possibilities could be considered. Mice immunised with pVAX-DEN2 or pVAX-

DEN4 may have produced non-neutralising antibodies which inhibited the binding of

197

neutralising antibodies to the corresponding DENV. In contrast, mice immunised

with the pVAX-Hybrid-E DNA vaccines failed to produce antibodies that inhibited

antibody-mediated virus neutralisation. This mechanism of antibody-mediated

neutralisation inhibition was described by Burton et al., (2001), and has been

reported for African swine fever virus (Gomez-Puertas and Escribano, 1997), Equine

infectious anaemia virus (O'Rourke et al., 1988) and mouse mammary tumour virus

(Massey and Schochetman, 1981).

Alternatively, mice immunised with the pVAX-Hybrid-E DNA vaccines may have

produced antibodies that triggered subtle conformational changes to the DENV-2

and DENV-4 virions, which resulted in either (i) the exposure of neutralisation

epitopes on the viruses that were previously inaccessible for antibody-mediated virus

neutralisation, or (ii) enabled the viruses to be neutralised by the binding of

antibodies that were previously non-neutralising. Mice immunised with the pVAX-

Hybrid-E DNA vaccines also may have produced antibodies with higher affinities

for DENV-2 or DENV-4 than mice immunised with pVAX-DEN2 or pVAX-DEN4

respectively, which increased the ability of the antibodies to neutralise the

corresponding viruses.

198

CONCLUSION

In conclusion, this study has developed a number of DNA vaccines for each of the

four DENV serotypes and evaluated their immunogenicity in outbred mice. A

number of superior DNA vaccines against each of the four DENV serotypes were

identified based on their ability to elicit high titres (titre of ≥40, FFURNT50) of

neutralising antibodies against the corresponding DENV in mice. The superior DNA

vaccines against DENV-1 were pVAX-DEN1, pVAX-C2M2E211, pVAX-

C2M2E122 and pVAX-C2M1E122. The superior DNA vaccine against DENV-2

was pVAX-C2M1E122 and the superior DNA vaccines against DENV-3 were

pVAX-DEN3 and pVAX-C2M3E344. The superior DNA vaccines against DENV-4

were pVAX-C2M3E344, pVAX-C2M4E434 and pVAX-C2M4E433. Each of these

DNA vaccines could provide effective protection against infection by the

corresponding DENV serotypes. This is the first study to describe the development

of DNA vaccines against DENV-3 and DENV-4.

In addition, the pVAX-C2M1E122 hybrid-E DNA vaccine elicited high neutralising

antibody responses against both DENV-1 and DENV-2 in mice, which suggested

that this DNA vaccine could provide effective concurrent protection against infection

by DENV-1 and DENV-2. The pVAX-C2M3E344 hybrid-E DNA vaccine also

elicited high neutralising antibody responses against both DENV-3 and DENV-4 in

mice, which suggested that this DNA vaccine could provide effective concurrent

protection against infection by DENV-3 and DENV-4. Future studies will need to

evaluate whether the co-immunisation of these two hybrid-E DNA vaccines could

elicit an effective tetravalent neutralising antibody response to provide protection

against each of the four DENV serotypes.

Alternatively, the development of the pVAX-C2M1E122 and pVAX-C2M4E434

hybrid-E DNA vaccines, which were capable of inducing high titres of anti-DENV-2

and anti-DENV-4 neutralising antibodies in mice respectively, could form the basis

for an effective tetravalent DENV DNA vaccine. The incorporation of these two

hybrid-E DNA vaccines with the pVAX-DEN1 and pVAX-DEN3 DNA vaccines

into a tetravalent formulation also will need to be investigated in future studies.

199

In addition, this study demonstrated that increasing the CpG-S content of DNA

vaccines could present a simple and effective approach to improving the

immunogenicity of DENV DNA vaccines. Therefore, future studies also will need to

investigate whether the immunogenicity of the other DNA vaccines developed in this

present study could be increased by increasing the ratio of CpG-S to CpG-N motifs.

Attempts also could be made to develop additional DENV hybrid-E DNA vaccines

incorporating other combinations of DENV serotypes to identify other hybrid-E

DNA vaccines that could elicit strong neutralising antibody responses against

multiple DENV serotypes.

The development of DNA vaccines against DENV is desirable due to their safety,

stability and low cost of manufacture. This would facilitate their use in less

developed countries where DENV infections are most prevalent. In addition, DENV

DNA vaccines are easy and inexpensive to manipulate if vaccines are needed to

provide immunity against emerging strains of DENV. DENV DNA vaccines also are

more stable and would require less safety evaluation than a vaccine incorporating

live attenuated DENV. Therefore, the results presented in this study suggested that

DNA immunisation should continue to be investigated as a method for developing an

effective DENV vaccine for human use.

200

APPENDIX A:

BUFFERS AND REAGENTS

A.1 GENERAL BUFFERS AND REAGENTS

AGAROSE GEL LOADING BUFFER (6X CONCENTRATION)

0.0125g Bromophenol Blue

0.0125g Xylene Cyanol FF

1.875ml 80% glycerol

1.5ml 0.5M EDTA (pH 8.0)

Dissolve to 5ml with sterile distilled water.

BORATE SALINE

80ml 1.5M NaCl

100ml 0.5M Boric acid

24ml 1M NaOH

Dilute to 1 litre with sterile distilled water.

CELL LYSATE EXTRACTION

0.5ml 1M Tris-HCl (pH 7.5)

1.5ml 5M NaCl

0.5ml Triton X-100

1 tablet Protease inhibitor

Dissolve to 50ml with sterile distilled water.

PHOSPHATE BUFFERED SALINE (PBS)

8g NaCl

0.2g KCl

1.44g Na2HPO4

0.24g KH2PO4

Adjust pH to 7.4 and dissolve to 1L with sterile distilled water.

201

POLYETHYLENE GLYCOL

400g PEG 6000

150g NaCl

Dissolve to 1 litre with sterile distilled water and autoclave. Shake vigorously before

storage at 40C.

TRIETHANOLAMINE (TAN)

100ml 0.5M Triethanolamine (pH 8.0)

20ml 5M NaCl

Dilute to 1L with sterile distilled water.

TRIS BUFFERED SALINE (TBS)

50ml 1M Tris-HCl (pH 7.5)

30ml 5M NaCl

Dilute to 1L with sterile distilled water.

TRIS GLYCINE

3.03g Tri Base

18.77g Glycine

10ml 10% SDS

Dissolve to 1L with sterile distilled water.

202

A.2 BUFFERS AND REAGENTS FOR CLONING AND PURIFICATION OF

DNA PLASMIDS

LB MEDIA (with agar)

10g Tryptone

5g Yeast Extract

10g NaCl

15g Agar (with agar)

Adjust pH to 7.0. Dissolve to 1 litre with sterile distilled water and autoclave.

CELL RESUSPENSION

12.5ml 1M Glucose (filtered sterilised)

6.25ml 1M Tris-HCl (pH 8.0)

5ml 0.5M EDTA (pH 8.0)

Dilute to 250ml with sterile distilled water.

CELL LYSIS

1ml 10% SDS

0.4ml 5M NaOH


POTASSIUM ACETATE

60ml 5M Potassium acetate (pH 4.8)

11.5ml Glacial acetic acid


203

A.3 BUFFERS AND REAGENTS FOR POLYACRYLAMIDE GEL

ELECTROPHORESIS AND WESTERN BLOTTING

POLYACRYLAMIDE GEL

5% Stacking 12% Resolving

40% acrylamide:bisacrylamide (29:1) 0.63ml 3ml

1.0M Tris-HCl (pH 6.8) 0.63ml -

1.5M Tris-HCl (pH 8.8) - 2.5ml

10% SDS 0.05ml 0.1ml

10% Ammonium persulphate 0.05ml 0.1ml

Temed 5µl 10µl

Sterile distilled water 3.6ml 4.3ml

PAGE LOADING BUFFER (2X CONCENTRATION)

2ml 1M Tris-HCl (pH 6.8)

8ml 10% SDS

0.04g Bromophenol blue

5ml 80% glycerol

Dissolve to 20ml in sterile distilled water.

TRANSFER BUFFER

2.21g 3-Cyclohexylamino-1-propanesulfonic acid [pH 11]

100ml Methanol

0.1ml 10% SDS

Dissolve to 1L with sterile distilled water.

204

APPENDIX B:

DEDUCED DNA SEQUENCES OF pVAX-DEN AND pVAX-HYBRID-E DNA

VACCINES (EXCLUDING VECTOR SEQUENCE) pVAX-C2M1E122 1 ACCATGGGAA GGATGCTGAA CATCTTGAAC AGGAGACGCA GAACTGCAGG 50 pVAX-C2M2E122 1 .......... .......... .......... .......... .......... 50 pVAX-C2M2E211 1 .......... .......... .......... .......... .......... 50 pVAX-C2M2E212 1 .......... .......... .......... .......... .......... 50 pVAX-C2M2E322 1 .......... .......... .......... .......... .......... 50 pVAX-C2M3E344 1 .......... .......... .......... .......... .......... 50 pVAX-C2M4E433 1 .......... .......... .......... .......... .......... 50 pVAX-C2M4E434 1 .......... .......... .......... .......... .......... 50 pVAX-DEN1 1 .......C.. AC...T...G ...AA....T ..A...AAA. ..T...TGAC 50 pVAX-DEN2 1 .......... .......... .......... .......... .......... 50 pVAX-DEN3 1 .......C.. AC.......G ...TA.C... .AAC.GAAA. AG..AT.GCT 50 pVAX-DEN4 1 ........CC .C........ .........T G.A...AAA. .GT.AA..AT 50 CprM pVAX-C2M1E122 51 CATGATCATT ATGCT-GATT CCAACAGTGA TGGCGTTCCA TCTGACCACA 100 pVAX-C2M2E122 51 .......... .....-.... .......... .......... .T.A...... 100 pVAX-C2M2E211 51 .......... .....-.... .......... .......... .T.A...... 100 pVAX-C2M2E212 51 .......... .....-.... .......... .......... .T.A...... 100 pVAX-C2M2E322 51 .......... .....-.... .......... .......... .T.A...... 100 pVAX-C2M3E344 51 .......... .....-.... .......... .......... CT.A..TT.. 100 pVAX-C2M4E433 51 .......... .....-.... .......... .......TTC CT..T.A... 100 pVAX-C2M4E434 51 .......... .....-.... .......... .......TTC CT..T.A... 100 pVAX-DEN1 51 ....C..C.. .....-.C.G ..C....CCC .......... .......... 100 pVAX-DEN2 51 .......... .....-.... .......... .......... .T.A...... 100 pVAX-DEN3 51 .TGTC....G ...A.-.T.A ...G..ACAC .T..T..... CT.A..TT.. 100 pVAX-DEN4 51 G.C-..TGC. G....T.... ..C..C.CA. .......T.. CT..T.A... 100 pVAX-C2M1E122 101 CGAGGGGGAG AGCCGCACAT GATAGTTAGC AAGCAGGAAA GAGGAAAGTC 150 pVAX-C2M2E122 101 ..TAAC.... .A..A..... ...C..C..T .GA..A..G. A...G..AAG 150 pVAX-C2M2E211 101 ..TAAC.... .A..A..... ...C..C..T .GA..A..G. A...G..AAG 150 pVAX-C2M2E212 101 ..TAAC.... .A..A..... ...C..C..T .GA..A..G. A...G..AAG 150 pVAX-C2M2E322 101 ..TAAC.... .A..A..... ...C..C..T .GA..A..G. A...G..AAG 150 pVAX-C2M3E344 101 ....AT.... ......G... ...T..GG.G ...A.T.... .......A.. 150 pVAX-C2M4E433 101 A...AT..C. .A..C.TT.. ......GGCA ..A..C.... .G..G.GAC. 150 pVAX-C2M4E434 101 A...AT..C. .A..C.TT.. ......GGCA ..A..C.... .G..G.GAC. 150 pVAX-DEN1 101 .......... .......... .......... .......... .......... 150 pVAX-DEN2 101 ..TAAC.... .A..A..... ...C..C..T .GA..A..G. A...G..AAG 150 pVAX-DEN3 101 ....AT.... ......G... ...T..GG.G ...A.T.... .......A.. 150 pVAX-DEN4 101 A...AT..C. .A..C.TT.. ......GGCA ..A..C.... .G..G.GAC. 150 pVAX-C2M1E122 151 ACTTTTGTTT AAGACCTCTG CAGGTGTCAA CATGTGCACC ATTATTGCGA 200 pVAX-C2M2E122 151 T...C..... ..A..AGAG. AT.....G.. ......T... C.C..G..C. 200 pVAX-C2M2E211 151 T...C..... ..A..AGAG. AT.....G.. ......T... C.C..G..C. 200 pVAX-C2M2E212 151 T...C..... ..A..AGAG. AT.....G.. ......T... C.C..G..C. 200 pVAX-C2M2E322 151 T...C..... ..A..AGAG. AT.....G.. ......T... C.C..G..C. 200 pVAX-C2M3E344 151 C..AC.T... .....AG.CT .T..AA.... .........A C.C..A..C. 200 pVAX-C2M4E433 151 T..C...... .....AA.A. AG..AA.... ..AA.....T C...A...C. 200 pVAX-C2M4E434 151 T..C...... .....AA.A. AG..AA.... ..AA.....T C...A...C. 200 pVAX-DEN1 151 .......... .......... .......... .......... .......... 200 pVAX-DEN2 151 T...C..... ..A..AGAG. AT.....G.. ......T... C.C..G..C. 200 pVAX-DEN3 151 C..AC.T... .....AG.CT .T..AA.... .........A C.C..A..C. 200 pVAX-DEN4 151 T..C...... .....AA.A. AG..AA.... ..AA.....T C...A...C. 200

205

pVAX-C2M1E122 201 TGGATTTGGG AGAGTTATGT GAGGACACAA TGACCTACAA ATGCCCCCGG 250 pVAX-C2M2E122 201 ....CC.T.. T..A..G... ..C..T.... .C..G..... G..T..TTTT 250 pVAX-C2M2E211 201 ....CC.T.. T..A..G... ..A..T.... .C..G..... G..T..TTTT 250 pVAX-C2M2E212 201 ....CC.T.. T..A..G... ..A..T.... .C..G..... G..T..TTTT 250 pVAX-C2M2E322 201 ....CC.T.. T..A..G... ..A..T.... .C..G..... G..T..TTTT 250 pVAX-C2M3E344 201 .......... ....A.G... ..T.....GG .C..T..... ........AC 250 pVAX-C2M4E433 201 ....CC.... T..AA.G... ........CG .C..G..TG. ......T.TA 250 pVAX-C2M4E434 201 ....CC.... T..AA.G... ........CG .C..G..TG. ......T.TA 250 pVAX-DEN1 201 .......... .......... .......... .......... .......... 250 pVAX-DEN2 201 ....CC.T.. T..A..G... ..A..T.... .C..G..... G..T..TTTT 250 pVAX-DEN3 201 .......... ....A.G... ..T.....GG .C..T..... ........AC 250 pVAX-DEN4 201 ....CC.... T..AA.G... ........CG .C..G..TG. ......T.TA 250 pVAX-C2M1E122 251 ATCACTAAGG CGGAACCAGA TGACGTTGAC TGTTGGTGCA ATGCCACGGA 300 pVAX-C2M2E122 251 C...GGC..A AT........ A...A.A..T .......... .CT.T...TC 300 pVAX-C2M2E211 251 C...GGC..A AT........ A...A.A..T .......... .CT.T...TC 300 pVAX-C2M2E212 251 C...GGC..A AT........ A...A.A..T .......... .CT.T...TC 300 pVAX-C2M2E322 251 C...GGC..A AT........ A...A.A..T .......... .CT.T...TC 300 pVAX-C2M3E344 251 ..T..CG.A. T...G..T.. A...A..... ..C....... .CCTT..ATC 300 pVAX-C2M4E433 251 C.GGTC..TA .C.....T.. G...A....T ..C....... ..CT....TC 300 pVAX-C2M4E434 251 C.GGTC..TA .C.....T.. G...A....T ..C....... ..CT....TC 300 pVAX-DEN1 251 .......... .......... .......... .......... .......... 300 pVAX-DEN2 251 C...GGC..A AT........ A...A.A..T .......... .CT.T...TC 300 pVAX-DEN3 251 ..T..CG.A. T...G..T.. A...A..... ..C....... .CCTT..ATC 300 pVAX-DEN4 251 C.GGTC..TA .C.....T.. G...A....T ..C....... ..CT....TC 300 pVAX-C2M1E122 301 CACATGGGTG ACCTATGGAA CGTGTTCTCG AACTGGCGAA CACCGACGAG 350 pVAX-C2M2E122 301 .........A ..T.....G. .....A.CAC C..A..A... ...A..A... 350 pVAX-C2M2E211 301 .........A ..T.....G. .....A.CAC C..A..A... ...A..A... 350 pVAX-C2M2E212 301 .........A ..T.....G. .....A.CAC C..A..A... ...A..A... 350 pVAX-C2M2E322 301 .........A ..T.....G. .....A.CAC C..A..A... ...A..A... 350 pVAX-C2M3E344 301 G......... ..T....... .A..CAA..A .G....A..G ..TA....C. 350 pVAX-C2M4E433 301 TG.C.....C .TG.....G. .A..CA...A G.G...G... .GGA....G. 350 pVAX-C2M4E434 301 TG.C.....C .TG.....G. .A..CA...A G.G...G... .GGA....G. 350 pVAX-DEN1 301 .......... .......... .......... .......... .......... 350 pVAX-DEN2 301 .........A ..T.....G. .....A.CAC C..A..A... ...A..A... 350 pVAX-DEN3 301 G......... ..T....... .A..CAA..A .G....A..G ..TA....C. 350 pVAX-DEN4 301 TG.C.....C .TG.....G. .A..CA...A G.G...G... .GGA....G. 350 M pVAX-C2M1E122 351 ACAAGCGTTC CGTCGCACTG GCCCCACATG TGGGGCTTGG TCTAGAAACA 400 pVAX-C2M2E122 351 .A..AA.A.. A..G.....C .TT....... ....AA.G.. A..G..G... 400 pVAX-C2M2E211 351 .A..AA.A.. A..G.....C .TT....... ....AA.G.. A..G..G... 400 pVAX-C2M2E212 351 .A..AA.A.. A..G.....C .TT....... ....AA.G.. A..G..G... 400 pVAX-C2M2E322 351 .A..AA.A.. A..G.....C .TT....... ....AA.G.. A..G..G... 400 pVAX-C2M3E344 351 .T...A.A.. A..G..GT.A ..T..C.... .C..CA.G.. A..G..C... 400 pVAX-C2M4E433 351 .G.....C.. A..A..C..A A.A......T CA..AA.G.. AT.G..G... 400 pVAX-C2M4E434 351 .G.....C.. A..A..C..A A.A......T CA..AA.G.. AT.G..G... 400 pVAX-DEN1 351 .......... .......... .......... .......... .......... 400 pVAX-DEN2 351 .A..AA.A.. A..G.....C .TT....... ....AA.G.. A..G..G... 400 pVAX-DEN3 351 .T...A.A.. A..G..GT.A ..T..C.... .C..CA.G.. A..G..C... 400 pVAX-DEN4 351 .G.....C.. A..A..C..A A.A......T CA..AA.G.. AT.G..G... 400 pVAX-C2M1E122 401 AGAGCCGAAA CGTGGATGTC CTCTGAAGGC GCTTGGAAAC AAATACAAAA 450 pVAX-C2M2E122 401 C..A.T.... .A........ A..A.....G ..C....... .TGCC..G.G 450 pVAX-C2M2E211 401 C..A.T.... .A........ A..A.....G ..C....... .TGCC..G.G 450 pVAX-C2M2E212 401 C..A.T.... .A........ A..A.....G ..C....... .TGCC..G.G 450 pVAX-C2M2E322 401 C..A.T.... .A........ A..A.....G ..C....... .TGCC..G.G 450 pVAX-C2M3E344 401 C.CA.TC... .C........ GG.......A .......G.. ..G.CG.G.. 450 pVAX-C2M4E433 401 ..G..T..G. .A........ A..G.....G .......... .TGCT..G.G 450 pVAX-C2M4E434 401 ..G..T..G. .A........ A..G.....G .......... .TGCT..G.G 450 pVAX-DEN1 401 .......... .......... .......... .......... .......... 450 pVAX-DEN2 401 C..A.T.... .A........ A..A.....G ..C....... .TGCC..G.G 450 pVAX-DEN3 401 C.CA.TC... .C........ GG.......A .......G.. ..G.CG.G.. 450 pVAX-DEN4 401 ..G..T..G. .A........ A..G.....G .......... .TGCT..G.G 450

206

pVAX-C2M1E122 451 AGTGGAGACT TGGGCTCTGA GACACCCAGG ATTCACGGTA ATAGCCCTCT 500 pVAX-C2M2E122 451 .A.T..A... ...ATCT... ....T..... C..T..CA.. ..G..AGCAA 500 pVAX-C2M2E211 451 .A.T..A... ...ATCT... ....T..... C..T..CA.. ..G..AGCAA 500 pVAX-C2M2E212 451 .A.T..A... ...ATCT... ....T..... C..T..CA.. ..G..AGCAA 500 pVAX-C2M2E322 451 .A.T..A... ...ATCT... ....T..... C..T..CA.. ..G..AGCAA 500 pVAX-C2M3E344 451 G..A.....A .....C..T. .G........ G..T..CA.. C.......A. 500 pVAX-C2M4E433 451 G..A....G. ...ATA..C. ..A....... ....G.TC.C T.G..AGGA. 500 pVAX-C2M4E434 451 G..A....G. ...ATA..C. ..A....... ....G.TC.C T.G..AGGA. 500 pVAX-DEN1 451 .......... .......... .......... .......... .......... 500 pVAX-DEN2 451 .A.T..A... ...ATCT... ....T..... C..T..CA.. ..G..AGCAA 500 pVAX-DEN3 451 G..A.....A .....C..T. .G........ G..T..CA.. C.......A. 500 pVAX-DEN4 451 G..A....G. ...ATA..C. ..A....... ....G.TC.C T.G..AGGA. 500 pVAX-C2M1E122 501 TTCTAGCACA TGCCATAGGA ACATCCATCA CCCAGAAAGG GATTATTTTC 550 pVAX-C2M2E122 501 .C..G...T. CA........ ..GA.ACATT T...A.G..C CC.G...... 550 pVAX-C2M2E211 501 .C..G...T. CA........ ..GA.ACATT T...A.G..C CC.G...... 550 pVAX-C2M2E212 501 .C..G...T. CA........ ..GA.ACATT T...A.G..C CC.G...... 550 pVAX-C2M2E322 501 .C..G...T. CA........ ..GA.ACATT T...A.G..C CC.G...... 550 pVAX-C2M3E344 501 ....T..C.. .TA......C ..T...T.G. .........T .G.......T 550 pVAX-C2M4E433 501 ..A.G..CT. .ATG..T..G CA.A.AGGA. T....CG.AC AG.CT.C..T 550 pVAX-C2M4E434 501 ..A.G..CT. .ATG..T..G CA.A.AGGA. T....CG.AC AG.CT.C..T 550 pVAX-DEN1 501 .......... .......... .......... .......... .......... 550 pVAX-DEN2 501 .C..G...T. CA........ ..GA.ACATT T...A.G..C CC.G...... 550 pVAX-DEN3 501 ....T..C.. .TA......C ..T...T.G. .........T .G.......T 550 pVAX-DEN4 501 ..A.G..CT. .ATG..T..G CA.A.AGGA. T....CG.AC AG.CT.C..T 550 ME,I pVAX-C2M1E122 551 ATTTTGTTGA TGCTGGTAAC ACCATCCATG GCCATGCGAT GCGTGGGAAT 600 pVAX-C2M2E122 551 ..C..AC... CAGCT..CG. T..T..A... A.A....... .......... 600 pVAX-C2M2E211 551 ..C..AC... CAGCT..CG. T..T..A... A.A.....T. ..A.A..... 600 pVAX-C2M2E212 551 ..C..AC... CAGCT..CG. T..T..A... A.A.....T. ..A.A..... 600 pVAX-C2M2E322 551 ..C..AC... CAGCT..CG. T..T..A... A.A...A... .T......G. 600 pVAX-C2M3E344 551 ..AC.A..A. .......T.. C......... A.A...A... .T......G. 600 pVAX-C2M4E433 551 G..C.AA... .......CG. C......TAC .GA....... ........G. 600 pVAX-C2M4E434 551 G..C.AA... .......CG. C......TAC .GA....... ........G. 600 pVAX-DEN1 551 .......... .......... .......... .......... .......... 600 pVAX-DEN2 551 ..C..AC... CAGCT..CG. T..T..A... A.A.....T. ..A.A..... 600 pVAX-DEN3 551 ..AC.A..A. .......T.. C......... A.A...A... .T......G. 600 pVAX-DEN4 551 G..C.AA... .......CG. C......TAC .GA....... ........G. 600 pVAX-C2M1E122 601 AGGCAACAGA GACTTCGTGG AAGGACTGTC AGGAGCAACG TGGGTGGATG 650 pVAX-C2M2E122 601 .......... .......... .......... .......... .......... 650 pVAX-C2M2E211 601 .TCA..T... .....T..A. ....GG.T.. .....G..GC .....T..CA 650 pVAX-C2M2E212 601 .TCA..T... .....T..A. ....GG.T.. .....G..GC .....T..CA 650 pVAX-C2M2E322 601 ...A...... ..T..T.... ....T..A.. G.....T... .....T..C. 650 pVAX-C2M3E344 601 ...A...... ..T..T.... ....C..A.. G.....T... .....T..C. 650 pVAX-C2M4E433 601 G..G...... .....T.... .....G.C.. ...T.G.G.A .....C...T 650 pVAX-C2M4E434 601 G..G...... .....T.... .....G.C.. ...T.G.G.A .....C...T 650 pVAX-DEN1 601 .......... .......... .......... .......... .......... 650 pVAX-DEN2 601 .TCA..T... .....T..A. ....GG.T.. .....G..GC .....T..CA 650 pVAX-DEN3 601 ...A...... ..T..T.... ....C..A.. G.....T... .....T..C. 650 pVAX-DEN4 601 G..G...... .....T.... .....G.C.. ...T.G.G.A .....C...T 650 pVAX-C2M1E122 651 TGGTACTGGA GCATGGAAGT TGCGTCACCA CCATGGCAAA AGATAAACCA 700 pVAX-C2M2E122 651 .......... .......... .......... .......... .......... 700 pVAX-C2M2E211 651 .A..CT.A.. A........C ..T..G..G. .G........ .A.C...... 700 pVAX-C2M2E212 651 .A..CT.A.. A........C ..T..G..G. .G........ .A.C...... 700 pVAX-C2M2E322 651 ....G..C.. ...C..TG.G ..T..G.... .......T.. GA.C..G..C 700 pVAX-C2M3E344 651 ....G..C.. ...C..TG.G ..T..G..T. .......T.. GA.C..G..C 700 pVAX-C2M4E433 651 ....G..A.. A......G.A ..T.....A. .......CC. G.GA...... 700 pVAX-C2M4E434 651 ....G..A.. A......G.A ..T.....A. .......CC. G.GA...... 700 pVAX-DEN1 651 .......... .......... .......... .......... .......... 700 pVAX-DEN2 651 .A..CT.A.. A........C ..T..G..G. .G........ .A.C...... 700 pVAX-DEN3 651 ....G..C.. ...C..TG.G ..T..G..T. .......T.. GA.C..G..C 700 pVAX-DEN4 651 ....G..A.. A......G.A ..T.....A. .......CC. G.GA...... 700

207

E,IE,II pVAX-C2M1E122 701 ACATTGGACA TTGAACTCTT GAAGACGGAG GTCACAAAGC CTGCCGTCCT 750 pVAX-C2M2E122 701 .......... .......... .......... .......... .......... 750 pVAX-C2M2E211 701 ........TT .......GA. A..A..A..A .C..A.C.A. .....ACT.. 750 pVAX-C2M2E212 701 ........TT .......GA. A..A..A..A .C..A.C.A. .....ACT.. 750 pVAX-C2M2E322 701 ..GC....T. .A..G..TCA ......C... .C...CC.A. TG..GAC... 750 pVAX-C2M3E344 701 ..GC...... .A..G..TCA ......C... .C...TC.A. TG..GAC... 750 pVAX-C2M4E433 701 ..C.....TT .......GA. C.....AACA .C..AGG.AG TG..TC.GT. 750 pVAX-C2M4E434 701 ..C.....TT .......GA. C.....AACA .C..AGG.AG TG..TC.GT. 750 pVAX-DEN1 701 .......... .......... .......... .......... .......... 750 pVAX-DEN2 701 ........TT .......GA. A..A..A..A .C..A.C.A. .....ACT.. 750 pVAX-DEN3 701 ..GC...... .A..G..TCA ......C... .C...TC.A. TG..GAC... 750 pVAX-DEN4 701 ..C.....TT .......GA. C.....AACA .C..AGG.AG TG..TC.GT. 750 pVAX-C2M1E122 751 GCGTAAACTG TGCATTGAAG CTAAAATATC AAACACCACC ACCGATTCAA 800 pVAX-C2M2E122 751 .......... .......... .......... .......... .......... 800 pVAX-C2M2E211 751 AA.G..GTAC ..T..A..G. .A..GC.GA. C.....A..G ..A.....TC 800 pVAX-C2M2E212 751 AA.G..GTAC ..T..A..G. .A..GC.GA. C.....A..A ..A.....TC 800 pVAX-C2M2E322 751 AA.G..GT.A ........G. GA.....TA. C....TA..A ..T..C.... 800 pVAX-C2M3E344 751 AA.G..G..A ........G. GA.....TA. C....TA..A .....C.... 800 pVAX-C2M4E433 751 AA.A.CCTAT .......... .CTCG..... .....TA... ..G.CAA... 800 pVAX-C2M4E434 751 AA.A.CCTAT .......... .CTCG..... .....TA... ..G.CAA... 800 pVAX-DEN1 751 .......... .......... .......... .......... .......... 800 pVAX-DEN2 751 AA.G..GTAC ..T..A..G. .A..GC.GA. C.....A..A ..A.....TC 800 pVAX-DEN3 751 AA.G..G..A ........G. GA.....TA. C....TA..A .....C.... 800 pVAX-DEN4 751 AA.A.CCTAT .......... .CTCG..... .....TA... ..G.CAA... 800 pVAX-C2M1E122 801 GATGTCCAAC ACAAGGGGAA GCCACACTGG TGGAAGAACA AGACGCGAAC 850 pVAX-C2M2E122 801 .......... .......... .......... .......... .......... 850 pVAX-C2M2E211 801 .C..C..... ......A... C...GC..AA AT.....G.. G...AAA.GG 850 pVAX-C2M2E212 801 .C..C..... ......A... C...GC..AA AT.....G.. G...AAA.GG 850 pVAX-C2M2E322 801 .G.....T.. C..G...... ..G.TTT.AC CA..G..G.. G...CA.... 850 pVAX-C2M3E344 801 .......C.. C......... ..G.TTT.AC CT..G..G.. G...CA...A 850 pVAX-C2M4E433 801 .......... G.....A... C.TTAT..CA AA..G..... ...TCAAC.G 850 pVAX-C2M4E434 801 .......... G.....A... C.TTAT..CA AA..G..... ...TCAAC.G 850 pVAX-DEN1 801 .......... .......... .......... .......... .......... 850 pVAX-DEN2 801 .C..C..... ......A... C...GC..AA AT.....G.. G...AAA.GG 850 pVAX-DEN3 801 .......C.. C......... ..G.TTT.AC CT..G..G.. G...CA...A 850 pVAX-DEN4 801 .......... G.....A... C.TTAT..CA AA..G..... ...TCAAC.G 850 pVAX-C2M1E122 851 TTCGTGTGTC GACGAACGTT TGTGGACAGA GGCTGGGGCA ATGGCTGTGG 900 pVAX-C2M2E122 851 .......... .......... .......... .......... .......... 900 pVAX-C2M2E211 851 .....C..CA A..ACT.CA. G......... ..A.....A. ....A..... 900 pVAX-C2M2E212 851 .....C..CA A..ACT.CA. G......... ..A.....A. ....A..... 900 pVAX-C2M2E322 851 .A...A...A AG.AT..A.A C......... ........A. .C..T..... 900 pVAX-C2M3E344 851 .A.......A AG.AT..A.A C......... ........A. .C..T..... 900 pVAX-C2M4E433 851 .A.A.T..C. .GA..GATG. G..A...... ..G....... .......... 900 pVAX-C2M4E434 851 .A.A.T..C. .GA..GATG. G..A...... ..G....... .......... 900 pVAX-DEN1 851 .......... .......... .......... .......... .......... 900 pVAX-DEN2 851 .....C..CA A..ACT.CA. G......... ..A.....A. ....A..... 900 pVAX-DEN3 851 .A.......A AG.AT..A.A C......... ........A. .C..T..... 900 pVAX-DEN4 851 .A.A.T..C. .GA..GATG. G..A...... ..G....... .......... 900 pVAX-C2M1E122 901 GCTTTTCGGA AAAGGTAGCC TAATAACGTG TGCTAAGTTC AAGTGTGTGA 950 pVAX-C2M2E122 901 .......... .......... .......... .......... .......... 950 pVAX-C2M2E211 901 AT.A..T... .....AG..A .TG.G..C.. .....T.... .CA..CAAA. 950 pVAX-C2M2E212 901 AT.A..T... .....AG..A .TG.G..C.. .....T.... .CA..CAAA. 950 pVAX-C2M2E322 901 CT.G..T... .....A...T .GG.G..A.. C..G..A..T C.A...T.AG 950 pVAX-C2M3E344 901 TT.G..T..C ..G..A...T .GG.G..A.. C..G..A..T C.A...T.AG 950 pVAX-C2M4E433 901 CT.G..T..G .....AG.AG .TG.G..A.. ...G.....T TCA..CTC.G 950 pVAX-C2M4E434 901 CT.G..T..G .....AG.AG .TG.G..A.. ...G.....T TCA..CTC.G 950 pVAX-DEN1 901 .......... .......... .......... .......... .......... 950 pVAX-DEN2 901 AT.A..T... .....AG..A .TG.G..C.. .....T.... .CA..CAAA. 950 pVAX-DEN3 901 TT.G..T..C ..G..A...T .GG.G..A.. C..G..A..T C.A...T.AG 950 pVAX-DEN4 901 CT.G..T..G .....AG.AG .TG.G..A.. ...G.....T TCA..CTC.G 950

208

E,IIE,I pVAX-C2M1E122 951 CAAAACTGGA AGGAAAGATT GTTCAATATG AGAACTTGAA ATATTCAGTG 1000 pVAX-C2M2E122 951 .......... .......... .......... .......... .......... 1000 pVAX-C2M2E211 951 AG..CA..A. ......AG.C ..G...CCA. .A......G. ...CA.CA.T 1000 pVAX-C2M2E212 951 AG..CA..A. ......AG.C ..G...CCA. .A......G. ...CATCA.T 1000 pVAX-C2M2E322 951 A.TC.A.A.. G.....AG.G ..G...C... .....C.C.. ...CA.C..C 1000 pVAX-C2M3E344 951 A.TC.A.A.. G.....AG.G ..G...C... .....C.C.. ...CA.C..C 1000 pVAX-C2M4E433 951 GG..GA.AAC ...C..TT.G ..C...AT.. .....C.TG. ...CA....A 1000 pVAX-C2M4E434 951 GG..GA.AAC ...C..TT.G ..C...AT.. .....C.TG. ...CA....A 1000 pVAX-DEN1 951 .......... .......... .......... .......... .......... 1000 pVAX-DEN2 951 AG..CA..A. ......AG.C ..G...CCA. .A......G. ...CA.CA.T 1000 pVAX-DEN3 951 A.TC.A.A.. G.....AG.G ..G...C... .....C.C.. ...CA.C..C 1000 pVAX-DEN4 951 GG..GA.AAC ...C..TT.G ..C...AT.. .....C.TG. ...CA....A 1000 pVAX-C2M1E122 1001 ATAGTCACCG TCCACACTGG TGACCAGCAC CAGGTGGGAA ATGAGACCAC 1050 pVAX-C2M2E122 1001 .......... .......... .......... .......... .......... 1050 pVAX-C2M2E211 1001 G.GA.A..AC CT...T.A.. G..AG....T GCA..C.... ....C..AGG 1050 pVAX-C2M2E212 1001 G.GA.A..AC CT...T.A.. G..AG....T GCA..C.... ....C..AGG 1050 pVAX-C2M2E322 1001 ..CA.T..A. .G.....A.. A.....A... .......... ....------ 1050 pVAX-C2M3E344 1001 ..CA....A. .G.....A.. A.....A... .......... ....A..GC- 1050 pVAX-C2M4E433 1001 G.T..A..A. ......A... A...ACC..T GCA..A.... ....C.TAC. 1050 pVAX-C2M4E434 1001 G.T..A..A. ......A... A...ACC..T GCA..A.... ....C.TAC. 1050 pVAX-DEN1 1001 .......... .......... .......... .......... .......... 1050 pVAX-DEN2 1001 G.GA.A..AC CT...T.A.. G..AG....T GCA..C.... ....C..AGG 1050 pVAX-DEN3 1001 ..CA....A. .G.....A.. A.....A... .......... ....A..GC- 1050 pVAX-DEN4 1001 G.T..A..A. ......A... A...ACC..T GCA..A.... ....C.TAC. 1050 pVAX-C2M1E122 1051 AGAACATGGA ACAATTGCAA CCATAACACC TCAAGCTCCT ACGTCGGAAA 1100 pVAX-C2M2E122 1051 .......... .......... .......... .......... .......... 1100 pVAX-C2M2E211 1051 .A.......C .AGGAAATC. AA........ A..GAG.T.C .TCA.A...G 1100 pVAX-C2M2E212 1051 .A.......C .AGGAAATC. AA........ A..GAG.T.C .TCA.A...G 1100 pVAX-C2M2E322 1051 .ACG..G... GTC.CG..TG AG........ C..G..AT.A ..CGTT...G 1100 pVAX-C2M3E344 1051 -----.G... GTT.CG..TG AG......T. C..G..AT.A ..CG.T...G 1100 pVAX-C2M4E433 1051 CA.C...... GTG.CA..C. .G.....C.. CAGGT.A..A T..GTA...G 1100 pVAX-C2M4E434 1051 CA.C...... GTG.CA..C. .G.....C.. CAGGT.A..A T..GTA...G 1100 pVAX-DEN1 1051 .......... .......... .......... .......... .......... 1100 pVAX-DEN2 1051 .A.......C .AGGAAATC. AA........ A..GAG.T.C .TCA.A...G 1100 pVAX-DEN3 1051 -----.G... GTT.CG..TG AG......T. C..G..AT.A ..CG.T...G 1100 pVAX-DEN4 1051 CA.C...... GTG.CA..C. .G.....C.. CAGGT.A..A T..GTA...G 1100 pVAX-C2M1E122 1101 TACAGCTGAC CGACTACGGA GCTCTTACAT TGGATTGCTC ACCCAGAACA 1150 pVAX-C2M2E122 1101 .......... .......... .......... .......... .......... 1150 pVAX-C2M2E211 1101 C.G..T.... A.G...T..C A..G.C..GA ....G..... T..G.....G 1150 pVAX-C2M2E212 1101 C.G..T.... A.G...T..C A..G.C..GA ....G..... T..G.....G 1150 pVAX-C2M2E322 1101 CTATCT..C. T..A..T... A.C...GGGC .A..A..... ...AC.G... 1150 pVAX-C2M3E344 1101 CCATTT.AC. T..A..T... A.C..CGGGC .A..A..... ...AC.G... 1150 pVAX-C2M4E433 1101 .TA.AT.AC. G..T..T... .AAT.A...C .C.....TGA ......GT.C 1150 pVAX-C2M4E434 1101 .TA.AT.AC. G..T..T... .AAT.A...C .C.....TGA ......GT.C 1150 pVAX-DEN1 1101 .......... .......... .......... .......... .......... 1150 pVAX-DEN2 1101 C.G..T.... A.G...T..C A..G.C..GA ....G..... T..G.....G 1150 pVAX-DEN3 1101 CCATTT.AC. T..A..T... A.C..CGGGC .A..A..... ...AC.G... 1150 pVAX-DEN4 1101 .TA.AT.AC. G..T..T... .AAT.A...C .C.....TGA ......GT.C 1150 E,IE,II pVAX-C2M1E122 1151 GGGCTAGACT TTAATGAGAT GGTGTTGTTG ACAATGAAAG AAAAATCATG 1200 pVAX-C2M2E122 1151 .......... .......... .......... .......... .......... 1200 pVAX-C2M2E211 1151 ..C..C.... .C........ .......C.. CA....G..A .T...G.T.. 1200 pVAX-C2M2E212 1151 ..C..C.... .C........ .......C.. CA....G..A .T...G.T.. 1200 pVAX-C2M2E322 1151 ..TT.G..T. .C.....A.. .A.C..A... ........GA .C...G.... 1200 pVAX-C2M3E344 1151 ..TT.G..T. .C.....A.. .A.T..A... ........GA .C...G.... 1200 pVAX-C2M4E433 1151 ..AA.T..T. .......... .A.TC..A.. .A.......A .G...A.G.. 1200 pVAX-C2M4E434 1151 ..AA.T..T. .......... .A.TC..A.. .A.......A .G...A.G.. 1200 pVAX-DEN1 1151 .......... .......... .......... .......... .......... 1200 pVAX-DEN2 1151 ..C..C.... .C........ .......C.. CA....G..A .T...G.T.. 1200 pVAX-DEN3 1151 ..TT.G..T. .C.....A.. .A.T..A... ........GA .C...G.... 1200 pVAX-DEN4 1151 ..AA.T..T. .......... .A.TC..A.. .A.......A .G...A.G.. 1200

209

pVAX-C2M1E122 1201 GCTTGTCCAC AAACAATGGT TTCTAGACTT ACCACTGCCC TGGACCTCGG 1250 pVAX-C2M2E122 1201 .......... .......... .......... .......... .......... 1250 pVAX-C2M2E211 1201 ...G..G... .GG....... .C......C. G..GT....A ...CTGC.C. 1250 pVAX-C2M2E212 1201 ...G..G... .GG....... .C......C. G..GT....A ...CTGC.C. 1250 pVAX-C2M2E322 1201 .A.G..A..T .G........ .CT.T...C. ...T..A..A .....A..A. 1250 pVAX-C2M3E344 1201 .A.G..A..T .G........ .CT.T..... ...C..A..A .....A..A. 1250 pVAX-C2M4E433 1201 ......G... ..G....... ..T.G..TC. ...T..A..A ...G.AG.A. 1250 pVAX-C2M4E434 1201 ......G... ..G....... ..T.G..TC. ...T..A..A ...G.AG.A. 1250 pVAX-DEN1 1201 .......... .......... .......... .......... .......... 1250 pVAX-DEN2 1201 ...G..G... .GG....... .C......C. G..GT....A ...CTGC.C. 1250 pVAX-DEN3 1201 .A.G..A..T .G........ .CT.T..... ...C..A..A .....A..A. 1250 pVAX-DEN4 1201 ......G... ..G....... ..T.G..TC. ...T..A..A ...G.AG.A. 1250 pVAX-C2M1E122 1251 GAGCTTCAAC ACCCCAAGAG ACTTGGAACA GAGAAGATTT GCTGGTTACA 1300 pVAX-C2M2E122 1251 .......... .......... .......... .......... .......... 1300 pVAX-C2M2E211 1251 ....GGAC.. ..AAGG.TCA .A.....TAC AGA....GAC AT....C..T 1300 pVAX-C2M2E212 1251 ....GGAC.. ..AAGG.TCA .A.....TAC AGA....GAC AT....C..T 1300 pVAX-C2M2E322 1251 .....A.... .GAGAC.CCA ..C....... .GA....GC. T..T..G... 1300 pVAX-C2M3E344 1251 .....A.... .AAAAC.CCA .......... .GA....GC. T..T..G... 1300 pVAX-C2M4E433 1251 ....AGAC.. .T.AG...TT CA......TT ACA....GAG AA....G... 1300 pVAX-C2M4E434 1251 ....AGAC.. .T.AG...TT CA......TT ACA....GAG AA....G... 1300 pVAX-DEN1 1251 .......... .......... .......... .......... .......... 1300 pVAX-DEN2 1251 ....GGAC.. ..AAGG.TCA .A.....TAC AGA....GAC AT....C..T 1300 pVAX-DEN3 1251 .....A.... .AAAAC.CCA .......... .GA....GC. T..T..G... 1300 pVAX-DEN4 1251 ....AGAC.. .T.AG...TT CA......TT ACA....GAG AA....G... 1300 pVAX-C2M1E122 1301 TTTAAGACAG CTCATGCAAA GAAGCAGGAA GTAGTCGTAC TAGGATCACA 1350 pVAX-C2M2E122 1301 .......... .......... .......... .......... .......... 1350 pVAX-C2M2E211 1301 ..C..A.ATC .C.....G.. ...A.....T ..T..T..TT .G.....C.. 1350 pVAX-C2M2E212 1301 ..C..A.ATC .C.....G.. ...A.....T ..T..T..TT .G.....C.. 1350 pVAX-C2M2E322 1301 ..C..A.AT. .A........ A..A..A... ........C. .T.....G.. 1350 pVAX-C2M3E344 1301 .....A.AT. .A........ A.....A... .....T..C. .T........ 1350 pVAX-C2M4E433 1301 ..C...GTTC .......C.. ..GA.....T ..GACA..G. .......T.. 1350 pVAX-C2M4E434 1301 ..C...GTTC .......C.. ..GA.....T ..GACA..G. .......T.. 1350 pVAX-DEN1 1301 .......... .......... .......... .......... .......... 1350 pVAX-DEN2 1301 ..C..A.ATC .C.....G.. ...A.....T ..T..T..TT .G.....C.. 1350 pVAX-DEN3 1301 .....A.AT. .A........ A.....A... .....T..C. .T........ 1350 pVAX-DEN4 1301 ..C...GTTC .......C.. ..GA.....T ..GACA..G. .......T.. 1350 pVAX-C2M1E122 1351 AGAAGGAGCA ATGCACACTG CGTTGACCGG AGCGACAGAA ATCCAAACGT 1400 pVAX-C2M2E122 1351 .......... .......... .......... .......... .......... 1400 pVAX-C2M2E211 1351 ......G..C ........A. .AC.C..A.. G..C...... .....G.T.. 1400 pVAX-C2M2E212 1351 ......G..C ........A. .AC.C..A.. G..C...... .....G.T.. 1400 pVAX-C2M2E322 1351 ...G...... .....T..A. ..C....A.. ...T.....G ..T....AC. 1400 pVAX-C2M3E344 1351 ...G...... .....T..A. .AC....A.. ...T.....G ........C. 1400 pVAX-C2M4E433 1351 G........C .....TT... .CC.C..... ...T...... G.GG.TT.CG 1400 pVAX-C2M4E434 1351 G........C .....TT... .CC.C..... ...T...... G.GG.TT.CG 1400 pVAX-DEN1 1351 .......... .......... .......... .......... .......... 1400 pVAX-DEN2 1351 ......G..C ........A. .AC.C..A.. G..C...... .....G.T.. 1400 pVAX-DEN3 1351 ...G...... .....T..A. .AC....A.. ...T.....G ........C. 1400 pVAX-DEN4 1351 G........C .....TT... .CC.C..... ...T...... G.GG.TT.CG 1400 E,IIE,I pVAX-C2M1E122 1401 CTGGAACGAC AAAAATTTTT GCAGGACACT TGAAATGTAG ACTAAAAATG 1450 pVAX-C2M2E122 1401 .......... .......... .......... .......... .......... 1450 pVAX-C2M2E211 1401 .ATC.GGA.A CTT.C.G..C A.......TC .C..G..C.. G..G.GG... 1450 pVAX-C2M2E212 1401 .ATC.GGA.A CTT.C.G..C A.......TC .C..G..C.. G..G.GG... 1450 pVAX-C2M2E322 1401 .A...GGC.. ..GC...... ..G..G.... .......... ...T..G... 1450 pVAX-C2M3E344 1401 .A...GGC.. ..GT...... ..G..G.... .A........ ...C..G... 1450 pVAX-C2M4E433 1401 G..ATGGA.A CC.C..G... ........TC .......C.A .G.TCGC... 1450 pVAX-C2M4E434 1401 G..ATGGA.A CC.C..G... ........TC .......C.A .G.TCGC... 1450 pVAX-DEN1 1401 .......... .......... .......... .......... .......... 1450 pVAX-DEN2 1401 .ATC.GGA.A CTT.C.G..C A.......TC .C..G..C.. G..G.GG... 1450 pVAX-DEN3 1401 .A...GGC.. ..GT...... ..G..G.... .A........ ...C..G... 1450 pVAX-DEN4 1401 G..ATGGA.A CC.C..G... ........TC .......C.A .G.TCGC... 1450

210

E,IE,III pVAX-C2M1E122 1451 AACAAACTGA CCTTAAAAGG AATGTCATAC TCTATGTGCA CAGGAAAGTT 1500 pVAX-C2M2E122 1451 .......... .......... .......... .......... .......... 1500 pVAX-C2M2E211 1451 G.......AC AGC.C..... G........T GTG....... ....TTCA.. 1500 pVAX-C2M2E212 1451 G.......AC AGC.C..... G........T GTG....... ....TTCA.. 1500 pVAX-C2M2E322 1451 G.......AC AGC.C..... .......... .......... .......... 1500 pVAX-C2M3E344 1451 G.....T... AAC.C..G.. .......... A.G......T .......... 1500 pVAX-C2M4E433 1451 G.G...T... GAA.C..G.. G...AGC..T G.A......T TGAAT.CC.. 1500 pVAX-C2M4E434 1451 G.G...T... GAA.C..G.. G...AGC..T G.A......T TGAAT.CC.. 1500 pVAX-DEN1 1451 .......... .......... G........T GTG....... ....TTCA.. 1500 pVAX-DEN2 1451 G.......AC AGC.C..... .......... .......... .......... 1500 pVAX-DEN3 1451 G.....T..G AAC.C..G.. G...AGC..T G.A......T TGAAT.CC.. 1500 pVAX-DEN4 1451 G.G...T... GAA.T..G.. .......... A.G......T .......... 1500 pVAX-C2M1E122 1501 TAAAGTTGTG AAGGAAATAG CAGAAACACA ACATGGAACA ATAGTTATCA 1550 pVAX-C2M2E122 1501 .......... .......... .......... .......... .......... 1550 pVAX-C2M2E211 1501 C..GT.A.A. ..A...G.G. .T..G..C.. G........T G.TC.AG.GC 1550 pVAX-C2M2E212 1501 C..GT.A.A. ..A...G.G. .T..G..C.. G........T G.TC.AG.GC 1550 pVAX-C2M2E322 1501 .......... .......... .......... .......... .......... 1550 pVAX-C2M3E344 1501 CTC.A...AC ..A..G..G. .......... G.....G... .C...GG.A. 1550 pVAX-C2M4E433 1501 .GTGT.GAA. ..A...G.CT .C.....G.. G.....G... ...C.C..T. 1550 pVAX-C2M4E434 1501 .GTGT.GAA. ..A...G.CT .C.....G.. G.....G... ...C.C..T. 1550 pVAX-DEN1 1501 C..GT.A.A. ..A...G.G. .T..G..C.. G........T G.TC.AG.GC 1550 pVAX-DEN2 1501 .......... .......... .......... .......... .......... 1550 pVAX-DEN3 1501 .GTGT.GAA. ..A...G.CT .C.....G.. G.....G... ...C.C..T. 1550 pVAX-DEN4 1501 CTC.A...AC ..A..G..G. .......... G.....G... .C...GG.A. 1550 pVAX-C2M1E122 1551 GAGTACAATA TGAAGGGGAC GGTTCTCCAT GTAAGATCCC TTTTGAGATA 1600 pVAX-C2M2E122 1551 .......... .......... .......... .......... .......... 1600 pVAX-C2M2E211 1551 AG..TA.... C.....AACA .A.G.A.... .C........ C...TC..CC 1600 pVAX-C2M2E212 1551 AG..TA.... C.....AACA .A.G.A.... .C........ C...TC..CC 1600 pVAX-C2M2E322 1551 .......... .......... .......... .......... .......... 1600 pVAX-C2M3E344 1551 A...CA.G.. ...G..T.CT ..AG...... ....AG.T.. CA.A...... 1600 pVAX-C2M4E433 1551 AG..TG.G.. CA.......A .A.G.A..C. .C.....T.. ...CTCC.CG 1600 pVAX-C2M4E434 1551 AG..TG.G.. CA.......A .A.G.A..C. .C.....T.. ...CTCC.CG 1600 pVAX-DEN1 1551 AG..TA.... C.....AACA .A.G.A.... .C........ C...TC..CC 1600 pVAX-DEN2 1551 .......... .......... .......... .......... .......... 1600 pVAX-DEN3 1551 AG..TG.G.. CA.......A .A.G.A..C. .C.....T.. ...CTCC.CG 1600 pVAX-DEN4 1551 A...CA.G.. ...G..T.CT ..AG...... ....AG.T.. CA.A...... 1600 pVAX-C2M1E122 1601 ATGGATT--T GGAAAAAAGA CATGTTTTAG GTCGCCTGAT TACAGTCAAC 1650 pVAX-C2M2E122 1601 .......--. .......... .......... .......... .......... 1650 pVAX-C2M2E211 1601 CAA...G--A .A..GG.GT. ACCCAGAAT. .GA.AT.... A....C.... 1650 pVAX-C2M2E212 1601 CAA...G--A .A..GG.GT. ACCCAGAAT. .GA.AT.... A....C.... 1650 pVAX-C2M2E322 1601 .......--. .......... .......... .......... .......... 1650 pVAX-C2M3E344 1601 .GA...GTGA AC..GG..A. AG..G.AG-. .CGCATC-.. CT..TCT.C. 1650 pVAX-C2M4E433 1601 GA....G--G AC..GGG.A. GC.CACAAT. .CA.A..... C....C...T 1650 pVAX-C2M4E434 1601 GA....G--G AC..GGG.A. GC.CACAAT. .CA.A..... C....C...T 1650 pVAX-DEN1 1601 CAA...G--A .A..GG.GT. ACCCAGAAT. .GA.AT.... A....C.... 1650 pVAX-DEN2 1601 .......--. .......... .......... .......... .......... 1650 pVAX-DEN3 1601 GA....G--G AC..GGG.A. GC.CACAAT. .CA.A..... C....C...T 1650 pVAX-DEN4 1601 .GA...GTGA AC..GG..A. AG..G.AG-. .CGCATC-.. CT..TCT.C. 1650 pVAX-C2M1E122 1651 CCAATCGTAA CAGAAAAAGA TAGCCCAGTC AACATAGAAG CAGAACCTCC 1700 pVAX-C2M2E122 1651 .......... .......... .......... .......... .......... 1700 pVAX-C2M2E211 1651 ..C..A..C. .T..C..... A.AA...... .....T..G. .......A.. 1700 pVAX-C2M2E212 1651 ..C..A..C. .T..C..... A.AA...... .....T..G. .......A.. 1700 pVAX-C2M2E322 1651 .......... .......... .......... .......... .......... 1700 pVAX-C2M3E344 1651 ..TT.T.CTG AGT.T.CCA. C..TGT.AC. .........T T......C.. 1700 pVAX-C2M4E433 1651 ...G.G..G. .CA.G..G.. GGAG..T... .....T..G. .T........ 1700 pVAX-C2M4E434 1651 ...G.G..G. .CA.G..G.. GGAG..T... .....T..G. .T........ 1700 pVAX-DEN1 1651 ..C..A..C. .T..C..... A.AA...... .....T..G. .......A.. 1700 pVAX-DEN2 1651 .......... .......... .......... .......... .......... 1700 pVAX-DEN3 1651 ...G.G..G. .CA.G..G.. GGAG..T... .....T..G. .T........ 1700 pVAX-DEN4 1651 ..TT.T.CTG AGT.T.CCA. C..TGT.AC. .........T T......C.. 1700

211

pVAX-C2M1E122 1701 ATTCGGAGAC AGCTACATCA TCATAGGAGT AGAGCCGGGA CAATTGAAGC 1750 pVAX-C2M2E122 1701 .......... .......... .......... .......... .......... 1750 pVAX-C2M2E211 1701 T..T..T..G ..T......G .GG......C ..GTGAAAA. GCT.....AT 1750 pVAX-C2M2E212 1701 T..T..T..G ..T......G .GG......C ..GTGAAAA. GCT.....AT 1750 pVAX-C2M2E322 1701 .......... .......... .......... .......... .......... 1750 pVAX-C2M3E344 1701 C..T..G... ........AG .A.....T.. T.GAGACA.T GC...A.CA. 1750 pVAX-C2M4E433 1701 T..T..G..A ..TA.T..AG .A..T...A. T.GAGACAA. GCCC....AA 1750 pVAX-C2M4E434 1701 T..T..G..A ..TA.T..AG .A..T...A. T.GAGACAA. GCCC....AA 1750 pVAX-DEN1 1701 T..T..T..G ..T......G .GG......C ..GTGAAAA. GCT.....AT 1750 pVAX-DEN2 1701 .......... .......... .......... .......... .......... 1750 pVAX-DEN3 1701 T..T..G..A ..TA.T..AG .A..T...A. T.GAGACAA. GCCC....AA 1750 pVAX-DEN4 1701 C..T..G... ........AG .A.....T.. T.GAGACA.T GC...A.CA. 1750 E,III pVAX-C2M1E122 1751 TCAACTGGTT TAAGAAAGGA AGTTCTATCG GCCAAATGAT TGAGACAACA 1800 pVAX-C2M2E122 1751 .......... .......... .......... .......... .......... 1800 pVAX-C2M2E211 1751 .A.G...... C......... ..CAGC..A. .GA.....C. ...AG....T 1800 pVAX-C2M2E212 1751 .A.G...... C......... ..CAGC..A. .GA.....C. ...AG....T 1800 pVAX-C2M2E322 1751 .......... .......... .......... .......... .......... 1800 pVAX-C2M3E344 1751 ..C.T..... C.G......G .....C..T. ..A.G...C. ....T.C... 1800 pVAX-C2M4E433 1751 .........A C.G...G... ..C..G..T. .GA.G...T. C...G.C..T 1800 pVAX-C2M4E434 1751 .........A C.G...G... ..C..G..T. .GA.G...T. C...G.C..T 1800 pVAX-DEN1 1751 .A.G...... C......... ..CAGC..A. .GA.....C. ...AG....T 1800 pVAX-DEN2 1751 .......... .......... .......... .......... .......... 1800 pVAX-DEN3 1751 .........A C.G...G... ..C..G..T. .GA.G...T. C...G.C..T 1800 pVAX-DEN4 1751 ..C.T..... C.G......G .....C..T. ..A.G...C. ....T.C... 1800 pVAX-C2M1E122 1801 ATGAGGGGAG CGAAGAGAAT GGCCATTTTA GGTGACACAG CTTGGGATTT 1850 pVAX-C2M2E122 1801 .......... .......... .......... .......... .......... 1850 pVAX-C2M2E211 1801 GCCC.A.... .ACGA..G.. ......CC.. ..A.....C. .A.....C.. 1850 pVAX-C2M2E212 1801 GCCC.A.... .ACGA..G.. ..T...CC.. .......... .......... 1850 pVAX-C2M2E322 1801 .......... .......... .......... .......... .......... 1850 pVAX-C2M3E344 1801 TAC..A..C. .A...C.... .......C.. .....A.... .C........ 1850 pVAX-C2M4E433 1801 GCC..A..T. .A.G.C.C.. ......C..G ..A....... .C.....C.. 1850 pVAX-C2M4E434 1801 GCC..A..T. .A.G.C.C.. ......C..G ..A....... .C.....C.. 1850 pVAX-DEN1 1801 GCCC.A.... .ACGA..G.. ......CC.. ..A.....C. .A.....C.. 1850 pVAX-DEN2 1801 .......... .......... .......... .......... .......... 1850 pVAX-DEN3 1801 GCC..A..T. .A.G.C.C.. ......C..G ..A....... .C.....C.. 1850 pVAX-DEN4 1801 TAC..A..C. .A...C.... .......C.. .....A.... .C........ 1850 pVAX-C2M1E122 1851 TGGATCCCTG GGAGGAGTGT TTACATCTAT AGGAAAGGCT CTCCACCAAG 1900 pVAX-C2M2E122 1851 .......... .......... .......... .......... .......... 1900 pVAX-C2M2E211 1851 C..T..TA.A .......... .C..G...G. G.....ACTG G.A.....GA 1900 pVAX-C2M2E212 1851 .......... .......... .......... .......... .......... 1900 pVAX-C2M2E322 1851 .......... .......... .......... .......... .......... 1900 pVAX-C2M3E344 1851 ...T..TG.T ..T...C..C .C.....AT. G......... G.A.....G. 1900 pVAX-C2M4E433 1851 ......AG.. ..T..T..T. .G.AT..AT. ...G..AATG G........A 1900 pVAX-C2M4E434 1851 ...T...G.T ..T...C..C .C.....AT. G......... G.A.....G. 1900 pVAX-DEN1 1851 C..T..TA.A .......... .C..G...G. G.....ACTG G.A.....GA 1900 pVAX-DEN2 1851 .......... .......... .......... .......... .......... 1900 pVAX-DEN3 1851 ......AG.. ..T..T..T. .G.AT..AT. ...G..AATG G........A 1900 pVAX-DEN4 1851 ...T..TG.T ..T...C..C .C.....AT. G......... G.A.....G. 1900 Stem-anchor pVAX-C2M1E122 1901 TTTTCGGAGC AATCTATGGG GCTGCCTTCA GTGGGGTCTC ATGGACTATG 1950 pVAX-C2M2E122 1901 .......... .......... .......... .......... .......... 1950 pVAX-C2M2E211 1901 .C..T...A. TGCA.....A .T.TTG.... .C..T..T.. C......... 1950 pVAX-C2M2E212 1901 .......... .......... .......... .......... .......... 1950 pVAX-C2M2E322 1901 .......... .......... .......... .......... .......... 1950 pVAX-C2M3E344 1901 ....T..TAG TG.G..CACA A..ATG..TG .A..A..... .....TGG.T 1950 pVAX-C2M4E433 1901 .A..T..GAG TGCT..CACA ..CCTA..T. ....A..... C....TA... 1950 pVAX-C2M4E434 1901 ....T..TAG TG.G..CACA A..ATG..TG .A..A..... .....TGG.T 1950 pVAX-DEN1 1901 .C..T...A. TGCA.....A .T.TTG.... .C..T..T.. C......... 1950 pVAX-DEN2 1901 .......... .......... .......... .......... .......... 1950 pVAX-DEN3 1901 .A..T..GAG TGCT..CACA ..CCTA..T. ....A..... C....TA... 1950 pVAX-DEN4 1901 ....T..TAG TG.G..CACA A..ATG..TG .A..A..... .....TGG.T 1950

212

pVAX-C2M1E122 1951 AAAATACTCA TAGGAGTCAT TATCACATGG ATAGGAATGA ATTCACGCAG 2000 pVAX-C2M2E122 1951 .......... .......... .......... .......... .......... 2000 pVAX-C2M2E211 1951 ......GGA. ....GA.TC. GC.G...... C.....T.A. .....A.G.. 2000 pVAX-C2M2E212 1951 .......... .......... .......... .......... .......... 2000 pVAX-C2M2E322 1951 .......... .......... .......... .......... .......... 2000 pVAX-C2M3E344 1951 .G...C..A. .T..GT..T. AG.GTTG... ..T..C.C.. ....GA.A.A 2000 pVAX-C2M4E433 1951 .....TGGA. ....T...C. CT.A..C... .....GT... .....AAA.A 2000 pVAX-C2M4E434 1951 .G...C..A. .T..GT..T. AG.GTTG... ..T..C.C.. ....GA.A.A 2000 pVAX-DEN1 1951 ......GGA. ....GA.TC. GC.G...... C.....T.A. .....A.G.. 2000 pVAX-DEN2 1951 .......... .......... .......... .......... .......... 2000 pVAX-DEN3 1951 .....TGGA. ....T...C. CT.A..C... .....GT... .....AAA.A 2000 pVAX-DEN4 1951 .G...C..A. .T..GT..T. AG.GTTG... ..T..C.C.. ....GA.A.A 2000 pVAX-C2M1E122 2001 CACCTCACTG TCTGTGTCAC TAGTATTGGT GGGAGTCGTG ACGCTGTATT 2050 pVAX-C2M2E122 2001 .......... .......... .......... .......... .......... 2050 pVAX-C2M2E211 2001 .G.G..C..T ..GA..A.GT GCA.TGCA.. T..CA.G..T ..A.....CC 2050 pVAX-C2M2E212 2001 .......... .......... .......... .......... .......... 2050 pVAX-C2M2E322 2001 .......... .......... .......... .......... .......... 2050 pVAX-C2M3E344 2001 .......A.. G.AA..A.GT GCA..GCT.. T....GAA.C ..T....T.C 2050 pVAX-C2M4E433 2001 ...T..TA.. ..AT.T...T GCA.TGC.A. A...A..A.T ..A..C...C 2050 pVAX-C2M4E434 2001 .......A.. G.AA..A.GT GCA..GCT.. T....GAA.C ..T....T.C 2050 pVAX-DEN1 2001 .G.G..C..T ..GA..A.GT GCA.TGCA.. T..CA.G..T ..A.....CC 2050 pVAX-DEN2 2001 .......... .......... .......... .......... .......... 2050 pVAX-DEN3 2001 ...T..TA.. ..AT.T...T GCA.TGC.A. A...A..A.T ..A..C...C 2050 pVAX-DEN4 2001 .......A.. G.AA..A.GT GCA..GCT.. T....GAA.C ..T....T.C 2050 Stem-anchor pVAX-C2M1E122 2051 TGGGAGTTAT GGTGCAGGCC TAA 2073 pVAX-C2M2E122 2051 .......... .......... ... 2073 pVAX-C2M2E211 2051 .A.....C.. .......... ... 2073 pVAX-C2M2E212 2051 .......... .......... ... 2073 pVAX-C2M2E322 2051 .......... ...A...... ... 2073 pVAX-C2M3E344 2051 ....TT.C.C A..T..C..A ... 2073 pVAX-C2M4E433 2051 .......CG. ......A... ... 2073 pVAX-C2M4E434 2051 ....TT.C.C A..T..C..A ... 2073 pVAX-DEN1 2051 .A.....C.. ...T..C..A ... 2073 pVAX-DEN2 2051 .......... ......A... ... 2073 pVAX-DEN3 2051 .......CG. ......A..T ... 2073 pVAX-DEN4 2051 ....TT.C.C A..T..C..A ... 2073

Note. Shaded sequences (grey) represent artificial translation initiation (including Kozak’s sequence) and termination codons that have been introduced to enable the expression of the DENV proteins.

213

APPENDIX C:

DEDUCED PROTEIN SEQUENCES OF pVAX-DEN AND pVAX-HYBRID-E

DNA VACCINES (EXCLUDING VECTOR SEQUENCE)

CprM pVAX-C2M1E122 1 TMGRMLNILN RRRRTAGMII MLIPTVMAFH LTTRGGEPHM IVSKQERGKS 50 pVAX-C2M2E122 1 .......... .......... .......... ....N..... ...R..K... 50 pVAX-C2M2E211 1 .......... .......... .......... ....N..... ...R..K... 50 pVAX-C2M2E212 1 .......... .......... .......... ....N..... ...R..K... 50 pVAX-C2M2E322 1 .......... .......... .......... ....N..... ...R..K... 50 pVAX-C2M3E344 1 .......... .......... .......... ..S.D...R. ..G.N..... 50 pVAX-C2M4E433 1 .......... .......... .........S .S..D...L. ..A.H...RP 50 pVAX-C2M4E434 1 .......... .......... .........S .S..D...L. ..A.H...RP 50 pVAX-DEN1 1 ..AN..S.M. ..K.SVT.LL ..L..AL... .......... .......... 50 pVAX-DEN2 1 .......... .......... .......... ....N..... ...R..K... 50 pVAX-DEN3 1 ..AN..S.I. K.KK.SLCLM .ML.ATL... ..S.D...R. ..G.N..... 50 pVAX-DEN4 1 .......... G.K.STMTLL C....A.... .S..D...L. ..A.H...RP 50 pVAX-C2M1E122 51 LLFKTSAGVN MCTIIAMDLG ELCEDTMTYK CPRITKAEPD DVDCWCNATD 100 pVAX-C2M2E122 51 .....ED... ...LM..... ...D..I... ..FLRQN..E .I.....S.S 100 pVAX-C2M2E211 51 .....ED... ...LM..... ......I... ..FLRQN..E .I.....S.S 100 pVAX-C2M2E212 51 .....ED... ...LM..... ......I... ..FLRQN..E .I.....S.S 100 pVAX-C2M2E322 51 .....ED... ...LM..... ......I... ..FLRQN..E .I.....S.S 100 pVAX-C2M3E344 51 .....AS.I. ...L...... .M.D..V... ..H..EV..E .I.....L.S 100 pVAX-C2M4E433 51 .....TE.I. K..LN..... .M....V..E ..LLVNT..E .I.....L.S 100 pVAX-C2M4E434 51 .....TE.I. K..LN..... .M....V..E ..LLVNT..E .I.....L.S 100 pVAX-DEN1 51 .......... .......... .......... .......... .......... 100 pVAX-DEN2 51 .....ED... ...LM..... ......I... ..FLRQN..E .I.....S.S 100 pVAX-DEN3 51 .....AS.I. ...L...... .M.D..V... ..H..EV..E .I.....L.S 100 pVAX-DEN4 51 .....TE.I. K..LN..... .M....V..E ..LLVNT..E .I.....L.S 100 M pVAX-C2M1E122 101 TWVTYGTCSR TGEHRRDKRS VALAPHVGLG LETRAETWMS SEGAWKQIQK 150 pVAX-C2M2E122 101 ........TT ......E... ...V....M. ....T..... ......HA.R 150 pVAX-C2M2E211 101 ........TT ......E... ...V....M. ....T..... ......HA.R 150 pVAX-C2M2E212 101 ........TT ......E... ...V....M. ....T..... ......HA.R 150 pVAX-C2M2E322 101 ........TT ......E... ...V....M. ....T..... ......HA.R 150 pVAX-C2M3E344 101 ........NQ A......... ........M. .D..TQ.... A....R.VE. 150 pVAX-C2M4E433 101 A..M....TQ S..R..E... ...T..S.M. .......... ......HA.R 150 pVAX-C2M4E434 101 A..M....TQ S..R..E... ...T..S.M. .......... ......HA.R 150 pVAX-DEN1 101 .......... .......... .......... .......... .......... 150 pVAX-DEN2 101 ........TT ......E... ...V....M. ....T..... ......HA.R 150 pVAX-DEN3 101 ........NQ A......... ........M. .D..TQ.... A....R.VE. 150 pVAX-DEN4 101 A..M....TQ S..R..E... ...T..S.M. .......... ......HA.R 150 ME,I pVAX-C2M1E122 151 VETWALRHPG FTVIALFLAH AIGTSITQKG IIFILLMLVT PSMAMRCVGI 200 pVAX-C2M2E122 151 I...I..... ..IM.AI..Y T...THF.RA L.....TA.A ...T...... 200 pVAX-C2M2E211 151 I...I..... ..IM.AI..Y T...THF.RA L.....TA.A ...T...I.. 200 pVAX-C2M2E212 151 I...I..... ..IM.AI..Y T...THF.RA L.....TA.A ...T...I.. 200 pVAX-C2M2E322 151 I...I..... ..IM.AI..Y T...THF.RA L.....TA.A ...T.....V 200 pVAX-C2M3E344 151 .......... ..IL...... Y....L...V V......... ...T.....V 200 pVAX-C2M4E433 151 ..S.I..N.. .ALL.G.M.Y M..QTGI.RT VF.V.M...A ..YG.....V 200 pVAX-C2M4E434 151 ..S.I..N.. .ALL.G.M.Y M..QTGI.RT VF.V.M...A ..YG.....V 200 pVAX-DEN1 151 .......... .......... .......... .......... .......... 200 pVAX-DEN2 151 I...I..... ..IM.AI..Y T...THF.RA L.....TA.A ...T...I.. 200 pVAX-DEN3 151 .......... ..IL...... Y....L...V V......... ...T.....V 200 pVAX-DEN4 151 ..S.I..N.. .ALL.G.M.Y M..QTGI.RT VF.V.M...A ..YG.....V 200

214

E,IE,II pVAX-C2M1E122 201 GNRDFVEGLS GATWVDVVLE HGSCVTTMAK DKPTLDIELL KTEVTKPAVL 250 pVAX-C2M2E122 201 .......... .......... .......... .......... .......... 250 pVAX-C2M2E211 201 S.......V. .GS...I... .......... N.....F..I ...AKQ..T. 250 pVAX-C2M2E212 201 S.......V. .GS...I... .......... N.....F..I ...AKQ..T. 250 pVAX-C2M2E322 201 .......... .......... ..G....... N........Q ...A.QL.T. 250 pVAX-C2M3E344 201 .......... .......... ..G....... N........Q ...A.QL.T. 250 pVAX-C2M4E433 201 ........V. .GA...L... ..G......Q G.....F..I ..TAKEV.L. 250 pVAX-C2M4E434 201 ........V. .GA...L... ..G......Q G.....F..I ..TAKEV.L. 250 pVAX-DEN1 201 .......... .......... .......... .......... .......... 250 pVAX-DEN2 201 S.......V. .GS...I... .......... N.....F..I ...AKQ..T. 250 pVAX-DEN3 201 .......... .......... ..G....... N........Q ...A.QL.T. 250 pVAX-DEN4 201 ........V. .GA...L... ..G......Q G.....F..I ..TAKEV.L. 250 pVAX-C2M1E122 251 RKLCIEAKIS NTTTDSRCPT QGEATLVEEQ DANFVCRRTF VDRGWGNGCG 300 pVAX-C2M2E122 251 .......... .......... .......... .......... .......... 300 pVAX-C2M2E211 251 ..Y.....LT .......... ...PS.N... .KR...KHSM .......... 300 pVAX-C2M2E212 251 ..Y.....LT .......... ...PS.N... .KR...KHSM .......... 300 pVAX-C2M2E322 251 ......G..T .I........ ....I.P... .Q.Y..KH.Y .......... 300 pVAX-C2M3E344 251 ......G..T .I........ ....I.P... .QKY..KH.Y .......... 300 pVAX-C2M4E433 251 .TY....S.. .I..AT.... ...PY.K... .QQYI...DV .......... 300 pVAX-C2M4E434 251 .TY....S.. .I..AT.... ...PY.K... .QQYI...DV .......... 300 pVAX-DEN1 251 .......... .......... .......... .......... .......... 300 pVAX-DEN2 251 ..Y.....LT .......... ...PS.N... .KR...KHSM .......... 300 pVAX-DEN3 251 ......G..T .I........ ....I.P... .QKY..KH.Y .......... 300 pVAX-DEN4 251 .TY....S.. .I..AT.... ...PY.K... .QQYI...DV .......... 300 E,IIE,I pVAX-C2M1E122 301 LFGKGSLITC AKFKCVTKLE GKIVQYENLK YSVIVTVHTG DQHQVGNETT 350 pVAX-C2M2E122 301 .......... .......... .......... .......... .......... 350 pVAX-C2M2E211 301 .....GIV.. .M.T.KKNMK ..V..P...E .TIVI.P.S. EE.A...D.G 350 pVAX-C2M2E212 301 .....GIV.. .M.T.KKNMK ..V..P...E .IIVI.P.S. EE.A...D.G 350 pVAX-C2M2E322 301 .......V.. ...Q.LESI. ..V..H.... .T..I..... .........- 350 pVAX-C2M3E344 301 .......V.. ...Q.LESI. ..V..H.... .T..I..... .........- 350 pVAX-C2M4E433 301 .....GVV.. ...S.SG.IT .NL..I...E .T.V....N. .T.A...DIP 350 pVAX-C2M4E434 301 .....GVV.. ...S.SG.IT .NL..I...E .T.V....N. .T.A...DIP 350 pVAX-DEN1 301 .......... .......... .......... .......... .......... 350 pVAX-DEN2 301 .....GIV.. .M.T.KKNMK ..V..P...E .TIVI.P.S. EE.A...D.G 350 pVAX-DEN3 301 .......V.. ...Q.LESI. ..V..H.... .T..I..... .........- 350 pVAX-DEN4 301 .....GVV.. ...S.SG.IT .NL..I...E .T.V....N. .T.A...DIP 350 E,IE,II pVAX-C2M1E122 351 EHGTIATITP QAPTSEIQLT DYGALTLDCS PRTGLDFNEM VLLTMKEKSW 400 pVAX-C2M2E122 351 .......... .......... .......... .......... .......... 400 pVAX-C2M2E211 351 K..KEIK... .SSIT.AE.. G..TV.ME.. .......... ...Q.EN.A. 400 pVAX-C2M2E212 351 K..KEIK... .SSIT.AE.. G..TV.ME.. .......... ...Q.EN.A. 400 pVAX-C2M2E322 351 -Q.VT.E... ..S.V.AI.P E..T.G.E.. .......... I.....N.A. 400 pVAX-C2M3E344 351 -Q.VT.E..S ..S.A.AI.P E..T.G.E.. .......... I.....N.A. 400 pVAX-C2M4E433 351 N..VT..... RS.SV.VK.P ...E.....E ..S.I..... I.MK..K.T. 400 pVAX-C2M4E434 351 N..VT..... RS.SV.VK.P ...E.....E ..S.I..... I.MK..K.T. 400 pVAX-DEN1 351 .......... .......... .......... .......... .......... 400 pVAX-DEN2 351 K..KEIK... .SSIT.AE.. G..TV.ME.. .......... ...Q.EN.A. 400 pVAX-DEN3 351 -Q.VT.E..S ..S.A.AI.P E..T.G.E.. .......... I.....N.A. 400 pVAX-DEN4 351 N..VT..... RS.SV.VK.P ...E.....E ..S.I..... I.MK..K.T. 400 pVAX-C2M1E122 401 LVHKQWFLDL PLPWTSGAST PQETWNREDL LVTFKTAHAK KQEVVVLGSQ 450 pVAX-C2M2E122 401 .......... .......... .......... .......... .......... 450 pVAX-C2M2E211 401 ...R...... ....LP..D. QGSN.IQKET .....NP... ..D....... 450 pVAX-C2M2E212 401 ...R...... ....LP..D. QGSN.IQKET .....NP... ..D....... 450 pVAX-C2M2E322 401 M..R...F.. ........T. ETP....KE. .....N.... .......... 450 pVAX-C2M3E344 401 M..R...F.. ........T. KTP....KE. .....N.... .......... 450 pVAX-C2M4E433 401 .......... ....AA..D. SEVH..YKER M....VP... R.D.T..... 450 pVAX-C2M4E434 401 .......... ....AA..D. SEVH..YKER M....VP... R.D.T..... 450 pVAX-DEN1 401 .......... .......... .......... .......... .......... 450 pVAX-DEN2 401 ...R...... ....LP..D. QGSN.IQKET .....NP... ..D....... 450 pVAX-DEN3 401 M..R...F.. ........T. KTP....KE. .....N.... .......... 450 pVAX-DEN4 401 .......... ....AA..D. SEVH..YKER M....VP... R.D.T..... 450

215

E,IIE,I E,IE,III pVAX-C2M1E122 451 EGAMHTALTG ATEIQTSGTT KIFAGHLKCR LKMNKLTLKG MSYSMCTGKF 500 pVAX-C2M2E122 451 .......... .......... .......... .......... .......... 500 pVAX-C2M2E211 451 .......... .....M.SGN LL.T...... .R.D..Q... ...V....S. 500 pVAX-C2M2E212 451 .......... .....M.SGN LL.T...... .R.D..Q... ...V....S. 500 pVAX-C2M2E322 451 .......... .....N..G. S......... ...D..Q... .......... 500 pVAX-C2M3E344 451 .......... ........G. S......... ...D..K... ...T..S... 500 pVAX-C2M4E433 451 .....S.... ...VDSGDGN HM.......K VR.E..RI.. ...A..LNT. 500 pVAX-C2M4E434 451 .....S.... ...VDSGDGN HM.......K VR.E..RI.. ...A..LNT. 500 pVAX-DEN1 451 .......... .......... .......... .......... ...V....S. 500 pVAX-DEN2 451 .......... .....M.SGN LL.T...... .R.D..Q... .......... 500 pVAX-DEN3 451 .......... ........G. S......... ...D..E... ...A..LNT. 500 pVAX-DEN4 451 .....S.... ...VDSGDGN HM.......K VR.E..RI.. ...T..S... 500 pVAX-C2M1E122 501 KVVKEIAETQ HGTIVIRVQY EGDGSPCKIP FEIMDLEKRH VLGRLITVNP 550 pVAX-C2M2E122 501 .......... .......... .......... .......... .......... 550 pVAX-C2M2E211 501 .LE..V.... ...VLVQ.K. ..TDA..... .STQ.EKGVT QN.....A.. 550 pVAX-C2M2E212 501 .LE..V.... ...VLVQ.K. ..TDA..... .STQ.EKGVT QN.....A.. 550 pVAX-C2M2E322 501 .......... .......... .......... .......... .......... 550 pVAX-C2M3E344 501 SID..M.... ...T.VK.K. ..A.A...V. I..R.VN.EK .V..I.SST. 550 pVAX-C2M4E433 501 VLK..VS... ....L.K.E. K.EDA..... .STE.GQGKA HN.....A.. 550 pVAX-C2M4E434 501 VLK..VS... ....L.K.E. K.EDA..... .STE.GQGKA HN.....A.. 550 pVAX-DEN1 501 .LE..V.... ...VLVQ.K. ..TDA..... .STQ.EKGVT QN.....A.. 550 pVAX-DEN2 501 .......... .......... .......... .......... .......... 550 pVAX-DEN3 501 VLK..VS... ....L.K.E. K.EDA..... .STE.GQGKA HN.....A.. 550 pVAX-DEN4 501 SID..M.... ...T.VK.K. ..A.A...V. I..R.VN.EK .V..I.SST. 550 E,III pVAX-C2M1E122 551 IVTEKDSPVN IEAEPPFGDS YIIIGVEPGQ LKLNWFKKGS SIGQMIETTM 600 pVAX-C2M2E122 551 .......... .......... .......... .......... .......... 600 pVAX-C2M2E211 551 ...D.EK... ........E. ..VV.AGEKA ...S...... ...K.L.A.A 600 pVAX-C2M2E212 551 ...D.EK... ........E. ..VV.AGEKA ...S...... ...K.L.A.A 600 pVAX-C2M2E322 551 .......... .......... .......... .......... .......... 600 pVAX-C2M3E344 551 FAEYTN.VT. ..L....... ..V...GDSA .T.H..R... ...K.L.S.Y 600 pVAX-C2M4E433 551 V..K.EE... ........E. N.V..IGDKA ..I..YR... ...K.F.A.A 600 pVAX-C2M4E434 551 V..K.EE... ........E. N.V..IGDKA ..I..YR... ...K.F.A.A 600 pVAX-DEN1 551 ...D.EK... ........E. ..VV.AGEKA ...S...... ...K.L.A.A 600 pVAX-DEN2 551 .......... .......... .......... .......... .......... 600 pVAX-DEN3 551 V..K.EE... ........E. N.V..IGDKA ..I..YR... ...K.F.A.A 600 pVAX-DEN4 551 FAEYTN.VT. ..L....... ..V...GDSA .T.H..R... ...K.L.S.Y 600 Stem-anchor pVAX-C2M1E122 601 RGAKRMAILG DTAWDFGSLG GVFTSIGKAL HQVFGAIYGA AFSGVSWTMK 650 pVAX-C2M2E122 601 .......... .......... .......... .......... .......... 650 pVAX-C2M2E211 601 ...R...... ........I. .....V..LV ..I..TA..V L......... 650 pVAX-C2M2E212 601 ...R..V... .......... .......... .......... .......... 650 pVAX-C2M2E322 601 .......... .......... .......... .......... .......... 650 pVAX-C2M3E344 601 .......... E.......V. .LL..L...V .....SV.TT M.G....MVR 650 pVAX-C2M4E433 601 ...R...... ........V. ..LN.L..MV ..I..SA.T. L......I.. 650 pVAX-C2M4E434 601 ...R...... ........V. .LL..L...V .....SV.TT M.G....MVR 650 pVAX-DEN1 601 ...R...... ........I. .....V..LV ..I..TA..V L......... 650 pVAX-DEN2 601 .......... .......... .......... .......... .......... 650 pVAX-DEN3 601 ...R...... ........V. ..LN.L..MV ..I..SA.T. L......I.. 650 pVAX-DEN4 601 .......... E.......V. .LL..L...V .....SV.TT M.G....MVR 650 Stem-anchor pVAX-C2M1E122 651 ILIGVIITWI GMNSRSTSLS VSLVLVGVVT LYLGVMVQA. 690 pVAX-C2M2E122 651 .......... .......... .......... .......... 690 pVAX-C2M2E211 651 .G..ILL..L .L....A... MTCIA..M.. .......... 690 pVAX-C2M2E212 651 .......... .......... .......... .......... 690 pVAX-C2M2E322 651 .......... .......... .......... .......... 690 pVAX-C2M3E344 651 ....FLVL.. .T...N..MA MTCIA..GI. .F..FT.H.. 690 pVAX-C2M4E433 651 .G...LL... .L..KN..M. F.CIAI.II. .....V.... 690 pVAX-C2M4E434 651 ....FLVL.. .T...N..MA MTCIA..GI. .F..FT.H.. 690 pVAX-DEN1 651 .G..ILL..L .L....A... MTCIA..M.. .......H.. 690 pVAX-DEN2 651 .......... .......... .......... .......... 690 pVAX-DEN3 651 .G...LL... .L..KN..M. F.CIAI.II. .....V.... 690 pVAX-DEN4 651 ....FLVL.. .T...N..MA MTCIA..GI. .F..FT.H.. 690

Note. Shaded sequences (grey) represent artificial amino acids that have been introduced to enable the expression of the DENV proteins.

216

REFERENCES

Aaskov, J. G. (2001). Immunological determinants on dengue virions: Is a chimeric

vaccine a possibility? In Arbovirus Research in Australia, M. D. Brown, P. Ryan,

and J. G. Aaskov, eds. (Brisbane, QUT/QIMR), pp. 1-4.

Aberle, J. H., Aberle, S. W., Allison, S. L., Stiasny, K., Ecker, M., Mandl, C. W.,

Berger, R., and Heinz, F. X. (1999). A DNA immunization model study with

constructs expressing the tick-borne encephalitis virus envelope protein E in

different physical forms. J Immunol 163, 6756-6761.

Ahmad-Nejad, P., Hacker, H., Rutz, M., Bauer, S., Vabulas, R. M., and Wagner, H.

(2002). Bacterial CpG-DNA and lipopolysaccharides activate Toll-like receptors at

distinct cellular compartments. Eur J Immunol 32, 1958-1968.

Allison, S. L., Schalich, J., Stiasny, K., Mandl, C. W., and Heinz, F. X. (2001).

Mutational evidence for an internal fusion peptide in flavivirus envelope protein E. J

Virol 75, 4268-4275.

Allison, S. L., Stadler, K., Mandl, C. W., Kunz, C., and Heinz, F. X. (1995).

Synthesis and secretion of recombinant tick-borne encephalitis virus protein E in

soluble and particulate form. J Virol 69, 5816-5820.

Allison, S. L., Stiasny, K., Stadler, K., Mandl, C. W., and Heinz, F. X. (1999).

Mapping of functional elements in the stem-anchor region of tick-borne encephalitis

virus envelope protein E. J Virol 73, 5605-5612.

Amberg, S. M., Nestorowicz, A., McCourt, D. W., and Rice, C. M. (1994). NS2B-3

proteinase-mediated processing in the yellow fever virus structural region: in vitro

and in vivo studies. J Virol 68, 3794-3802.

217

Angsubhakorn, S., Moe, J. B., Marchette, N. J., Latendresse, J. R., Palumbo, N. E.,

Yoksan, S., and Bhamarapravati, N. (1987a). Neurovirulence detection of dengue

virus using rhesus and cynomolgus monkeys. J Virol Methods 18, 13-24.

Angsubhakorn, S., Moe, J. B., Marchette, N. J., Palumbo, N. E., Yoksan, S., and

Bhamarapravati, N. (1987b). Neurovirulence effects of dengue-2 viruses on the

rhesus (Macaca mulatta) brain and spinal cord. Southeast Asian J Trop Med Public

Health 18, 52-55.

Angsubhakorn, S., Yoksan, S., Bhamarapravati, N., Moe, J. B., Marchette, N. J.,

Pradermwong, A., and Sahaphong, S. (1988). Dengue-4 vaccine: neurovirulence,

viraemia and immune responses in rhesus and cynomolgus monkeys. Trans R Soc

Trop Med Hyg 82, 746-749.

Angsubhakorn, S., Yoksan, S., Pradermwong, A., Nitatpattana, N., Sahaphong, S.,

and Bhamarapravati, N. (1994). Dengue-3 (16562) PGMK 33 vaccine:

neurovirulence, viremia and immune responses in Macaca fascicularis. Southeast

Asian J Trop Med Public Health 25, 554-559.

Anonymous (1990). Dengue hemorrhagic fever in Venezuela. Epidemiology Bulletin

11, 7-9.

Anonymous (1996). Points to consider on plasmid DNA vaccines for preventive

infectious disease indications (Docket no. 96N-0400). In (Rockville, United States

Food and Drug Administration, Center for Biologics Evaluation and Research), pp.

1-30.

Anonymous (1997a). Dengue haemorrhagic fever: Diagnosis, treatment, prevention

and control (Geneva, World Health Organization).

Anonymous (1997b). Re-emergence of Dengue in the Americas. Pan American

Health Organization: Epidemiological Bulletin 18.

218

Anonymous (2000a). Case Definitions: Dengue and Leptospirosis. Pan American

Health Organization: Epidemiological Bulletin 21.

Anonymous (2000b). Dengue in the Americas: The Epidemics of 2000. Pan

American Health Organization: Epidemiological Bulletin 21.

Arias, C. F., Preugschat, F., and Strauss, J. H. (1993). Dengue 2 virus NS2B and

NS3 form a stable complex that can cleave NS3 within the helicase domain.

Virology 193, 888-899.

Arroyo, J., Guirakhoo, F., Fenner, S., Zhang, Z. X., Monath, T. P., and Chambers, T.

J. (2001a). Molecular basis for attenuation of neurovirulence of a yellow fever

Virus/Japanese encephalitis virus chimera vaccine (ChimeriVax-JE). J Virol 75, 934-

942.

Arroyo, J., Miller, C. A., Catalan, J., and Monath, T. P. (2001b). Yellow fever vector

live-virus vaccines: West Nile virus vaccine development. Trends Mol Med 7, 350-

354.

Ashok, M. S., and Rangarajan, P. N. (1999). Immunization with plasmid DNA

encoding the envelope glycoprotein of Japanese Encephalitis virus confers

significant protection against intracerebral viral challenge without inducing

detectable antiviral antibodies. Vaccine 18, 68-75.

Ashok, M. S., and Rangarajan, P. N. (2000). Evaluation of the potency of BIKEN

inactivated Japanese Encephalitis vaccine and DNA vaccines in an intracerebral

Japanese Encephalitis virus challenge [letter]. Vaccine 19, 155-157.

Ashok, M. S., and Rangarajan, P. N. (2002). Protective efficacy of a plasmid DNA

encoding Japanese encephalitis virus envelope protein fused to tissue plasminogen

activator signal sequences: studies in a murine intracerebral virus challenge model.

Vaccine 20, 1563-1570.

219

Ballas, Z. K., Rasmussen, W. L., and Krieg, A. M. (1996). Induction of NK activity

in murine and human cells by CpG motifs in oligodeoxynucleotides and bacterial

DNA. J Immunol 157, 1840-1845.

Baluna, R., and Vitetta, E. S. (1997). Vascular leak syndrome: a side effect of

immunotherapy. Immunopharmacology 37, 117-132.

Bancroft, T. L. (1906). On the etiology of dengue fever. Australasian Medical

Gazette 25, 17-18.

Bartelma, G., and Padmanabhan, R. (2002). Expression, purification, and

characterization of the RNA 5'-triphosphatase activity of dengue virus type 2

nonstructural protein 3. Virology 299, 122-132.

Bates, P. J., Kahlon, J. B., Thomas, S. D., Trent, J. O., and Miller, D. M. (1999).

Antiproliferative activity of G-rich oligonucleotides correlates with protein binding.

J Biol Chem 274, 26369-26377.

Beasley, D. W., and Aaskov, J. G. (2001). Epitopes on the dengue 1 virus envelope

protein recognized by neutralizing IgM monoclonal antibodies. Virology 279, 447-

458.

Benarroch, D., Selisko, B., Locatelli, G. A., Maga, G., Romette, J. L., and Canard, B.

(2004). The RNA helicase, nucleotide 5'-triphosphatase, and RNA 5'-triphosphatase

activities of Dengue virus protein NS3 are Mg2+-dependent and require a functional

Walker B motif in the helicase catalytic core. Virology 328, 208-218.

Bendtsen, J. D., Nielsen, H., von Heijne, G., and Brunak, S. (2004). Improved

prediction of signal peptides: SignalP 3.0. J Mol Biol 340, 783-795.

Benimetskaya, L., Berton, M., Kolbanovsky, A., Benimetsky, S., and Stein, C. A.

(1997). Formation of a G-tetrad and higher order structures correlates with biological

activity of the RelA (NF-kappaB p65) 'antisense' oligodeoxynucleotide. Nucleic

Acids Res 25, 2648-2656.

220

Bethell, D. B., Flobbe, K., Cao, X. T., Day, N. P., Pham, T. P., Buurman, W. A.,

Cardosa, M. J., White, N. J., and Kwiatkowski, D. (1998). Pathophysiologic and

prognostic role of cytokines in dengue hemorrhagic fever. J Infect Dis 177, 778-782.

Bhamarapravati, N., and Sutee, Y. (2000). Live attenuated tetravalent dengue

vaccine. Vaccine 18, 44-47.

Bhamarapravati, N., and Yoksan, S. (1997). Live attenuated tetravalent dengue

vaccine. In Dengue and dengue hemorrhagic fever, D. J. Gubler, and G. Kuno, eds.

(CAB International), pp. 367-377.

Bhamarapravati, N., Yoksan, S., Chayaniyayothin, T., Angsubphakorn, S., and

Bunyaratvej, A. (1987). Immunization with a live attenuated dengue-2-virus

candidate vaccine (16681-PDK 53): clinical, immunological and biological

responses in adult volunteers. Bull World Health Organ 65, 189-195.

Bielefeldt-Ohmann, H., Beasley, D. W., Fitzpatrick, D. R., and Aaskov, J. G. (1997).

Analysis of a recombinant dengue-2 virus-dengue-3 virus hybrid envelope protein

expressed in a secretory baculovirus system. J Gen Virol 78, 2723-2733.

Blaney, J. E., Jr., Hanson, C. T., Firestone, C. Y., Hanley, K. A., Murphy, B. R., and

Whitehead, S. S. (2004a). Genetically modified, live attenuated dengue virus type 3

vaccine candidates. Am J Trop Med Hyg 71, 811-821.

Blaney, J. E., Jr., Hanson, C. T., Hanley, K. A., Murphy, B. R., and Whitehead, S. S.

(2004b). Vaccine candidates derived from a novel infectious cDNA clone of an

American genotype dengue virus type 2. BMC Infect Dis 4, 39.

Blaney, J. E., Jr., Manipon, G. G., Firestone, C. Y., Johnson, D. H., Hanson, C. T.,

Murphy, B. R., and Whitehead, S. S. (2003). Mutations which enhance the

replication of dengue virus type 4 and an antigenic chimeric dengue virus type 2/4

vaccine candidate in Vero cells. Vaccine 21, 4317-4327.

221

Bock, H. L., Klockmann, U., Jungst, C., Schindel-Kunzel, F., Theobald, K., and

Zerban, R. (1990). A new vaccine against tick-borne encephalitis: initial trial in man

including a dose-response study. Vaccine 8, 22-24.

Bokisch, V. A., Top, F. H., Jr., Russell, P. K., Dixon, F. J., and Muller-Eberhard, H.

J. (1973). The potential pathogenic role of complement in dengue hemorrhagic shock

syndrome. N Engl J Med 289, 996-1000.

Bonaldo, M. C., Caufour, P. S., Freire, M. S., and Galler, R. (2000). The yellow

fever 17D vaccine virus as a vector for the expression of foreign proteins:

development of new live flavivirus vaccines. Mem Inst Oswaldo Cruz 95 Suppl 1,

215-223.

Bray, M., and Lai, C. J. (1991). Construction of intertypic chimeric dengue viruses

by substitution of structural protein genes. Proc Natl Acad Sci U S A 88, 10342-

10346.

Bray, M., Men, R., and Lai, C. J. (1996). Monkeys immunized with intertypic

chimeric dengue viruses are protected against wild-type virus challenge. J Virol 70,

4162-4166.

Bray, M., Men, R., Tokimatsu, I., and Lai, C. J. (1998). Genetic determinants

responsible for acquisition of dengue type 2 virus mouse neurovirulence. J Virol 72,

1647-1651.

Bray, M., Zhao, B. T., Markoff, L., Eckels, K. H., Chanock, R. M., and Lai, C. J.

(1989). Mice immunized with recombinant vaccinia virus expressing dengue 4 virus

structural proteins with or without nonstructural protein NS1 are protected against

fatal dengue virus encephalitis. J Virol 63, 2853-2856.

Bressanelli, S., Stiasny, K., Allison, S. L., Stura, E. A., Duquerroy, S., Lescar, J.,

Heinz, F. X., and Rey, F. A. (2004). Structure of a flavivirus envelope glycoprotein

in its low-pH-induced membrane fusion conformation. Embo J 23, 728-738.

222

Brinkworth, R. I., Fairlie, D. P., Leung, D., and Young, P. R. (1999). Homology

model of the dengue 2 virus NS3 protease: putative interactions with both substrate

and NS2B cofactor. J Gen Virol 80, 1167-1177.

Buckley, A., and Gould, E. A. (1985). Neutralization of yellow fever virus studied

using monoclonal and polyclonal antibodies. J Gen Virol 66, 2523-2531.

Burke, K. L., Dunn, G., Ferguson, M., Minor, P. D., and Almond, J. W. (1988).

Antigen chimaeras of poliovirus as potential new vaccines. Nature 332, 81-82.

Butrapet, S., Huang, C. Y., Pierro, D. J., Bhamarapravati, N., Gubler, D. J., and

Kinney, R. M. (2000). Attenuation markers of a candidate dengue type 2 vaccine

virus, strain 16681 (PDK-53), are defined by mutations in the 5' noncoding region

and nonstructural proteins 1 and 3. J Virol 74, 3011-3019.

Cahour, A., Pletnev, A., Vazielle-Falcoz, M., Rosen, L., and Lai, C. J. (1995).

Growth-restricted dengue virus mutants containing deletions in the 5' noncoding

region of the RNA genome. Virology 207, 68-76.

Calarota, S., Bratt, G., Nordlund, S., Hinkula, J., Leandersson, A. C., Sandstrom, E.,

and Wahren, B. (1998). Cellular cytotoxic response induced by DNA vaccination in

HIV-1-infected patients. Lancet 351, 1320-1325.

Cane, P. A., and Gould, E. A. (1988a). Reduction of yellow fever virus mouse

neurovirulence by immunization with a bacterially synthesized non-structural protein

(NS1) fragment. J Gen Virol 69, 1241-1246.

Cane, P. A., and Gould, E. A. (1988b). Reduction of yellow fever virus mouse

neurovirulence by immunization with a bacterially synthesized non-structural protein

(NS1) fragment. J Gen Virol 69, 1241-1246.

Cardon, L. R., Burge, C., Clayton, D. A., and Karlin, S. (1994). Pervasive CpG

suppression in animal mitochondrial genomes. Proc Natl Acad Sci U S A 91, 3799-

3803.

223

Carroll, M. W., and Moss, B. (1997). Host range and cytopathogenicity of the highly

attenuated MVA strain of vaccinia virus: propagation and generation of recombinant

viruses in a nonhuman mammalian cell line. Virology 238, 198-211.

Cecilia, D., and Gould, E. A. (1991). Nucleotide changes responsible for loss of

neuroinvasiveness in Japanese encephalitis virus neutralization-resistant mutants.

Virology 181, 70-77.

Chace, J. H., Hooker, N. A., Mildenstein, K. L., Krieg, A. M., and Cowdery, J. S.

(1997). Bacterial DNA-induced NK cell IFN-gamma production is dependent on

macrophage secretion of IL-12. Clin Immunol Immunopathol 84, 185-193.

Chambers, T. J., Hahn, C. S., Galler, R., and Rice, C. M. (1990a). Flavivirus genome

organization, expression, and replication. Annu Rev Microbiol 44, 649-688.

Chambers, T. J., Nestorowicz, A., Mason, P. W., and Rice, C. M. (1999). Yellow

fever/Japanese encephalitis chimeric viruses: construction and biological properties.

J Virol 73, 3095-3101.

Chambers, T. J., Tsai, T. F., Pervikov, Y., and Monath, T. P. (1997). Vaccine

development against dengue and Japanese encephalitis: report of a World Health

Organization meeting. Vaccine 15, 1494-1502.

Chambers, T. J., Weir, R. C., Grakoui, A., McCourt, D. W., Bazan, J. F., Fletterick,

R. J., and Rice, C. M. (1990b). Evidence that the N-terminal domain of nonstructural

protein NS3 from yellow fever virus is a serine protease responsible for site-specific

cleavages in the viral polyprotein. Proc Natl Acad Sci U S A 87, 8898-8902.

Chang, G. J. (1997). Molecular biology of dengue viruses. In Dengue and dengue

hemorrhagic fever, D. J. Gubler, and G. Kuno, eds. (CAB International), pp. 175-

198.

224

Chang, G. J., Hunt, A. R., and Davis, B. (2000). A single intramuscular injection of

recombinant plasmid DNA induces protective immunity and prevents Japanese

encephalitis in mice. J Virol 74, 4244-4252.

Chang, G. J., Hunt, A. R., Holmes, D. A., Springfield, T., Chiueh, T. S., Roehrig, J.

T., and Gubler, D. J. (2003). Enhancing biosynthesis and secretion of premembrane

and envelope proteins by the chimeric plasmid of dengue virus type 2 and Japanese

encephalitis virus. Virology 306, 170-180.

Charlier, N., Molenkamp, R., Leyssen, P., Vandamme, A. M., Clercq, E. D.,

Bredenbeek, P., and Neyts, J. (2003). A rapid and convenient variant of fusion-PCR

to construct chimeric flaviviruses. J Virol Methods 108, 67-74.

Chaturvedi, P., Mukherjee, R., Chaturvedi, U. C., and Mathur, A. (1991a). Dengue

virus-induced helper cytokine has two polypeptide chains which bear different

determinants. Int J Exp Pathol 72, 665-672.

Chaturvedi, P., Mukherjee, R., Chaturvedi, U. C., and Mathur, A. (1992).

Characterization of the dengue virus-induced helper cytokine. Int J Exp Pathol 73,

263-272.

Chaturvedi, U. C., Agarwalb, R., Elbishbishia, E. A., and Mustafaa, A. S. (2000).

Cytokine cascade in dengue hemorrhagic fever: implications for pathogenesis.

FEMS Immunol Med Microbiol 28, 183-188.

Chaturvedi, U. C., Dhawan, R., Khanna, M., and Mathur, A. (1991b). Breakdown of

the blood-brain barrier during dengue virus infection of mice. J Gen Virol 72, 859-

866.

Chaturvedi, U. C., Dhawan, R., and Mukherjee, R. (1997). Immunosuppression and

cytotoxicity of dengue infection in the mouse model. In Dengue and dengue

hemorrhagic fever, D. J. Gubler, and G. Kuno, eds. (CAB International), pp. 291-

311.

225

Chaturvedi, U. C., Elbishbishi, E. A., Agarwal, R., Raghupathy, R., Nagar, R.,

Tandon, R., Pacsa, A. S., Younis, O. I., and Azizieh, F. (1999). Sequential

production of cytokines by dengue virus-infected human peripheral blood leukocyte

cultures. J Med Virol 59, 335-340.

Chen, H. W., Pan, C. H., Huan, H. W., Liau, M. Y., Chiang, J. R., and Tao, M. H.

(2001a). Suppression of immune response and protective immunity to a Japanese

encephalitis virus DNA vaccine by coadministration of an IL-12-expressing plasmid.

J Immunol 166, 7419-7426.

Chen, H. W., Pan, C. H., Liau, M. Y., Jou, R., Tsai, C. J., Wu, H. J., Lin, Y. L., and

Tao, M. H. (1999). Screening of protective antigens of Japanese encephalitis virus by

DNA immunization: a comparative study with conventional viral vaccines. J Virol

73, 10137-10145.

Chen, Y., Lenert, P., Weeratna, R., McCluskie, M., Wu, T., Davis, H. L., and Krieg,

A. M. (2001b). Identification of methylated CpG motifs as inhibitors of the immune

stimulatory CpG motifs. Gene Ther 8, 1024-1032.

Chia, S. C., Leung, P. S., Liao, C. P., Huang, J. H., and Lee, S. T. (2001). Fragment

of Japanese encephalitis virus envelope protein produced in Escherichia coli protects

mice from virus challenge. Microb Pathog 31, 9-19.

Chu, P. W., and Westaway, E. G. (1985). Replication strategy of Kunjin virus:

evidence for recycling role of replicative form RNA as template in semiconservative

and asymmetric replication. Virology 140, 68-79.

Chungue, E., Deubel, V., Cassar, O., Laille, M., and Martin, P. M. (1993). Molecular

epidemiology of dengue 3 viruses and genetic relatedness among dengue 3 strains

isolated from patients with mild or severe form of dengue fever in French Polynesia.

J Gen Virol 74, 2765-2770.

Cichutek, K. (2000). DNA vaccines: development, standardization and regulation.

Intervirology 43, 331-338.

226

Clum, S., Ebner, K. E., and Padmanabhan, R. (1997). Cotranslational membrane

insertion of the serine proteinase precursor NS2B-NS3(Pro) of dengue virus type 2 is

required for efficient in vitro processing and is mediated through the hydrophobic

regions of NS2B. J Biol Chem 272, 30715-30723.

Cologna, R., and Rico-Hesse, R. (2003). American genotype structures decrease

dengue virus output from human monocytes and dendritic cells. J Virol 77, 3929-

3938.

Colombage, G., Hall, R., Pavy, M., and Lobigs, M. (1998). DNA-based and

alphavirus-vectored immunisation with prM and E proteins elicits long-lived and

protective immunity against the flavivirus, Murray Valley encephalitis virus.

Virology 250, 151-163.

Corver, J., Ortiz, A., Allison, S. L., Schalich, J., Heinz, F. X., and Wilschut, J.

(2000). Membrane fusion activity of tick-borne encephalitis virus and recombinant

subviral particles in a liposomal model system. Virology 269, 37-46.

Coutelier, J. P., van der Logt, J. T., Heessen, F. W., Warnier, G., and Van Snick, J.

(1987). IgG2a restriction of murine antibodies elicited by viral infections. J Exp Med

165, 64-69.

Dar, L., Broor, S., Sengupta, S., Xess, I., and Seth, P. (1999). The first major

outbreak of dengue hemorrhagic fever in Delhi, India. Emerg Infect Dis 5, 589-590.

Davis, B. S., Chang, G. J., Cropp, B., Roehrig, J. T., Martin, D. A., Mitchell, C. J.,

Bowen, R., and Bunning, M. L. (2001). West Nile virus recombinant DNA vaccine

protects mouse and horse from virus challenge and expresses in vitro a noninfectious

recombinant antigen that can be used in enzyme-linked immunosorbent assays. J

Virol 75, 4040-4047.

227

Delenda, C., Frenkiel, M. P., and Deubel, V. (1994a). Protective efficacy in mice of

a secreted form of recombinant dengue-2 virus envelope protein produced in

baculovirus infected insect cells. Arch Virol 139, 197-207.

Delenda, C., Staropoli, I., Frenkiel, M. P., Cabanie, L., and Deubel, V. (1994b).

Analysis of C-terminally truncated dengue 2 and dengue 3 virus envelope

glycoproteins: processing in insect cells and immunogenic properties in mice. J Gen

Virol 75, 1569-1578.

Delogu, G., Li, A., Repique, C., Collins, F., and Morris, S. L. (2002). DNA vaccine

combinations expressing either tissue plasminogen activator signal sequence fusion

proteins or ubiquitin-conjugated antigens induce sustained protective immunity in a

mouse model of pulmonary tuberculosis. Infect Immun 70, 292-302.

Despres, P., Dietrich, J., Girard, M., and Bouloy, M. (1991). Recombinant

baculoviruses expressing yellow fever virus E and NS1 proteins elicit protective

immunity in mice. J Gen Virol 72, 2811-2816.

Dharakul, T., Kurane, I., Bhamarapravati, N., Yoksan, S., Vaughn, D. W., Hoke, C.

H., and Ennis, F. A. (1994). Dengue virus-specific memory T cell responses in

human volunteers receiving a live attenuated dengue virus type 2 candidate vaccine.

J Infect Dis 170, 27-33.

Dimmock, N. J. (1993). Neutralization of animal viruses. Curr Top Microbiol

Immunol 183, 1-149.

Dokland, T., Walsh, M., Mackenzie, J. M., Khromykh, A. A., Ee, K. H., and Wang,

S. (2004). West Nile virus core protein; tetramer structure and ribbon formation.

Structure (Camb) 12, 1157-1163.

Donnelly, J. J., Ulmer, J. B., and Liu, M. A. (1998). DNA vaccines. Dev Biol Stand

95, 43-53.

228

Donnelly, J. J., Ulmer, J. B., Shiver, J. W., and Liu, M. A. (1997). DNA vaccines.

Annu Rev Immunol 15, 617-648.

Dung, N. M., Day, N. P., Tam, D. T., Loan, H. T., Chau, H. T., Minh, L. N., Diet, T.

V., Bethell, D. B., Kneen, R., Hien, T. T., et al. (1999). Fluid replacement in dengue

shock syndrome: a randomized, double-blind comparison of four intravenous-fluid

regimens. Clin Infect Dis 29, 787-794.

Durbin, A. P., Karron, R. A., Sun, W., Vaughn, D. W., Reynolds, M. J., Perreault, J.

R., Thumar, B., Men, R., Lai, C. J., Elkins, W. R., et al. (2001). Attenuation and

immunogenicity in humans of a live dengue virus type-4 vaccine candidate with a 30

nucleotide deletion in its 3'-untranslated region. Am J Trop Med Hyg 65, 405-413.

Eckels, K. H., Dubois, D. R., Putnak, R., Vaughn, D. W., Innis, B. L., Henchal, E.

A., and Hoke, C. H., Jr. (2003). Modification of dengue virus strains by passage in

primary dog kidney cells: preparation of candidate vaccines and immunization of

monkeys. Am J Trop Med Hyg 69, 12-16.

Edelman, R., Tacket, C. O., Wasserman, S. S., Vaughn, D. W., Eckels, K. H.,

Dubois, D. R., Summers, P. L., and Hoke, C. H. (1994). A live attenuated dengue-1

vaccine candidate (45AZ5) passaged in primary dog kidney cell culture is attenuated

and immunogenic for humans. J Infect Dis 170, 1448-1455.

Edelman, R., Wasserman, S. S., Bodison, S. A., Putnak, R. J., Eckels, K. H., Tang,

D., Kanesa-Thasan, N., Vaughn, D. W., Innis, B. L., and Sun, W. (2003). Phase I

trial of 16 formulations of a tetravalent live-attenuated dengue vaccine. Am J Trop

Med Hyg 69, 48-60.

Egloff, M. P., Benarroch, D., Selisko, B., Romette, J. L., and Canard, B. (2002). An

RNA cap (nucleoside-2'-O-)-methyltransferase in the flavivirus RNA polymerase

NS5: crystal structure and functional characterization. Embo J 21, 2757-2768.

229

Elshuber, S., Allison, S. L., Heinz, F. X., and Mandl, C. W. (2003). Cleavage of

protein prM is necessary for infection of BHK-21 cells by tick-borne encephalitis

virus. J Gen Virol 84, 183-191.

Falconar, A. K. (1999). Identification of an epitope on the dengue virus membrane

(M) protein defined by cross-protective monoclonal antibodies: design of an

improved epitope sequence based on common determinants present in both envelope

(E and M) proteins. Arch Virol 144, 2313-2330.

Falgout, B., Chanock, R., and Lai, C. J. (1989). Proper processing of dengue virus

nonstructural glycoprotein NS1 requires the N-terminal hydrophobic signal sequence

and the downstream nonstructural protein NS2a. J Virol 63, 1852-1860.

Falgout, B., and Markoff, L. (1995). Evidence that flavivirus NS1-NS2A cleavage is

mediated by a membrane-bound host protease in the endoplasmic reticulum. J Virol

69, 7232-7243.

Falgout, B., Pethel, M., Zhang, Y. M., and Lai, C. J. (1991). Both nonstructural

proteins NS2B and NS3 are required for the proteolytic processing of dengue virus

nonstructural proteins. J Virol 65, 2467-2475.

Feltquate, D. M., Heaney, S., Webster, R. G., and Robinson, H. L. (1997). Different

T helper cell types and antibody isotypes generated by saline and gene gun DNA

immunization. J Immunol 158, 2278-2284.

Ferlenghi, I., Clarke, M., Ruttan, T., Allison, S. L., Schalich, J., Heinz, F. X.,

Harrison, S. C., Rey, F. A., and Fuller, S. D. (2001). Molecular organization of a

recombinant subviral particle from tick-borne encephalitis virus. Mol Cell 7, 593-

602.

Fiedler, S., and Wirth, R. (1988). Transformation of bacteria with plasmid DNA by

electroporation. Anal Biochem 170, 38-44.

230

Fonseca, B. A., Pincus, S., Shope, R. E., Paoletti, E., and Mason, P. W. (1994).

Recombinant vaccinia viruses co-expressing dengue-1 glycoproteins prM and E

induce neutralizing antibodies in mice [published erratum appears in Vaccine 1994

Apr;12(5):480]. Vaccine 12, 279-285.

Gagnon, S. J., Ennis, F. A., and Rothman, A. L. (1999). Bystander target cell lysis

and cytokine production by dengue virus-specific human CD4(+) cytotoxic T-

lymphocyte clones. J Virol 73, 3623-3629.

Gagnon, S. J., Zeng, W., Kurane, I., and Ennis, F. A. (1996). Identification of two

epitopes on the dengue 4 virus capsid protein recognized by a serotype-specific and a

panel of serotype-cross-reactive human CD4+ cytotoxic T-lymphocyte clones. J

Virol 70, 141-147.

Gamble, J., Bethell, D., Day, N. P., Loc, P. P., Phu, N. H., Gartside, I. B., Farrar, J.

F., and White, N. J. (2000). Age-related changes in microvascular permeability: a

significant factor in the susceptibility of children to shock? Clin Sci (Lond) 98, 211-

216.

Gentry, M. K., Henchal, E. A., McCown, J. M., Brandt, W. E., and Dalrymple, J. M.

(1982). Identification of distinct antigenic determinants on dengue-2 virus using

monoclonal antibodies. Am J Trop Med Hyg 31, 548-555.

George, R., and Lum, L. C. S. (1997). Clinical spectrum of dengue infection. In

Dengue and dengue hemorrhagic fever, D. J. Gubler, and G. Kuno, eds. (CAB

International), pp. 89-113.

Gomez-Puertas, P., and Escribano, J. M. (1997). Blocking antibodies inhibit

complete African swine fever virus neutralization. Virus Res 49, 115-122.

Gorbalenya, A. E., Donchenko, A. P., Koonin, E. V., and Blinov, V. M. (1989). N-

terminal domains of putative helicases of flavi- and pestiviruses may be serine

proteases. Nucleic Acids Res 17, 3889-3897.

231

Gould, E. A., Buckley, A., Barrett, A. D., and Cammack, N. (1986). Neutralizing

(54K) and non-neutralizing (54K and 48K) monoclonal antibodies against structural

and non-structural yellow fever virus proteins confer immunity in mice. J Gen Virol

67, 591-595.

Green, S., Kurane, I., Edelman, R., Tacket, C. O., Eckels, K. H., Vaughn, D. W.,

Hoke, C. H., Jr., and Ennis, F. A. (1993). Dengue virus-specific human CD4+ T-

lymphocyte responses in a recipient of an experimental live-attenuated dengue virus

type 1 vaccine: bulk culture proliferation, clonal analysis, and precursor frequency

determination. J Virol 67, 5962-5967.

Green, S., Vaughn, D. W., Kalayanarooj, S., Nimmannitya, S., Suntayakorn, S.,

Nisalak, A., Lew, R., Innis, B. L., Kurane, I., Rothman, A. L., and Ennis, F. A.

(1999). Early immune activation in acute dengue illness is related to development of

plasma leakage and disease severity. J Infect Dis 179, 755-762.

Gritsun, T. S., and Gould, E. A. (1995). Infectious transcripts of tick-borne

encephalitis virus, generated in days by RT-PCR. Virology 214, 611-618.

Gritsun, T. S., and Gould, E. A. (1998). Development and analysis of a tick-borne

encephalitis virus infectious clone using a novel and rapid strategy. J Virol Methods

76, 109-120.

Gruenberg, A., and Wright, P. J. (1992). Processing of dengue virus type 2 structural

proteins containing deletions in hydrophobic domains. Arch Virol 122, 77-94.

Gualano, R. C., Pryor, M. J., Cauchi, M. R., Wright, P. J., and Davidson, A. D.

(1998). Identification of a major determinant of mouse neurovirulence of dengue

virus type 2 using stably cloned genomic-length cDNA. J Gen Virol 79, 437-446.

Gubler, D. J. (1997). Dengue and dengue hemorrhagic fever: its history and

resurgence as a global public health problem. In Dengue and dengue hemorrhagic

fever, D. J. Gubler, and G. Kuno, eds. (CAB International), pp. 1-22.

232

Gubler, D. J. (1998). Dengue and dengue hemorrhagic fever. Clin Microbiol Rev 11,

480-496.

Guirakhoo, F., Arroyo, J., Pugachev, K. V., Miller, C., Zhang, Z. X., Weltzin, R.,

Georgakopoulos, K., Catalan, J., Ocran, S., Soike, K., et al. (2001). Construction,

safety, and immunogenicity in nonhuman primates of a chimeric yellow fever-

dengue virus tetravalent vaccine. J Virol 75, 7290-7304.

Guirakhoo, F., Pugachev, K., Arroyo, J., Miller, C., Zhang, Z. X., Weltzin, R.,

Georgakopoulos, K., Catalan, J., Ocran, S., Draper, K., and Monath, T. P. (2002).

Viremia and immunogenicity in nonhuman primates of a tetravalent yellow fever-

dengue chimeric vaccine: genetic reconstructions, dose adjustment, and antibody

responses against wild-type dengue virus isolates. Virology 298, 146-159.

Guirakhoo, F., Pugachev, K., Zhang, Z., Myers, G., Levenbook, I., Draper, K., Lang,

J., Ocran, S., Mitchell, F., Parsons, M., et al. (2004). Safety and efficacy of chimeric

yellow Fever-dengue virus tetravalent vaccine formulations in nonhuman primates. J

Virol 78, 4761-4775.

Guirakhoo, F., Weltzin, R., Chambers, T. J., Zhang, Z. X., Soike, K., Ratterree, M.,

Arroyo, J., Georgakopoulos, K., Catalan, J., and Monath, T. P. (2000). Recombinant

chimeric yellow fever-dengue type 2 virus is immunogenic and protective in

nonhuman primates. J Virol 74, 5477-5485.

Guirakhoo, F., Zhang, Z. X., Chambers, T. J., Delagrave, S., Arroyo, J., Barrett, A.

D., and Monath, T. P. (1999). Immunogenicity, genetic stability, and protective

efficacy of a recombinant, chimeric yellow fever-Japanese encephalitis virus

(ChimeriVax-JE) as a live, attenuated vaccine candidate against Japanese

encephalitis. Virology 257, 363-372.

Gupta, R. K., and Siber, G. R. (1995). Method for quantitation of IgG subclass

antibodies in mouse serum by enzyme-linked immunosorbent assay. J Immunol

Methods 181, 75-81.

233

Hacker, H., Vabulas, R. M., Takeuchi, O., Hoshino, K., Akira, S., and Wagner, H.

(2000). Immune cell activation by bacterial CpG-DNA through myeloid

differentiation marker 88 and tumor necrosis factor receptor-associated factor

(TRAF)6. J Exp Med 192, 595-600.

Haddad, D., Ramprakash, J., Sedegah, M., Charoenvit, Y., Baumgartner, R., Kumar,

S., Hoffman, S. L., and Weiss, W. R. (2000). Plasmid vaccine expressing

granulocyte-macrophage colony-stimulating factor attracts infiltrates including

immature dendritic cells into injected muscles. J Immunol 165, 3772-3781.

Hahn, C. S., Hahn, Y. S., Rice, C. M., Lee, E., Dalgarno, L., Strauss, E. G., and

Strauss, J. H. (1987). Conserved elements in the 3' untranslated region of flavivirus

RNAs and potential cyclization sequences. J Mol Biol 198, 33-41.

Hall, R. A., Nisbet, D. J., Pham, K. B., Pyke, A. T., Smith, G. A., and Khromykh, A.

A. (2003). DNA vaccine coding for the full-length infectious Kunjin virus RNA

protects mice against the New York strain of West Nile virus. Proc Natl Acad Sci U

S A 100, 10460-10464.

Halstead, S. B. (1988). Pathogenesis of dengue: challenges to molecular biology.

Science 239, 476-481.

Halstead, S. B., Nimmannitya, S., and Cohen, S. N. (1970). Observations related to

pathogenesis of dengue hemorrhagic fever. IV. Relation of disease severity to

antibody response and virus recovered. Yale J Biol Med 42, 311-328.

Halstead, S. B., and O'Rourke, E. J. (1977a). Antibody-enhanced dengue virus

infection in primate leukocytes. Nature 265, 739-741.

Halstead, S. B., and O'Rourke, E. J. (1977b). Dengue viruses and mononuclear

phagocytes. I. Infection enhancement by non-neutralizing antibody. J Exp Med 146,

201-217.

234

Halstead, S. B., Venkateshan, C. N., Gentry, M. K., and Larsen, L. K. (1984).

Heterogeneity of infection enhancement of dengue 2 strains by monoclonal

antibodies. J Immunol 132, 1529-1532.

Han, J., Zhu, Z., Hsu, C., and Finley, W. H. (1994). Selection of antisense

oligonucleotides on the basis of genomic frequency of the target sequence. Antisense

Res Dev 4, 53-65.

Hanahan, D. (1983). Studies on transformation of Escherichia coli with plasmids. J

Mol Biol 166, 557-580.

Hanley, K. A., Manlucu, L. R., Gilmore, L. E., Blaney, J. E., Jr., Hanson, C. T.,

Murphy, B. R., and Whitehead, S. S. (2003). A trade-off in replication in mosquito

versus mammalian systems conferred by a point mutation in the NS4B protein of

dengue virus type 4. Virology 312, 222-232.

Hanley, K. A., Manlucu, L. R., Manipon, G. G., Hanson, C. T., Whitehead, S. S.,

Murphy, B. R., and Blaney, J. E., Jr. (2004). Introduction of mutations into the non-

structural genes or 3' untranslated region of an attenuated dengue virus type 4

vaccine candidate further decreases replication in rhesus monkeys while retaining

protective immunity. Vaccine 22, 3440-3448.

Hartmann, G., and Krieg, A. M. (1999). CpG DNA and LPS induce distinct patterns

of activation in human monocytes. Gene Ther 6, 893-903.

Hartmann, G., and Krieg, A. M. (2000). Mechanism and function of a newly

identified CpG DNA motif in human primary B cells. J Immunol 164, 944-953.

Hartmann, G., Weiner, G. J., and Krieg, A. M. (1999). CpG DNA: a potent signal for

growth, activation, and maturation of human dendritic cells. Proc Natl Acad Sci U S

A 96, 9305-9310.

Hegner, M., von Kieckebusch-Guck, A., Falchetto, R., James, P., Semenza, G., and

Mantei, N. (1992). Single amino acid substitutions can convert the uncleaved signal-

235

anchor of sucrase-isomaltase to a cleaved signal sequence. J Biol Chem 267, 16928-

16933.

Heinz, F. X., and Allison, S. L. (2000). Structures and mechanisms in flavivirus

fusion. Adv Virus Res 55, 231-269.

Heinz, F. X., and Allison, S. L. (2001). The machinery for flavivirus fusion with host

cell membranes. Curr Opin Microbiol 4, 450-455.

Heinz, F. X., Allison, S. L., Stiasny, K., Schalich, J., Holzmann, H., Mandl, C. W.,

and Kunz, C. (1995). Recombinant and virion-derived soluble and particulate

immunogens for vaccination against tick-borne encephalitis. Vaccine 13, 1636-1642.

Heinz, F. X., Berger, R., Tuma, W., and Kunz, C. (1983). A topological and

functional model of epitopes on the structural glycoprotein of tick-borne encephalitis

virus defined by monoclonal antibodies. Virology 126, 525-537.

Heinz, F. X., Kunz, C., and Fauma, H. (1980). Preparation of a highly purified

vaccine against tick-borne encephalitis by continuous flow zonal ultracentrifugation.

J Med Virol 6, 213-221.

Hellen, C. U., Krausslich, H. G., and Wimmer, E. (1989). Proteolytic processing of

polyproteins in the replication of RNA viruses. Biochemistry 28, 9881-9890.

Hemmi, H., Kaisho, T., Takeda, K., and Akira, S. (2003). The roles of Toll-like

receptor 9, MyD88, and DNA-dependent protein kinase catalytic subunit in the

effects of two distinct CpG DNAs on dendritic cell subsets. J Immunol 170, 3059-

3064.

Hemmi, H., Takeuchi, O., Kawai, T., Kaisho, T., Sato, S., Sanjo, H., Matsumoto, M.,

Hoshino, K., Wagner, H., Takeda, K., and Akira, S. (2000). A Toll-like receptor

recognizes bacterial DNA. Nature 408, 740-745.

236

Henchal, E. A., and Putnak, J. R. (1990). The dengue viruses. Clin Microbiol Rev 3,

376-396.

Henderson, B. E., Cheshire, P. P., Kirya, G. B., and Lule, M. (1970). Immunologic

studies with yellow fever and selected African group B arboviruses in rhesus and

vervet monkeys. Am J Trop Med Hyg 19, 110-118.

Hiramatsu, K., Tadano, M., Men, R., and Lai, C. J. (1996). Mutational analysis of a

neutralization epitope on the dengue type 2 virus (DEN2) envelope protein:

monoclonal antibody resistant DEN2/DEN4 chimeras exhibit reduced mouse

neurovirulence. Virology 224, 437-445.

Hober, D., Delannoy, A. S., Benyoucef, S., De Groote, D., and Wattre, P. (1996).

High levels of sTNFR p75 and TNF alpha in dengue-infected patients. Microbiol

Immunol 40, 569-573.

Hober, D., Poli, L., Roblin, B., Gestas, P., Chungue, E., Granic, G., Imbert, P.,

Pecarere, J. L., Vergez-Pascal, R., Wattre, P., and et al. (1993). Serum levels of

tumor necrosis factor-alpha (TNF-alpha), interleukin-6 (IL-6), and interleukin-1 beta

(IL-1 beta) in dengue-infected patients. Am J Trop Med Hyg 48, 324-331.

Hoke, C. H., Jr., Malinoski, F. J., Eckels, K. H., Scott, R. M., Dubois, D. R.,

Summers, P. L., Simms, T., Burrous, J., Hasty, S. E., and Bancroft, W. H. (1990).

Preparation of an attenuated dengue 4 (341750 Carib) virus vaccine. II. Safety and

immunogenicity in humans. Am J Trop Med Hyg 43, 219-226.

Hoke, C. H., Nisalak, A., Sangawhipa, N., Jatanasen, S., Laorakapongse, T., Innis,

B. L., Kotchasenee, S., Gingrich, J. B., Latendresse, J., Fukai, K., and et al. (1988).

Protection against Japanese encephalitis by inactivated vaccines. N Engl J Med 319,

608-614.

Holzmann, H., Stiasny, K., Ecker, M., Kunz, C., and Heinz, F. X. (1997).

Characterization of monoclonal antibody-escape mutants of tick-borne encephalitis

virus with reduced neuroinvasiveness in mice. J Gen Virol 78, 31-37.

237

Hornung, V., Rothenfusser, S., Britsch, S., Krug, A., Jahrsdorfer, B., Giese, T.,

Endres, S., and Hartmann, G. (2002). Quantitative expression of toll-like receptor 1-

10 mRNA in cellular subsets of human peripheral blood mononuclear cells and

sensitivity to CpG oligodeoxynucleotides. J Immunol 168, 4531-4537.

Huang, C. Y., Butrapet, S., Pierro, D. J., Chang, G. J., Hunt, A. R., Bhamarapravati,

N., Gubler, D. J., and Kinney, R. M. (2000). Chimeric dengue type 2 (vaccine strain

PDK-53)/dengue type 1 virus as a potential candidate dengue type 1 virus vaccine. J

Virol 74, 3020-3028.

Huang, C. Y., Butrapet, S., Tsuchiya, K. R., Bhamarapravati, N., Gubler, D. J., and

Kinney, R. M. (2003). Dengue 2 PDK-53 virus as a chimeric carrier for tetravalent

dengue vaccine development. J Virol 77, 11436-11447.

Hurrelbrink, R. J., Nestorowicz, A., and McMinn, P. C. (1999). Characterization of

infectious Murray Valley encephalitis virus derived from a stably cloned genome-

length cDNA. J Gen Virol 80, 3115-3125.

Igarashi, A. (1978). Isolation of a Singh's Aedes albopictus cell clone sensitive to

Dengue and Chikungunya viruses. J Gen Virol 40, 531-544.

Ishimine, T., Tadano, M., Fukunaga, T., and Okuno, Y. (1987). An improved

micromethod for infectivity assays and neutralization tests of dengue viruses. Biken

J 30, 39-44.

Jakob, T., Walker, P. S., Krieg, A. M., Udey, M. C., and Vogel, J. C. (1998).

Activation of cutaneous dendritic cells by CpG-containing oligodeoxynucleotides: a

role for dendritic cells in the augmentation of Th1 responses by immunostimulatory

DNA. J Immunol 161, 3042-3049.

Jianmin, Z., Linn, M. L., Bulich, R., Gentry, M. K., and Aaskov, J. G. (1995).

Analysis of functional epitopes on the dengue 2 envelope (E) protein using

monoclonal IgM antibodies. Arch Virol 140, 899-913.

238

Jones, C. T., Ma, L., Burgner, J. W., Groesch, T. D., Post, C. B., and Kuhn, R. J.

(2003). Flavivirus capsid is a dimeric alpha-helical protein. J Virol 77, 7143-7149.

Kanesa-Thasan, N., Edelman, R., Tacket, C. O., Wasserman, S. S., Vaughn, D. W.,

Coster, T. S., Kim-Ahn, G. J., Dubois, D. R., Putnak, J. R., King, A., et al. (2003).

Phase 1 studies of Walter Reed Army Institute of Research candidate attenuated

dengue vaccines: selection of safe and immunogenic monovalent vaccines. Am J


Kanesa-thasan, N., Smucny, J. J., Hoke, C. H., Marks, D. H., Konishi, E., Kurane, I.,

Tang, D. B., Vaughn, D. W., Mason, P. W., and Shope, R. E. (2000). Safety and

immunogenicity of NYVAC-JEV and ALVAC-JEV attenuated recombinant

Japanese encephalitis virus--poxvirus vaccines in vaccinia-nonimmune and vaccinia-

immune humans. Vaccine 19, 483-491.

Kanesa-thasan, N., Sun, W., Kim-Ahn, G., Van Albert, S., Putnak, J. R., King, A.,

Raengsakulsrach, B., Christ-Schmidt, H., Gilson, K., Zahradnik, J. M., et al. (2001).

Safety and immunogenicity of attenuated dengue virus vaccines (Aventis Pasteur) in

human volunteers. Vaccine 19, 3179-3188.

Kapoor, M., Zhang, L., Mohan, P. M., and Padmanabhan, R. (1995). Synthesis and

characterization of an infectious dengue virus type-2 RNA genome (New Guinea C

strain). Gene 162, 175-180.

Karlin, S., Doerfler, W., and Cardon, L. R. (1994a). Why is CpG suppressed in the

genomes of virtually all small eukaryotic viruses but not in those of large eukaryotic

viruses? J Virol 68, 2889-2897.

Karlin, S., Ladunga, I., and Blaisdell, B. E. (1994b). Heterogeneity of genomes:

measures and values. Proc Natl Acad Sci U S A 91, 12837-12841.

Kaufman, B. M., Summers, P. L., Dubois, D. R., Cohen, W. H., Gentry, M. K.,

Timchak, R. L., Burke, D. S., and Eckels, K. H. (1989). Monoclonal antibodies for

239

dengue virus prM glycoprotein protect mice against lethal dengue infection. Am J


Kaur, R., Sachdeva, G., and Vrati, S. (2002). Plasmid DNA immunization against

Japanese encephalitis virus: immunogenicity of membrane-anchored and secretory

envelope protein. J Infect Dis 185, 1-12.

Keelapang, P., Sriburi, R., Supasa, S., Panyadee, N., Songjaeng, A., Jairungsri, A.,

Puttikhunt, C., Kasinrerk, W., Malasit, P., and Sittisombut, N. (2004). Alterations of

pr-M cleavage and virus export in pr-M junction chimeric dengue viruses. J Virol 78,

2367-2381.

Kelly, E. P., Greene, J. J., King, A. D., and Innis, B. L. (2000). Purified dengue 2

virus envelope glycoprotein aggregates produced by baculovirus are immunogenic in

mice. Vaccine 18, 2549-2559.

Khromykh, A. A., Kenney, M. T., and Westaway, E. G. (1998). trans-

Complementation of flavivirus RNA polymerase gene NS5 by using Kunjin virus

replicon-expressing BHK cells. J Virol 72, 7270-7279.

Khromykh, A. A., Meka, H., Guyatt, K. J., and Westaway, E. G. (2001a). Essential

role of cyclization sequences in flavivirus RNA replication. J Virol 75, 6719-6728.

Khromykh, A. A., Sedlak, P. L., and Westaway, E. G. (1999). trans-

Complementation analysis of the flavivirus Kunjin ns5 gene reveals an essential role

for translation of its N-terminal half in RNA replication. J Virol 73, 9247-9255.

Khromykh, A. A., Varnavski, A. N., Sedlak, P. L., and Westaway, E. G. (2001b).

Coupling between replication and packaging of flavivirus RNA: evidence derived

from the use of DNA-based full-length cDNA clones of Kunjin virus. J Virol 75,

4633-4640.

240

Khromykh, A. A., and Westaway, E. G. (1994). Completion of Kunjin virus RNA

sequence and recovery of an infectious RNA transcribed from stably cloned full-

length cDNA. J Virol 68, 4580-4588.

Kim, J. J., Trivedi, N. N., Nottingham, L. K., Morrison, L., Tsai, A., Hu, Y.,

Mahalingam, S., Dang, K., Ahn, L., Doyle, N. K., et al. (1998). Modulation of

amplitude and direction of in vivo immune responses by co-administration of

cytokine gene expression cassettes with DNA immunogens. Eur J Immunol 28,

1089-1103.

Kimura, R., and Hotta, S. (1944). Studies on dengue: anti-dengue active

immunisation experiments in mice. Japanese Journal of Bacteriology 1, 96-99.

Kinney, R. M., Butrapet, S., Chang, G. J., Tsuchiya, K. R., Roehrig, J. T.,

Bhamarapravati, N., and Gubler, D. J. (1997). Construction of infectious cDNA

clones for dengue 2 virus: strain 16681 and its attenuated vaccine derivative, strain

PDK-53. Virology 230, 300-308.

Kinney, R. M., and Huang, C. Y. (2001). Development of new vaccines against

dengue fever and Japanese encephalitis. Intervirology 44, 176-197.

Kitson, J. D., Burke, K. L., Pullen, L. A., Belsham, G. J., Almond, J. W., Minor, P.

D., Ferguson, M., Katrak, K., Wood, D., John, A., et al. (1991). Chimeric

polioviruses that include sequences derived from two independent antigenic sites of

foot-and-mouth disease virus (FMDV) induce neutralizing antibodies against FMDV

in guinea pigs. J Virol 65, 3068-3075.

Kliks, S. C., Nimmanitya, S., Nisalak, A., and Burke, D. S. (1988). Evidence that

maternal dengue antibodies are important in the development of dengue hemorrhagic

fever in infants. Am J Trop Med Hyg 38, 411-419.

Klinman, D. M., Takeno, M., Ichino, M., Gu, M., Yamshchikov, G., Mor, G., and

Conover, J. (1997a). DNA vaccines: safety and efficacy issues. Springer Semin

Immunopathol 19, 245-256.

241

Klinman, D. M., Yamshchikov, G., and Ishigatsubo, Y. (1997b). Contribution of

CpG motifs to the immunogenicity of DNA vaccines. J Immunol 158, 3635-3639.

Kochel, T., Wu, S. J., Raviprakash, K., Hobart, P., Hoffman, S., Porter, K., and

Hayes, C. (1997). Inoculation of plasmids expressing the dengue-2 envelope gene

elicit neutralizing antibodies in mice. Vaccine 15, 547-552.

Kochel, T. J., Raviprakash, K., Hayes, C. G., Watts, D. M., Russell, K. L., Gozalo,

A. S., Phillips, I. A., Ewing, D. F., Murphy, G. S., and Porter, K. R. (2000). A

dengue virus serotype-1 DNA vaccine induces virus neutralizing antibodies and

provides protection from viral challenge in Aotus monkeys. Vaccine 18, 3166-3173.

Kofler, R. M., Heinz, F. X., and Mandl, C. W. (2002). Capsid protein C of tick-borne

encephalitis virus tolerates large internal deletions and is a favorable target for

attenuation of virulence. J Virol 76, 3534-3543.

Kofler, R. M., Heinz, F. X., and Mandl, C. W. (2004). A novel principle of

attenuation for the development of new generation live flavivirus vaccines. Arch

Virol Suppl, 191-200.

Kofler, R. M., Leitner, A., O'Riordain, G., Heinz, F. X., and Mandl, C. W. (2003).

Spontaneous mutations restore the viability of tick-borne encephalitis virus mutants

with large deletions in protein C. J Virol 77, 443-451.

Kojima, Y., Xin, K. Q., Ooki, T., Hamajima, K., Oikawa, T., Shinoda, K., Ozaki, T.,

Hoshino, Y., Jounai, N., Nakazawa, M., et al. (2002). Adjuvant effect of multi-CpG

motifs on an HIV-1 DNA vaccine. Vaccine 20, 2857-2865.

Konishi, E., and Fujii, A. (2002). Dengue type 2 virus subviral extracellular particles

produced by a stably transfected mammalian cell line and their evaluation for a

subunit vaccine. Vaccine 20, 1058-1067.

242

Konishi, E., Fujii, A., and Mason, P. W. (2001). Generation and characterization of a

mammalian cell line continuously expressing Japanese encephalitis virus subviral

particles. J Virol 75, 2204-2212.

Konishi, E., Kurane, I., Mason, P. W., Shope, R. E., and Ennis, F. A. (1997a).

Poxvirus-based Japanese encephalitis vaccine candidates induce JE virus-specific

CD8+ cytotoxic T lymphocytes in mice. Virology 227, 353-360.

Konishi, E., Kurane, I., Mason, P. W., Shope, R. E., Kanesa-Thasan, N., Smucny, J.

J., Hoke, C. H., Jr., and Ennis, F. A. (1998a). Induction of Japanese encephalitis

virus-specific cytotoxic T lymphocytes in humans by poxvirus-based JE vaccine

candidates [published erratum appears in Vaccine 1999 Feb 5;17(5):I]. Vaccine 16,

842-849.

Konishi, E., and Mason, P. W. (1993). Proper maturation of the Japanese

encephalitis virus envelope glycoprotein requires cosynthesis with the premembrane

protein. J Virol 67, 1672-1675.

Konishi, E., Pincus, S., Fonseca, B. A., Shope, R. E., Paoletti, E., and Mason, P. W.

(1991). Comparison of protective immunity elicited by recombinant vaccinia viruses

that synthesize E or NS1 of Japanese encephalitis virus. Virology 185, 401-410.

Konishi, E., Pincus, S., Paoletti, E., Shope, R. E., Burrage, T., and Mason, P. W.

(1992). Mice immunized with a subviral particle containing the Japanese

encephalitis virus prM/M and E proteins are protected from lethal JEV infection.

Virology 188, 714-720.

Konishi, E., Pincus, S., Paoletti, E., Shope, R. E., and Wason, P. W. (1994). Avipox

virus-vectored Japanese encephalitis virus vaccines: use as vaccine candidates in

combination with purified subunit immunogens. Vaccine 12, 633-638.

Konishi, E., Terazawa, A., and Fujii, A. (2003). Evidence for antigen production in

muscles by dengue and Japanese encephalitis DNA vaccines and a relation to their

immunogenicity in mice. Vaccine 21, 3713-3720.

243

Konishi, E., Win, K. S., Kurane, I., Mason, P. W., Shope, R. E., and Ennis, F. A.

(1997b). Particulate vaccine candidate for Japanese encephalitis induces long-lasting

virus-specific memory T lymphocytes in mice. Vaccine 15, 281-286.

Konishi, E., Yamaoka, M., Khin Sane, W., Kurane, I., and Mason, P. W. (1998b).

Induction of protective immunity against Japanese encephalitis in mice by

immunization with a plasmid encoding Japanese encephalitis virus premembrane and

envelope genes. J Virol 72, 4925-4930.

Konishi, E., Yamaoka, M., Khin Sane, W., Kurane, I., Takada, K., and Mason, P. W.

(1999). The anamnestic neutralizing antibody response is critical for protection of

mice from challenge following vaccination with a plasmid encoding the Japanese

encephalitis virus premembrane and envelope genes. J Virol 73, 5527-5534.

Konishi, E., Yamaoka, M., Kurane, I., and Mason, P. W. (2000a). A DNA vaccine

expressing dengue type 2 virus premembrane and envelope genes induces

neutralizing antibody and memory B cells in mice. Vaccine 18, 1133-1139.

Konishi, E., Yamaoka, M., Kurane, I., and Mason, P. W. (2000b). Japanese

encephalitis DNA vaccine candidates expressing premembrane and envelope genes

induce virus-specific memory B cells and long-lasting antibodies in swine. Virology

268, 49-55.

Koonin, E. V. (1993). Computer-assisted identification of a putative

methyltransferase domain in NS5 protein of flaviviruses and lambda 2 protein of

reovirus. J Gen Virol 74 ( Pt 4), 733-740.

Krausslich, H. G., and Wimmer, E. (1988). Viral proteinases. Annu Rev Biochem

57, 701-754.

Krieg, A. M. (2002). CpG motifs in bacterial DNA and their immune effects. Annu

Rev Immunol 20, 709-760.

244

Krieg, A. M., Wu, T., Weeratna, R., Efler, S. M., Love-Homan, L., Yang, L., Yi, A.

K., Short, D., and Davis, H. L. (1998). Sequence motifs in adenoviral DNA block

immune activation by stimulatory CpG motifs. Proc Natl Acad Sci U S A 95, 12631-

12636.

Krieg, A. M., Yi, A. K., Matson, S., Waldschmidt, T. J., Bishop, G. A., Teasdale, R.,

Koretzky, G. A., and Klinman, D. M. (1995). CpG motifs in bacterial DNA trigger

direct B-cell activation. Nature 374, 546-549.

Krug, A., Rothenfusser, S., Hornung, V., Jahrsdorfer, B., Blackwell, S., Ballas, Z.

K., Endres, S., Krieg, A. M., and Hartmann, G. (2001). Identification of CpG

oligonucleotide sequences with high induction of IFN-alpha/beta in plasmacytoid

dendritic cells. Eur J Immunol 31, 2154-2163.

Kuhn, R. J., Zhang, W., Rossmann, M. G., Pletnev, S. V., Corver, J., Lenches, E.,

Jones, C. T., Mukhopadhyay, S., Chipman, P. R., Strauss, E. G., et al. (2002).

Structure of dengue virus: implications for flavivirus organization, maturation, and

fusion. Cell 108, 717-725.

Kuno, G., Chang, G. J., Tsuchiya, K. R., Karabatsos, N., and Cropp, C. B. (1998).

Phylogeny of the genus Flavivirus. J Virol 72, 73-83.

Kurane, I., Brinton, M. A., Samson, A. L., and Ennis, F. A. (1991a). Dengue virus-

specific, human CD4+ CD8- cytotoxic T-cell clones: multiple patterns of virus

cross-reactivity recognized by NS3-specific T-cell clones. J Virol 65, 1823-1828.

Kurane, I., Innis, B. L., Nimmannitya, S., Nisalak, A., Meager, A., Janus, J., and

Ennis, F. A. (1991b). Activation of T lymphocytes in dengue virus infections. High

levels of soluble interleukin 2 receptor, soluble CD4, soluble CD8, interleukin 2, and

interferon-gamma in sera of children with dengue. J Clin Invest 88, 1473-1480.

Kurane, I., Innis, B. L., Nisalak, A., Hoke, C., Nimmannitya, S., Meager, A., and

Ennis, F. A. (1989). Human T cell responses to dengue virus antigens. Proliferative

responses and interferon gamma production. J Clin Invest 83, 506-513.

245

Kurane, I., Okamoto, Y., Dai, L. C., Zeng, L. L., Brinton, M. A., and Ennis, F. A.

(1995). Flavivirus-cross-reactive, HLA-DR15-restricted epitope on NS3 recognized

by human CD4+ CD8- cytotoxic T lymphocyte clones. J Gen Virol 76 ( Pt 9), 2243-

2249.

Kurane, I., Rothman, A. L., Livingston, P. G., Green, S., Gagnon, S. J., Janus, J.,

Innis, B. L., Nimmannitya, S., Nisalak, A., and Ennis, F. A. (1994).

Immunopathologic mechanisms of dengue hemorrhagic fever and dengue shock

syndrome. Arch Virol Suppl 9, 59-64.

Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the

head of bacteriophage T4. Nature 227, 680-685.

Lai, C. J., Zhao, B. T., Hori, H., and Bray, M. (1991). Infectious RNA transcribed

from stably cloned full-length cDNA of dengue type 4 virus. Proc Natl Acad Sci U S

A 88, 5139-5143.

Lanciotti, R. S., Gubler, D. J., and Trent, D. W. (1997). Molecular evolution and

phylogeny of dengue-4 viruses. J Gen Virol 78, 2279-2284.

Lanciotti, R. S., Lewis, J. G., Gubler, D. J., and Trent, D. W. (1994). Molecular

evolution and epidemiology of dengue-3 viruses. J Gen Virol 75, 65-75.

Ledwith, B. J., Manam, S., Troilo, P. J., Barnum, A. B., Pauley, C. J., Griffiths, T.

G., 2nd, Harper, L. B., Beare, C. M., Bagdon, W. J., and Nichols, W. W. (2000).

Plasmid DNA vaccines: investigation of integration into host cellular DNA

following intramuscular injection in mice. Intervirology 43, 258-272.

Lee, E., Stocks, C. E., Amberg, S. M., Rice, C. M., and Lobigs, M. (2000).

Mutagenesis of the signal sequence of yellow fever virus prM protein: enhancement

of signalase cleavage In vitro is lethal for virus production. J Virol 74, 24-32.

246

Leitmeyer, K. C., Vaughn, D. W., Watts, D. M., Salas, R., Villalobos, I., de, C.,

Ramos, C., and Rico-Hesse, R. (1999). Dengue virus structural differences that

correlate with pathogenesis. J Virol 73, 4738-4747.

Lewis, J. G., Chang, G. J., Lanciotti, R. S., and Trent, D. W. (1992). Direct

sequencing of large flavivirus PCR products for analysis of genome variation and

molecular epidemiological investigations. J Virol Methods 38, 11-23.

Li, H., Clum, S., You, S., Ebner, K. E., and Padmanabhan, R. (1999a). The serine

protease and RNA-stimulated nucleoside triphosphatase and RNA helicase

functional domains of dengue virus type 2 NS3 converge within a region of 20

amino acids. J Virol 73, 3108-3116.

Li, Z., Howard, A., Kelley, C., Delogu, G., Collins, F., and Morris, S. (1999b).

Immunogenicity of DNA vaccines expressing tuberculosis proteins fused to tissue

plasminogen activator signal sequences. Infect Immun 67, 4780-4786.

Lin, C., Amberg, S. M., Chambers, T. J., and Rice, C. M. (1993). Cleavage at a

novel site in the NS4A region by the yellow fever virus NS2B-3 proteinase is a

prerequisite for processing at the downstream 4A/4B signalase site. J Virol 67, 2327-

2335.

Lin, Y. L., Chen, L. K., Liao, C. L., Yeh, C. T., Ma, S. H., Chen, J. L., Huang, Y. L.,

Chen, S. S., and Chiang, H. Y. (1998). DNA immunization with Japanese

encephalitis virus nonstructural protein NS1 elicits protective immunity in mice. J

Virol 72, 191-200.

Lindenbach, B. D., and Rice, C. M. (1999). Genetic interaction of flavivirus

nonstructural proteins NS1 and NS4A as a determinant of replicase function. J Virol

73, 4611-4621.

Liu, M. A., Fu, T. M., Donnelly, J. J., Caulfield, M. J., and Ulmer, J. B. (1998).

DNA vaccines. Mechanisms for generation of immune responses. Adv Exp Med

Biol 452, 187-191.

247

Liu, N., Ohnishi, N., Ni, L., Akira, S., and Bacon, K. B. (2003). CpG directly

induces T-bet expression and inhibits IgG1 and IgE switching in B cells. Nat

Immunol 4, 687-693.

Livingston, P. G., Kurane, I., Dai, L. C., Okamoto, Y., Lai, C. J., Men, R., Karaki,

S., Takiguchi, M., and Ennis, F. A. (1995). Dengue virus-specific, HLA-B35-

restricted, human CD8+ cytotoxic T lymphocyte (CTL) clones. Recognition of NS3

amino acids 500 to 508 by CTL clones of two different serotype specificities. J

Immunol 154, 1287-1295.

Lobigs, M. (1993). Flavivirus premembrane protein cleavage and spike heterodimer

secretion require the function of the viral proteinase NS3. Proc Natl Acad Sci U S A

90, 6218-6222.

Lobigs, M., Arthur, C. E., Mullbacher, A., and Blanden, R. V. (1994). The flavivirus

nonstructural protein NS3 is a dominant source of cytotoxic T cell peptide

determinants. Virology 202, 195-201.

Lok, S. M., Ng, M. L., and Aaskov, J. (2001). Amino acid and phenotypic changes in

dengue 2 virus associated with escape from neutralisation by IgM antibody. J Med

Virol 65, 315-323.

Ma, L., Jones, C. T., Groesch, T. D., Kuhn, R. J., and Post, C. B. (2004). Solution

structure of dengue virus capsid protein reveals another fold. Proc Natl Acad Sci U S

A 101, 3414-3419.

Macfarlane, D. E., and Manzel, L. (1998). Antagonism of immunostimulatory CpG-

oligodeoxynucleotides by quinacrine, chloroquine, and structurally related

compounds. J Immunol 160, 1122-1131.

MacGregor, R. R., Boyer, J. D., Ugen, K. E., Lacy, K. E., Gluckman, S. J.,

Bagarazzi, M. L., Chattergoon, M. A., Baine, Y., Higgins, T. J., Ciccarelli, R. B., et

al. (1998). First human trial of a DNA-based vaccine for treatment of human

248

immunodeficiency virus type 1 infection: safety and host response. J Infect Dis 178,

92-100.

Mackenzie, J. M., and Westaway, E. G. (2001). Assembly and maturation of the

flavivirus Kunjin virus appear to occur in the rough endoplasmic reticulum and along

the secretory pathway, respectively. J Virol 75, 10787-10799.

Mandl, C. W., Ecker, M., Holzmann, H., Kunz, C., and Heinz, F. X. (1997).

Infectious cDNA clones of tick-borne encephalitis virus European subtype

prototypic strain Neudoerfl and high virulence strain Hypr. J Gen Virol 78, 1049-

1057.

Mandl, C. W., Heinz, F. X., and Kunz, C. (1988). Sequence of the structural proteins

of tick-borne encephalitis virus (western subtype) and comparative analysis with

other flaviviruses. Virology 166, 197-205.

Manickan, E., Karem, K. L., and Rouse, B. T. (1997). DNA vaccines -- a modern

gimmick or a boon to vaccinology? Crit Rev Immunol 17, 139-154.

Markoff, L., Falgout, B., and Chang, A. (1997). A conserved internal hydrophobic

domain mediates the stable membrane integration of the dengue virus capsid protein.

Virology 233, 105-117.

Markoff, L., Pang, X., Houng Hs, H. S., Falgout, B., Olsen, R., Jones, E., and Polo,

S. (2002). Derivation and characterization of a dengue type 1 host range-restricted

mutant virus that is attenuated and highly immunogenic in monkeys. J Virol 76,

3318-3328.

Marx, F., Gritsun, T. S., Grubeck-Loebenstein, B., and Gould, E. A. (2001).

Diagnostic immunoassays for tick-borne encephalitis virus based on recombinant

baculovirus protein expression. J Virol Methods 91, 75-84.

Mason, P. W., Pincus, S., Fournier, M. J., Mason, T. L., Shope, R. E., and Paoletti,

E. (1991). Japanese encephalitis virus-vaccinia recombinants produce particulate

249

forms of the structural membrane proteins and induce high levels of protection

against lethal JEV infection. Virology 180, 294-305.

Massey, R. J., and Schochetman, G. (1981). Viral epitopes and monoclonal

antibodies: isolation of blocking antibodies that inhibit virus neutralization. Science

213, 447-449.

Mathew, A., Kurane, I., Rothman, A. L., Zeng, L. L., Brinton, M. A., and Ennis, F.

A. (1996). Dominant recognition by human CD8+ cytotoxic T lymphocytes of

dengue virus nonstructural proteins NS3 and NS1.2a. J Clin Invest 98, 1684-1691.

Matusan, A. E., Kelley, P. G., Pryor, M. J., Whisstock, J. C., Davidson, A. D., and

Wright, P. J. (2001a). Mutagenesis of the dengue virus type 2 NS3 proteinase and the

production of growth-restricted virus. J Gen Virol 82, 1647-1656.

Matusan, A. E., Pryor, M. J., Davidson, A. D., and Wright, P. J. (2001b).

Mutagenesis of the Dengue virus type 2 NS3 protein within and outside helicase

motifs: effects on enzyme activity and virus replication. J Virol 75, 9633-9643.

McCown, J., Cochran, M., Putnak, R., Feighny, R., Burrous, J., Henchal, E., and

Hoke, C. (1990). Protection of mice against lethal Japanese encephalitis with a

recombinant baculovirus vaccine. Am J Trop Med Hyg 42, 491-499.

Men, R., Bray, M., Clark, D., Chanock, R. M., and Lai, C. J. (1996). Dengue type 4

virus mutants containing deletions in the 3' noncoding region of the RNA genome:

analysis of growth restriction in cell culture and altered viremia pattern and

immunogenicity in rhesus monkeys. J Virol 70, 3930-3937.

Men, R., Wyatt, L., Tokimatsu, I., Arakaki, S., Shameem, G., Elkins, R., Chanock,

R., Moss, B., and Lai, C. (2000). Immunization of rhesus monkeys with a

recombinant of modified vaccinia virus Ankara expressing a truncated envelope

glycoprotein of dengue type 2 virus induced resistance to dengue type 2 virus

challenge. Vaccine 18, 3113-3122.

250

Minor, P. D., Ferguson, M., Katrak, K., Wood, D., John, A., Howlett, J., Dunn, G.,

Burke, K., Almond, J. W., and Burke, K. L. (1990). Antigenic structure of chimeras

of type 1 and type 3 poliovirus involving antigenic site 1. J Gen Virol 71 ( Pt 11),

2543-2551.

Minor, P. D., Ferguson, M., Katrak, K., Wood, D., John, A., Howlett, J., Dunn, G.,

Burke, K., Almond, J. W., Kitson, J. D., et al. (1991). Antigenic structure of

chimeras of type 1 and type 3 polioviruses involving antigenic sites 2, 3 and 4. J Gen

Virol 72 ( Pt 10), 2475-2481.

Modis, Y., Ogata, S., Clements, D., and Harrison, S. C. (2003). A ligand-binding

pocket in the dengue virus envelope glycoprotein. Proc Natl Acad Sci U S A 100,

6986-6991.

Modis, Y., Ogata, S., Clements, D., and Harrison, S. C. (2004). Structure of the

dengue virus envelope protein after membrane fusion. Nature 427, 313-319.

Molloy, S. S., Anderson, E. D., Jean, F., and Thomas, G. (1999). Bi-cycling the furin

pathway: from TGN localization to pathogen activation and embryogenesis. Trends

Cell Biol 9, 28-35.

Molloy, S. S., Bresnahan, P. A., Leppla, S. H., Klimpel, K. R., and Thomas, G.

(1992). Human furin is a calcium-dependent serine endoprotease that recognizes the

sequence Arg-X-X-Arg and efficiently cleaves anthrax toxin protective antigen. J

Biol Chem 267, 16396-16402.

Monath, T. P. (1994). Dengue: the risk to developed and developing countries. Proc

Natl Acad Sci U S A 91, 2395-2400.

Monath, T. P., Levenbook, I., Soike, K., Zhang, Z. X., Ratterree, M., Draper, K.,

Barrett, A. D., Nichols, R., Weltzin, R., Arroyo, J., and Guirakhoo, F. (2000).

Chimeric yellow fever virus 17D-Japanese encephalitis virus vaccine: dose-response

effectiveness and extended safety testing in rhesus monkeys. J Virol 74, 1742-1751.

251

Monath, T. P., McCarthy, K., Bedford, P., Johnson, C. T., Nichols, R., Yoksan, S.,

Marchesani, R., Knauber, M., Wells, K. H., Arroyo, J., and Guirakhoo, F. (2002).

Clinical proof of principle for ChimeriVax: recombinant live, attenuated vaccines

against flavivirus infections. Vaccine 20, 1004-1018.

Monath, T. P., Soike, K., Levenbook, I., Zhang, Z. X., Arroyo, J., Delagrave, S.,

Myers, G., Barrett, A. D., Shope, R. E., Ratterree, M., et al. (1999). Recombinant,

chimaeric live, attenuated vaccine (ChimeriVax) incorporating the envelope genes of

Japanese encephalitis (SA14-14-2) virus and the capsid and nonstructural genes of

yellow fever (17D) virus is safe, immunogenic and protective in non-human

primates. Vaccine 17, 1869-1882.

Mongkolsapaya, J., Dejnirattisai, W., Xu, X. N., Vasanawathana, S.,

Tangthawornchaikul, N., Chairunsri, A., Sawasdivorn, S., Duangchinda, T., Dong,

T., Rowland-Jones, S., et al. (2003). Original antigenic sin and apoptosis in the

pathogenesis of dengue hemorrhagic fever. Nat Med 9, 921-927.

Morens, D. M., Halstead, S. B., Repik, P. M., Putvatana, R., and Raybourne, N.

(1985). Simplified plaque reduction neutralization assay for dengue viruses by

semimicro methods in BHK-21 cells: comparison of the BHK suspension test with

standard plaque reduction neutralization. J Clin Microbiol 22, 250-254.

Munoz-Jordan, J. L., Sanchez-Burgos, G. G., Laurent-Rolle, M., and Garcia-Sastre,

A. (2003). Inhibition of interferon signaling by dengue virus. Proc Natl Acad Sci U S

A 100, 14333-14338.

Murali-Krishna, K., Ravi, V., and Manjunath, R. (1996). Protection of adult but not

newborn mice against lethal intracerebral challenge with Japanese encephalitis virus

by adoptively transferred virus-specific cytotoxic T lymphocytes: requirement for

L3T4+ T cells. J Gen Virol 77 ( Pt 4), 705-714.

Murray, J. M., Aaskov, J. G., and Wright, P. J. (1993). Processing of the dengue

virus type 2 proteins prM and C-prM. J Gen Virol 74 ( Pt 2), 175-182.

252

Nakayama, K. (1997). Furin: a mammalian subtilisin/Kex2p-like endoprotease

involved in processing of a wide variety of precursor proteins. Biochem J 327 ( Pt

3), 625-635.

Nam, J. H., Wyatt, L. S., Chae, S. L., Cho, H. W., Park, Y. K., and Moss, B. (1999).

Protection against lethal Japanese encephalitis virus infection of mice by

immunization with the highly attenuated MVA strain of vaccinia virus expressing

JEV prM and E genes. Vaccine 17, 261-268.

Ngo, N. T., Cao, X. T., Kneen, R., Wills, B., Nguyen, V. M., Nguyen, T. Q., Chu, V.

T., Nguyen, T. T., Simpson, J. A., Solomon, T., et al. (2001). Acute management of

dengue shock syndrome: a randomized double-blind comparison of 4 intravenous

fluid regimens in the first hour. Clin Infect Dis 32, 204-213.

Nothwehr, S. F., and Gordon, J. I. (1989). Eukaryotic signal peptide

structure/function relationships. Identification of conformational features which

influence the site and efficiency of co-translational proteolytic processing by site-

directed mutagenesis of human pre(delta pro)apolipoprotein A-II. J Biol Chem 264,

3979-3987.

Nowak, T., Farber, P. M., and Wengler, G. (1989). Analyses of the terminal

sequences of West Nile virus structural proteins and of the in vitro translation of

these proteins allow the proposal of a complete scheme of the proteolytic cleavages

involved in their synthesis. Virology 169, 365-376.

Ocazionez Jimenez, R., and Lopes da Fonseca, B. A. (2000). Recombinant plasmid

expressing a truncated dengue-2 virus E protein without co-expression of prM

protein induces partial protection in mice. Vaccine 19, 648-654.

O'Rourke, K., Perryman, L. E., and McGuire, T. C. (1988). Antiviral, anti-

glycoprotein and neutralizing antibodies in foals with equine infectious anaemia

virus. J Gen Virol 69 ( Pt 3), 667-674.

253

Otten, G. R., Doe, B., Schaefer, M., Chen, M., Selby, M. J., Goldbeck, C., Hong, M.,

Xu, F., and Ulmer, J. B. (2000). Relative potency of cellular and humoral immune

responses induced by DNA vaccination. Intervirology 43, 227-232.

Palmenberg, A. C. (1990). Proteolytic processing of picornaviral polyprotein. Annu

Rev Microbiol 44, 603-623.

Pan, C. H., Chen, H. W., Huang, H. W., and Tao, M. H. (2001). Protective

mechanisms induced by a Japanese encephalitis virus DNA vaccine: requirement for

antibody but not CD8(+) cytotoxic T-cell responses. J Virol 75, 11457-11463.

Pang, T. (1987a). Dengue-specific IgM and dengue haemorrhagic fever/shock

[letter]. Lancet 1, 988.

Pang, T. (1987b). Pathogenesis of dengue haemorrhagic fever: towards a more

balanced view. Southeast Asian J Trop Med Public Health 18, 321-325.

Panicali, D., Davis, S. W., Weinberg, R. L., and Paoletti, E. (1983). Construction of

live vaccines by using genetically engineered poxviruses: biological activity of

recombinant vaccinia virus expressing influenza virus hemagglutinin. Proc Natl

Acad Sci U S A 80, 5364-5368.

Perkus, M. E., Piccini, A., Lipinskas, B. R., and Paoletti, E. (1985). Recombinant

vaccinia virus: immunization against multiple pathogens. Science 229, 981-984.

Perlmutter, R. M., Hansburg, D., Briles, D. E., Nicolotti, R. A., and Davie, J. M.

(1978). Subclass restriction of murine anti-carbohydrate antibodies. J Immunol 121,

566-572.

Pertmer, T. M., Roberts, T. R., and Haynes, J. R. (1996). Influenza virus

nucleoprotein-specific immunoglobulin G subclass and cytokine responses elicited

by DNA vaccination are dependent on the route of vector DNA delivery. J Virol 70,

6119-6125.

254

Phillpotts, R. J., Venugopal, K., and Brooks, T. (1996). Immunisation with DNA

polynucleotides protects mice against lethal challenge with St. Louis encephalitis

virus. Arch Virol 141, 743-749.

Pincus, S., Mason, P. W., Konishi, E., Fonseca, B. A., Shope, R. E., Rice, C. M., and

Paoletti, E. (1992). Recombinant vaccinia virus producing the prM and E proteins of

yellow fever virus protects mice from lethal yellow fever encephalitis. Virology 187,

290-297.

Plaimauer, B., Mohr, G., Wernhart, W., Himmelspach, M., Dorner, F., and Schlokat,

U. (2001). 'Shed' furin: mapping of the cleavage determinants and identification of

its C-terminus. Biochem J 354, 689-695.

Pletnev, A. G., Bray, M., Hanley, K. A., Speicher, J., and Elkins, R. (2001). Tick-

borne Langat/mosquito-borne dengue flavivirus chimera, a candidate live attenuated

vaccine for protection against disease caused by members of the tick-borne

encephalitis virus complex: evaluation in rhesus monkeys and in mosquitoes. J Virol

75, 8259-8267.

Pletnev, A. G., Bray, M., and Lai, C. J. (1993). Chimeric tick-borne encephalitis and

dengue type 4 viruses: effects of mutations on neurovirulence in mice. J Virol 67,

4956-4963.

Pletnev, A. G., Putnak, R., Speicher, J., Wagar, E. J., and Vaughn, D. W. (2002).

West Nile virus/dengue type 4 virus chimeras that are reduced in neurovirulence and

peripheral virulence without loss of immunogenicity or protective efficacy. Proc Natl

Acad Sci U S A 99, 3036-3041.

Poland, J. D., Cropp, C. B., Craven, R. B., and Monath, T. P. (1990). Evaluation of

the potency and safety of inactivated Japanese encephalitis vaccine in US

inhabitants. J Infect Dis 161, 878-882.

255

Polo, S., Ketner, G., Levis, R., and Falgout, B. (1997). Infectious RNA transcripts

from full-length dengue virus type 2 cDNA clones made in yeast. J Virol 71, 5366-

5374.

Porter, K. R., Kochel, T. J., Wu, S. J., Raviprakash, K., Phillips, I., and Hayes, C. G.

(1998). Protective efficacy of a dengue 2 DNA vaccine in mice and the effect of

CpG immuno-stimulatory motifs on antibody responses. Arch Virol 143, 997-1003.

Preugschat, F., Lenches, E. M., and Strauss, J. H. (1991). Flavivirus enzyme-

substrate interactions studied with chimeric proteinases: identification of an

intragenic locus important for substrate recognition. J Virol 65, 4749-4758.

Preugschat, F., Yao, C. W., and Strauss, J. H. (1990). In vitro processing of dengue

virus type 2 nonstructural proteins NS2A, NS2B, and NS3. J Virol 64, 4364-4374.

Pryor, M. J., Carr, J. M., Hocking, H., Davidson, A. D., Li, P., and Wright, P. J.

(2001). Replication of dengue virus type 2 in human monocyte-derived

macrophages: comparisons of isolates and recombinant viruses with substitutions at

amino acid 390 in the envelope glycoprotein. Am J Trop Med Hyg 65, 427-434.

Pryor, M. J., Gualano, R. C., Lin, B., Davidson, A. D., and Wright, P. J. (1998).

Growth restriction of dengue virus type 2 by site-specific mutagenesis of virus-

encoded glycoproteins. J Gen Virol 79 ( Pt 11), 2631-2639.

Pugachev, K. V., Guirakhoo, F., Trent, D. W., and Monath, T. P. (2003). Traditional

and novel approaches to flavivirus vaccines. Int J Parasitol 33, 567-582.

Purdy, D. E., and Chang, G. J. (2005). Secretion of noninfectious dengue virus-like

particles and identification of amino acids in the stem region involved in intracellular

retention of envelope protein. Virology 333, 239-250.

Puri, B., Polo, S., Hayes, C. G., and Falgout, B. (2000). Construction of a full length

infectious clone for dengue-1 virus Western Pacific,74 strain. Virus Genes 20, 57-63.

256

Putnak, R., Barvir, D. A., Burrous, J. M., Dubois, D. R., D'Andrea, V. M., Hoke, C.

H., Sadoff, J. C., and Eckels, K. H. (1996a). Development of a purified, inactivated,

dengue-2 virus vaccine prototype in Vero cells: immunogenicity and protection in

mice and rhesus monkeys. J Infect Dis 174, 1176-1184.

Putnak, R., Cassidy, K., Conforti, N., Lee, R., Sollazzo, D., Truong, T., Ing, E.,

Dubois, D., Sparkuhl, J., Gastle, W., and Hoke, C. (1996b). Immunogenic and

protective response in mice immunized with a purified, inactivated, Dengue-2 virus

vaccine prototype made in fetal rhesus lung cells. Am J Trop Med Hyg 55, 504-510.

Putnak, R., Fuller, J., VanderZanden, L., Innis, B. L., and Vaughn, D. W. (2003).

Vaccination of rhesus macaques against dengue-2 virus with a plasmid DNA vaccine

encoding the viral pre-membrane and envelope genes. Am J Trop Med Hyg 68, 469-

476.

Qu, X., Chen, W., Maguire, T., and Austin, F. (1993). Immunoreactivity and

protective effects in mice of a recombinant dengue 2 Tonga virus NS1 protein

produced in a baculovirus expression system. J Gen Virol 74, 89-97.

Racaniello, V. R., and Baltimore, D. (1981). Cloned poliovirus complementary DNA

is infectious in mammalian cells. Science 214, 916-919.

Raengsakulrach, B., Nisalak, A., Gettayacamin, M., Thirawuth, V., Young, G. D.,

Myint, K. S., Ferguson, L. M., Hoke, C. H., Jr., Innis, B. L., and Vaughn, D. W.

(1999). Safety, immunogenicity, and protective efficacy of NYVAC-JEV and

ALVAC-JEV recombinant Japanese encephalitis vaccines in rhesus monkeys. Am J


Rapoport, T. A. (1992). Transport of proteins across the endoplasmic reticulum

membrane. Science 258, 931-936.

Raviprakash, K., Ewing, D., Simmons, M., Porter, K. R., Jones, T. R., Hayes, C. G.,

Stout, R., and Murphy, G. S. (2003). Needle-free Biojector injection of a dengue

virus type 1 DNA vaccine with human immunostimulatory sequences and the GM-

257

CSF gene increases immunogenicity and protection from virus challenge in Aotus

monkeys. Virology 315, 345-352.

Raviprakash, K., Kochel, T. J., Ewing, D., Simmons, M., Phillips, I., Hayes, C. G.,

and Porter, K. R. (2000a). Immunogenicity of dengue virus type 1 DNA vaccines

expressing truncated and full length envelope protein. Vaccine 18, 2426-2434.

Raviprakash, K., Marques, E., Ewing, D., Lu, Y., Phillips, I., Porter, K. R., Kochel,

T. J., August, T. J., Hayes, C. G., and Murphy, G. S. (2001). Synergistic neutralizing

antibody response to a dengue virus type 2 DNA vaccine by incorporation of

lysosome-associated membrane protein sequences and use of plasmid expressing

GM-CSF. Virology 290, 74-82.

Raviprakash, K., Porter, K. R., Kochel, T. J., Ewing, D., Simmons, M., Phillips, I.,

Murphy, G. S., Weiss, W. R., and Hayes, C. G. (2000b). Dengue virus type 1 DNA

vaccine induces protective immune responses in rhesus macaques. J Gen Virol 81,

1659-1667.

Raz, E., Tighe, H., Sato, Y., Corr, M., Dudler, J. A., Roman, M., Swain, S. L.,

Spiegelberg, H. L., and Carson, D. A. (1996). Preferential induction of a Th1

immune response and inhibition of specific IgE antibody formation by plasmid DNA

immunization. Proc Natl Acad Sci U S A 93, 5141-5145.

Redford, T. W., Yi, A. K., Ward, C. T., and Krieg, A. M. (1998). Cyclosporin A

enhances IL-12 production by CpG motifs in bacterial DNA and synthetic

oligodeoxynucleotides. J Immunol 161, 3930-3935.

Rey, F. A., Heinz, F. X., Mandl, C., Kunz, C., and Harrison, S. C. (1995). The

envelope glycoprotein from tick-borne encephalitis virus at 2 A resolution. Nature

375, 291-298.

Rice, C. M., Grakoui, A., Galler, R., and Chambers, T. J. (1989). Transcription of

infectious yellow fever RNA from full-length cDNA templates produced by in vitro

ligation. New Biol 1, 285-296.

258

Rigau-Perez, J. G., Clark, G. G., Gubler, D. J., Reiter, P., Sanders, E. J., and

Vorndam, A. V. (1998). Dengue and dengue haemorrhagic fever. Lancet 352, 971-

977.

Robertson, J., and Griffiths, E. (1998). WHO guidelines for assuring the quality of

DNA vaccines. Biologicals 26, 205-212.

Robertson, J. S. (1994). Safety considerations for nucleic acid vaccines. Vaccine 12,

1526-1528.

Roehrig, J. T., Bolin, R. A., and Kelly, R. G. (1998). Monoclonal antibody mapping

of the envelope glycoprotein of the dengue 2 virus, Jamaica. Virology 246, 317-328.

Roehrig, J. T., Hunt, A. R., Johnson, A. J., and Hawkes, R. A. (1989). Synthetic

peptides derived from the deduced amino acid sequence of the E-glycoprotein of

Murray Valley encephalitis virus elicit antiviral antibody. Virology 171, 49-60.

Roehrig, J. T., Johnson, A. J., Hunt, A. R., Bolin, R. A., and Chu, M. C. (1990).

Antibodies to dengue 2 virus E-glycoprotein synthetic peptides identify antigenic

conformation. Virology 177, 668-675.

Rosen, L. (1977). The emperor's new clothes revisited, or reflections on the

pathogenesis of dengue hemorrhagic fever. Am J Trop Med Hyg 26, 337-343.

Rothman, A. L. (2004). Dengue: defining protective versus pathologic immunity. J

Clin Invest 113, 946-951.

Rothman, A. L., and Ennis, F. A. (1999). Immunopathogenesis of Dengue

hemorrhagic fever. Virology 257, 1-6.

Rothman, A. L., Kanesa-thasan, N., West, K., Janus, J., Saluzzo, J. F., and Ennis, F.

A. (2001). Induction of T lymphocyte responses to dengue virus by a candidate

tetravalent live attenuated dengue virus vaccine. Vaccine 19, 4694-4699.

259

Russell, P. K., Brandt, W. E., and Dalrymple, J. M. (1980). Chemical and antigenic

structure of flaviviruses. In The Togaviruses: Biology, Structure, Replication, R. W.

Schlesinger, ed. (New York, Academic Press), pp. 503-529.

Ryan, M. D., Monaghan, S., and Flint, M. (1998). Virus-encoded proteinases of the

Flaviviridae. J Gen Virol 79, 947-959.

Sabchareon, A., Lang, J., Chanthavanich, P., Yoksan, S., Forrat, R., Attanath, P.,

Sirivichayakul, C., Pengsaa, K., Pojjaroen-Anant, C., Chambonneau, L., et al.

(2004). Safety and immunogenicity of a three dose regimen of two tetravalent live-

attenuated dengue vaccines in five- to twelve-year-old Thai children. Pediatr Infect

Dis J 23, 99-109.

Sabchareon, A., Lang, J., Chanthavanich, P., Yoksan, S., Forrat, R., Attanath, P.,

Sirivichayakul, C., Pengsaa, K., Pojjaroen-Anant, C., Chokejindachai, W., et al.

(2002). Safety and immunogenicity of tetravalent live-attenuated dengue vaccines in

Thai adult volunteers: role of serotype concentration, ratio, and multiple doses. Am J


Sabin, A. B. (1952). Research on dengue during World War II. American Journal of

Tropical Medicine and Hygiene 1, 30-50.

Sabin, A. B., and Schlesinger, R. W. (1945). Production of immunity to dengue with

virus modified by propagation in mice. Science 101, 640-642.

Salk, D., and Salk, J. (1984). Vaccinology of poliomyelitis. Vaccine 2, 59-74.

Sambrook, J., and Russell, D. W. (2001). Molecular Cloning: A Laboratory Manual,

3 edn (New York, Cold Spring Harbor Laboratory Press).

Sato, Y., Roman, M., Tighe, H., Lee, D., Corr, M., Nguyen, M. D., Silverman, G. J.,

Lotz, M., Carson, D. A., and Raz, E. (1996). Immunostimulatory DNA sequences

necessary for effective intradermal gene immunization. Science 273, 352-354.

260

Schalich, J., Allison, S. L., Stiasny, K., Mandl, C. W., Kunz, C., and Heinz, F. X.

(1996). Recombinant subviral particles from tick-borne encephalitis virus are

fusogenic and provide a model system for studying flavivirus envelope glycoprotein

functions. J Virol 70, 4549-4557.

Schlesinger, J. J., Brandriss, M. W., Cropp, C. B., and Monath, T. P. (1986).

Protection against yellow fever in monkeys by immunization with yellow fever virus

nonstructural protein NS1. J Virol 60, 1153-1155.

Schlesinger, J. J., Brandriss, M. W., Putnak, J. R., and Walsh, E. E. (1990). Cell

surface expression of yellow fever virus non-structural glycoprotein NS1:

consequences of interaction with antibody. J Gen Virol 71, 593-599.

Schlesinger, J. J., Brandriss, M. W., and Walsh, E. E. (1985). Protection against 17D

yellow fever encephalitis in mice by passive transfer of monoclonal antibodies to the

nonstructural glycoprotein gp48 and by active immunization with gp48. J Immunol

135, 2805-2809.

Schlesinger, J. J., Brandriss, M. W., and Walsh, E. E. (1987). Protection of mice

against dengue 2 virus encephalitis by immunization with the dengue 2 virus non-

structural glycoprotein NS1. J Gen Virol 68 ( Pt 3), 853-857.

Schmaljohn, C., Custer, D., VanderZanden, L., Spik, K., Rossi, C., and Bray, M.

(1999). Evaluation of tick-borne encephalitis DNA vaccines in monkeys. Virology

263, 166-174.

Schmaljohn, C., Vanderzanden, L., Bray, M., Custer, D., Meyer, B., Li, D., Rossi,

C., Fuller, D., Fuller, J., Haynes, J., and Huggins, J. (1997). Naked DNA vaccines

expressing the prM and E genes of Russian spring summer encephalitis virus and

Central European encephalitis virus protect mice from homologous and heterologous

challenge. J Virol 71, 9563-9569.

261

Schultz, J., Dollenmaier, G., and Molling, K. (2000). Update on antiviral DNA

vaccine research (1998-2000). Intervirology 43, 197-217.

Seif, S. A., Morita, K., Matsuo, S., Hasebe, F., and Igarashi, A. (1995). Finer

mapping of neutralizing epitope(s) on the C-terminal of Japanese encephalitis virus

E-protein expressed in recombinant Escherichia coli system. Vaccine 13, 1515-1521.

Serafin, I. L., and Aaskov, J. G. (2001). Identification of epitopes on the envelope

(E) protein of dengue 2 and dengue 3 viruses using monoclonal antibodies. Arch

Virol 146, 2469-2479.

Shiu, S. Y., Morikawa, S., Buckley, A., Higgs, S., Karunakarannair, V., Blachere,

C., and Gould, E. A. (1991). 17D yellow fever vaccine virus envelope protein

expressed by recombinant baculovirus is antigenically indistinguishable from

authentic viral protein. J Gen Virol 72, 1451-1454.

Shrestha, B., and Diamond, M. S. (2004). Role of CD8+ T cells in control of West

Nile virus infection. J Virol 78, 8312-8321.

Simmons, M., Murphy, G. S., and Hayes, C. G. (2001a). Short report: Antibody

responses of mice immunized with a tetravalent dengue recombinant protein subunit

vaccine. Am J Trop Med Hyg 65, 159-161.

Simmons, M., Murphy, G. S., Kochel, T., Raviprakash, K., and Hayes, C. G.

(2001b). Characterization of antibody responses to combinations of a dengue-2 DNA

and dengue-2 recombinant subunit vaccine. Am J Trop Med Hyg 65, 420-426.

Sin, J. I., and Weiner, D. B. (2000). Improving DNA vaccines targeting viral

infection. Intervirology 43, 233-246.

Smith, G. L., and Moss, B. (1983). Infectious poxvirus vectors have capacity for at

least 25 000 base pairs of foreign DNA. Gene 25, 21-28.

262

Smith, H. A. (1994). Regulatory considerations for nucleic acid vaccines. Vaccine

12, 1515-1519.

Smucny, J. J., Kelly, E. P., Macarthy, P. O., and King, A. D. (1995). Murine

immunoglobulin G subclass responses following immunization with live dengue

virus or a recombinant dengue envelope protein. Am J Trop Med Hyg 53, 432-437.

Speight, G., Coia, G., Parker, M. D., and Westaway, E. G. (1988). Gene mapping

and positive identification of the non-structural proteins NS2A, NS2B, NS3, NS4B

and NS5 of the flavivirus Kunjin and their cleavage sites. J Gen Virol 69, 23-34.

Sriburi, R., Keelapang, P., Duangchinda, T., Pruksakorn, S., Maneekarn, N., Malasit,

P., and Sittisombut, N. (2001). Construction of infectious dengue 2 virus cDNA

clones using high copy number plasmid. J Virol Methods 92, 71-82.

Srivastava, A. K., Putnak, J. R., Warren, R. L., and Hoke, C. H., Jr. (1995). Mice

immunized with a dengue type 2 virus E and NS1 fusion protein made in Escherichia

coli are protected against lethal dengue virus infection. Vaccine 13, 1251-1258.

Stadler, K., Allison, S. L., Schalich, J., and Heinz, F. X. (1997). Proteolytic

activation of tick-borne encephalitis virus by furin. J Virol 71, 8475-8481.

Staropoli, I., Clement, J. M., Frenkiel, M. P., Hofnung, M., and Deubel, V. (1996).

Dengue virus envelope glycoprotein can be secreted from insect cells as a fusion

with the maltose-binding protein. J Virol Methods 56, 179-189.

Staropoli, I., Frenkiel, M. P., Megret, F., and Deubel, V. (1997). Affinity-purified

dengue-2 virus envelope glycoprotein induces neutralizing antibodies and protective

immunity in mice. Vaccine 15, 1946-1954.

Stiasny, K., Allison, S. L., Mandl, C. W., and Heinz, F. X. (2001). Role of

metastability and acidic pH in membrane fusion by tick-borne encephalitis virus. J

Virol 75, 7392-7398.

263

Stiasny, K., Allison, S. L., Marchler-Bauer, A., Kunz, C., and Heinz, F. X. (1996).

Structural requirements for low-pH-induced rearrangements in the envelope

glycoprotein of tick-borne encephalitis virus. J Virol 70, 8142-8147.

Stocks, C. E., and Lobigs, M. (1995). Posttranslational signal peptidase cleavage at

the flavivirus C-prM junction in vitro. J Virol 69, 8123-8126.

Stocks, C. E., and Lobigs, M. (1998). Signal peptidase cleavage at the flavivirus C-

prM junction: dependence on the viral NS2B-3 protease for efficient processing

requires determinants in C, the signal peptide, and prM. J Virol 72, 2141-2149.

Stunz, L. L., Lenert, P., Peckham, D., Yi, A. K., Haxhinasto, S., Chang, M., Krieg,

A. M., and Ashman, R. F. (2002). Inhibitory oligonucleotides specifically block

effects of stimulatory CpG oligonucleotides in B cells. Eur J Immunol 32, 1212-

1222.

Sugrue, R. J., Cui, T., Xu, Q., Fu, J., and Chan, Y. C. (1997). The production of

recombinant dengue virus E protein using Escherichia coli and Pichia pastoris. J

Virol Methods 69, 159-169.

Sumiyoshi, H., Hoke, C. H., and Trent, D. W. (1992). Infectious Japanese

encephalitis virus RNA can be synthesized from in vitro-ligated cDNA templates. J

Virol 66, 5425-5431.

Sun, W., Edelman, R., Kanesa-Thasan, N., Eckels, K. H., Putnak, J. R., King, A. D.,

Houng, H. S., Tang, D., Scherer, J. M., Hoke, C. H., Jr., and Innis, B. L. (2003).

Vaccination of human volunteers with monovalent and tetravalent live-attenuated

dengue vaccine candidates. Am J Trop Med Hyg 69, 24-31.

Sweet, B. H., Wisseman, C. L., Jr., Kitaoka, M., and Tamiya, T. (1962).

Immunological studies with group B arthropod-borne viruses.II. Effect of prior

infection with Japanese encephalitis virus on the viremia in human subject following

administration of 17D yellow fever vaccine. Am J Trop Med Hyg 11, 562-569.

264

Tan, B. H., Fu, J., Sugrue, R. J., Yap, E. H., Chan, Y. C., and Tan, Y. H. (1996).

Recombinant dengue type 1 virus NS5 protein expressed in Escherichia coli exhibits

RNA-dependent RNA polymerase activity. Virology 216, 317-325.

Tartaglia, J., Perkus, M. E., Taylor, J., Norton, E. K., Audonnet, J. C., Cox, W. I.,

Davis, S. W., van der Hoeven, J., Meignier, B., Riviere, M., and et al. (1992).

NYVAC: a highly attenuated strain of vaccinia virus. Virology 188, 217-232.

Taylor, J., Tartaglia, J., Riviere, M., Duret, C., Languet, B., Chappuis, G., and

Paoletti, E. (1994). Applications of canarypox (ALVAC) vectors in human and

veterinary vaccination. Dev Biol Stand 82, 131-135.

Temin, H. M. (1990). Overview of biological effects of addition of DNA molecules

to cells. J Med Virol 31, 13-17.

Temin, H. M. (1998). Overview of biological effects of addition of DNA molecules

to cells. Dev Biol Stand 93, 37-44.

Teo, K. F., and Wright, P. J. (1997). Internal proteolysis of the NS3 protein specified

by dengue virus 2. J Gen Virol 78 ( Pt 2), 337-341.

Tesh, R. B., Arroyo, J., Travassos Da Rosa, A. P., Guzman, H., Xiao, S. Y., and

Monath, T. P. (2002). Efficacy of killed virus vaccine, live attenuated chimeric virus

vaccine, and passive immunization for prevention of West Nile virus encephalitis in

hamster model. Emerg Infect Dis 8, 1392-1397.

Theiler, M., and Anderson, C. R. (1975). The relative resistance of dengue-immune

monkeys to yellow fever virus. Am J Trop Med Hyg 24, 115-117.

Theiler, M., and Smith, H. H. (1937a). The effect of prolonged cultivation in vitro

upon the pathogenicity of yellow fever virus. J Exp Med 65, 767-786.

Theiler, M., and Smith, H. H. (1937b). The use of yellow fever virus modified by in

vitro cultivation for human immunization. J Exp Med 65, 787-800.

265

Thomssen, R. (1975). Live attenuated versus killed virus vaccines. Monogr Allergy

9, 155-176.

Tokunaga, T., Yamamoto, H., Shimada, S., Abe, H., Fukuda, T., Fujisawa, Y.,

Furutani, Y., Yano, O., Kataoka, T., Sudo, T., and et al. (1984). Antitumor activity of

deoxyribonucleic acid fraction from Mycobacterium bovis BCG. I. Isolation,

physicochemical characterization, and antitumor activity. J Natl Cancer Inst 72, 955-

962.

Towbin, H., Staehelin, T., and Gordon, J. (1979). Electrophoretic transfer of proteins

from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.

Proc Natl Acad Sci U S A 76, 4350-4354.

Tracey, K. J., and Cerami, A. (1993). Tumor necrosis factor, other cytokines and

disease. Annu Rev Cell Biol 9, 317-343.

Trent, D. W., Kinney, R. M., and Huang, C. Y. H. (1997). Recombinant dengue

virus vaccines. In Dengue and dengue hemorrhagic fever, D. J. Gubler, and G. Kuno,

eds. (CAB International), pp. 379-403.

Trirawatanapong, T., Chandran, B., Putnak, R., and Padmanabhan, R. (1992).

Mapping of a region of dengue virus type-2 glycoprotein required for binding by a

neutralizing monoclonal antibody. Gene 116, 139-150.

Troyer, J. M., Hanley, K. A., Whitehead, S. S., Strickman, D., Karron, R. A., Durbin,

A. P., and Murphy, B. R. (2001). A live attenuated recombinant dengue-4 virus

vaccine candidate with restricted capacity for dissemination in mosquitoes and lack

of transmission from vaccinees to mosquitoes. Am J Trop Med Hyg 65, 414-419.

Ulmer, J. B., Donnelly, J. J., Deck, R. R., DeWitt, C. M., and Liu, M. A. (1995).

Immunization against viral proteins with naked DNA. Ann N Y Acad Sci 772, 117-

125.

266

Ulmer, J. B., Donnelly, J. J., and Liu, M. A. (1996). Toward the development of

DNA vaccines. Curr Opin Biotechnol 7, 653-658.

Vaughn, D. W. (2000). Invited commentary: Dengue lessons from Cuba. Am J

Epidemiol 152, 800-803.

Vaughn, D. W., Green, S., Kalayanarooj, S., Innis, B. L., Nimmannitya, S.,

Suntayakorn, S., Endy, T. P., Raengsakulrach, B., Rothman, A. L., Ennis, F. A., and

Nisalak, A. (2000). Dengue viremia titer, antibody response pattern, and virus

serotype correlate with disease severity. J Infect Dis 181, 2-9.

Vaughn, D. W., Hoke, C. H., Jr., Yoksan, S., LaChance, R., Innis, B. L., Rice, R. M.,

and Bhamarapravati, N. (1996). Testing of a dengue 2 live-attenuated vaccine (strain

16681 PDK 53) in ten American volunteers. Vaccine 14, 329-336.

Velzing, J., Groen, J., Drouet, M. T., van Amerongen, G., Copra, C., Osterhaus, A.

D., and Deubel, V. (1999). Induction of protective immunity against Dengue virus

type 2: comparison of candidate live attenuated and recombinant vaccines. Vaccine

17, 1312-1320.

Venugopal, K., Jiang, W. R., and Gould, E. A. (1995). Immunity to St. Louis

encephalitis virus by sequential immunization with recombinant vaccinia and

baculovirus derived PrM/E proteins. Vaccine 13, 1000-1005.

Vinner, L., Nielsen, H. V., Bryder, K., Corbet, S., Nielsen, C., and Fomsgaard, A.

(1999). Gene gun DNA vaccination with Rev-independent synthetic HIV-1 gp160

envelope gene using mammalian codons. Vaccine 17, 2166-2175.

Vollmer, J., Weeratna, R., Payette, P., Jurk, M., Schetter, C., Laucht, M., Wader, T.,

Tluk, S., Liu, M., Davis, H. L., and Krieg, A. M. (2004). Characterization of three

CpG oligodeoxynucleotide classes with distinct immunostimulatory activities. Eur J

Immunol 34, 251-262.

267

von Heijne, G. (1983). Patterns of amino acids near signal-sequence cleavage sites.

Eur J Biochem 133, 17-21.

von Heijne, G. (1984). How signal sequences maintain cleavage specificity. J Mol

Biol 173, 243-251.

von Heijne, G. (1985). Signal sequences. The limits of variation. J Mol Biol 184, 99-

105.

Wang, J. C., Lang, H. D., Liao, P., and Wong, A. (1992). Recombinant alpha-

interferon inhibits colony formation of bone marrow fibroblast progenitor cells

(CFU-F). Am J Hematol 40, 81-85.

Wang, Z., Karras, J. G., Colarusso, T. P., Foote, L. C., and Rothstein, T. L. (1997).

Unmethylated CpG motifs protect murine B lymphocytes against Fas-mediated

apoptosis. Cell Immunol 180, 162-167.

Warrener, P., Tamura, J. K., and Collett, M. S. (1993). RNA-stimulated NTPase

activity associated with yellow fever virus NS3 protein expressed in bacteria. J Virol

67, 989-996.

Watts, D. M., Porter, K. R., Putvatana, P., Vasquez, B., Calampa, C., Hayes, C. G.,

and Halstead, S. B. (1999). Failure of secondary infection with American genotype

dengue 2 to cause dengue haemorrhagic fever. Lancet 354, 1431-1434.

Weeratna, R. D., McCluskie, M. J., Comanita, L., Wu, T., and Davis, H. L. (2000).

Optimization strategies for DNA vaccines. Intervirology 43, 218-226.

Weiss, R., Scheiblhofer, S., Freund, J., Ferreira, F., Livey, I., and Thalhamer, J.

(2002). Gene gun bombardment with gold particles displays a particular Th2-

promoting signal that over-rules the Th1-inducing effect of immunostimulatory CpG

motifs in DNA vaccines. Vaccine 20, 3148-3154.

268

Wellink, J., and van Kammen, A. (1988). Proteases involved in the processing of

viral polyproteins. Brief review. Arch Virol 98, 1-26.

Wengler, G., Czaya, G., Farber, P. M., and Hegemann, J. H. (1991). In vitro

synthesis of West Nile virus proteins indicates that the amino-terminal segment of

the NS3 protein contains the active centre of the protease which cleaves the viral

polyprotein after multiple basic amino acids. J Gen Virol 72 ( Pt 4), 851-858.

Westaway, E. G., and Blok, J. (1997). Taxonomy and evolutionary relationships of

flaviviruses. In Dengue and dengue hemorrhagic fever, D. J. Gubler, and G. Kuno,

eds. (CAB International), pp. 147-174.

White, N. J. (1999). Variation in virulence of dengue virus. Lancet 354, 1401-1402.

Whitehead, S. S., Falgout, B., Hanley, K. A., Blaney Jr, J. E., Jr., Markoff, L., and

Murphy, B. R. (2003a). A live, attenuated dengue virus type 1 vaccine candidate

with a 30-nucleotide deletion in the 3' untranslated region is highly attenuated and

immunogenic in monkeys. J Virol 77, 1653-1657.

Whitehead, S. S., Hanley, K. A., Blaney, J. E., Jr., Gilmore, L. E., Elkins, W. R., and

Murphy, B. R. (2003b). Substitution of the structural genes of dengue virus type 4

with those of type 2 results in chimeric vaccine candidates which are attenuated for

mosquitoes, mice, and rhesus monkeys. Vaccine 21, 4307-4316.

Winther, M. D., and Dougan, G. (1984). The impact of new technologies on vaccine

development. Biotechnol Genet Eng Rev 2, 1-39.

Wu, C. J., Lee, S. C., Huang, H. W., and Tao, M. H. (2004). In vivo electroporation

of skeletal muscles increases the efficacy of Japanese encephalitis virus DNA

vaccine. Vaccine 22, 1457-1464.

Wurm, F. M., and Petropoulos, C. J. (1994). Plasmid integration, amplification and

cytogenetics in CHO cells: questions and comments. Biologicals 22, 95-102.

269

Yamamoto, S., Yamamoto, T., Shimada, S., Kuramoto, E., Yano, O., Kataoka, T.,

and Tokunaga, T. (1992). DNA from bacteria, but not from vertebrates, induces

interferons, activates natural killer cells and inhibits tumor growth. Microbiol

Immunol 36, 983-997.

Yamshchikov, V., Mishin, V., and Cominelli, F. (2001a). A new strategy in design

of +RNA virus infectious clones enabling their stable propagation in E. coli.

Virology 281, 272-280.

Yamshchikov, V. F., and Compans, R. W. (1993). Regulation of the late events in

flavivirus protein processing and maturation. Virology 192, 38-51.

Yamshchikov, V. F., and Compans, R. W. (1995). Formation of the flavivirus

envelope: role of the viral NS2B-NS3 protease. J Virol 69, 1995-2003.

Yamshchikov, V. F., Trent, D. W., and Compans, R. W. (1997). Upregulation of

signalase processing and induction of prM-E secretion by the flavivirus NS2B-NS3

protease: roles of protease components. J Virol 71, 4364-4371.

Yamshchikov, V. F., Wengler, G., Perelygin, A. A., Brinton, M. A., and Compans,

R. W. (2001b). An infectious clone of the West Nile flavivirus. Virology 281, 294-

304.

Yew, N. S., Zhao, H., Przybylska, M., Wu, I. H., Tousignant, J. D., Scheule, R. K.,

and Cheng, S. H. (2002). CpG-depleted plasmid DNA vectors with enhanced safety

and long-term gene expression in vivo. Mol Ther 5, 731-738.

Yi, A. K., Chace, J. H., Cowdery, J. S., and Krieg, A. M. (1996a). IFN-gamma

promotes IL-6 and IgM secretion in response to CpG motifs in bacterial DNA and

oligodeoxynucleotides. J Immunol 156, 558-564.

Yi, A. K., Chang, M., Peckham, D. W., Krieg, A. M., and Ashman, R. F. (1998a).

CpG oligodeoxyribonucleotides rescue mature spleen B cells from spontaneous

apoptosis and promote cell cycle entry. J Immunol 160, 5898-5906.

270

Yi, A. K., Hornbeck, P., Lafrenz, D. E., and Krieg, A. M. (1996b). CpG DNA rescue

of murine B lymphoma cells from anti-IgM-induced growth arrest and programmed

cell death is associated with increased expression of c-myc and bcl-xL. J Immunol

157, 4918-4925.

Yi, A. K., Klinman, D. M., Martin, T. L., Matson, S., and Krieg, A. M. (1996c).

Rapid immune activation by CpG motifs in bacterial DNA. Systemic induction of

IL-6 transcription through an antioxidant-sensitive pathway. J Immunol 157, 5394-

5402.

Yi, A. K., Tuetken, R., Redford, T., Waldschmidt, M., Kirsch, J., and Krieg, A. M.

(1998b). CpG motifs in bacterial DNA activate leukocytes through the pH-dependent

generation of reactive oxygen species. J Immunol 160, 4755-4761.

You, S., Falgout, B., Markoff, L., and Padmanabhan, R. (2001). In vitro RNA

synthesis from exogenous dengue viral RNA templates requires long range

interactions between 5'- and 3'-terminal regions that influence RNA structure. J Biol

Chem 276, 15581-15591.

Yun, S. I., Kim, S. Y., Rice, C. M., and Lee, Y. M. (2003). Development and

application of a reverse genetics system for Japanese encephalitis virus. J Virol 77,

6450-6465.

Zeng, L., Falgout, B., and Markoff, L. (1998). Identification of specific nucleotide

sequences within the conserved 3'-SL in the dengue type 2 virus genome required for

replication. J Virol 72, 7510-7522.

Zhang, F., Huang, Q., Ma, W., Jiang, S., Fan, Y., and Zhang, H. (2001).

Amplification and cloning of the full-length genome of Japanese encephalitis virus

by a novel long RT-PCR protocol in a cosmid vector. J Virol Methods 96, 171-182.

271

Zhang, L., Mohan, P. M., and Padmanabhan, R. (1992). Processing and localization

of Dengue virus type 2 polyprotein precursor NS3-NS4A-NS4B-NS5. J Virol 66,

7549-7554.

Zhang, W., Chipman, P. R., Corver, J., Johnson, P. R., Zhang, Y., Mukhopadhyay,

S., Baker, T. S., Strauss, J. H., Rossmann, M. G., and Kuhn, R. J. (2003a).

Visualization of membrane protein domains by cryo-electron microscopy of dengue

virus. Nat Struct Biol 10, 907-912.

Zhang, Y., Corver, J., Chipman, P. R., Zhang, W., Pletnev, S. V., Sedlak, D., Baker,

T. S., Strauss, J. H., Kuhn, R. J., and Rossmann, M. G. (2003b). Structures of

immature flavivirus particles. Embo J 22, 2604-2613.

Zhang, Y. M., Hayes, E. P., McCarty, T. C., Dubois, D. R., Summers, P. L., Eckels,

K. H., Chanock, R. M., and Lai, C. J. (1988). Immunization of mice with dengue

structural proteins and nonstructural protein NS1 expressed by baculovirus

recombinant induces resistance to dengue virus encephalitis. J Virol 62, 3027-3031.

Zhao, Z., Wakita, T., and Yasui, K. (2003). Inoculation of plasmids encoding

Japanese encephalitis virus PrM-E proteins with colloidal gold elicits a protective

immune response in BALB/c mice. J Virol 77, 4248-4260.

Zhu, M., Xu, X., Liu, H., Liu, X., Wang, S., Dong, F., Yang, B., and Song, G.

(2003). Enhancement of DNA vaccine potency against herpes simplex virus 1 by co-

administration of an interleukin-18 expression plasmid as a genetic adjuvant. J Med

Microbiol 52, 223-228.

Zivna, I., Green, S., Vaughn, D. W., Kalayanarooj, S., Stephens, H. A.,

Chandanayingyong, D., Nisalak, A., Ennis, F. A., and Rothman, A. L. (2002). T cell

responses to an HLA-B*07-restricted epitope on the dengue NS3 protein correlate

with disease severity. J Immunol 168, 5959-5965.

272

Zivny, J., DeFronzo, M., Jarry, W., Jameson, J., Cruz, J., Ennis, F. A., and Rothman,

A. L. (1999). Partial agonist effect influences the CTL response to a heterologous

dengue virus serotype. J Immunol 163, 2754-2760.

development of novel vaccines for the concurrent...

Documents