detection of single nucleotide polymorphisms in p53 mutation hotspots and expression of mutant p53...

Full Paper

Detection of Single Nucleotide Polymorphisms in p53 MutationHotspots and Expression of Mutant p53 in Human Cell Lines Usingan Enzyme-Linked Electrochemical AssayPetra Horakova,a, b Eva Simkova,a Zdenka Vychodilova,a Marie Brazdova,a Miroslav Fojtaa*a Institute of Biophysics AS CR, v.v.i., Kralovopolska 135, 61265 Brno, Czech Republic

*e-mail: [email protected] Department of Analytical Chemistry, Faculty of Chemical Technology, University of Pardubice, Nam. Cs. Legi� 565,

532 10 Pardubice, Czech Republic

Received: May 5, 2009Accepted: June 1, 2009

AbstractAn enzyme-linked electrochemical technique for single nucleotide polymorphism (SNP) typing in the p53 tumorsuppressor gene is presented. The technique is based on a DNA polymerase-catalyzed extension of a primerhybridized to a target DNA strand upstream (5’! 3’) to the SNP site by one nucleotide bearing a biotin tag. Underoptimized conditions, efficient incorporation of the biotinylated nucleotide occurs only in the case of complementaritybetween the first nucleotide in single-stranded 5’-overhang of the target strand. The introduced biotin tag is detectedafter capture of the primer extension products at magnetic beads bearing oligoT strands via oligoA adaptors at 5’-endsof the primer, binding of streptavidin-alkaline phosphatase conjugate and enzymatic conversion of 1-naphthylphosphate into 1-naphthol which is determined electrochemically at carbon electrodes. In addition to model studieswith synthetic oligonucleotides, we report on detection of mutant p53 expression in human cell lines using reversetranscription-PCR technique combined with amplified primer extension and the magnetic beads-based electro-chemical assay.

Keywords: Enzyme-linked electrochemical assay, SNP typing, p53, Mutation, Magnetic beads, Polymorphism

DOI: 10.1002/elan.200904656

Dedicated to Professor Karel Vytras on the Occasion of His 65th Birthday

1. Introduction

Recent progress in the utilization of electrochemicaltechniques in sequence-specific DNA sensing has broughta number of novel applications. It has been shown thatelectrochemical detection is well suited not only for DNAhybridization sensors (where it is applied to monitorformation of the hybrid duplexes between the surface-immobilized capture probe and a target DNA of interest, orbetween the target DNA and a specifically labeled reporterprobe, reviewed in [1, 2]), but also in connection with otherapproaches well established in contemporary molecularbiology, such as primer extension (PEx) or polymerase chainreactions (PCR). These techniques are based on sequence-specific in vitro synthesis of DNA by elongation of a shortoligonucleotide primer forming duplex with a segment inthe DNA of interest, catalyzed by DNA polymerases andrequiring deoxynucleotide triphosphates (dNTP) as mono-meric substrates. Using the PEx, nucleotide sequence of thenewly synthesized DNA strand is complementary to theDNA molecule used as a template, while PCR amplifiesdouble-stranded DNA fragments delimited by pair ofprimers. Both techniques in principle allow incorporation

of nucleotide analogues, chemically modified or labelednucleotides into the synthesized DNA provided that corre-sponding modified dNTPs are available and suitable assubstrates for the DNA polymerases [3 – 6]. Some of thecurrent arrayed techniques of DNA resequencing (such asAPEX [7]) involve this principle combined with fluorescentDNA labeling. In our recent papers we reported onapplication of dNTP conjugates with ferrocene [3], nitro-phenyl or aminophenyl tags [4], or tris-bipyridine complexesof osmium or ruthenium [8] as electroactive DNA markers.We showed that the above mentioned labeled dNTPs canserve as convenient tools for the detection of singlenucleotide polymorphisms (SNPs) [4, 8].

Another convenient tag for nucleotides to be enzymati-cally incorporated into DNA is biotin due to the versatilityof bioanalytical application of the biotin-(strept)avidinlinkage. In particular, enzymes (when coupled to avidin orstreptavidin) have often been attached to biotinylatedtargets and used in various enzyme-linked bioassays,including electrochemical DNA sensing. The enzyme-linked electrochemical techniques employing biotinDNA labeling and streptavidin-enzyme conjugates sub-sequently attached to the biotin tags have taken the

1723

� 2009 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim Electroanalysis 2009, 21, No. 15, 1723 – 1729

advantage of biocatalytic signal amplification and havebeen applied by many authors involved in electrochemicalDNA sensing (reviewed in [1, 2, 9]). Application ofbiotinylated (and subsequently enzyme-labeled) reporterprobes was combined with both classical (�single – sur-face�) electrochemical biosensor concept [10] and the�double – surface� [1, 2, 9] techniques. Similarly, usingbiotinylated dNTPs, PEx-based electrochemical assayshave been developed and applied for the detection ofvarious DNA targets [6, 11], including PCR-amplifiedgenomic DNA sequences. We have recently demonstratedapplicability of this type of assay in monitoring tissuespecific gene expression [6].

The p53 gene is one of the main components of the celldefense against malignant transformation [12]. It encodes aprotein that acts as a tumor suppressor via activation of theexpression of a number of the genes involved in the cell cyclecontrol, DNA repair or in the programmed cell death. Theimportance of the p53 gene is underlined by the fact thatmore than 50% of human solid tumors are connected withmutation in the p53 gene. The cancer-associated mutationsare concentrated in a region encoding the protein coredomain responsible for the recognition of the specific DNAsequences within promoters of the p53-controlled genes[13 – 15]. The most frequent mutations connected with theloss of the p53 tumor suppressor function represent sixmutation �hotspots� [16]. Occurrence of the hotspot muta-tions has been established to have an impact on the cellproneness to becoming a tumor cell and to have implicationsin efficacy and prognosis of the cancer therapy. Identifica-tion of the hotspot mutants is thus an important diagnosticcriterion.

In this paper we applied sequence-specific PEx incorpo-ration of the biotinylated nucleotides, in connection with asimple double-surface electrochemical assay, for SNPtyping within the p53 hotspot mutation sites. We demon-strate a reliable discrimination between wild and mutanttypes in the R273H, G245S and R273C hotspots. Inaddition, using a reverse transcription-PCR techniquecombined with amplified (thermally cycled) PEx SNPtyping protocol we monitor expression of wild type ormutant p53 in human cell lines.

2. Experimental

2.1. Materials

Synthetic oligodeoxynucleotides (ODNs; Table 1) werepurchased from VBC Biotech. Pfu DNA polymerase andStreptavidin alkaline phosphatase (ALP) conjugate wereobtained from Promega, Sequenase and Thermo Sequenaseform USB, Klenow Fragment, Klenow Fragment (3’-5’exo-),Vent (exo-) DNA Polymerase, Therminator DNA Poly-merase, Therminator II DNA Polymerase from NewEngland Biolabs, DyNAzyme II DNA Polymerase fromFinnzymes, Pwo DNA Polymerase from PEQLAB, un-modified nucleoside triphosphates (dATP, dTTP, dGTP,dCTP) from Sigma, Biotin-16-dUTP (dUbioTP) from Roche,Biotin-14-dCTP (dCbioTP) from Invitrogen, 1-naphtyl phos-phate disodium salt from Sigma. Other chemicals were ofthe analytical grade.

2.2. Reverse Transcription-PCR Analysis of p53Expression in Human Cell Lines

Reverse transcription of the total RNA isolated from theU251 [17] or Onda 10 [18] cells was performed using High-Capacity cDNA Reverse Transcription Kits (AppliedBiosystems). PCR amplification of the p53 cDNA (thereverse transcript) was performed using p53-for and p53-revprimers (0.5 mM each, sequences: ATGGAGGAGCCG-CAGTCAG, TCAGTCTGAGTCAGGCCCTTC), PfuDNA polymerase (3U) and mix of standard dNTPs(125 mM each) in a total volume of 100 mL. The PCRproceeded in 30 cycles (denaturation 94 8C/90 s, annealing60 8C/120 s, polymerization 72 8C/180 s). The PCR productswere then purified using QIAquick PCR Purification Kit(QIAGEN).

2.3. Primer Extension with Model ODN Targets

ODN target template (37.5 nM) was mixed with primer(37.5 nM), DNA polymerase (0.2 – 0.5 U) and dCbioTP or

Table 1. Nucleotide sequences of the synthetic ODNs used in this work.

Hotspot Nucleotide sequence ODN acronym

R273H wt 5-GTGCGTGTTTGTGCCTGTCCT wt-273H3-_ACAAACACGGACAGGTTTAAAAAAAAAAAAAAAAAAAA prim-273H

mut 5-GTGCATGTTTGTGCCTGTCCT mut-273H3-_ACAAACACGGACAGGTTTAAAAAAAAAAAAAAAAAAAA prim-273H

R273C wt 5-AAAAAAAAAAAAAAAAAAAATTTGAACAGCTTTGAGGTG_ prim-273C3-CTTGTCGAAACTCCACGCACC wt-273C

mut 5-AAAAAAAAAAAAAAAAAAAATTTGAACAGCTTTGAGGTG_ prim-273C3-CTTGTCGAAACTCCACACACC mut-273C

G245S wt 5-GGGCGGCATGAACCGGAGGCC wt-245S3-_CGTACTTGGCCTCCGGTTTAAAAAAAAAAAAAAAAAAAA prim-245S

mut 5-GGGCAGCATGAACCGGAGGCC wt-245S3-_CGTACTTGGCCTCCGGTTTAAAAAAAAAAAAAAAAAAAA prim-245S

1724 P. Horakova et al.

Electroanalysis 2009, 21, No. 15, 1723 – 1729 www.electroanalysis.wiley-vch.de � 2009 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.electroanalysis.wiley-vch.de

dUbioTP (1 mM) in a total volume of 20 mL. The reaction washeld at 37 8C using thermolabile polymerases, or at 60 – 75 8Cusing thermostable polymerases, for 30 min.

2.4. Amplified Primer Extension with the RT-PCR Targets

3.5 ng of the PCR-amplified p53 cDNA fragments and0.06 mM primer were mixed with the thermostable DNApolymerase (Thermo Sequenase, 0.2 U) and dCbioTP ordUbioTP (1 mM) in 20 mL. The reaction was conducted during20 thermal cycles (94 8C/90 s, 60 8C/120 s, 72 8C/180 s).

2.5. Enzyme-Linked Assay on Magnetic Beads

The PEx products with the dA20 5’-overhang in the primerstrand were immobilized onto magnetic beads bearing dT25

strands from 20 mL of PEx solution with 0.3 M NaCl duringshaking for 30 min. The unbound components of the PExmixture were removed by triplicate washing of the beadswith solution containing 0.3 M NaCl, 10 mM Tris-HCl,pH 7.5 (buffer H). The unoccupied surface of beads wasblocked by incubation in 50 mL of milk solution (2.5 g ofpowdered milk dissolved in 50 mL of PBS – 0.28 M NaCl,5.5 mM KCl, 24 mM NaHPO4, 3.5 mM KH2PO4, pH 7.4) for15 min. Then 50 mL of streptavidin-ALP solution (100-timesdiluted stock in milk-PBS) was added to the beads and thesamples were shaken for 30 min, followed by triplicatewashing with PBS containing 0.05% of Tween 20 andtriplicate washing with buffer H. Finally, the beads wereincubated with 50 mL of 5 mM 1-naphthyl phosphatesolution in 0.5 M K2CO3, 0.5 M NaHCO3, pH 9.5 for30 min under stirring. After incubation, the solution con-taining enzymatically produced 1-napthol was separatedfrom the beads, added to the background electrolyte (0.5 MK2CO3, 0.5 M NaHCO3, pH 9.5) and analyzed electro-chemically. All incubation steps were conducted at 20 8C.

2.6. Voltammetric Measurements

All measurements were performed with a CHI440 Electro-chemical Workstation (CH Instruments, Inc., USA) con-nected to a three-electrode system [with basal-plane pyro-lytic graphite electrode (PGE) as working, Ag/AgCl/3 MKCl as reference and platinum wire as counter electrode].The electroactive indicator 1-naphthol was detected via itselectrochemical oxidation using linear sweep voltammetry(LSV) in 0.5 M K2CO3 and 0.5 M NaHCO3, pH 9.5 withinitial potential �0.5 V, end potential þ0.9 V, scan rate1 Vs�1, potential step 5 mV.

3. Results and Discussion

Our recent work on electrochemical detection of SNPusing sequence-specific incorporation of labeled nucleo-

tides into specific positions revealed the usefulness of thePEx-based approaches in connection with the dNTPconjugates bearing various electrochemically active tags[3, 4, 8]. PEx incorporation of multiple biotin tags intospecific DNA sequences has recently been used by us toimprove sensitivity and specificity of electrochemicaldetection of PCR-amplified DNA fragments. We appliedthe technique to monitor plant tissue-specific gene ex-pression [6]. Here we use site specific incorporation of asingle biotin-labeled nucleotide, in connection with themagnetic beads (MB)-based �double – surface� detectionconcept (reviewed in [2, 9]), to discriminate between SNPvariants within mutation hotspots R273H, R273C andG245S in tumor suppressor p53 gene.

Principle of the technique applied in this work is depictedin Figure 1. Sequence polymorphism (point mutation) in atarget DNA (tDNA) strand is interrogated using a probethat hybridizes with the tDNA upstream (! 3’ in the targetstrand) to the SNP site, which represents the first free(unpaired) nucleotide in the tDNA single-stranded 5�-overhang. The probe serves as a primer to be extended byone nucleotide on the tDNA template. Upon addition of theDNA polymerase and a biotin-labeled dNTP (dNbioTP)complementary to the first unpaired base, the labelednucleotide is attached to 3’-end of the probe primer. Whenthe dNbioTP does not match base pairing with the nucleotideat the SNP position (i.e., when another SNP variant occurs inthe tDNA), efficient PEx should not take place and the labelshould not be introduced under optimum conditions. Theprobe primers are designed to posses a single-stranded 5’-oligo(A) tail for post-PEx capture at magnetic beadsbearing oligo(T) stretches. Streptavidin-ALP conjugate issubsequently attached to the PEx product at the beads.After transferring the MB into a solution of 1-naphthylphosphate, the latter substrate is enzymatically convertedinto 1-naphthol serving as an electroactive indicator of thepresence of the enzyme – ergo the biotin tag – ergo the SNPtype complementary to the dNbioTP incorporated.

The technique was first tested using synthetic oligonucle-otides modeling the p53 hotspot SNP variants (Table 1). Inthese experiments, the PEx reactions were conducted in asingle step using equimolar primer-target pairs (as depictedin Fig. 1) and thermolabile DNA polymerases (such asKlenow fragments or the Sequenase enzyme) at 37 8C. For aPEx reaction with 37.5 nM primer and 37.5 nM wild type(wt) of the G245S hotspot possessing guanine at the SNPposition, using dCbioTP, a well developed peak due to 1-naphthol electrooxidation was observed (Fig. 2A, curve 1).On the other hand, the wt target combined with dUbioTPyielded only weak signal (Fig. 2A, curve 2) which wasprobably due to a small frequency of erroneous incorpo-ration of U against G (see below) rather than to non-specificadsorption of the ALP conjugate at the MB or spontaneoussubstrate hydrolysis (because negative controls withoutdNbioTP, without DNA polymerase or without targettemplates gave zero signals, not shown). For the mutant(mut) type of the G245S hotspot (with adenine at the SNPposition of the tDNA), well developed signals were

1725Detection of Single Nucleotide Polymorphisms

� 2009 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim www.electroanalysis.wiley-vch.de Electroanalysis 2009, 21, No. 15, 1723 – 1729


obtained for PEx with dUbioTP but not dCbioTP (Fig. 2A,curves 4 and 3, respectively).

We optimized the experimental conditions to reach thebest discrimination between SNP types matching or mis-matching the complementarity with the dNbioTP. We testeddependences on the concentrations of the target-primerhybrids (Fig. 2B) and of the dNbioTPs (not shown), variousDNA polymerases (Fig, 3A), and optimized their concen-tration (activity units added to the PEx reaction, not shown).Based on these experiments, most of the single-step PExreactions were performed in 20 mL volumes with 37.5 nMprimer-target duplexes, 1 mM dNbioTPs and 0.2 units of DNA

polymerase per reaction. Increasing the dNbioTP and/orenzyme concentrations resulted in more frequent misincor-poration of the tags (resulting in false positives), whiledecreasing concentrations of any of the components belowthe above-mentioned values caused decreasing detectionsensitivity in the true positive (target SNP-dNbioTP match-ing) samples.

Special attention was paid to the choice of DNApolymerases providing best fidelity of the biotinylatednucleotide incorporation. We tested both thermolabilepolymerases acting at 37 8C and thermostable ones withtemperature optima at 60 – 75 8C; application of the latter isnecessary for the thermally cycled PEx reactions (seebelow). As summarized in Figure 3, individual enzymesdiffered significantly in both efficiency of the properincorporation and tendency to misincorporation of eitherUbio and Cbio in the single-step PEx with oligonucleotidetargets (as in Fig. 2). In general, all polymerases showedmore frequent erroneous incorporation of Ubio against G,compared to Cbio against A, due to the formation of therelatively stable G · U wobble pair [19]. Most of the thermo-stable polymerases were more prone to the Ubio misincor-poration than the thermolabile ones; in some of the thermo-stable polymerases (such as Therminator or TherminatorII), it was even impossible to distinguish between correctincorporation of Cbio and erroneous incorporation of Ubio tothe same site (Fig. 3B). The thermostable enzymes usuallyexhibited more efficient correct incorporation of the Ubio,compared to the Cbio (Fig. 3B). These data demonstrate theimportance of the careful selection of DNA polymerase forattaining sufficient specificity of the PEx reactions. Based onthese studies, we selected Klenow (exo-) and Sequenaseenzymes as best suited for the single-step PEx reactions at37 8C (Fig. 3A). For the following thermally cycled PEx,Thermo Sequenase was chosen which – as the only oneamong the thermostable enzymes – exhibited efficientcorrect incorporation of both biotinylated nucleotides andsufficiently small frequency of errors featured by Ubio

incorporation against G and/or erroneous elongation ofthe primer by more than one nucleobase.

We focused the next studies on the detection of theexpression of the mutant p53 in the in vitro cultured cell linesat the mRNA level using a reverse transcription – PCRprotocol [6]. Briefly, total RNA was isolated from cell linesU251 (expressing R273H mutant) and Onda 10 (expressingG245S mutant). The RNA was reversely transcribed and344 bp fragments of the p53 cDNA (Scheme 1) wereamplified using gene-specific primers. These fragmentswere further used as templates for the enzyme-linkedelectrochemical SNP assay. Our attempts to perform thesingle-step PEx reactions (as above) with equimolar tDNA/probe primer ratios were unsuccessful due to the largedifference in molecular weights of the target (344 bp) andthe primer (40 bases), resulting in insufficient sensitivity andsuggesting that an amplification of the PEx incorporation isrequired. Using a thermostable DNA polymerase, it ispossible to cycle the PEx reaction similarly as done in thePCR. Since only one primer is used, extension of only one

Fig. 1. A) Incorporation of dNbioTP into DNA using primerextension. The probe primer is hybridized with complementarysequence of target DNA and extended using DNA polymeraseand dNbioTP that is/is not attached to primer in accord tocomplementarity of the first free nucleotide in the target templatefollowing the primer sequence. B) Enzyme-linked electrochemicalassay with magnetic beads. After immobilization of the PExproduct on magnetic beads, the beads surface is blocked and thebiotin tags are coupled to a conjugate of streptavidin with alkalinephosphatase (ALP). After washing, the substrate, 1-naphthylphosphate, is added and enzymatically converted into an electro-active indicator 1-naphthol that is detected by voltammetry at acarbon electrode (producing peak N).




strand takes place and the amount of the PEx productsincreases linearly with the number of cycles. Thus, when anexcess of the primer is added to the reaction, this processresults in enrichment of the extended primers bearing thebiotinylated nucleotide (in case of complementarity be-tween the dNbioTP used and the first free nucleobase in thetarget; see Fig. 4A).

Figure 4B shows results of the amplified PEx experimentsobtained for the G245S mutation hotspot in the p53 cDNAs(where G at the SNP position corresponds to the wild typeand A to the mutant type). After 20 cycles of the PEx, thePEx products were captured at the MB and further analyzedas described above. For genomic DNA amplicon from the

U251 cells, bearing guanine in the G245 hotspot position(corresponding to the wt at this SNP site), a well developedpeak N was obtained with dCbioTP present in the PExmixture, while reaction with dUbioTP gave only negligiblepeak due to the certain frequency of misincorporation. Thesame experiment with DNA amplicon from the Onda 10cells which express the G245S p53 mutant was performed. Inthis case, specific incorporation of Ubio was indicated by anintense peak N, while no signal was obtained after PEx withdCbioTP. Analogous results were obtained for analysis of theR273H mutation hotspot in the same cDNA amplicons(which is mutant in U251 cells and wt in Onda 10).

Fig. 2. A) Typical linear sweep voltammograms resulting from the SNP typing experiments with oligonucleotides derived from the p53mutation hotspot sites (here, G245S). 1) wtþ dCbioTP, 2) wtþ dUbioTP, 3) mutþ dCbioTP, 4) mutþ dUbioTP. Measurement conditions:LSV, Ei¼�0.5 V, Efin¼þ0.9 V, scan rate 1 Vs�1, potential step 5 mV, background electrolyte 0.5 M K2CO3 and 0.5 M NaHCO3. B)Dependence of the peak N height on primer · target duplex concentration for ODNs derived from the R273H hotspot. PEx with dCbioTP(full columns), dUbioTP (hatched columns). C) Bar graph showing results for three different hotspots (in all of them G at the SNPposition corresponds to wt and A to mutant): wtþ dCbioTP (full gray column), wtþ dUbioTP (hatched gray), mutþ dCbioTP (full black),mutþdUbioTP (hatched black).

Fig. 3. Comparison of different DNA polymerases regarding fidelity of incorporation of the biotinylated nucleotides. A) Forthermolabile DNA polymerases, the PEx reaction was held for 30 min at 37 8C. B) Results obtained using thermostable DNApolymerases for PEx held for 30 min at 75 8C (Therminator and Therminator II polymerases) or at 60 8C (others).




4. Conclusions

We present a primer extension-based enzyme-linked elec-trochemical technique for SNP typing. Due to the sequencespecific elongation of a probe primer by a biotinylated

nucleotide, reliable discrimination between wild and mutanttypes of the p53 mutation hotspots R273H, G245S andR273C is attained. We took the advantage of the double-surface MB-based electrochemical bioassays, allowing effi-cient separation of the PEx products from the reaction

Scheme 1. Nucleotide sequence of the PCR-amplified 344-bp p53 cDNA fragment. Sequences complementary to probe primers usedin the SNP typing experiments are denoted by rectangles, nucleotides at the SNP positions are in bold.

Fig. 4. Detection of wild type vs. mutant p53 expression in the human cell lines using RT-PCR followed by the SNP typing assay. A)Scheme of amplified SNP sensing in the PCR amplicons of p53 cDNA using thermally cycled PEx. The target double-stranded DNAfragment (PCR product) was denatured and mixed with the excess of the probe primer, thermostable DNA polymerase and a dNbioTP.The primer hybridized with template and the dNbioTP was incorporated. Then the thermal denaturation followed to allow thehybridization of another (unlabeled) primer and new extension in the next cycle. The procedure was repeated 20-times to enrich thesample for biotin-labeled primers. B) Linear sweep voltammograms obtained for SNP typing within the G245 hotspot for p53 expressionin U251 cells (wt at the G245 position) or Onda 10 cells (G245S mutant; see Scheme 1). Sequences around the SNP positions are shownin the figure; for other details see Fig. 2.




mixture containing potentially interfering species (such asproteins, detergents or unreacted biotinylated dNTPs).When combined with the RT-PCR protocol and an ampli-fied (thermally cycled) PEx, analogous technique has beenapplied to detect wild type or mutant p53 expression inhuman cell lines. Due to the compatibility of the MBtechnology with microfluidic systems and the lab-on-a-chipconcept, the presented approach appears as one of thepromising ones for the future development of automatedelectrochemical devices for genetic screening.

5. Acknowledgements

This work was supported by the Czech Science Foundation(203/07/1195), the Academy of Sciences of the CzechRepublic (IAA400040901), the Ministry of Education,Youth and Sports of the CR (LC06035), by the EU(MERG-6-CT-2005-014875), and by Institutional ResearchPlans No. AV0Z50040702 and AV0Z50040507.

6. References

[1] E. Palecek, M. Fojta, In Bioelectronics (Eds: I. Wilner, E.Katz), Wiley VCH, Weinheim 2005, pp. 127 – 192.

[2] E. Palecek, M. Fojta, Talanta 2007, 74, 276.[3] P. Brazdilova, M. Vrabel, R. Pohl, H. Pivonkova, L. Havran,

M. Hocek, M. Fojta, Chem. Eur. J. 2007, 13, 9527.[4] H. Cahova, L. Havran, P. Brazdilova, H. Pivonkova, R. Pohl,

M. Fojta, M. Hocek, Angew. Chem. Int. Ed. 2008, 47, 2059.

[5] M. Hocek, M. Fojta, Org. Biomol. Chem. 2008, 6, 2233.[6] P. Horakova-Brazdilova, M. Fojtova, K. Vytras, M. Fojta,

Sensors 2008, 8, 193.[7] J. M. Shumaker, J. J. Tollet, K. J. Filbin, M. P. Montague-

Smith, M. C. Pirrung, Bioorg. Med. Chem. 2001, 9, 2269.[8] M. Vrabel, P. Horakova, H. Pivonkova, L. Kalachova, H.

Cernocka, H. Cahova, R. Pohl, P. Sebest, L. Havran, M.Hocek, M. Fojta, Chem. Eur. J. 2009, 15, 1144.

[9] M. Fojta, P. Horakova, K. Cahova, M. Fojtova, S. Hason, L.Havran, P. Kostecka, K. Nemcova, H. Pivonkova, M.Brazdova, in Bioelectrochemistry Research Developments(Ed: E. M. Bernstein), Nova Publishers, Hauppauge, NY2008, pp. 67 – 103.

[10] M. Fojta, P. Brazdilova, K. Cahova, P. Pecinka, Electro-analysis 2006, 18, 141.

[11] F. Patolsky, A. Lichtenstein, I. Willner, Chem. Eur. J. 2003, 9,1137.

[12] B. Vogelstein, D. Lane, A. J. Levine, Nature 2000, 408, 307.[13] H. C. Ang, A. C. Joerger, S. Mayer, A. R. Fersht, J. Biol.

Chem. 2006, 281, 21934.[14] H. Pivonkova, P. Pecinka, P. Ceskova, M. Fojta, FEBS J.

2006, 273, 4693.[15] M. Brazdova, T. Quante, L. Togel, K. Walter, C. Loscher, V.

Tichy, L. Cincarova, W. Deppert, G. V. Tolstonog, NucleicAcids Res. 2009, 37, 1486.

[16] A. Petitjean, M. I. Achatz, A. L. Borresen-Dale, P. Hainaut,M. Olivier, Oncogene 2007, 26, 2157.

[17] C. Gomez-Manzano, J. Fueyo, A. P. Kyritsis, P. A. Steck, J. A.Roth, T. J. McDonnel, K. D. Steck, V. A. Levin, W. K. A.Yung, Cancer Res. 1996, 56, 694.

[18] H. Koga, S. Zhang, K. Washiyama, T. Ichikawa, K. Onda, T.Kumanishi, Brain Tumor Pathol. 1996, 13, 1.

[19] W. H. Elliott, D. C. Elliott, Biochemistry and MolecularBiology, 2nd ed., Oxford University Press, New York 2001.




detection of single nucleotide polymorphisms in p53 mutation hotspots and expression of mutant p53...

Documents