design of a novel serum-free monolayer differentiation ... · embryonic stem cells (escs) can...
TRANSCRIPT
Design of a novel serum-free monolayer differentiation system for murine embryonic stem cell-
derived chondrocytes for potential high-content imaging applications
by
Yan Ling Elaine Waese
A thesis submitted in conformity with the requirements
for the degree of Doctor of Philosophy
Department of Chemical Engineering and Applied Chemistry
Institute of Biomedical and Biomaterials Engineering
University of Toronto
© Copyright by Y. L. Elaine Waese «2011»
ii
Design of a novel serum-free monolayer differentiation system for murine embryonic stem cell-derived chondrocytes for potential
high-content imaging applications
Yan Ling Elaine Waese
Doctor of Philosophy
Department of Chemical Engineering and Applied Chemistry
Institute of Biomedical and Biomaterials Engineering
University of Toronto
2011
Abstract
Cartilage defects have limited capacity for repair and are often replaced by fibrocartilage with
inferior mechanical properties. To overcome the limitations of artificial joint replacement, high
throughput screens (HTS) could be developed to identify molecules that stimulate differentiation
and/or proliferation of articular cartilage for drug therapy or tissue engineering. Currently
embryonic stem cells (ESCs) can differentiate into articular cartilage by forming aggregates
(embryoid body (EB), pellet, micromass), which are difficult to image. I present a novel, single-
step method of generating murine ESC (mESC)-derived chondrocytes in monolayer cultures in
chemically defined conditions. Mesoderm induction was achieved in cultures supplemented with
BMP4, Activin A or Wnt3a. Prolonged culture with sustained Activin A, TGFβ3 or BMP4
supplementation led to robust chondrogenic induction. A short pulse of Activin A or BMP4 also
induced chondrogenesis efficiently while Wnt3a acted as a later inducer. Long-term
supplementation with Activin A or with Activin A followed by TGFβ3 may specifically promote
iii
articular cartilage formation. Thus, I devised a serum-free (SF) culture system to generate ESC-
derived chondrocytes without the establishment of 3D cultures or the aid of cell sorting.
Cultures were governed by the same signaling pathways as 3D ESC differentiation systems and
limb bud mesenchyme or articular cartilage explant cultures. I am also in the process of creating
a Col2a1 promoter-controlled, Cre-inducible reporter cell line to be used in my SF culture
system using the Multisite Gateway® cloning technology. ESCs undergoing chondrogenic
differentiation can be identified and quantified in HTS via the expression of fluorescent proteins.
In addition, this transgenic line can be used to isolate ESC-derived chondrocytes as well as their
progeny via cell sorting or antibiotic selection for in-depth characterization. The modular design
of my construct system allows transgenic lines to be generated using various promoters of
chondrogenic marker genes to perform parallel HTS analyses.
iv
Acknowledgments
First and foremost, I would like to express my gratitude towards Dr. William Stanford for
giving me the opportunity to conduct research in his laboratory. Through his guidance and
support, I have learned tremendously and the experience has helped me achieve great
professional as well as personal growth. I thank members of the Stanford Lab for being
wonderful colleagues and friends who filled the work days with fun and laughter (in addition to
providing sound scientific advice of course). The fond memories we created together will be
great conversation topics for years to come. To my family, thank you for providing
unconditional support through the years which allowed me to pursue my interests. I appreciated
the little reminders that taught me the importance of work-life balance. I would also like to tip
my hat to my dad, whose exhibition of courage and tenacity when faced with life’s adversity was
a great source of inspiration. I would like to thank Aaron for his boundless love and support.
Everyday I am humbled by your focus, determination and discipline, which frankly made me
look like a really lazy person.
Lastly, to the little one, thank you for helping me find the important things in life.
v
Table of Contents
Acknowledgments.................................................................................................................... iv
Table of Contents ..................................................................................................................... v
List of Tables ........................................................................................................................... ix
List of Figures ........................................................................................................................... x
List of Abbreviations ............................................................................................................. xiv
Chapter 1 Introduction ............................................................................................................ 1
1.1 Mammalian embryonic development .............................................................................. 1
1.1.1 Asymmetrical embryonic patterning begins at pre-gastrulation with the
differential expression patterns of key growth factors .......................................... 1
1.1.2 Gastrulation – formation of ectoderm, mesoderm and endoderm germ layers ...... 2
1.1.2.1 Formation of the primitive streak is marked by the expression of the
transcription factor Brachyury ............................................................... 3
1.1.2.2 The migration of the primitive streak is carried out via epithelial-to-
mesenchymal transition ......................................................................... 5
1.2 Signaling pathways involved in early embryonic development ........................................ 6
1.2.1 Transforming growth factor β (TGFβ) pathway ................................................... 6
1.2.2 Wnt pathway ....................................................................................................... 8
1.2.3 Roles of TGFβ and Wnt signaling pathways during gastrulation and
mesoderm specification ......................................................................................11
1.3 Skeletogenesis ...............................................................................................................12
1.3.1 Chondrogenesis during endochondral bone formation ........................................13
1.3.1.1 Key molecular markers of chondrogenesis ............................................13
1.3.1.2 Structure of hyaline cartilage ................................................................15
1.3.2 Challenges in cartilage repair .............................................................................17
1.4 Potential of stem cells in regenerative medicine .............................................................19
vi
1.5 Sources of stem cells ......................................................................................................20
1.5.1 Somatic stem cells ..............................................................................................20
1.5.1.1 MSCs in cartilage repair .......................................................................22
1.5.2 Embryonic stem cells .........................................................................................23
1.5.2.1 Regulation of ESC cell fate decisions ...................................................25
1.5.2.1.1 Murine ESCs maintain their undifferentiated state through the
activation of the gp130 signaling pathway ............................................. 25
1.5.2.1.2 Key transcription factors governing ESC self-renewal – OCT4,
SOX2 and NANOG ............................................................................... 26
1.5.2.1.3 The TGFβ signaling pathway plays a role in both ESC self-
renewal and differentiation .................................................................... 28
1.5.2.1.4 Wnt signaling influences ESC cell fate decisions in a context-
dependent manner .................................................................................. 29
1.5.3 Induced pluripotent stem cells (iPSCs) ...............................................................30
1.6 Genetic modifications to ESCs .......................................................................................32
1.6.1 Non-viral methods used in the transfer of foreign DNA into mammalian cells ....32
1.6.2 Antibiotic-resistance genes .................................................................................35
1.6.3 Fluorescent proteins ...........................................................................................36
1.6.4 Conditional transgene expression .......................................................................38
1.6.4.1 Cre/loxP system ...................................................................................38
1.6.4.2 Flp/frt system .......................................................................................39
1.6.4.3 C31/att system ......................................................................................39
1.7 Project objectives and hypothesis ...................................................................................40
Chapter 2 Serum-free derivation of ESC-derived mesoderm and chondrocytes from
monolayer cultures .............................................................................................................50
2.1 Overview .......................................................................................................................51
2.2 Materials and Methods ...................................................................................................52
2.2.1 Maintenance of ESCs .........................................................................................52
vii
2.2.2 Differentiation of ESCs ......................................................................................53
2.2.3 HCI experiment setup .........................................................................................54
2.2.4 Antibody staining for IF and HCI .......................................................................54
2.2.5 Flow cytometry ..................................................................................................55
2.2.6 Alcian blue staining ............................................................................................55
2.2.7 cDNA synthesis..................................................................................................55
2.2.8 Real-time quantitative polymerase chain reaction (qPCR) ..................................56
2.2.9 Statistical analysis ..............................................................................................56
2.3 Results ...........................................................................................................................58
2.3.1 N2B27 supported ESC adhesion and proliferation on collagen IV ......................58
2.3.2 Activin A-supplemented monolayer differentiation cultures exhibited stronger
cell-matrix adhesion and improved survival........................................................60
2.3.3 Endogenous Wnt3a was up-regulated in serum cultures as well as BMP4-
supplemented and untreated SF differentiation cultures ......................................62
2.3.4 BMP4, Activin A or Wnt3a induced BRACHYURY+ primitive streak-like
populations in monolayer differentiation cultures ...............................................64
2.3.5 Mesoderm marker genes expression patterns correlated with those in EB
cultures and in murine embryos studies ..............................................................66
2.3.6 Activin A facilitated chondrogenic differentiation in SF monolayer cultures ......68
2.3.7 TGFβ3 induced chondrocyte formation when added at the onset of
differentiation .....................................................................................................72
2.3.8 Five-day Activin A treatment achieved competitive chondrogenic
differentiation in SF monolayer cultures .............................................................75
2.3.9 High BMP4 concentration induced chondrogenic differentiation, while Wnt3a
acted as a late chondrogenic inducer ...................................................................78
2.4 Discussion .....................................................................................................................82
2.5 Potential uses of 2D culture system in HTS/HCI applications ........................................88
Chapter 3 Generation of a bi-colour fluorescent reporter mESC line for potential
chondrocyte-specific fate mapping and drug screen applications ....................................91
viii
3.1 Overview .......................................................................................................................91
3.2 Materials and Methods ...................................................................................................93
3.2.1 Differentiation of EST2B cells ...........................................................................93
3.2.2 Transient transfection of T2A plasmid into HEK 293T cells ...............................94
3.2.3 Generation of stable transgenic EST2 line ..........................................................94
3.2.4 Validation of targeting to the Rosa26 locus via PCR...........................................95
3.2.5 PCR ...................................................................................................................96
3.2.6 Immunostaining .................................................................................................96
3.2.7 Ethanol precipitation ..........................................................................................97
3.2.8 Transformation ...................................................................................................97
3.2.9 Directional cloning of NLS-Cre and SV40pA into pBlueScript ..........................97
3.2.10 Gateway® cloning..............................................................................................99
3.3 Results ......................................................................................................................... 100
3.3.1 Validation of EST2B clones ............................................................................. 100
3.3.2 Construction of vector T2A .............................................................................. 103
3.3.3 Validation of the transgenic EST2 line ............................................................. 112
3.4 Current work................................................................................................................ 114
3.5 Future work ................................................................................................................. 114
Chapter 4 Discussion and conclusion ................................................................................... 116
References .............................................................................................................................. 125
Appendix A Supplementary Data for Chapter 2 ................................................................. 155
Appendix B Supplementary Data for Chapter 3 .................................................................. 164
ix
List of Tables
Table 2.1– List of test conditions used to examine the effects of BMP4, Activin A, Wnt3a,
TGFβ3, FGF8 and serum on monolayer chondrogenic differentiation from R1 ESCs in
chemically defined conditions ...............................................................................................57
Table 3.1 – Test conditions for the transfection of EST2B cells with T2A expression plasmid
using Neon™ Transfection System. .................................................................................... 114
Table A.1 – Primer sequences for qPCR analysis..................................................................... 157
Table B.1 – Primer sequences for RT-PCR and targeting PCR analyses .................................. 164
x
List of Figures
Fig. 1.1 – Schematic diagram depicting A) the blastocyst and B) the layout of the pre-
gastrulation embryo with the asymmetrical expression of marker genes ................................. 2
Fig. 1.2 – Schematic diagram summarizing the regulation of TGFβ signaling pathway ............... 7
Fig. 1.3 – Schematic diagram summarizing the canonical and non-canonical Wnt signaling
pathways................................................................................................................................ 9
Fig. 1.4 – Schematic of the interactions among TGFβ /Wnt signals and their antagonists in an
embryo undergoing early gastrulation ...................................................................................12
Fig. 1.5 – Diagrammatic representation of the structure of articular cartilage .............................17
Fig. 1.6 – Schematic of the screening assay to be conducted to assess the basal conditions to
be used in my monolayer differentiation culture system ........................................................43
Fig. 1.7 – Schematic of the analyses to be conducted to verify mesoderm induction in my
ESC SF monolayer differentiation system .............................................................................44
Fig. 1.8 – Schematic of the experimental strategy to be used in the derivation of ESC-derived
chondrocytes in a defined condition ......................................................................................46
Fig. 1.9 – Design schematic of the reporter construct T2A to be used in the identification of
COL2A1+ ESC-derived chondrocytes generated in the SF monolayer differentiation
system. .................................................................................................................................47
Fig. 1.10 – Diagrammatic representation of the derivation of EST2 transgenic ESC line............48
Fig. 1.11 – Schematic of the interaction between tissue-specific promoter-driven reporter
construct (T2A) and Rosa26-targeted Cre-inducible reporter construct (T2B) when the
Col2a1 promoter was activated upon chondrogenic differentiation of the transgenic EST2
cells. .....................................................................................................................................49
Fig. 2.1 – Two-day ESC cultures on collagen IV in N2B27 medium with LIF maintained
high OCT4 expression ..........................................................................................................59
Fig. 2.2 –Morphologies of four-day SF, growth factor-supplemented ESC monolayer
differentiation cultures established on collagen IV ................................................................61
Fig. 2.3 – Characteristics of four-day SF, growth factor-supplemented ESC monolayer
differentiation cultures established on collagen IV ................................................................62
Fig. 2.4 – Potential synergistic effects of Activin A, BMP4 and Wnt3a in four-day SF,
growth factor-supplemented ESC monolayer differentiation cultures ....................................63
xi
Fig. 2.5 – Addition of exogenous Activin A and Wnt3a led to robust induction of
BRACHYURY protein expression in four-day monolayer differentiation cultures ................64
Fig. 2.6 – Early mesoderm specification in four-day growth factor-supplemented SF
monolayer differentiation cultures.........................................................................................65
Fig. 2.7 – Quantitative PCR analysis showed that BMP4, Activin A and Wnt3a induced the
expression of marker genes of various mesoderm subsets .....................................................67
Fig. 2.8 – 15-day Activin A-treated SF monolayer cultures underwent chondrogenic
differentiation .......................................................................................................................69
Fig. 2.9 – Real-time qPCR results confirmed the up-regulation of (A) Col2a1, (B) Sox9 and
(C) Aggrecan in day 7 and day 15 of Activin A-supplemented SF monolayer
differentiation cultures, while the levels of hypertrophic markers Col10a and Runx2 were
similar to non-inductive conditions (D) .................................................................................70
Fig. 2.10 – Formation of micromasses after 15 days of differentiation in SF medium
supplemented with Activin A (30ng/ml) ...............................................................................71
Fig. 2.11 – Supplementation of SF differentiating cultures with FGF8 or TGFβ3, beginning
on day 0 of differentiation, was able to induce chondrogenic differentiation .........................73
Fig. 2.12 – Supplementation of SF BMP4- or Activin A-treated differentiating cultures with
FGF8 or TGFβ3 did not dramatically enhance chondrocyte formation ..................................74
Fig. 2.13 – Chondrogenic differentiation was achieved in SF monolayer cultures
supplemented with Activin A from day 0-5 of differentiation................................................76
Fig. 2.14 – Sequential addition of growth factors did not lead to dramatically enhanced
chondrogenic induction .........................................................................................................77
Fig. 2.15 – Real-time qPCR analysis of Prg4 expression suggested that sustained Activin A
supplementation (“A”) or the sequential addition of Activin A followed by TGFβ3 (“T”)
appeared to promote articular chondrocyte formation ............................................................78
Fig. 2.16 –Wnt3a acted as a late inducer to amplify the effect of BMP4 (10ng/ml) ....................80
Fig. 2.17 –BMP4 (25ng/ml) acted as an early inducer of chondrogenesis ...................................81
Fig. 2.18 – Schematic of my SF monolayer chondrogenic differentiation strategy .....................87
Fig. 2.19 – Schematic diagram depicting the set up of a molecule screen by establishing the
ESC-derived chondrocyte cultures using my SF monolayer differentiation system. ...............90
Fig. 3.1 – Schematic diagram of the targeted insertion of Cre-inducible vector T2B into the
Rosa26 locus ........................................................................................................................93
Fig. 3.2 – PCR results showing the correct insertion of vector T2B into the Rosa26 locus of
the mouse genome. ............................................................................................................. 101
xii
Fig. 3.3 – Fluorescent images showing expression of DsRedT3 RFP in live EST2B cells upon
Cre excision ........................................................................................................................ 101
Fig. 3.4 – Verification of EST2B pluripotency......................................................................... 103
Fig. 3.5 – Schematic of construct T2A ..................................................................................... 104
Fig. 3.6 – Schematic diagrams of the entry clones generated via Gateway® BP reactions ........ 106
Fig. 3.7 – Schematic of the final expression clone assembled via Multisite Gateway® Pro 4.0
system ................................................................................................................................ 107
Fig. 3.8 – Restriction digest analyses of the expression clones suggested the successful
generation of the T2A construct to be integrated into EST2B cells ...................................... 108
Fig. 3.9 – Sequencing results confirmed the proper integration of cloning fragments into
destination vector using the Multisite Gateway® Pro 4.0 system. ........................................ 110
Fig. 3.10 – Bright field (i) and fluorescence (ii) images (100x) documenting transgene
expression of plasmid T2A in live HEK 293T cells 48hrs. after transient co-transfection
with human Sox9 cDNA via lipofection .............................................................................. 111
Fig. 3.11 – IF analysis of the expression of Cre recombinase in HEK 293T cells transiently
transfected with construct T2A and Sox9 cDNA ................................................................. 112
Fig. A.1 – (A) HCI analysis of OCT4 expression from two-day CDM (i-iii) and X-Vivo™10
(iv-vi) cultures showing similar biphasic profiles from cultures established on
gelatin+fibronectin. (B) Compiled HCI data indicated that OCT4 expression remained
stable when cultures were established on gelatin, although cultures in N2B27 appeared to
have variable OCT4 expression when initiated at a high seeding density ............................. 158
Fig. A.2 – (A) Four-day SF differentiation culture supplemented with Activin A (10ng/ml)
had less BRACHYURY+ cells compared to that with Activin A (30ng/ml). (B) Addition
of both BMP4 and Activin A (i) or Wnt3a (ii) on day 0 of differentiation enhanced the
proportion of BRACHYURY+ cell population compared to BMP4 alone. Cultures
supplemented with Activin A+Wnt3a (iii) or serum+Activin A (iv) did not appear to
generate more BRACHYURY+ cells than cultures with Activin A, Wnt3a or serum alone.
Images were taken at 200x magnification. ........................................................................... 159
Fig. A.3 – (A) IF image (200x) of COL2A1 antibody staining and (B) Alcian blue staining
for 15-day SF monolayer differentiation culture supplemented with BMP4 (10ng/ml, from
day 0 to day 15) and Activin A (30ng/ml, from day 5 to day 15) confirmed the lack of
COL2A1 networks and proteoglycan production, respectively ............................................ 159
Fig. A.4 – Addition of (i) Activin A, (ii) TGFβ3 (10ng/ml) and (iii) FGF8 (50ng/ml) on day 5
of differentiation to BMP4-treated cultures (from day 0 to 5) did not compensate for the
non-inductive nature of BMP4, as exhibited by the lack of COL2A1 networks ................... 160
xiii
Fig. A.5 – (A) As part of the confirmation that Wnt3a acted as a late chondrogenic inducer,
IF images (200x) showed minimal COL2A1 staining in SF monolayer cultures
supplemented with Wnt3a for (i-iii) 15 days or (iv-vi) five days. Addition of (i, iv)
Activin A, (ii, v) TGFβ3 and (iii, vi) FGF8 to Wnt3a-supplemented cultures from day 5 to
15 of differentiation did not improve COL2A1 network formation. This observation was
corroborated by the weak Alcian blue staining of the same cultures showing the lack of
proteoglycan production (B). .............................................................................................. 161
Fig. A.6 – qPCR analysis of αMHC, Nkx2.5, GATA1 and Sox17 transcript levels in 15-day
SF monolayer differentiation cultures subjected to 15-day BMP4, Activin A or Wnt3a
supplementation .................................................................................................................. 162
Fig. A.7 – qPCR analysis of αMHC, Nkx2.5, GATA1 and Sox17 transcript levels in 15-day SF
monolayer differentiation cultures subjected to five-day BMP4, Activin A or Wnt3a
supplementation .................................................................................................................. 163
Fig. B.1 – Schematic of (A) the BP reaction that generates an entry clone from PCR-
amplified DNA fragment and the donor vector and (B) the LR reaction that creates an
expression clone from an entry clone and a destination vector ............................................. 165
Fig. B.2 – Schematic of the promoterless destination vector used in MultiSite Gateway®
cloning................................................................................................................................ 165
Fig. B.3 – Schematics of the MultiSite Gateway® donor vectors used in a four-fragment
cloning reaction .................................................................................................................. 166
Fig. B.4 – Schematic of plasmid T1b. ...................................................................................... 167
xiv
List of Abbreviations
AFP Alpha-fetoprotein DSH Dishevelled
ALK Activin receptor-like kinase DVE Distal visceral endoderm
α-MEM Minimum Essential Medium α EB Embryoid body
α-MHC α myosin heavy chain EC Embryonic carcinoma
APC Adenomatous polyposis coli ECM Extracellular matrix
AVE Anterior visceral endoderm EDTA Ethylenediaminetetraacetic acid
β-TrCP β-transducin repeat-containing
protein
EF1 Elongation factor 1
BMP Bone morphogenetic protein eGFP Enhanced GFP
BSA Bovine serum albumin EMT Epithelial-to-mesenchymal
transition
CBP CREB binding protein ESC Embryonic stem cell
CDK Cyclin dependent kinase Evx1 Even-skipped homeobox 1
CDM Chemically defined medium ExE Extraembryonic ectoderm
Cdx2 Caudal-type homeobox protein 2 eYFP Enhanced YFP
Cer1 Cerberus-like protein 1 FACS Fluorescence-activated cell sorting
CFP Cyan fluorescent protein FAK Focal adhesion kinase
CK1α Casein kinase 1α FBS Fetal bovine serum
Col2a1 Type II collagen FGF4 Fibroblast growth factor 4
Col10a Type X collagen Flk1 Fetal liver kinase 1
Co-SMAD Common-mediator SMAD Foxa2 Forkhead box a2
Dkk1 Dickkopf 1 frt Flp recombinase recognition target
D-MEM Dulbecco’s Modified Eagle
Medium
Fst Follistatin
DMSO Dimethyl sulfoxide FZD Frizzled
xv
GAG Glycosaminoglycan iPSC Induced pluriopotent stem cell
GAPDH glyceraldehyde-3-phosphate
dehydrogenase
IRES Inter-ribosomal entry site
GDF Growth and differentiation factor I-SMAD Inhibitory SMAD
GFP Green fluorescent protein IVS Intervening sequence
gp130 Glycoprotein 130 JAK Janus tyrosine kinase
Grb2 Growth factor receptor-bound
protein 2
JNK c-jun N-terminal kinase
Gsc Goosecoid Klf4 Kruppel-like factor 4
GSK3β Glycogen synthase kinase 3β LB Luria broth
H3K27me3 Tri-methylated histone H3 at
lysine 27
LEF Lymphoid enhancer factor
HCI High-content imaging Lefty1 Left-right determination factor 1
HCl Hydrochloric acid Lhx1 LIM homeobox 1
HEK Human embryonic kidney LIF Leukemia inhibitory factor
hESC Human ESC LIFR LIF receptor
HMG High motility group loxP Locus of crossover (x) in P1
HoxB1 Homeobox B1 LRP5/6 Low-density lipoprotein related
protein 5/6
HSC Hematopoietic stem cell L-Sox5 Long form of Sox5
HTS High-throughput screen MAPK Mitogen-activated protein kinase
ICM Inner cell mass MEF Mouse embryonic fibroblast
Id Inhibitor of differentiation Meox2 Mesenchyme homeobox 2
IF Immunofluorescence mESC Murine ESC
IGF1 Insulin growth factor 1 Mesp2 Mesoderm posterior 2
I-MDM Iscove’s Modified Dulbecco’s
Medium
MMP9 Metalloproteinase 9
xvi
MSC Mesenchymal stromal cell SAP Shrimp alkaline phosphatase
NCAM Neural cell adhesion molecule SCID Severe combined immunodeficient
Nkx2.5 NK2 transcription factor related,
locus 5 (Drosophila)
SF Serum-free
NLS Nuclear localization signal SMAD Similar to mothers against
decapentaplegic homologue
OCT3/4 Octamer-binding transcription
factor 3/4
SRY Sex-determining region Y
pA Polyadenylation Sox9 SRY-box 9
PBS Phosphate buffered saline SSEA1 Stage-specific embryonic antigen 1
PCP Planar cell polarity SSR Site-specific recombination
PDGFRα Platelet-derived growth factor
receptor α
STAT3 Signal transducer and activator of
transcription 3
PE Primitive endoderm SV40 Simian virus 40
PRG4 Proteoglycan 4 Tal1 T-cell acute leukemia 1
qPCR Quantitative polymerase chain
reaction
TCF T-cell factor
Rb Retinoblastoma TE Trophectoderm
RFP Red fluorescent protein TGFβ Transforming growth factor β
R-SMAD Receptor-regulated SMAD VEGF Vascular endothelial growth factor
RT-PCR Reverse transcriptase PCR Xist X-inactive specific transcript
Runx2 Runt-related transcription factor 2 YFP Yellow fluorescent protein
1
Chapter 1 Introduction
1.1 Mammalian embryonic development
1.1.1 Asymmetrical embryonic patterning begins at pre-gastrulation with the differential expression patterns of key growth factors
The implantation stage embryo, called a blastocyst, is a spherical structure consisting of
an inner cell mass (ICM) surrounded by a layer of large polarized cells of the trophectoderm
(TE) lineage fated to become progenitors of the placenta including the extraembryonic ectoderm
(ExE) and the ectoplacental cone (Fig. 1.1A) (Rossant 1986). At E3.5, the ICM is comprised of
cells expressing the Octamer-binding transcription factor 3/4 (Oct3/4), while the outer cells
express Caudal-type homeobox protein 2 (Cdx2) (Niwa, Toyooka et al. 2005; Dietrich and
Hiiragi 2007; Ralston and Rossant 2008). Concurrently, the cells within the ICM also express
GATA-binding protein 6 (GATA6) and the transcription factor Nanog in a mosaic pattern. The
GATA6+ cells are eventually rearranged to the distal edge of the ICM by E4.5, forming the
primitive endoderm (PE) population (Fig. 1.1A), which gives rise to visceral and parietal
endoderm that lines the yolk sac cavity (Loebel, Watson et al. 2003), while the NANOG+ cells
give rise to the epiblast that forms the embryo proper (Chazaud, Yamanaka et al. 2006). Prior to
the formation of the primitive streak, the asymmetrical development of the embryo begins with
the regionalized expression of marker genes, defining the proximal-distal axis of the embryo
(Fig. 1.1B). Nodal and Wnt are expressed in the epiblast at E5.0 (Norris and Robertson 1999),
but their expression is restricted to the proximal region of the epiblast due to the activation of the
NODAL antagonists Cerberus-like protein 1 (Cer1), Left-right determination factor 1 (Lefty1)
2
and the WNT antagonist Dickkopf 1(Dkk1) in the distal visceral endoderm (DVE) (Arnold and
Robertson 2009). In addition, the expression of Nodal and Fibroblast growth factor 4 (Fgf4) in
the epiblast also maintains the population of trophoblast progenitors in the proximal ExE, while
Bone morphogenetic protein 4 (BMP4) secreted by the ExE patterns the proximal epiblast and
the VE (Guzman-Ayala, Ben-Haim et al. 2004; Rodriguez, Srinivas et al. 2005). Therefore, the
interaction between signals secreted by both the extraembryonic and embryonic tissues is
required to maintain the integrity of the pre-gastrulation embryo.
A B
Fig. 1.1 – Schematic diagram depicting A) the blastocyst and B) the layout of the pre-gastrulation embryo with
the asymmetrical expression of marker genes (adapted from (Arnold and Robertson 2009)).
1.1.2 Gastrulation – formation of ectoderm, mesoderm and endoderm germ layers
The radial symmetry of the developing embryo is broken at E6.0 when the DVE migrates
to form the anterior VE (AVE) (Tam and Loebel 2007; Arnold and Robertson 2009).
Anteroposterior gradients of Nodal and Wnt signaling are established, with the expression of
3
NODAL and WNT antagonists concentrating on the anterior side of the epiblast leading to the
formation of neuroectodermal cells, while the mesendodermal cells emerge from the posterior
side of the embryo (Rossant and Tam 2009). At the same time as the migration of the DVE,
epiblast cells congregate at the posterior proximal side of the embryo and form the primitive
streak in a process known as gastrulation (Lawson, Meneses et al. 1991). Gastrulation is a vital
process during embryogenesis where the three germ layers: ectoderm, mesoderm and endoderm
are formed. At the commencement of mouse gastrulation at E6.5, a population of epiblast cells
undergoes epithelial-to-mesenchymal transition (EMT) and ingresses at the distally-migrating
primitive streak to form a new embryonic mesoderm layer in between the epiblast cells and the
outer VE cells, leading to the elongation of the embryo and defining the anteroposterior
embryonic axis (Tam, Gad et al. 2001). The earliest and most posterior mesodermal population
that emerges is the extraembryonic mesoderm, which includes the yolk sac mesoderm and the
blood islands. Nascent mesoderm from the intermediate section of the primitive streak gives rise
to lateral plate and paraxial mesoderm, which further differentiate into hematopoietic, vascular,
osteogenic, chondrogenic, adipogenic and muscular lineages, as well as cardiac mesoderm
(Parameswaran and Tam 1995; Kinder, Tsang et al. 1999). Epiblast cells that travel to the
anterior tip of the primitive streak form axial mesendodermal cells of the notochord, the node
and the definitive endoderm. The cells remaining in the epiblast on the proximal anterior side of
the embryo become ectodermal cells (Tam and Loebel 2007).
1.1.2.1 Formation of the primitive streak is marked by the expression of the transcription factor Brachyury
There is a special interest in studying the development of the mesoderm germ layer
because tissues of mesodermal origin make up major parts of the vertebrate’s adult body, and the
mesoderm plays a role in the induction and differentiation of many tissues derived from other
4
germ layers as well as in morphogenetic processes (Technau 2001). Mesoderm formation, as a
response to induction, is thought to be established and maintained by the expression of
mesodermal transcription factors (Dawid 1994), one of which is the pan-primitive streak marker
gene Brachyury or T.
The Brachyury gene has been studied extensively in model systems such as the mouse,
zebrafish and Xenopus. The BRACHYURY protein is a transcription activator that is required
for the differentiation of notochord cells and the formation of posterior mesoderm (Herrmann
and Kispert 1994; Kispert, Koschorz et al. 1995). It binds specifically to a partially palindromic
20bp sequence T[G/C]ACACCTAGGTGTGAAATT (Kispert and Herrmann 1993) via a
conserved DNA-binding domain named T-box (Bollag, Siegfried et al. 1994). BRACHYURY
was originally identified through the effect of a loss-of-function mutation on embryonic
development, where heterozygous mutant mice have short tails and homozygous embryos die in
utero without a properly developed allanotois, a notochord and posterior region of the embryo
(Dobrovolskaia-Zavadskaia 1927). The Brachyury gene has a highly regulated expression
pattern (Herrmann, Labeit et al. 1990); it is transcribed in the notochord, the primitive streak as
well as in the nascent and early migrating mesoderm from the primitive streak in wild-type
embryos (Beddington, Rashbass et al. 1992; Kispert and Herrmann 1993). By the end of
gastrulation, Brachyury gene expression is restricted to the notochord (Wilkinson, Bhatt et al.
1990).
Brachyury is also suggested to be a target gene of the Wnt/β-catenin signaling pathway.
Wnt genes encode secreted glycoproteins (McMahon 1992) that are involved in early
developmental events such as cell fate determination, cell proliferation, segmentation, dorsal-
ventral patterning and growth regulation (Uusitalo, Heikkila et al. 1999). In particular, Wnt8,
5
Wnt5a, Wnt5b, Wnt3 and Wnt3a are expressed in the primitive streak (Lako, Lindsay et al. 2001).
BRACHYURY was induced by WNT1, 3a and 4 in cocultures with ESCs and WNT-expressing
NIH3T3 mouse embryonic fibroblast (MEF) cells (Arnold, Stappert et al. 2000). In addition to
BRACHYURY induction, WNT3 was found to be required for the formation of the primitive
streak, mesoderm and node in embryos (Liu, Wakamiya et al. 1999).
1.1.2.2 The migration of the primitive streak is carried out via epithelial-to-mesenchymal transition
EMT describes the process where epithelial cells undergo inter-and intracellular changes
to convert into mesenchymal cells (Thiery and Sleeman 2006). Epithelial cells, such as those
within the TE (Vestweber, Gossler et al. 1987), have the ability to form cell layers and/or
clusters through membrane structures such as tight, adheren and gap junctions. They are
characterized by the expression of adhesion molecules such as cadherins and integrins, which
facilitate their capability to form cell-cell contacts as well as their association with basement
membranes (Nakaya and Sheng 2008). Mesenchymal cells, on the other hand, are not usually
associated with the basal lamina. They only interact with neighbouring cells focally, and they
possess a fibroblast-like morphology (Thiery and Sleeman 2006). EMT-inducing signals
promote the decoupling of intercellular adhesion complexes, the abolishment of the apical-basal
polarity in epithelial cells (Barrallo-Gimeno and Nieto 2005; Moreno-Bueno, Portillo et al.
2008), and subsequently the disruption of cytoskeletal organization in order to facilitate cell
migration (Nakaya, Sukowati et al. 2008). Concurrently, cells begin to ingress upon the
breakdown of the basement membrane by proteases (Haraguchi, Okubo et al. 2008). The
hallmark signaling event that takes place during EMT is the repression of E-cadherin expression.
E-cadherin is negatively regulated by Twist, Snail and Slug, and the loss of E-CADHERIN
causes the dissolution of intercellular junctional complexes (Cano, Perez-Moreno et al. 2000;
6
Bolos, Peinado et al. 2003; Yang, Mani et al. 2004). Repression of E-CADHERIN also leads to
an increase in the stabilization of β-CATENIN, allowing downstream transcriptional activation
as β-CATENIN translocates into the nucleus (Heuberger and Birchmeier 2010).
1.2 Signaling pathways involved in early embryonic development
1.2.1 Transforming growth factor β (TGFβ) pathway
The TGFβ superfamily of signaling pathways consists of soluble growth factors such as
TGFβs, Nodals/Activins, BMPs and Growth and differentiation factors (GDFs). The canonical
TGFβ pathway is comprised of two transmembrane serine/threonine kinase receptors (types I and
II) and several Similar to mothers against decapentaplegic homologue (SMAD) transcription
factors. Upon ligand binding, pairs of the two types of receptors form a heterotetrameric
signaling complex in which the type II receptor phosphorylates and activates the type I receptor
(Moustakas and Heldin 2002). Type I receptor in turn phosphorylates the receptor-regulated
SMAD (R-SMAD), which complexes with the common-mediator SMAD (Co-SMAD) and
translocates to the nucleus to regulate gene expression (Shi and Massague 2003; Clarke and Liu
2008) (Fig. 1.2). TGFβs, Nodals/Activins, BMPs and GDFs bind to different isoforms of both
type I and type II receptors, which lead to the activation of different R-Smads. Generally
speaking, there are seven type I receptors termed Activin receptor-like kinase (ALK) 1-7 and
five type II receptors. TGFβs tend to interact with ALK5 and the type II receptor TβRII (Rahimi
and Leof 2007); Nodals/Activins complex with ALK4 and the type II receptors ActRIIA and
ActRIIB (Oh and Li 1997; Song, Oh et al. 1999; Reissmann, Jornvall et al. 2001), while BMPs
bind to ALK2, ALK3 or ALK6, which form heteromeric complexes with ActRIIA, ActRIIB as
well as BMPRII (Koenig, Cook et al. 1994; ten Dijke, Yamashita et al. 1994; Kawabata, Chytil
7
et al. 1995; Rosenzweig, Imamura et al. 1995; Yamashita, ten Dijke et al. 1995; Macias-Silva,
Hoodless et al. 1998).
Fig. 1.2 – Schematic diagram summarizing the regulation of TGFββββ signaling pathway (adapted from (Moustakas and Heldin 2009)).
In addition to the formation of receptor complexes, the type of R-SMAD protein involved
in ligand-mediated pathway activation also differs. SMAD2 and SMAD3 are primarily involved
in the TGFβ- and Nodal/Activin-mediated signaling, while SMADs 1, 5 and 8 are activated upon
BMP binding (Guo and Wang 2009). The activated R-SMAD then complexes with the Co-
SMAD SMAD4 and undergoes nuclear translocation. Aside from R-SMADs and Co-SMAD,
there are also inhibitory SMADs (I-SMADs), namely SMAD6 and SMAD7, which inhibit the
activation of TGFβ pathway activation. SMAD6 inhibits BMP signaling by competing with
8
activated SMAD1 for binding to SMAD4 (Hata, Lagna et al. 1998). On the other hand, SMAD7
acts by directly binding to the activated TGFβ type I receptor, thereby inhibiting the
phosphorylation of R-SMADs (Kavsak, Rasmussen et al. 2000; Suzuki, Murakami et al. 2002).
1.2.2 Wnt pathway
The Wnt signaling pathway is traditionally divided into the canonical and non-canonical
pathways (Fig. 1.3). The canonical pathway is activated by WNT ligand binding to the
transmembrane Frizzled (FZD) receptor and the co-receptor called Low-density lipoprotein
related protein 5/6 (LRP5/6). In the absence of ligand binding, the phosphorylated cytoplasmic
protein Dishevelled (DSH) becomes part of a multiprotein destruction complex consisting of
AXIN, Adenomatous polyposis coli (APC), the serine/threonine kinases Casein kinase 1α
(CK1α) and Glycogen synthase kinase 3β (GSK3β) (Logan and Nusse 2004). The scaffold
proteins AXIN and APC facilitate CK1α and GSK3β to bind and phosphorylate β-CATENIN,
creating a binding site for β-transducin repeat-containing protein (β-TrCP) which mediates the
ubiquitylation of β-CATENIN and its subsequent degradation in proteasomes (Aberle, Bauer et
al. 1997; Liu, Kato et al. 1999). Upon ligand binding, WNT-FZD-LRP5/6 complex recruits
DSH and AXIN to the cell membrane (Mao, Wang et al. 2001; Cliffe, Hamada et al. 2003;
Wong, Bourdelas et al. 2003; Tamai, Zeng et al. 2004) and thus prevents the formation of the
destruction complex. As such, β-CATENIN is allowed to accumulate in the cytoplasm and
eventually translocates to the nucleus where it binds to the transcription factors Lymphoid
enhancer factor/T-cell factor (LEF/TCF) and triggers downstream gene transcription.
The DKK extracellular proteins are the most studied inhibitors of the Wnt signaling
pathway. DKK1 is a potent WNT inhibitor and it functions by binding to LRP5/6 (Bafico, Liu et
al. 2001; Mao, Wu et al. 2001) and another class of transmembrane molecules called the
9
KREMENs (Mao, Wu et al. 2002) with high affinity. The formation of a complex with DKK1,
LRP5/6 and KREMEN leads to the internalization of LRP and rendering it unavailable for WNT
ligand binding (Logan and Nusse 2004).
Fig. 1.3 – Schematic diagram summarizing the canonical and non-canonical Wnt signaling pathways (Rao
and Kuhl 2010).
One example of non-canonical Wnt signaling pathways (i.e., independent of β-
CATENIN) is involved in planar cell polarity (PCP), which refers to the orientation of cells
within the epithelium, perpendicular to the apical-basal polarity (Saburi and McNeill 2005).
Although WNT is not the ligand for FZD in PCP, WNT5a and WNT11 appear to play a role in
PCP, as the constitutive expression of exogenous WNT11 rescued PCP defects caused by the
loss of the Wnt11 gene in zebrafish (Heisenberg, Tada et al. 2000). In Drosophila, the bristles on
10
the wing cells and hairs of Fzd or Dsh mutants appear disorganized, as opposed to them all
pointing in the same direction in wild-type flies. Similarly, the organization of the photoreceptor
cells in the Drosophila eye is also disrupted (Saburi and McNeill 2005; Widelitz 2005). The
localized expression of core PCP proteins is thought to be important for the proper progression
of PCP; for example, FZD, DSH and DIEGO localize to the distal edge of the Drosophila wing
cells, PRICKLE and STRABISMUS are expressed proximally, and FLAMINGO and the G
protein Gα0 localize both proximally and distally, with Gα0 eventually resolving to the proximal
border (Usui, Shima et al. 1999; Tree, Shulman et al. 2002; Fanto and McNeill 2004; Katanaev,
Ponzielli et al. 2005). In vertebrates, homologs of PCP genes play a role in various cellular
processes that involve polarized movements, including convergent extension, gastrulation and
neural tube closure. An example is the motion of mesodermal cells along the medial-lateral axis
of the embryo, followed by the intercalation of adjacent epithelial and mesenchymal cells, results
in elongation along the anteroposterior body axis (Widelitz 2005). Disruptions of PCP genes
have been shown in the manifestation of an abnormally short and broad body axis due to defects
in convergent extension (Saburi and McNeill 2005). Other non-canonical pathways include the
Wnt/c-Jun N-terminal kinase (JNK) pathway which activates small GTPases of the Rho family
and downstream kinases like JNK and Rho kinase (Rao and Kuhl 2010), as well as the Wnt-
activated calcium-mediated pathway which affects cell adhesion. However, studies such as the
discovery of novel Wnt receptors including those of the Ryk and Ror families (Oishi, Suzuki et
al. 2003; Lu, Yamamoto et al. 2004), the confirmation that traditional non-canonical WNT such
as WNT5a can signal through β-CATENIN in cells expressing both FZD and LRP (Mikels and
Nusse 2006), and the role of KREMEN in generating a biphasic Wnt signaling response based on
DKK concentration (Mao, Wu et al. 2002; Hassler, Cruciat et al. 2007; Cselenyi and Lee 2008)
suggest that members of the Wnt pathway function in a context-dependent manner; therefore, it
11
may no longer be appropriate to simply label a given Wnt member as canonical or non-
canonical.
1.2.3 Roles of TGFβ and Wnt signaling pathways during gastrulation and mesoderm specification
During gastrulation, BMP signals are sent from the ExE distally to induce the epiblast to
acquire posterior cell fates (Watson and Tam 2001). The formation of primitive streak-derived
mesoderm and endoderm is also governed by TGFβ signals, with BMPs strongly influencing the
induction of posterior mesoderm, while NODAL exerts overlapping inductive effects in
primitive streak formation in the posterior region of the embryo. NODAL is also required for the
formation of the AVE precursors at the distal tip of the developing embryo (Rossant and Tam
2009), and it is necessary for the derivation of anterior mesoderm and endoderm populations in a
dose-dependent manner. Interestingly, the inhibition of NODAL activity by the NODAL
antagonists LEFTY1 and CER1, which are asymmetrically expressed on one side of the AVE
precursors, restricts cell proliferation to the posterior side of the embryo (Yamamoto, Saijoh et
al. 2004). The WNT ligand is expressed in the posterior region of the embryo while its
antagonist DKK1 exerts its activity through the AVE, thus restricting the Wnt signaling activity
to the posterior epiblast where the primitive streak develops (Fig. 1.4) (Tam, Loebel et al. 2006).
The primitive streak marker gene Brachyury has been shown to be a direct target of the Wnt
pathway (Arnold, Stappert et al. 2000), with Brachyury and Wnt3a mutants displaying similar
kinked or shortened tail phenotypes, while the disruption in endogenous WNT3a expression also
compromised paraxial mesoderm specification (Yamaguchi, Takada et al. 1999). It was also
demonstrated that LEF-1/TCF-1 regulated the maintenance of Brachyury expression during
gastrulation, as Brachyury expression was only abolished in Lef-1-/-
/Tcf-1-/-
compound mutants
embryos at E9.5 and beyond, while Brachyury expression was similar to that of wild-type
12
embryos at E7.5 (Galceran, Hsu et al. 2001). Furthermore, zebrafish studies showed that the
Brachyury orthologs ntl and bra functioned in a positive autoregulatory loop with Wnts such as
Wnt3a and Wnt8 to maintain the paraxial mesoderm precursor population during the formation of
somites, which are the building blocks of skeletal muscle and vertebrae (Martin and Kimelman
2008).
Fig. 1.4 – Schematic of the interactions among TGFβ /Wnt signals and their antagonists in an
embryo undergoing early gastrulation (adapted
from (Tam, Loebel et al. 2006)).
1.3 Skeletogenesis
The skeleton is formed by three lineages: the paraxial mesoderm-derived somites
generate the axial skeleton, the lateral plate mesoderm forms the limbs and the cranial neural
crest gives rise to the craniofacial bones and cartilage (Olsen, Reginato et al. 2000).
Skeletogenesis is initiated by the migration of committed mesenchymal cells to the site of
skeletal development (DeLise, Fischer et al. 2000; Karsenty, Kronenberg et al. 2009). Bone
formation, which is the last phase of skeletogenesis, occurs through endochondral and
intramembranous ossifications, where the latter process involves the direct conversion of
mesenchymal cells to osteogenic cells in craniofacial bone development (Hall 1987).
13
1.3.1 Chondrogenesis during endochondral bone formation
As mentioned above, endochondral ossification is initiated by the migration of committed
mesenchymal cells to the sites of skeletogenesis (DeLise, Fischer et al. 2000; Karsenty,
Kronenberg et al. 2009). These cells secrete extracellular matrix (ECM) molecules such as type
I collagen, hyaluronan and fibronectin (Linsenmayer, Trelstad et al. 1973; Dessau, von der Mark
et al. 1980; Knudson and Toole 1985; Kulyk, Upholt et al. 1989). The mesenchymal cells
condense into compact clusters during a process called pre-cartilaginous condensation (Tuan
2004), after which they differentiate into chondrocytes. These chondrocytes proliferate and
eventually mature by undergoing hypertrophy (Olsen, Reginato et al. 2000; de Crombrugghe,
Lefebvre et al. 2001; Provot and Schipani 2005). This hypertrophic cartilage is then subjected to
vascular invasion, and osteoblasts are transported into the cartilage tissue via the newly formed
blood vessels, whereby they facilitate the replacement of cartilage with mineralized bone (Hall
1987).
1.3.1.1 Key molecular markers of chondrogenesis
As mentioned above, type I collagen and hyaluronan are produced by pre-cartilage cells
at the onset of mesenchymal condensation but is replaced by cartilage ECM molecules as
chondrocytes differentiate. Both of these matrix molecules contribute positively to the formation
of mesenchymal condensations, with hyaluronan functioning to prevent close cell-cell interaction
and to facilitate cell migration. This is supported by the action of hyaluronidases later in
condensation during which hyaluronan is degraded. As a result, cell migration ceases which
allows the clustering of mesenchymal cells (Knudson 2003). Cells within mesenchymal
condensations that differentiate into chondroprogenitors express the transcription factor Sex-
determining region Y (SRY)-box 9 (Sox9). SOX9 regulates the production of the proteoglycan
aggrecan and the structural protein type II collagen (COL2A1), which replaces the type I
14
collagen (Lefebvre, Huang et al. 1997; Bi, Deng et al. 1999; Poole, Kojima et al. 2001; Akiyama,
Chaboissier et al. 2002; Lefebvre and Smits 2005; Goldring, Tsuchimochi et al. 2006).
Aggrecan is a large protein (200kDa) with sulfated glycosaminoglycan (GAG) side chains
attached to it, and these side chains provide a highly anionic charge to the ECM which attracts
water osmotically. Water retention by aggrecan leads to the exertion of turgor pressure, allowing
cartilage to withstand compressive forces (Poole 1986; Heinegard 2009). Two other members of
the Sox family of transcription factors, namely the long form of Sox5 (L-Sox5) and Sox6, are co-
expressed with Sox9 and together, the three transcription factors activate a 48bp enhancer of
Col2a1 (Lefebvre, Li et al. 1998). Heterozygous mutations in Sox9 lead to campomelic
dysplasia, characterized by hypoplasia of cartilage-derived skeletal elements. It is a severe form
of dwarfism that leads to embryonic or neonatal lethality (Foster, Dominguez-Steglich et al.
1994; Wagner, Wirth et al. 1994). Meanwhile, double Sox5- and Sox6-null mutant mice exhibit
achondroplasia characterized by the absence of cartilage (Smits, Li et al. 2001). As
chondrogenic differentiation progresses, chondrocytes begin to express type IIB collagen, whose
mRNA is transcribed from a splice variant of the Col2a1 transcript consisting of one less exon
(Ryan and Sandell 1990; Oganesian, Zhu et al. 1996; Oganesian, Zhu et al. 1997). Terminally
differentiated chondrocytes eventually undergo hypertrophy, at which point Sox9 expression is
down-regulated. As these cells exit their proliferative phase, they begin to produce type X
collagen (COL10A) and express the transcription factor Runt-related transcription factor 2
(Runx2), which is the master regulator of osteoblast differentiation that positively regulates
chondrocyte maturation and hypertrophy (Komori, Yagi et al. 1997; Otto, Thornell et al. 1997;
Enomoto, Enomoto-Iwamoto et al. 2000; Karsenty and Wagner 2002). The transition from
cartilage to bone requires the vascularization of the ECM surrounding the hypertrophic
chondrocytes. The expression of Metalloproteinase 9 (MMP9) by chondrocytes positively
15
regulates cartilage removal via the apoptosis of hypertrophic chondrocytes and angiogenesis with
the release of Vascular endothelial growth factor (VEGF), a downstream target of RUNX2
(Zelzer, Glotzer et al. 2001). In addition, the cartilage ECM is also degraded by MMP9 to be
replaced by one that is rich in type I collagen secreted by osteoblasts (Karsenty and Wagner
2002; Goldring, Tsuchimochi et al. 2006).
1.3.1.2 Structure of hyaline cartilage
Three types of cartilaginous tissues exist in the adult vertebrate skeleton, namely hyaline
cartilage, elastic cartilage and fibrocartilage, with hyaline cartilage being the most abundant.
Elastic cartilage is found in places such as the outer ear, epiglottis and the larynx. It consists of
elastin which gives this type of cartilage great flexibility (Sucheston and Cannon 1969).
Fibrocartilage, on the other hand, consists of a mixture of fibrous and cartilaginous tissues and
contains arrays of thick bundles of collagen fibrils of both type I and type II collagens. It
provides tensile strength in structures such as intervetebral discs, temporomandibular joints and
pubic symphysis (Benjamin and Evans 1990).
Embryonically, endochondral bone is derived from hyaline cartilage; however, certain
areas of cartilage such as the articular surface of diarthrodial joints persist into adulthood (Ross,
Kaye et al. 2003). Articular cartilage of the vertebrate skeleton consists of chondrocytes
suspended in rigid ECM and provides a resilient barrier between bones while facilitating load-
bearing and joint articulations. Articular hyaline cartilage is self-organized into four zones. The
superficial zone is the outermost layer that is in contact with the synovial fluid of the intra-
articular space and it accounts for about one fifth of the articular cartilage (Bobick, Chen et al.
2009). Chondrocytes in the superficial zone take on a flattened morphology with thin collagen
fibrils, and this zone possesses the highest amount of collagen but the lowest amount of
16
aggrecan, contributing to its high tensile strength (Venn 1979; Akizuki, Mow et al. 1986; Poole,
Kojima et al. 2001). Importantly, the chondrocytes at the articular surface synthesize lubricin, or
Proteoglycan 4 (PRG4), a molecule thought to play a role in providing frictionless articulation of
the surface cartilage (Flannery, Hughes et al. 1999; Schumacher, Hughes et al. 1999; Warman
2000). Underneath the superficial zone is the middle zone, which consists of randomly dispersed
spherical chondrocytes and collagen fibrils. The amount of aggrecan in this zone is at its
highest; meanwhile, the collagen fibrils are able to adjust themselves from a vertical orientation
to a more horizontal one upon the application of a compressive load (McCall 1969; Clark and
Simonian 1997; Poole, Kojima et al. 2001). High levels of aggrecan persist into the territorial
region of the deep zone, which is located furthest away from the intra-articular space and
comprised of large collagen fibrils. Aggrecan is degraded in the interterritorial region of the
deep zone situated between the territorial region and the tide mark. The tide mark demarcates
the deep zone from the calcified zone consisting of hypertophic chondrocytes. Collagen fibrils
in the deep zone penetrate the tide mark to anchor the articular cartilage to the calcified cartilage
and the subchondral cortical bone so as to resist shear forces exerted onto the cartilage (Bobick,
Chen et al. 2009) (Fig. 1.5).
17
Fig. 1.5 – Diagrammatic representation of the structure of articular cartilage (adapted from (Poole, Kojima et
al. 2001; Battler, Leor et al. 2006)).
1.3.2 Challenges in cartilage repair
Articular cartilage damage is triggered by pathological degradation from enzymes and
inflammatory cues in osteoarthritis and rheumatoid arthritis, or it can be caused by physical
trauma like intra-articular fractures and ligament injuries (Beris, Lykissas et al. 2005). The
avascularity and low metabolic rate of articular cartilage limit the repair capacity of partial-
thickness defects due to the inability of progenitor cells to travel through the ECM to the injury
site (van Osch, Brittberg et al. 2009; Vinatier, Mrugala et al. 2009). Full-thickness defects
involve damages to both the cartilage and the subchondral bone. As a result, blood is able to
escape from the vasculature and enters the defect site during the wound healing process, bringing
with it mesenchymal progenitors cells that differentiate into fibrocartilage that is rich in type I
collagen. Unfortunately, fibrocartilage is mechanically inferior to articular cartilage and will
eventually break down (Buckwalter and Mankin 1998; Hunziker 2002). Since there is a lack of
effective pharmaceutical agents that promote the healing of articular cartilage defects through the
18
proliferation of neighbouring autologous chondrocytes, surgical approaches are the current
standards for repairing damaged cartilage. Partial-thickness defects are often treated with
mechanical penetration of the subchondral bone such as microfracture to gain access to the
vasculature and marrow. Blood clot fills the injury site and leads to the formation of
fibrocartilage (Steinert, Ghivizzani et al. 2007). Transplantation of tissues from the
perichondrium or the construction of osteochondral grafts have also been attempted with positive
short-term results (Bouwmeester, Beckers et al. 1997; Hangody and Fules 2003). These
procedures have been transitioned to autologous chondrocytes transplantation whereby cartilage
from a non-load-bearing joint is inserted into the defect site. Although this approach is routinely
used in the clinic for cartilage repair, it also fails to provide or regenerate functional hyaline
cartilage at the defect site (Minas and Nehrer 1997; Peterson, Brittberg et al. 2002). All of these
methods are limited by the availability of transplantable cells and tissues. As such, for end-stage
cartilage repair, the optimal solution is the replacement of the damaged articulating joint with
synthetic prosthesis. However, as much as one in five of these types of implants fail after 10 to
20 years (Ahmed, Stanford et al. 2007). Therefore, it is crucial to develop biological treatments
that lead to the long-term maintenance of transplanted hyaline cartilage.
Tissue engineering approaches combine the use of cells, scaffolds and inductive factors
to devise transplantable constructs that can be inserted into defect sites. The idea is that the
scaffold will provide the proper structure and necessary ECM, which acts in concert with
inductive factors, to achieve long-term maintenance of the population of transplanted articular
cartilage cells. However, to obtain sufficent cell numbers for transplantation, it is necessary to
expand the transplantable cells ex vivo and seed them onto the scaffold prior to their insertion
into the defect site. The problem with this approach is that articular chondrocytes tend to
dedifferentiate in monolayer culture and adopt a fibroblastic phenotype (Darling and Athanasiou
19
2005). Consequently, such experimental tissue engineering approaches to articular cartilage
repair have shown similar long-term results as conventional treatment methods so far (Kuo, Li et
al. 2006; Nesic, Whiteside et al. 2006). In the search of an appropriate source of articular
cartilage cells that can be expanded to great numbers in vitro for cartilage repair, researchers
have focused their attention on the potential of stem cells and the possibility of inducing them
into functional articular cartilage for cell-based therapies, which falls under the umbrella of the
field of regenerative medicine.
1.4 Potential of stem cells in regenerative medicine
The development of the field of regenerative medicine is partially driven by the
shortcomings associated with traditional treatments for ailments such as genetic diseases, organ
failures and traumas. Apart from the issue of donor shortage in both functional tissues and
organs, potential immune rejection is another major problem associated with organ transplants
that increases patient morbidity and decreases the quality of life. Regenerative medicine is more
involved than conventional medicine in that its goal is not to simply replace damaged and
diseased cells and tissues, but it is an interdisciplinary endeavor that acts to stimulate and aid in
the body’s ability to heal itself or to directly infuse functional cells and tissues into the site of
injury (Stocum 2002; Daar and Greenwood 2007; Corona, Ward et al. 2010). In the case of the
engineering of tissue grafts, the design considerations encompass the union of developmental
and cell biology, genetics, material science as well as transplantation expertise.
The regeneration of functional cells, tissues and organs goes beyond wound healing
because oftentimes, intrinsic wound healing, as demonstrated in the case of cartilage repair,
results in the formation of fibrotic tissues at the injury site which leads to decrease or loss of
20
function (Gurtner, Werner et al. 2008). Also, injuries, diseases and even aging processes that
compromise the tissue-resident stem cell compartments may result in the development of more
severe degenerative disorders (Mimeault, Hauke et al. 2007). Therefore, the availability of
robust cell sources capable of producing functional cell types is paramount. The use of stem
cells in regenerative medicine has long been considered as the most plausible solution because of
the possibility of stimulating their expansion in vitro and in vivo as well as their ability to
differentiate into functional tissues under the appropriate conditions (Smith 1998). The critical
questions that need to be answered are whether we have the know-how and the resources to
directly differentiate stem cells into pure populations of the desired cell types in a controlled
manner, and whether we can generate sufficient numbers of these functional cell types to be used
in the clinical setting.
1.5 Sources of stem cells
Stem cells were first discovered by Till and McCulloch in the 1960’s when they observed
that clusters of cells would grow on the spleens of irradiated mice upon the injection of bone
marrow cells and that selective populations of cells within the bone marrow were able to form
these cell growths (Till and McCulloch 1963). Generally speaking, there are two types of stem
cells that exist in an individual during development, namely non-embryonic, or somatic, and
embryonic stem cells (ESCs).
1.5.1 Somatic stem cells
Tissue-specific somatic stem cells from the adult body exist as rare cell populations in
various niches, and they are usually quiescent cells that expand and differentiate into multiple
cell types upon receiving the appropriate signals. Somatic stem cells have been found in adult
21
tissues such as bone marrow (Becker, McCulloch et al. 1963; Siminovitch, McCulloch et al.
1963; Till and McCulloch 1963; Caplan 1991), liver (Vessey and de la Hall 2001), muscle (e.g.
muscle satellite cells) (Baroffio, Hamann et al. 1996; Williams, Southerland et al. 1999; Lee, Qu-
Petersen et al. 2000), fat (Zuk, Zhu et al. 2001), pancreas (Seaberg, Smukler et al. 2004), retina
(Tropepe, Coles et al. 2000), kidneys (Gupta, Verfaillie et al. 2006; Sagrinati, Netti et al. 2006),
lungs (Griffiths, Bonnet et al. 2005; Kim, Jackson et al. 2005), gastrointestinal tract (Booth,
O'Shea et al. 1999; Rotter, Oder et al. 2008), skin (Lavker and Sun 1983; Jones, Harper et al.
1995; Ghazizadeh and Taichman 2001), heart (Messina, De Angelis et al. 2004) and brain
(Morshead, Reynolds et al. 1994; Gage 2000). They have also been isolated from fetal sources
such as amniotic fluid (De Coppi, Bartsch et al. 2007) and umbilical cord blood (Broxmeyer,
Gluckman et al. 1990; Wagner and Kurtzberg 1997; Kogler, Sensken et al. 2004) as well as
tissue (Mitchell, Weiss et al. 2003; Wang, Hung et al. 2004; Sarugaser, Lickorish et al. 2005).
The most studied somatic stem cells are the bone marrow-derived hematopoietic stem cells
(HSCs) (Becker, McCulloch et al. 1963; Siminovitch, McCulloch et al. 1963; Till and
McCulloch 1963). These cells have the ability to differentiate into mature blood cells such as
red blood cells, megakaryocytes, neutrophils, macrophages and lymphocytes (Orkin and Zon
2008). Bone marrow-derived mesenchymal stromal cells (MSCs) are also intensely examined,
and the clinical potential of HSCs and MSCs is routinely demonstrated in bone marrow
transplants that replenish the patients’ hematopoietic compartments severely compromised by
circumstances such as chemotherapy. Because of the immunosuppressive capability of MSCs,
they are often infused with HSCs during transplantation to prevent graft rejection and limit graft
vs. host disease, which ultimately enhances the engraftment of HSCs (Bernardo, Locatelli et al.
2009). MSCs have the ability to differentiate into muscle, fat, cartilage, bone and fibroblasts,
and it is suggested that MSCs gradually lose their ability to differentiate into these five lineages
22
in a hierarchical manner, beginning with the loss of myogenic differentiation capability
(Sarugaser, Hanoun et al. 2009).
1.5.1.1 MSCs in cartilage repair
The use of MSCs in cartilage repair has been examined in various animal models with
similar results. MSCs are often introduced into defect sites with the help of matrix scaffolds to
provide structure for the resulting tissue-engineered construct. Studies conducted in animals
such as rats (Anraku, Mizuta et al. 2008), rabbits (Huang, Durbhakula et al. 2006; Shao, Goh et
al. 2006; Swieszkowski, Tuan et al. 2007; Yan and Yu 2007; Chang, Ishii et al. 2008) and sheep
(Dorotka, Windberger et al. 2005; Mrugala, Bony et al. 2008) all demonstrated the beneficial
effect of MSCs on the repair of cartilage defects regardless of the formation of hyaline or
fibrocartilage. However, it was difficult to determine whether the formation of cartilage tissue
was due to the differentiation of the transplanted MSCs or the induction of recruitment and
proliferation of endogenous chondrocytes from paracrine signals sent by the MSCs (Sarugaser,
Hanoun et al. 2009).
The clinical use of MSCs in cartilage repair has been documented in several studies.
Patients who were treated with autologous MSCs seeded onto collagen-based scaffolds and were
examined for five years post-surgery experienced significant symptoms improvement as they
regained mobility in the damaged joints with evident cartilage repair via the formation of
fibrocartilage (Wakitani, Mitsuoka et al. 2004; Kuroda, Ishida et al. 2007; Wakitani, Nawata et
al. 2007).
Because the number of available stem cells in the body is scarce, ex vivo expansion of
MSCs is often required after isolation. However, the culture of somatic stem cells is oftentimes
tricky because they tend to senesce and/or lose their differentiation capacity after a few passages.
23
Another caveat to using somatic stem cells is that these cells can only form a limited number of
cell types. As such, ESCs may be a more suitable cell source for providing clinically relevant
cell numbers used in cell-based therapies.
1.5.2 Embryonic stem cells
ESCs are derived from the ICM at the blastocyst stage of a preimplantation embryo
(Evans and Kaufman 1981; Martin 1981). These cells have the ability to self-renew indefinitely
in vitro, and they are considered pluripotent because they can differentiate into all cell types of
the adult body. ESCs have been shown to generate functional cells such as cardiomyocytes,
hepatocytes, chondrocytes, osteocytes, adipocytes, dendritic cells, pancreatic islet cells,
hematopoietic cells and germ cells (reviewed in (Smith 2001; Metallo, Azarin et al. 2008)).
Pluripotent ESCs are able to integrate into the ICM of unrelated blastocysts upon transplantation
via microinjection or aggregation and participate in embryonic development (with no
contribution to the formation of extraembryonic tissues), resulting in fetuses that exhibit a high
level of chimerism in various tissues (Bradley, Evans et al. 1984; Beddington and Robertson
1989). Chimeras can also be created from ESCs using the tetraploid complementation assay.
Blastomeres of two-cell stage preimplantation embryos are electrofused together into one cell
under a direct electric current, and the fused cell is cultured until it reaches a four-cell stage,
resulting in two tetraploid embryos. ESCs are then aggregated with two zona pellucida-free
tetraploid embryos prior to being transferred into pseudopregnant mice. Since tetraploid cells
cannot undergo normal development and can only contribute to the extraembryonic endoderm as
well as the TE while ESCs cannot form extraembryonic lineages, the aggregated embryo will
develop to term in which the embryo proper and all structures in the fetus will be derived from
ESCs (Nagy, Rossant et al. 1993; Tam and Rossant 2003).
24
Undifferentiated ESCs are also characterized by their ability to form teratomas upon
injection into severe combined immunodeficient (SCID) mice (Thomson, Itskovitz-Eldor et al.
1998; Reubinoff, Pera et al. 2000). Murine ESCs (mESCs) express markers such as alkaline
phosphatase (Niwa, Burdon et al. 1998), OCT4, E-CADHERIN and Stage-specific embryonic
antigen 1 (SSEA1) (Saito, Liu et al. 2004). SSEA1 is a surface glycolipid also strongly
expressed on ICM cells and embryonic carcinoma (EC) cells, while SSEA3 and SSEA4 are
expressed on the surface of human ESCs (hESCs) (Solter and Knowles 1979; Fenderson, Eddy et
al. 1990; Henderson, Draper et al. 2002). E-CADHERIN is a member of the Ca2+
-dependent
family of transmembrane cell adhesion molecules that are involved in development during cell
differentiation and the maintenance of tissue structure (Takeichi 1995). In the absence of E-
CADHERIN, such as the case in E-cadherin-null ESCs, the cells failed to aggregate or form
organized tissues in vitro (Larue, Antos et al. 1996).
ESCs lack a G1 cell cycle checkpoint with a very short G1 phase. In mammalian cell
cycle, the progression from G1 to S phase is mediated by mitogen-activated Cyclin dependent
kinases (CDK) 4 and 6, CYCLINs D and E, and members of the Retinoblastoma (Rb) tumour
suppressor protein family. RB protein binds to and inhibits the E2f family of transcription
factors known to promote cell proliferation (Weinberg 1995). However, during G1 phase, RB
protein is phosphorylated by CYCLINs and CDKs, allowing E2F to be partially released to
activate the transcription of cdc25A. The production of CDC25A phosphatase completes the RB
phosphorylation by removing inhibitory phosphatases from CDKs to allow the formation of a
CYCLIN/CDK complex that phosphorylates RB, which leads to the full release of E2F and the
activation of target genes that facilitate the entry into S phase (Harbour, Luo et al. 1999; Harbour
and Dean 2000; Bartek and Lukas 2001). It was discovered that in ESCs, CYCLIN D is inactive
and the levels of inhibitory phosphatases are low, while CYCLIN E/CDK2 complex is
25
constitutively active (Savatier, Lapillonne et al. 1996; Stead, White et al. 2002). As such, RB
proteins are inactive due to hyperphosphorylation and E2F target genes are transcribed
independently from cell cycle progression (Savatier, Huang et al. 1994; Burdon, Smith et al.
2002; Stead, White et al. 2002).
In addition to the lack of a G1 checkpoint, there is an absence of X inactivation in ESCs.
During embryonic development, the paternal X chromosome in the preimplantation female
embryo is inactivated as a result of the expression of the non-coding X-inactive specific
transcript (Xist) RNA from the paternal X chromosome and histone modifications such as the
gain of tri-methylated histone H3 at lysine 27 (H3K27me3) imposed by the Polycomb group
protein EZH2 (Heard 2004). However, the epigenetic marks associated with the inactive X
chromosome are erased in the pluripotent primitive ectoderm cells within the ICM of the late
blastocyst through epigenetic modifications such as the removal of H3K27me3 on the inactive X
chromosome (Surani, Hayashi et al. 2007). It is believed that undifferentiated ESCs have
captured and maintained this state of X reactivation.
1.5.2.1 Regulation of ESC cell fate decisions
1.5.2.1.1 Murine ESCs maintain their undifferentiated state through the activation of the gp130 signaling pathway
Leukemia inhibitory factor (LIF) is a member of the interleukin-6 cytokine family that is
essential for the maintenance of the undifferentiated state of mESCs in vitro. LIF functions by
binding to the low-affinity transmembrane LIF receptor (LIFR), which forms a high-affinity
heterodimer with another transmembrane protein glycoprotein 130 (gp130) (Smith, Heath et al.
1988; Gearing, Comeau et al. 1992). The intracellular domains of the LIFR/gp130 heterodimer
are then phosphorylated by Janus tyrosine kinase (JAK), creating docking sites for the
26
transcription factor Signal transducer and activator of transcription 3 (STAT3) (Burdon, Smith et
al. 2002). STAT3 in turn becomes phosphorylated and dimerizes; this dimer translocates to the
nucleus and activates downstream signaling (Ihle 1996; Niwa, Burdon et al. 1998). It has been
suggested that Stat3 expression is necessary and sufficient to maintain mESC self-renewal
independent of the LIF/LIFR/gp130 activity, as the activation of Stat3 in the absence of LIF
could sustain the undifferentiated state of mESCs in serum culture (Matsuda, Nakamura et al.
1999).
1.5.2.1.2 Key transcription factors governing ESC self-renewal – OCT4, SOX2 and NANOG
Oct4, also known as Pou5f1, is a member of the Octamer family of transcription factors
that is expressed in blastomeres, the ICM and in germ cells (Scholer, Hatzopoulos et al. 1989;
Okamoto, Okazawa et al. 1990; Rosner, Vigano et al. 1990; Scholer, Dressler et al. 1990;
Scholer, Ruppert et al. 1990; Yeom, Fuhrmann et al. 1996; Pesce, Gross et al. 1998). The OCT
proteins recognize and bind to an 8bp DNA consensus sequence ATGCAAAT in target genes
(Falkner and Zachau 1984; Parslow, Blair et al. 1984; Herr and Cleary 1995; Nichols, Zevnik et
al. 1998). The Oct genes are part of the POU class of transcription factors which also includes
Pit and Unc, and the OCT, PIT and UNC proteins interact with DNA via a low-affinity POU-
specific domain and a high-affinity homeodomain (Herr, Sturm et al. 1988; Klemm and Pabo
1996). Oct4-null embryos exhibited pre-implantation lethality due to the inability to form the
ICM (Nichols, Zevnik et al. 1998). The level of Oct4 expression in ESCs has been shown to be
critical in the maintenance of their self-renewal capability, as a 50% decrease in endogenous
Oct4 expression leads to ESC differentiation into TE, while a 1.5 fold increase induces
differentiation into the PE lineage (Niwa, Miyazaki et al. 2000). Although the tight regulation of
27
Oct4 expression level is essential for ESC cell fate, OCT4 itself is incapable of preventing
differentiation in the absence of LIF in mESCs (Boiani and Scholer 2005).
SOX2 is a member of the SOX family of proteins, so named because these proteins share
a highly conserved high motility group (HMG)-type SRY box DNA binding motif (Gubbay,
Collignon et al. 1990; Sinclair, Berta et al. 1990; Kiefer 2007). The HMG domain binds to the
DNA sequence (A/T A/T CAA A/T G) with high affinity (Harley, Lovell-Badge et al. 1994).
Similar to Oct4, Sox2 is expressed in ESCs and knockdown of Sox2 induces ESC differentiation
into TE cells, while Sox2 inactivation in blastocyst leads to embryonic lethality due to defective
primitive ectoderm formation (Avilion, Nicolis et al. 2003; Chew, Loh et al. 2005). However,
unlike OCT4, SOX2 is also expressed in neural precursors along with other SOX proteins such
as SOX1 and SOX 3 (Collignon, Sockanathan et al. 1996). OCT4 and SOX2 have been found to
bind DNA cooperatively. The Fgf4 enhancer contains a HMG binding motif (for SOX2) and a
POU motif (for OCT4) that are closely spaced together, and it has been demonstrated that the
binding of SOX2 and OCT4 to the enhancer induces the expression of Fgf4 in EC cells and
ESCs (Lamb and Rizzino 1998). Fgf4 is expressed in preimplantation embryo and is important
for the proliferation of the ICM; it has also been shown that the inactivation of Fgf4 is
embryonically lethal (Niswander and Martin 1992; Rappolee, Basilico et al. 1994; Feldman,
Poueymirou et al. 1995). Therefore, OCT4 and SOX2 alone are not only important nuclear
factors in the mediation of ESC fate, but they act synergistically to regulate other major
contributors that play a role in the maintenance of ESC pluripotency.
Nanog is a homeodomain-containing transcription factor named after the island of eternal
youth Tir nan Og (or Tir Na nOg) depicted in Irish mythology. Nanog is expressed in cells of
the ICM, early germ cells and ESCs, and it has been demonstrated that constitutive expression of
28
NANOG was able to maintain the undifferentiated state of ESCs in a LIF-independent manner
(Chambers, Colby et al. 2003; Mitsui, Tokuzawa et al. 2003). Despite this observation,
physiological levels of NANOG are unable to sustain ESC self-renewal upon LIF withdrawal
(Boiani and Scholer 2005). Nanog-null embryos lack the primitive ectoderm, while Nanog-/-
ESCs gradually differentiate into extraembryonic endodermal cells (Mitsui, Tokuzawa et al.
2003). Because Nanog-/-
ESCs are capable of prolonged self-renewal in the presence of LIF, it
has been suggested that Nanog functions mainly in the establishment of the ICM and germ cells
in vivo instead of acting as a major contributor to the maintenance of ESC self-renewal
(Chambers, Silva et al. 2007). Indeed, Nanog-mediated ESC self-renewal requires the
expression of functional OCT4 protein, and these two transcription factors primarily function as
repressors of differentiation rather than activators of the self-renewal machinery (Boiani and
Scholer 2005).
1.5.2.1.3 The TGFβ signaling pathway plays a role in both ESC self-renewal and differentiation
One of the downstream targets of SMAD4 is the negative helix-loop-helix factor
Inhibitor of differentiation (Id), and it has been shown that the expression of ID proteins in
mESC cultures specifically prevents neural differentiation while LIF inhibits mesoderm
differentiation (Ying, Nichols et al. 2003). In addition, Suzuki et al. discovered that upon
mesoderm specification (i.e., activation of Smad1 and Brachyury) in the presence of BMP,
STAT3 was activated by LIF and interacted with BRACHYURY, both of which then bound to
the Nanog enhancer and led to the up-regulation of Nanog expression. NANOG subsequently
bound to SMAD1 to inhibit the propagation of BMP signaling, thus limiting the progression of
mesoderm specification by down-regulating Brachyury expression (Suzuki, Raya et al. 2006).
SMADs were also found to bind to the Nanog promoter and regulate Nanog expression in hESC
29
cultures. In addition, TGFβ/Activin was shown to sustain Nanog promoter activity in
undifferentiated hESCs (Xu, Sampsell-Barron et al. 2008).
Similarly, stimulation of ESCs with ligands of TGFβ signaling can induce specific
populations of mesoderm derivatives. Nodal/Activin, but not BMP, signaling has been shown to
be required for the induction of an ESC-derived BRACHYURY+ primitive streak-like population
(Gadue, Huber et al. 2006). On the other hand, BMP signals have been shown to be required to
induce the formation of hematopoietic populations from ESC-derived BRACHYURY+ cells
(Park, Afrikanova et al. 2004; Nostro, Cheng et al. 2008). Hence, it is determined that
Nodal/Activin signaling tends to stimulate the generation of anterior mesoderm populations (e.g.
paraxial mesoderm) and definitive endoderm (Kubo, Shinozaki et al. 2004; Sakurai, Era et al.
2006; Sakurai, Okawa et al. 2008).
1.5.2.1.4 Wnt signaling influences ESC cell fate decisions in a context-dependent manner
The activation of Wnt signaling via the inhibition of GSK3β or the treatment with
exogenous Wnts has been shown to facilitate the short-term maintenance of the undifferentiated
state of both mESCs and hESCs (Sato, Meijer et al. 2004; Pera and Tam 2010). It was suggested
that the addition of exogenous Wnt enhanced the proliferation of hESCs in the absence of MEFs;
however, Wnt itself was not sufficient to maintain the undifferentiated state of hESCs (Dravid,
Ye et al. 2005). Treatment of mESCs with exogenous WNT3a and the small molecule IQ-1
maintained ESC proliferation and pluripotency in the absence of serum for extended periods of
time. IQ-1 selectively promoted the interaction between β-CATENIN and the transcriptional co-
activator CREB binding protein (CBP) at the expense of β-CATENIN’s interaction with another
co-activator p300, which mediated ESC differentiation (Miyabayashi, Teo et al. 2007). Wnt
signaling is also required for the generation of primitive streak-like populations in ESCs
30
(Lindsley, Gill et al. 2006), with the activation of β-catenin shown to be essential for the
generation of primitive hematopoietic cells (Nostro, Cheng et al. 2008). On the other hand,
transient inhibition of Wnt is required for the generation of cardiomyocytes from differentiating
ESCs (Naito, Shiojima et al. 2006; Ueno, Weidinger et al. 2007). In addition, canonical Wnt
signaling has been shown to mediate the emergence of localized cell populations undergoing
gastrulation within embryoid bodies (EBs) (ten Berge, Koole et al. 2008).
1.5.3 Induced pluripotent stem cells (iPSCs)
Despite the numerous successes achieved in hESC research in the past decade, the first
hESC-based clinical trial has only been approved by the Food and Drug Administration recently
(Alper 2009). The hesitation in widely introducing hESCs to the clinical setting is due to a
number of issues. The incorporation of undifferentiated ESCs into the body causes the formation
of teratomas due to their pluripotent nature; as a result, extreme care has to be taken to ensure the
isolation of pure populations of differentiated cell types prior to clinical use. Secondly, the
ethical considerations surrounding the embryo-derived nature of hESCs continue to be the
subject of debate and enormous controversy. Thirdly, differentiated cell types generated from
hESCs are still subjected to immune rejection (Yamanaka 2008). Recent advances in the
generation of iPSCs can hopefully provide solutions to the last two issues. These cells are
originally generated by genetically reprogramming fibroblasts with specific combinations of the
transcription factors Sox2, Oct4, Nanog, Lin28, cMyc and Kruppel-like factor 4 (Klf4) via
retroviral (Takahashi and Yamanaka 2006; Takahashi, Tanabe et al. 2007) or lentiviral (Yu,
Vodyanik et al. 2007) transduction. Since then, others have successfully generated iPSCs from
a plethora of cell types with alternative methods such as the use of adenoviruses (Stadtfeld,
Nagaya et al. 2008), plasmids (Okita, Nakagawa et al. 2008), episomal vectors (Yu, Hu et al.
2009), protein transduction (Zhou, Wu et al. 2009) and synthetic mRNA (Warren, Manos et al.
31
2010), although some techniques such as the episomal vector method require the introduction of
all six aforementioned factors plus the oncogene Simian virus 40 (Sv40) (Yamanaka 2009; Yu,
Hu et al. 2009). There are also studies that suggest the further addition of other factors and small
molecules such as valproic acid can increase the reprogramming efficiency (Huangfu, Maehr et
al. 2008; Maherali and Hochedlinger 2008). Through genetic and epigenetic events that are not
fully understood, a small fraction of the fibroblasts lose their genetic identity during the
reprogramming process and take on the genetic signature and morphology of ESCs. One of the
major obstacles to increasing the efficiency of iPSCs generation is partial reprogramming of the
fibroblast cells, which leads to the generation of iPSCs that do not possess all the characteristics
of pluripotent ESCs. It has been suggested that reprogramming is a stochastic event that has to
satisfy at least two requirements. First, the reprogramming factors must be expressed in a
balanced pattern to initialize the process of converting the fibroblast cells back to a pluripotent
state. Secondly, the cells must undergo epigenetic modifications (via DNA demethylation,
histone modifications etc.) such that they can remain in a pluripotent state even after the
transgenes expression is silenced (Hanna, Saha et al. 2009; Yamanaka 2009). The generation of
iPSCs has caused great excitement because they are not derived from embryos and hence
removing the ethical roadblock that has been preventing hESCs from moving from the bench to
the clinic. They can be used to study normal development; they can serve as a cell source for
drug screens and they can be used to generate human disease models. Perhaps the most
important point is the possibility of generating patient-specific iPSC-derived functional cell types
for cellular therapies if one can eliminate the use of retroviruses and oncogenes such as cMyc in
the reprogramming process (Nishikawa, Goldstein et al. 2008). Although it is not known for
certain whether these iPSCs will maintain compatible genetic and epigenetic profiles with those
of the patient after reprogramming, the potential of these cells is still tremendously promising.
32
1.6 Genetic modifications to ESCs
Regardless of the cell source, one of the fundamental issues associated with cell-based
therapies is the inability to track and control the behaviour of the transplanted cells in vivo.
Although it is generally undesirable to manipulate the genetics of transplanted cells, genetic
engineering is a powerful method that enables us to better understand cellular behaviour, through
the insertion or deletion of DNA fragments, when modeling human diseases in animal models.
In addition, there are circumstances under which it is beneficial to incorporate transgenes into
transplanted cells. For example, genetic mutations can be fixed with the targeted insertion of
DNA sequences. As shown in animal models, it is also beneficial to be able to perform cell
tracking in vivo to ensure proper homing of transplanted cells (Austin, Salimi et al. 2000;
Hammer, Flugel et al. 2000). In addition, to ensure the proper function of transplanted cells in
vivo, one can incorporate a suicide gene into the cells such that when the cells exhibit aberrant
behaviour, the activation of the suicide gene will ensure the removal of these malfunctioning
cells (Tiberghien 2001).
A common practice in transgenics is the use of extra-chromosomal pieces of DNA such
as bacterial plasmids to introduce the desired genetic fragments (e.g. reporter genes) into
mammalian cells. Plasmids have been examined in bacterial biology since the early 1950’s, and
the development of transformation techniques in the early 1970’s allowed plasmid DNA to be
propagated in E.coli (Cohen 1993).
1.6.1 Non-viral methods used in the transfer of foreign DNA into mammalian cells
The alteration of cells with exogenous DNA can be short-term or permanent depending
on whether the DNA is integrated into the genome of the host cell. Short-term or transient
33
transformation occurs because the plasmid DNA does not contain an origin of replication that is
functional in the host cell; therefore, if it remains in its supercoiled circular state, it cannot
integrate into the host cell genome. As a result, transgene expression only persists for a short
time before the plasmid DNA is diluted or degraded. To achieve stable transfection for the
generation of transgenic cell line, the plasmid DNA needs to be linearized via digestion by a
restriction enzyme and this linear piece of DNA will randomly insert itself into the host cell
genome. Alternatively, for targeted insertion of plasmid DNA into the host cell genome, the
transgene is flanked by DNA sequences that specifically recognize a target sequence in the
genome and the linearized plasmid is integrated via homologous recombination.
Two of the most common non-viral methods of transferring DNA into ESCs are
electroporation and lipofection. Electroporation describes the process where nanometer-sized
pores are created on the cell membrane of ESCs suspended in an ionic buffer, through which
DNA can enter and be transported to the nucleus, using one or more brief, high-voltage pulses
generated from a capacitor discharge machine (Wong and Neumann 1982; Primrose, Twyman et
al. 2001). The electric pulses surpass the capacitance of the cell membrane facing the electrodes
and transiently permeabilize it. The extent of permeabilization is dependent on the amplitude of
the pulse, with higher amplitude generating a larger area of permeabilization (Gabriel and Teissie
1997). The degree of membrane perturbation is also positively correlated with the duration of
the electric pulse and the number of pulses (Kobayashi, Rivas-Carrillo et al. 2005). The
downside of this method of gene transfer is that it requires a large number of cells and a
relatively large amount of DNA. In addition, there is a high percentage (~50%) of cell death
occurring after the electroporation process (Primrose, Twyman et al. 2001).
34
Lipofection is a chemical method which uses lipid molecules to facilitate DNA transfer.
Fraley et al. discovered that by mixing lipids with DNA in water, the lipids formed spherical
liposomes with aqueous centres that contained the DNA molecules. Upon contact with cells
cultured in vitro, these liposomes fused with the cell membrane and their contents were
endocytosed by the cells (Fraley, Subramani et al. 1980). The cationic lipids used in lipofection
are commonly comprised of a positively-charged head group, a flexible linker group and two or
more hydrophobic tail groups (Tranchant, Thompson et al. 2004). These lipids undergo
structural alteration when mixed with DNA to form lipoplexes. The positively-charged
lipoplexes bind to the negatively-charged cell membranes. Another component of the lipofection
reagent called a neutral “helper” lipid prevents the DNA from being engulfed by the endosomes
and be degraded upon fusion with lysosomes, allowing the exogenous DNA to gain access to the
nucleus (Felgner, Gadek et al. 1987; Felgner, Kumar et al. 1994; Kobayashi, Rivas-Carrillo et al.
2005). Lipofection is superior to electroporation in a number of ways. The low toxicity of the
lipofection reagents and the gentler treatment on the cells lead to better cell survival post-
transfection. Transfection can be applied to both suspension and adherent cell types with
minimal experimental steps. In addition, since DNA uptake in lipofection relies on endocytosis,
it can be used with large DNA fragments such as bacterial artificial chromosomes, which can
reach sizes of 100-1000kbp, without subjecting the cells to stronger electric pulses in order to
create larger pore sizes. However, there are circumstances under which electroporation is the
more suitable transfection method. For example, stronger transgene expression in early chick
embryos was observed when in ovo gene transfer was carried out via electroporation as opposed
to lipofection. The superiority of electroporation was attributed to the ability of transfecting
higher amounts of DNA into the embryos, while an optimal DNA to liposome ratio had to be
achieved for lipofection (Muramatsu, Mizutani et al. 1997).
35
1.6.2 Antibiotic-resistance genes
When generating stable transgenic cell lines, the exogenous plasmid DNA inserted into
the genome of the host cell usually contains a selectable marker that is used to identify and/or
isolate the transformed cells. The use of antibiotic resistance genes as selectable markers is very
effective as one can easily isolate the cells of interest by applying a selective pressure to the
transfected culture with the addition of the appropriate antibiotic. Many antibiotics used in
selection processes, including the types mentioned herein, cause cell death by preventing cell
growth via protein synthesis blockage in eukaryotic cells, and the enzymes encoded by the
antibiotic resistance genes modify the drugs (e.g. via phosphorylation, acetylation) to render
them inactive. For bacterial selection, ampicillin is regularly used as a dominant selectable
marker after plasmid transformation. The ampicillin resistance gene is derived from the Tn3
transposon of the naturally occurring R1 plasmid in Salmonella paratyphi B and it encodes for β-
lactamase (Sutcliffe 1978). This enzyme inactivates ampicillin by hydrolyzing the β-lactam ring
that is part of the molecular structure of the antibiotic (Citri and Garber 1962). The most
common antibiotic resistance gene used in ESCs, called Neo or NeoR, encodes aminoglycoside
3’phosphotransferase type II and is isolated from the E. coli Tn5 transposon (Jorgensen,
Rothstein et al. 1979; Colbere-Garapin, Horodniceanu et al. 1981). Cells that possess this
selectable marker survive selection using the aminoglycoside antibiotics neomycin or its variant
Geneticin® (G418) in eukaryotic cells and also kanamycin in bacteria. Though widely used in
ESC studies, Neo expression has been shown to cause cis-acting gene silencing from promoters
in eukaryotic cells (Artelt, Grannemann et al. 1991). Another antibiotic resistance gene
regularly used in selection, namely Pac or PuroR, encodes the puromycin N-acetyl transferase
isolated from Streptomyces aboniger (Vara, Malpartida et al. 1985). ESCs that expressed the
Pac gene were found to be resistant to puromycin selection, and the resistant cells demonstrated
36
higher germline competency because puromycin worked at much lower concentrations over a
significantly shorter duration of selection, making Pac a very efficient selection marker
(Watanabe, Kai et al. 1995). A third example of antibiotic resistance gene used in mammalian
cells is Bsd or BlastR isolated from Aspergillus terreus, which encodes the enzyme blasticidin
deaminase (Izumi, Miyazawa et al. 1991; Kimura, Takatsuki et al. 1994) and confers blasticidin
resistance. Blasticidin selection works at lower concentrations than neomycin or G418;
however, the selection periods for both antibiotics are similar.
1.6.3 Fluorescent proteins
Prior to the use of fluorescent proteins as reporter genes, reporter genes such as secreted
alkaline phosphatase, β-galactosidase or firefly luciferase have been used in vitro to quantify
transfection efficiency, In particular, in situ β-galactosidase staining or luciferase assay are also
used to identify transgene expression (such as the bacterial β-galactosidase LacZ gene) in vivo.
However, these assays are often conducted with cellular extracts and fixed cells or tissues, and
they do not provide a direct, quantifiable way of assessing transgene expression in living cells
and tissues (Zhang, Gurtu et al. 1996; Hadjantonakis and Nagy 2001).
The green fluorescent protein (GFP) was first discovered as a protein produced by the
jellyfish Aequorea victoria (Shimomura, Johnson et al. 1962); however, it was not until 1992
that the GFP cDNA was cloned. Wild-type GFP has a maturation time of 2-4hrs. and has two
excitation wavelengths at 395nm and 475nm (Heim, Prasher et al. 1994; Cubitt, Heim et al.
1995). A point mutation that replaces serine 65 of the amino acid sequence of wild-type GFP
with a threonine extended the excitation wavelength to 490nm and this S65T mutant matured
four-fold faster than wild-type GFP (Heim, Cubitt et al. 1995). Another GFP variant, the
enhanced GFP (eGFP), consists of the S65T mutation, a point mutation that replaces
37
phenylalanine 64 with a leucine as well as codon optimization, and it is 35 times brighter than
wild-type GFP with improved expression in mammalian cells (Zhang, Gurtu et al. 1996).
GFP mutations also led to the discovery of different fluorophores such as cyan (CFP) and
yellow (YFP) variants. The first generation of the YFP variant was stemmed from three point
mutations in GFP: serine 65 to glycine, serine 72 to alanine and threonine 203 to tyrosine
(Ormo, Cubitt et al. 1996). However, this YFP was very sensitive to pH and chloride
fluctuations as well as photobleaching. Enhanced YFP (eYFP) consisting of a valine 68 to
leucine and a glutamine 69 to lysine mutations showed improved acid resistance, but it was not
until the creation of Citrine and Venus that the problems were alleviated (Zhang, Campbell et al.
2002). Citrine is a YFP mutant with two point mutations: valine 68 to leucine and glutamine 69
to methionine (Griesbeck, Baird et al. 2001), while Venus has five mutations: phenylalanine 46
to leucine, phenylalanine 64 to leucine, methionine 153 to threonine, valine 63 to alanine and
serine 175 to glycine (Nagai, Ibata et al. 2002). Venus is the brightest and matures the fastest
compared to YFP and Citrine; however, it has inferior photostability compared to Citrine
(Zhang, Campbell et al. 2002).
Long-wavelength fluorescent proteins are especially useful in multicolour applications
such as fate mapping of different cell types because the long wavelength provides sufficient
spectral separation from the GFP-based variants to limit cellular autofluorescence. The
tetrameric red fluorescent protein (RFP) called DsRed was isolated from the coral Discosoma sp.
(Matz, Fradkov et al. 1999). Wild-type DsRed has a number of limitations including poor
solubility, a slow maturation time – it requires a 30hr. incubation period at 37oC to reach a
steady-state level, and its retention of a “GFP-like” intermediate that has a peak excitation
wavelength of 490nm (Baird, Zacharias et al. 2000; Zhang, Campbell et al. 2002). DsRed was
38
modified through mutagenesis to create variants with shorter maturation time, greater solubility
and without the 490nm excitation peak; however, it was discovered that these RFPs could not be
constitutively expressed in transgenic mice due to cellular toxicity (Baird, Zacharias et al. 2000;
Hadjantonakis, Macmaster et al. 2002). It was not until the development of DsRedT3 that the
level of cellular toxicity was tolerable for ESCs (Bevis and Glick 2002).
1.6.4 Conditional transgene expression
To provide further control on transgene expression, especially in vivo, site-specific
recombination (SSR) proves to be an indispensible technology enabling the induction of DNA
modifications with precise temporal and spatial specifications. Site-specific recombination
occurs at distinct short recognition sequences that can be easily inserted into transgenes.
However, recombination will only occur in a cell containing the recognition sites in the presence
of the corresponding recombinase enzyme (Primrose, Twyman et al. 2001), which can be
administered on a conditional basis either by the experimenter or through the transcriptional
control of cell type-specific or inducible promoters. This is extremely useful in creating
conditional knockouts because certain null mutations lead to embryonic lethality and hence
chimeras cannot be generated from knock-out cells.
1.6.4.1 Cre/loxP system
The Cre recombinase is a bacteriophage P1 protein that catalyzes recombination between
two locus of crossover (x) in P1 (loxP, 34bp) sites. A DNA fragment to be modified by Cre/loxP
recombination is “loxP-flanked” or “floxed,” and depending on the orientation of the recognition
sites, the DNA fragment can be excised/integrated, inverted or translocated (Sternberg, Hamilton
et al. 1981; Sauer and Henderson 1989; Voziyanov, Pathania et al. 1999) in applications
including gene trapping, conditional gene knock-out, selective gene repair or aberration and
39
selectable marker removal (Lewandoski 2001). The Cre/loxP system is regularly used for
conditional gene inactivation in mice created from ESCs containing a floxed allele of a targeted
gene. When these mice are crossed with transgenic mice that express Cre under the
transcriptional control of a tissue-specific promoter, one is able to create an offspring that is
subjected to gene deletion in a tissue-specific manner (Sauer 1998; Stanley, Biben et al. 2002).
Oftentimes, the deleted allele is replaced by a reporter gene to allow for identification of the
mutant phenotype in situ (Nagy 2000).
1.6.4.2 Flp/frt system
Flp recombinase, or its enhanced form Flpe, is named for its ability to invert, or flip, a
DNA fragment in Saccharomyces cerevisiae. The corresponding recognition sequence for Flp is
the Flp recombinase recognition target (frt) site (Broach, Guarascio et al. 1982; Sadowski 1995).
Flp/frt system is essentially the eukaryotic homolog of the Cre/loxP system. Frt and loxP sites
share the same structure of two 13bp inverted repeats, with which the recombinases form
complexes, separated by an 8bp asymmetric spacer sequence (Branda and Dymecki 2004).
1.6.4.3 φC31/att system
The φC31 integrase is derived from Streptomyces phage and it catalyzes recombination
between the heterotypic attB and attP sites (Thorpe, Wilson et al. 2000). The attB (34bp) and
attP (39bp) sites are named for the integrase attachment sites on the bacterial and phage
genomes, respectively (Groth, Olivares et al. 2000). Upon recombination, the resulting attL and
attR sites are non-reactive to φC31, making the process irreversible (Belteki, Gertsenstein et al.
2003). Unlike Cre and Flp, which belong to the Integrase family and undergo tyrosine-mediated
recombination, reaction with φC31 is a serine-catalyzed event as it belongs to the Resolvase-
Invertase family (Thyagarajan, Olivares et al. 2001). Apart from φC31, the bacteriophage λ
40
integrase also catalyzes recombination between attB and attP sites. Other enzymes that
participate in λ recombination include Integration Host Factor with its ability to bind and bend
DNA at specific sites, as well as Excisionase, which is responsible for DNA excision.
Specifically, Excisionase promotes the recombination of attL and attR sites in the presence of λ
integrase and Integration Host Factor (Landy 1989).
1.7 Project objectives and hypothesis
As mentioned in Sections 1.5.2.1.3 and 1.5.2.1.4, various EB-based in vitro models of
primitive streak and mesoderm formation have collectively established that BMP4 and Wnt3a
induced the generation of posterior mesodermal cells while exogenous Activin A could induce
both posterior and anterior populations in a concentration-dependent manner (Park, Afrikanova
et al. 2004; Ng, Azzola et al. 2005; Gadue, Huber et al. 2006; Nostro, Cheng et al. 2008). The
growth factors were added to the ESC cultures either at the time of plating (Ng, Azzola et al.
2005) or two days after the onset of differentiation (Park, Afrikanova et al. 2004; Gadue, Huber
et al. 2006; Nostro, Cheng et al. 2008) with similar results. Studies using monolayer ESC
differentiation cultures established in serum media on collagen IV or on a layer OP9 bone
marrow-derived mouse stromal cells were also able to generate different mesoderm subsets when
cells were isolated based on their differential protein expression patterns of markers such as E-
cadherin, VE-cadherin, Fetal liver kinase 1 (FLK1) and Platelet-derived growth factor receptor α
(PDGFRα) (Nishikawa, Nishikawa et al. 1998; Sakurai, Era et al. 2006). Regardless of whether
differentiation was initiated via the EB or monolayer culture method, the up-regulation of early
primitive streak/mesoderm marker genes such as Brachyury or Flk1 was observed between days
3 to 5 of differentiation, with peak expression levels detected on day 4. Using this knowledge, I
decided to design a one-step differentiation system that can generate mesodermal derivatives.
41
Specifically, my overall goal is to devise a system that can potentially be used in the discovery of
inducers that can enhance the generation of mesoderm-derived chondrocytes via high-throughput
screening (HTS) and high-content imaging (HCI) technologies. As such, I have devised the
following design criteria for the differentiation system:
1. Develop a system with minimal manual manipulation (i.e., without the need for cell
dissociation, cell sorting, subculturing, etc.) required to establish differentiation cultures
using known mesoderm and chondrogenic inducers.
2. Establish a versatile system that can be adapted to different ESC-derived cell types of
interest.
3. Develop a culture system that will be used as a baseline tool to study the effects of
modulators.
Since the differentiation system is intended to be used as a screening tool, it will be
beneficial to generate a mixed population of cells instead of using pure cell populations (e.g.
cells isolated from EBs using fluorescence activated cell sorting (FACS)) such that one can
detect the effects of modulators on the propagation of cell populations of interest. In addition,
one should be able to establish these test cultures quickly and easily in a cost-effective manner to
facilitate the screening of multiple test molecules in a high-throughpout manner. Furthermore, it
is essential to equip such a screening platform with a direct readout that allows for the easy
identification of candidate molecules. As such, I have identified three major project objectives:
Objective 1: Develop a 2D ESC differentiation system in defined conditions using exogenous
growth factors such as BMP4, Activin A or Wnt3a.
42
Objective 2: By comparing the mRNA and protein expression patterns of my cultures with
published data, I can validate whether my culture system supports the differentiation of ESCs
into A) mesoderm followed by B) chondrocytes as well as whether the known signaling
pathways that occur in vivo and in 3D cultures play similar roles in my 2D cultures.
Objective 3: Develop a transgenic reporter system that can be used in lieu of wild-type ESCs in
my differentiation system to facilitate the easy identification of ESC-derived chondrocytes in
live-cell imaging applications.
In terms of Objectives 1 and 2A, based on published results on the derivation ESC-
derived mesodermal cells, I hypothesize that I can recapitulate conventional EB culture
technique to generate ESC-derived mesoderm cells by establishing monolayer
differentiation cultures in a defined condition using exogenous growth factors. I have
identified the following project aims to test my hypothesis:
Aim 1: Identify the suitable basal conditions necessary to establish serum-free (SF) monolayer
ESC cultures.
Aim 2: Examine the feasibility of inducing mesoderm differentiation in SF monolayer ESC
cultures by adding BMP4, Activin A or Wnt3a at the onset of differentiation.
Aim 3: Determine whether the addition of BMP4, Activin A or Wnt3a at the onset of
differentiation can generate different mesoderm subsets.
For the establishment of the basal SF culture conditions (Aim 1), I am focusing on
examining the effects of SF medium formulation, ECM and seeding density on my cultures.
Specifically, I am looking for conditions that will not lead to dramatic spontaneous
43
differentiation without the addition of inductive factors because that may skew the results of my
assessment. To do so, I will culture the cells for two days in various combinations of SF
medium, ECM and seeding density in the presence of LIF, and I will choose the basal conditions
based on the extent of the maintenance of OCT4 expression in my cultures, as quantified by the
Cellomics ArrayScan® high-content screening system from Thermo Scientific (Fig. 1.6).
Fig. 1.6 – Schematic of the screening assay to be conducted to assess the basal conditions to be used in my monolayer differentiation culture system. ESC cultures established in every three consecutive wells
(representing three technical replicates) of the 96-well plate will be subjected to a specific combination of test
conditions, namely, SF medium, ECM and seeding density. After two days of culture, the expression of OCT4
protein in each well will be assessed via immunostaining and the fluorescence intensity will be quantified using the Cellomics ArrayScan® high-content screening system. Histograms representing the distribution of OCT4
expression for each combination of test condition can then be generated.
To induce mesoderm differentiation (Aim 2), I will add BMP4, Activin A or Wnt3a to
my SF monolayer cultures at the time of plating in the absence of LIF and measure the
expression of the primitive streak marker BRACHYURY on days 2, 4 and 6 of differentiation
using the Cellomics ArrayScan® high-content screening system. Additional analyses will be
performed on four-day differentiation cultures, concurrent with the time of peak expression of
primitive streak/early mesoderm markers, to determine the marker gene expression levels for
posterior and anterior mesoderm as well as mesendoderm (Aim 3) (Fig. 1.7). I want to determine
if the addition BMP4, Activin A or Wnt3a at the onset of differentiation to my SF culture system
44
can recapitulate the results of other in vitro ESC mesoderm differentiation systems as well as in
vivo studies of early embryonic development.
Fig. 1.7 – Schematic of the analyses to be conducted to verify mesoderm induction in my ESC SF monolayer differentiation system. Mesoderm inducers will be added to cultures at the onset of differentiation (Day 0) and
cells will be differentiated for 6 days during which BRACHYURY protein expression will be assessed via
Cellomics ArrayScan® high-content screening system (represented by image of the instrument) every two days.
Transcript level analyses of early mesoderm markers as wells mesoderm subset-specific marker genes (represented
by bar graph) will be conducted on day 4 of differentiation to confirm the recapitulation of published results regarding effects of growth factors on the induction of specific mesoderm populations.
As will be discussed in detail in Chapter 2, my culture system behaved similarly to other
published ESC mesoderm differentiation systems in that BMP4 could induce the up-regulation of
posterior mesoderm marker genes while Activin A addition enhanced the generation of anterior
mesoderm populations. The ability to control the type of mesoderm intermediates being formed
in monolayer differentiation cultures based on the addition of specific mesoderm inducers
enhanced the versatility of the system. To address Objective 2B, I suspect that I can use my
differentiation system to generate various mesoderm-derived cell types with prolonged culture
knowing that posterior mesoderm intermediates can give rise to hematopoietic or endothelial-
type cells, while more anterior populations can further differentiate into cell types such as those
45
of the skeletal and cardiac lineages. I am particularly interested in the generation of
chondrocytes from ESCs because of the challenges associated with cartilage repair (outlined in
Section 1.3.2), and as mentioned before, I want to generate an ESC-derived source of
chondrocytes that can potentially be used in the screening for novel therapeutics for cartilage
repair. I hypothesize that I can also bypass the conventional 3D EB, pellet or micromass
culture techniques to generate ESC-derived chondrocytes from ESCs by establishing
monolayer differentiation cultures in a defined condition using exogenous Activin A,
BMP4, Wnt3a and/or known chondrogenic inducers such as TGFββββ3 and FGF8. The
following aims are identified in order to test this particular hypothesis:
Aim 4: Determine the effect of prolonged exposure to Activin A, BMP4 or Wnt3a on
chondrogenic induction in my differentiation system.
Aim 5: Upon verifying that mesoderm inducers can also induce chondrocyte formation in my
differentiation culture system, examine whether known chondrogenic inducers such as TGFβ3
and FGF8 can further enhance chondrogenic induction from ESCs.
Aim 6: Determine the duration of growth factor supplementation necessary to induce
chondrocyte formation in my ESC differentiation cultures.
I plan to assess the efficacy of my culture system based on the expression of major
chondrogenic marker genes such as Col2a1, Sox9, Aggrecan on days 7 and/or 15 of
differentiation, and I will also examine the transcript levels of hypertrophic chondrocyte markers
Col10a and Runx2 to determine whether or not the cells are undergoing terminal differentiation.
Protein expression of chondrogenic markers such as COL2A1 and SOX9 will be assessed via
46
immunofluorescence (IF) analysis and proteoglycan production would be verified with Alcian
blue staining (Fig. 1.8).
Fig. 1.8 – Schematic of the experimental strategy to be used in the derivation of ESC-derived chondrocytes in a defined condition. Growth factors will be added at the onset of differentiation (Day 0) and cells will be
cultured for five days, at which point BMP4, Activin A or Wnt3a can be removed and be replaced by other growth
factors like TGFβ3 and FGF8. Cultures will be continued until day 7 or day 15 of differentiation, and transcript analyses, immunostaining and Alcian blue staining will be conducted to assess the extent of chondrocyte
formation.
When I assessed the extent of chondrocyte formation in my culture system, I observed
that Co2a1 was dramatically up-regulated and there was robust formation of COL2A1 networks
in my cultures, indicating that COL2A1 expression was a suitable readout for my analyses.
However, I could not use IF-based strategy to quantify the percentage of chondrocytes in my
culture because I was visualizing the protein network secreted by all the COL2A1-producing
cells. As such, the third objective (Objective 3) of this project is to generate a transgenic ESC
line that will allow me to identify the transient COL2A1+ population during chondrogenic
differentiation. A construct will be assembled such that Col2a1 promoter will drive the
transcription of a fluorescent protein as the reporter. To facilitate the isolation of transfected
cells, the construct will also be equipped with a selectable marker in the form of a cassette
47
consisting of an antibiotic resistance gene under the transcriptional control of a ubiquitous
promoter, and the cassette can be removed via site-specific recombination from the genome of
the transgenic cell line to minimize the amount of genetic manipulation (Fig. 1.9).
Fig. 1.9 – Design schematic of the reporter construct T2A to be used in the identification of COL2A1+ ESC-
derived chondrocytes generated in the SF monolayer differentiation system.
I plan to assemble my reporter construct using the Gateway® cloning technology which
incorporates fragments of insert into a cloning vector in a modular manner. By separating the
promoter, the fluorescent protein and the antibiotic resistance gene cassette into separate
modules, this reporter system that can be used in a multitude of cell tracking analyses by
substituting in different promoters and reporter genes. Although it is not necessary for my task
at hand, which is to identify COL2A1+ cells in my chondrongenic differentiation cultures, I have
further modified the construct design such that it can be implemented in a two-step reporter
system that will utilize my reporter construct to activate a Cre-inducible cell line (EST2B) that
was previously generated in our laboratory (Handy 2005). To do so, I will insert the sequence
encoding Cre recombinase into my reporter construct such that the activation of the tissue-
specfic promoter will lead to the expression of both the fluoresecent protein and the Cre
recombinase. I will then insert this modified tissue-specific reporter construct into EST2B cells
to create the EST2 transgenic ESC line (Fig. 1.10).
48
Fig. 1.10 – Diagrammatic representation of the derivation of EST2 transgenic ESC line. Linearized T2A
construct will be inserted into EST2B cells via electroporation or lipofection, and the culture will be subjected to
antibiotic selection using both puromycin and G418 24-48hrs. post-transfection. About a week after the start of the
selection process, puromycin/neomycin-resistant ESC clones will arise, at which point each clone will be
individually transferred to a 96-well plate line with MEFs. Clones of interest will be further expanded for further
analyses.
Using my chondrogenic differentiation system as a proof-of-principle assay, the
differentiation of EST2 cells into chondrocytes will activate the Col2a1 promoter and lead to the
transcription of Cre. Cre recombinase will then excise the floxed PuroR that is part of the
construct targetd to the ubiquitous Rosa26 locus (Soriano 1999) of the mouse genome in the Cre-
inducible cell line. The recombination will facilitate the constitutive expression of DsRed T3
RFP in the blasticidin-resistant cells (Fig. 1.11). This two-step system can be used to identify
any ESC-derived transient populations of interest. Furthermore, since the transgenic ESCs will
constitutively express RFP upon Cre excision, all the progeny of the transient cell population can
be identified even after the tissue-specific promoter was no longer active, allowing this versatile
system to be used in various fate-mapping studies.
49
Fig. 1.11 – Schematic of the interaction between tissue-specific promoter-driven reporter construct (T2A) and
Rosa26-targeted Cre-inducible reporter construct (T2B) when the Col2a1 promoter was activated upon
chondrogenic differentiation of the transgenic EST2 cells.
The coupling of the SF monolayer differentiation system with the use of EST2 cells can
have many potential downstream uses. By establishing a minimal system that acts as a baseline
for chondrogenic induction from ESCs, one can use it in the discovery of novel regulators by
screening siRNA, shRNA, over-expression or small molecules libraries. In addition, the
versatility associated with both the differentiation system and construct T2A was greatly
increased due to their modular designs. As such, one can use my design as a blueprint for
establishing screening platforms for a plethora of ESC-derived cell types.
50
Chapter 2 Serum-free derivation of ESC-derived mesoderm and
chondrocytes from monolayer cultures
This chapter is a modified version of the work published in Stem Cell Research titled “One-step
generation of murine embryonic stem cell-derived mesoderm progenitors and chondrocytes in a
serum-free monolayer differentiation system.”
Waese, E. Y. and W. L. Stanford. "One-step generation of murine embryonic stem cell-derived
mesoderm progenitors and chondrocytes in a serum-free monolayer differentiation system."
Stem Cell Research. 2011 Jan; 6(1): 34-49.
51
2.1 Overview
As mentioned in Section 1.7, published ESC models of primitive streak formation and
lineage commitment have validated the possibility of generating functional mesodermal cell
types in defined conditions by adding BMP4, Activin A or Wnt3a on either day 0 or day 2 of
differentiation. I was interested in desigining a culture system for ESC-derived chondrocytes
that could be use as a baseline tool to test the chondrogenic enhancing effects of molecules in the
discovery of novel therapeutics for cartilage repair. Currently, the majority of in vitro
chondrogenic differentiation strategies rely on the establishment of dense pellet or micromass
cultures in serum-containing or conditioned media to mimic mesenchymal condensation.
However, the 3D clustering of heterogeneous cell populations creates an unknown culture
environment that obscures the effects of exogenous factors due to more severe fate-determining
paracrine interactions among various cell populations compared to 2D cultures, while the
presence of serum components masks the effects of growth factors. As such, I decided to
establish my differentiation cultures in monolayers by adding BMP4, Activin A or Wnt3a at the
onset of differentiation to induce mesoderm formation for five days, after which I examined the
effect of the three mesoderm inducers plus known chondrogenic inducers TGFβ3 and FGF8 on
chondrocyte formation by analyzing the expression of the major chondrocyte markers Col2a1,
Sox9, Aggrecan, Col10a and Runx2. I also studied the protein expression of COL2A1 and SOX9
via IF as well as proteoglycan production through Alcian blue staining (Fig. 1.8). I found that
my 2D SF culture system recapitulated the cellular behaviour both in vitro and in vivo in that I
was able to generate poseterior and anterior mesoderm by day 4 of differentiation in cultures
supplemented with BMP4 (10ng/ml) or Activin A (30ng/ml), respectively. I also discovered that
short-term exposures (five days) of ESCs to Activin A (30ng/ml) or BMP4 (25ng/ml) was
52
sufficient to induce chondrocyte formation, while Wnt3a (100ng/ml) only promoted
chondrogenic differentiation as a late inducer after mesoderm specification, consistent with
results obtained in limb bud studies.
2.2 Materials and Methods
2.2.1 Maintenance of ESCs
R1 ESCs (Nagy, Rossant et al. 1993) were thawed onto irradiated MEFs feeder layer in
ES medium containing high glucose Dulbecco’s Modified Eagle Medium (D-MEM, Gibco)
supplemented with GlutaMAX™-1 (2mM) (100x, Gibco), β-mercaptoethanol (0.1%) (1000x,
Gibco), sodium pyruvate (1mM) (100x, Gibco), non-essential amino acids (100µM) (100x,
Gibco), penicillin/streptomycin (0.5%) (stock containing penicillin at 10,000U/ml and
streptomycin at 10,000µg/ml, Gibco), LIF (1000U/ml, Chemicon) and fetal bovine serum (FBS,
15%, Northbio or Gibco). Cells were subcultured every two days on MEFs. Briefly, ESCs were
rinsed with phosphate buffered saline (PBS, without Ca2+
/Mg2+
, Gibco) and dissociated using
trypsin-ethylenediaminetetraacetic acid (EDTA) (0.05%, Gibco) after 5min. incubation at 37oC.
Trypsin was inactivated with serum-containing medium and single-cell suspension was achieved
by repeated pipetting. Cells were then seeded onto plated MEFs in ES medium with LIF. ESCs
were subcultured onto gelatinized (0.1%) tissue culture plastic twice for feeder depletion prior to
experimentation. All cultures were maintained at 37oC under 5% CO2.
For SF ES media formulations, N2B27 medium (Ying, Nichols et al. 2003) consisted of
1:1 ratio of D-MEM/F-12 medium and NEUROBASAL™ medium (both from Gibco)
conditioned with N2 (0.5x) and B27 (0.5x, without retinoic acid) supplements (100x and 50x
respectively, both from Gibco) as well as bovine serum albumin (BSA, 25µg/ml, Sigma).
53
Chemically defined medium (CDM) (Johansson and Wiles 1995) consisted of 1:1 ratio of
GlutaMAX™-1-supplemented Iscove’s Modified Dulbecco’s Medium (I-MDM) and Ham’s F-
12 medium (both from Gibco), BSA (5mg/ml), chemically defined lipid concentrate (1x) (100x,
Gibco), transferrin (15µg/ml, Sigma), insulin (7µg/ml, Sigma) and monothioglycerol (450µM,
Sigma). The third candidate SF medium was X-Vivo™10 (Bio Whittaker). For ESC
maintenance, all SF media were supplemented with LIF (1000U/ml), GlutaMAX™1 (2mM) and
β-mercaptoethanol (0.1%).
2.2.2 Differentiation of ESCs
For EB formation, 4x106
ESCs were seeded onto a 10-cm Petri dish with ES medium
without LIF. EBs were subcultured at a 1:2 ratio on alternate days. Occasional mechanical
separation and dislodging of attached EBs through gentle pipetting was required. For SF ESC
differentiation, LIF was replaced with Activin A (R&D), BMP4 (R&D) or Wnt3a (STEMCELL
Technologies) in SF ES medium. ESCs were seeded into wells coated with gelatin (0.1%),
gelatin (0.02%)+fibronectin (12.5µg/ml), or collagen IV (250µg/ml) (all from Sigma).
For chondrogenic differentiation, 104cells/cm
2 were seeded onto collagen IV-coated wells
and cultured for 15 days in SF differentiation medium supplemented with one growth factor or a
combination of two factors (Table 2.1). Serum monolayer cultures were established as described
in (Nishikawa, Nishikawa et al. 1998). Briefly, 104cells/cm
2 ESCs were seeded onto collagen
IV-coated tissue culture plastic in medium containing Minimum Essential Medium α (α-MEM,
Gibco) supplemented with FBS (10%, Gibco), penicillin/streptomycin (0.5%) and β-
mercaptoethanol (0.5%). To establish micromass cultures, trypsinized cells were resuspended at
2x107cells/ml in N2B27 media supplemented with Activin A (30ng/ml) or in chondrogenic
media (Woods, Wang et al. 2007). Chondrogenic media consisted of F12 Nutrient Mixture
54
(60%), D-MEM (40%), FBS (10%), penicillin/streptomycin (0.25%) and Glutamax™-1 (0.25%).
A droplet (10-20µl) of cell suspension (2-4x105cells/drop) was added into each well of a Nunc™
∆-Surface 4-well plate and was incubated for 3hrs. Media (1ml) was added to each well after the
incubation period, at which point the chondrogenic media was supplemented with β-
glycerophosphate (1mM) and ascorbic acid (50µg/ml), and the cultures were maintained for 15
days.
2.2.3 HCI experiment setup
Cells were plated onto ECM-coated black 96-well plates (Greiner Bio-One) in SF ES
media and varying concentrations of test cytokines. Each plate consisted of triplicates of 27
combinations of cytokine concentrations and five serum conditions. Plates were centrifuged at
1000rpm for 2min. prior to incubation. Analysis was performed using Cellomics ArrayScan®
high-content screening system (Thermo Scientific) at 10x magnification.
2.2.4 Antibody staining for IF and HCI
Cells were fixed with formaldehyde (3.7%, Sigma) for 10min. at 37oC or 20min. at room
temperature and permeabilized with (a) methanol (100%, Sigma) for 2min. at room temperature
for HCI or (b) Triton-X-100 (0.1%, Fisher Scientific) in PBS containing Ca2+
/Mg2+
with BSA
(0.1%) for 30min. at room temperature for IF. Cells were blocked with FBS (10%) or DifcoTM
skim milk (5%, BD Biosciences) overnight at 4oC and then stained with the primary antibody
overnight at 4oC. Cells were subsequently stained for 1hr. at room temperature in the dark with
secondary antibodies (Molecular Probes AlexFluor antibodies) at 1:200 dilution for HCI or
1:1000 for IF and were co-stained with 1:10,000 dilution of Hoechst dye (10mg/ml) or 4',6-
diamidino-2-phenylindole (DAPI) nuclear stain (5mg/ml) (both from Molecular Probes).
Primary antibodies: mouse monoclonal anti-OCT4 antibody (1:200 for HCI) (BD Biosciences),
55
goat polyclonal anti-human BRACHYURY antibody (1:150 for HCI and 1:500 for IF) (R&D),
mouse monoclonal anti-COL2A1 antibody (1:500 for IF) (Abcam) and rabbit polyclonal anti-
SOX9 antibody (1:200 for IF) (Santa Cruz Biotechnology). IF images were taken using the
camera-mounted Leica DMIRE2 fluorescence inverted microscope.
2.2.5 Flow cytometry
Trypsinized cells were washed twice with cold PBS and resuspended in 1x Binding
Buffer (BD Biosciences) at 107cells/ml. Cells (10
6 in 100µl) were stained with phycoerythrin-
conjugated ANNEXIN V antibody (5µl, BD Biosciences) for 15min. at room temperature in the
dark. Cells were diluted with 1x Binding Buffer (900µl) and analyzed using the Beckman
Coulter FC 500 MCL System. The percentage of positively-stained population was determined
by setting the gate such that 99.9% of the population was considered negative in the absence of
antibody staining.
2.2.6 Alcian blue staining
Cells were fixed with ethanol (95%) for 3hrs. at -20oC and washed with hydrochloric acid
(HCl) (0.2N) prior to staining with Alcian blue (0.1%, Sigma) in HCl at room temperature or 4oC
overnight. Cells were washed with HCl and imaged using camera-mounted Leica MZ6
stereomicroscope at 12.5x magnification. Each figure represents 58% of the well.
2.2.7 cDNA synthesis
Total RNA was isolated using the NucleoSpin® RNA II kit (Macherey-Nagel) and RNA
(1-2µg) was treated with DNA-free™ kit (Ambion). Briefly, RNA was mixed with 10x DNase I
Buffer (2µl), rDNase I (1µl) and DNase/RNase-free water (Gibco) in a 20µl reaction. The
mixture was incubated at 37oC for 30min. DNase Inactivation Reagent (2µl) was added to the
reaction mixture and centrifuged after 2min. incubation at room temperature, and then treated
56
RNA was transferred to a fresh tube. Synthesis of cDNA was carried out using random primers
and Superscript® II reverse transcriptase (all from Invitrogen). A reaction mixture consisting of
treated RNA (10µl), random primers (250ng) and dNTP (1µl from 10mM stock) was incubated
at 65oC for 5 min. and quickly chilled on ice. 5x First-Strand Buffer (4µl), 0.1M DTT (2µl) and
RNaseOUT™ (1µl from 40units/µl stock) were added to the reaction mixture which was then
incubated at 25oC for 2min. before the addition of SuperScript® II reverse transcriptase (1µl).
The final reaction conditions were: 25oC for 10min., 42
oC for 50min. then 70
oC for 15min.
2.2.8 Real-time quantitative polymerase chain reaction (qPCR)
The qPCR mixture (10µl) consisted of diluted cDNA (4µl), LightCycler®480 DNA 2x
SYBR Green I Master reagent (3µl, Roche), primer mix (0.2µl at 50µM) and DNase/RNase-free
water (2.8µl, Roche). Standard curves were generated using genomic DNA or cDNA collected
from EBs. Technical triplicates of each qPCR reaction were carried out using the
LightCycler®480 Real-Time PCR System (Roche): 95oC for 5min.; 45 cycles of (95
oC for
10sec., 60oC for 10sec. then 72
oC for 10sec). See Table A.1 in the Appendix A for primer
sequences. Measured transcript levels were normalized to Elongation factor 1 (Ef1) or
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and compared to undifferentiated ESC
control.
2.2.9 Statistical analysis
Statistical analysis was performed using the two-tail Student T-test: significance between
two test conditions: * (p<0.05), ** (p<0.005); significance between test condition and untreated
SF control: (p<0.05), (p<0.005), and significance between test condition and serum
control: (p<0.05), (p<0.005). HCI and qPCR analyses for each sample were performed
in triplicates and each experiment was replicated independently as indicated by the n values.
57
Supplementation Schedule 1 Supplementation Schedule 2
Factor 1 Day 0-15 Factor 2 Day 5-15 Factor 1 Day 0-5 Factor 2 Day 5-15
Activin
(30ng/ml)
BMP4 (10ng/ml)
Activin
(30ng/ml)
BMP4 (10ng/ml)
Wnt3a (100ng/ml) Wnt3a (100ng/ml)
TGFβ3 (10ng/ml) TGFβ3 (10ng/ml)
FGF8 (50ng/ml) FGF8 (50ng/ml)
BMP4
(10ng/ml)
Activin A (30ng/ml)
BMP4
(10ng/ml)
Activin A (30ng/ml)
Wnt3a Wnt3a
TGFβ3 TGFβ3
FGF8 FGF8
BMP4
(25ng/ml)
Activin A
BMP4
(25ng/ml)
Activin A
Wnt3a Wnt3a
TGFβ3 TGFβ3
FGF8 FGF8
Wnt3a
(100ng/ml)
BMP4
Wnt3a
(100ng/ml)
BMP4
Activin A Activin A
TGFβ3 TGFβ3
FGF8 FGF8
TGFβ3 (10ng/ml)
FGF8 (50ng/ml)
Serum (15%)
Table 2.1– List of test conditions used to examine the effects of BMP4, Activin A, Wnt3a, TGFβ3, FGF8 and serum on monolayer chondrogenic differentiation from R1 ESCs in chemically defined conditions. Factor 1
was added on day 0 of differentiation and was withdrawn after 15 days or 5 days of culture while Factor 2
supplementation commenced on day 5 of differentiation until the end of the time course.
58
2.3 Results
2.3.1 N2B27 supported ESC adhesion and proliferation on collagen IV
I examined the combined effects of LIF-supplemented SF medium formulations, ECMs
and seeding densities on OCT4 expression in undifferentiated ESCs. LIF- and BMP4-
supplemented N2B27 medium has been previously shown to maintain undifferentiated ESCs in
culture (Ying, Nichols et al. 2003). N2B27 has also been used in various ESC mesoderm
differentiation studies (Gadue, Huber et al. 2006; Nostro, Cheng et al. 2008; Purpura, Morin et
al. 2008). CDM was formulated to study the roles of Activin A and BMP4 in mesoderm and
hematopoietic development (Johansson and Wiles 1995); while X-Vivo™10 was developed for
human hematopoietic cells and ESC cultures. For ECM selection, gelatin has been widely used
in ESC cultures, gelatin+fibronectin has been commonly used in HCI assays (Davey and
Zandstra 2006; Walker, Ohishi et al. 2007) and collagen IV has been used in serum monolayer
differentiation cultures (Nishikawa, Nishikawa et al. 1998; Tada, Era et al. 2005; Sakurai, Era et
al. 2006; Fujiwara, Hayashi et al. 2007). Seeding densities were set at 6x104; 3x10
4; and
1.5x104cells/cm
2.
Histograms representing OCT4 expression profiles were generated from the fluorescence
intensity data quantified by HCI analysis. Regardless of seeding density or medium formulation,
two-day cultures established on gelatin+fibronectin demonstrated significant loss in OCT4
expression with a clear separation between OCT4+ and OCT4
- populations (Figs. 2.1A and
A.1A), while OCT4 levels remained high in gelatin or collagen IV cultures (Figs. 2.1B and
A.1B, respectively). OCT4 expression decreased in gelatin+fibronectin cultures as cell density
decreased (Fig. 2.1Ci) while it varied in collagen IV cultures depending on SF medium
formulation and remained steady in gelatin cultures (Fig. A.1B). OCT4 levels decreased and
59
varied greatly in collagen IV cultures seeded at 1.5x104cells/cm
2 in X-Vivo™10 medium due to
the scarcity of colonies, while the opposite trend was observed in CDM cultures due to over-
confluency (Fig. 2.1Cii). Therefore, ESC cultures established on collagen IV and maintained in
LIF-supplemented N2B27 medium were most tolerant to varying seeding densities.
A
B
C
Fig. 2.1 – Two-day ESC cultures on collagen IV in N2B27 medium with LIF maintained high OCT4 expression. (A) N2B27 cultures on (i) gelatin+fibronectin exhibited a biomodal distribution of OCT4 levels
compared to those on (ii) gelatin and (iii) collagen IV, leading to a lower percentage of OCT4+ population (B). (C) (i) OCT4 levels of gelatin+fibronectin cultures reduced with decreasing seeding density regardless of SF medium
formulation. (ii) OCT4 expression varied dramatically at a high seeding density in X-Vivo cultures on collagen IV,
while the opposite trend was observed in CDM cultures. OCT4 expression remained relatively stable at all seeding
densities in N2B27 cultures on collagen IV. Plotted values represented means±SEM (n=2).
% O
CT
4-p
ositiv
e c
ells
% O
CT
4-p
ositiv
e c
ells
% O
CT
4-p
ositiv
e c
ells
60
2.3.2 Activin A-supplemented monolayer differentiation cultures exhibited stronger cell-matrix adhesion and improved survival
I investigated the roles of Activin A (30ng/ml), BMP4 (10ng/ml) and Wnt3a (100ng/ml)
in my N2B27 medium-based SF monolayer culture system as they effectively induced mesoderm
formation in EB studies (Murry and Keller 2008). Activin A acts as a surrogate of NODAL by
signaling through the same receptor but is not inhibited by LEFTY1, which is expressed during
EB development (Gadue, Huber et al. 2006). Morphological examination of four-day
differentiating ESCs in serum condition showed extensive cell spreading and strong cell-matrix
adhesion (Fig. 2.2i). Differentiating cells in Activin A- or Wnt3a-supplemented cultures adhered
well on collagen IV-coated surface (Fig. 2.2ii-iii), albeit with inferior cell spreading and
distribution compared to serum cultures. Some colonies in BMP4 cultures elevated from the
flattened surrounding cells and displayed poor cell-matrix contact (Fig. 2.2iv). Overall, growth
factor-supplemented cultures displayed stronger cell-matrix adhesion than untreated SF cultures
consisting of tightly packed colonies that detached easily from culture surface (Fig. 2.2v).
I determined whether differences in cell adhesion capabilities in growth factor-
supplemented cultures were indicative of a compromise in cell survival, specifically that of the
nascent mesodermal cells. As such, I examined the expression of the early mesoderm marker
FLK1 in my SF monolayer differentiation cultures. Flow cytometry analysis of FLK1:eGFP
ESCs (Ema, Takahashi et al. 2006) differentiated for four days in SF monolayer cultures showed
that FLK1:eGFP expression was significantly higher in Activin A-supplemented cultures
compared to untreated cultures (Fig. 2.3A). Interestingly, greater Flk1 transcript expression was
observed in BMP4- or Wnt3a-supplemented cultures than that in Activin A-treated cultures (Fig.
2.3B). Expression of the apoptotic marker ANNEXIN V was significantly higher in BMP4-
supplemented cultures than in Activin A-treated cultures (Fig. 2.3C). Dot plots showed that <1%
61
of the population co-expressed FLK1:eGFP and ANNEXIN V (Fig. 2.3D), indicating that
monolayer ESC cultures established on collagen IV in growth factor-supplemented SF medium
supported mesoderm differentiation.
Fig. 2.2 –Morphologies of four-day SF, growth factor-supplemented ESC monolayer differentiation cultures established on collagen IV. Brightfield images (100x) taken with the camera-mounted Leica DM IL inverted
microscope illustrated that serum cultures (i) exhibited more pronounced cell adhesion and spreading than SF
Activin A (ii) and Wnt3a (iii) cultures. Raised colonies (arrows) were present in BMP4 cultures (iv), while untreated
cultures (“No GF”) (v) consisted of tightly packed cell populations that adhered poorly.
62
A Flow cytometry B qPCR
C Flow cytometry
D Flow cytometry
Fig. 2.3 – Characteristics of four-day SF, growth factor-supplemented ESC monolayer differentiation cultures established on collagen IV. (A) Flow cytometric analyses and (B) qPCR indicated that although Activin
A, BMP4 and Wnt3a induced FLK1:eGFP expression and Flk1 transcript in SF monolayer differentiation cultures,
respectively, expression of the apoptotic marker Annexin V was distinctly higher in BMP4 cultures (C). (D) Flow
cytometric dot plots of Annexin V vs. FLK1:eGFP showed that nascent mesodermal cells generated in the SF
monolayer cultures were not apoptotic, as <1% of the population expressed both markers (highlighted in red). Transcript levels were compared to those in undifferentiated ESCs. Plotted values from flow cytometric analyses
and qPCR represent means±SEM (n≥2).
2.3.3 Endogenous Wnt3a was up-regulated in serum cultures as well as BMP4-supplemented and untreated SF differentiation cultures
Endogenous Bmp4, Nodal and Wnt3a expression in SF differentiation cultures was
quantified by qPCR to determine if they were specifically up-regulated by their respective
exogenous ligands. Activin A-supplemented cultures had significantly higher Nodal transcript
% F
LK
1-p
ositiv
e c
ells
%
AN
NE
XIN
V-p
ositiv
e c
ells
63
levels than BMP4-supplemented and untreated four-day SF cultures (Fig. 2.4A). Interestingly,
Bmp4 expression was up-regulated by either BMP4 or Wnt3a ligand (Fig. 2.4B). The expression
of Nodal, Bmp4 and Wnt3a increased competitively in serum cultures. Surprisingly, Wnt3a
expression was markedly up-regulated to comparable levels in both untreated and Wnt3a-
supplemented cultures (Fig. 2.4C).
A Nodal
B Bmp4
C Wnt3a
Fig. 2.4 – Potential synergistic effects of Activin A, BMP4 and Wnt3a in four-day SF, growth factor-supplemented ESC monolayer differentiation cultures. Quantitative PCR analyses of endogenous expression of
(A) Nodal; (B) Bmp4 and (C) Wnt3a mRNA showed that Wnt3a was significantly up-regulated in BMP4-
supplemented cultures. Expression levels were compared to those in undifferentiated ESCs. Plotted values
represent means±SEM (n≥2).
Rela
tive
Expre
ssio
n o
f B
mp
4
64
Fig. 2.5 – Addition of exogenous Activin A and Wnt3a led to robust induction of BRACHYURY protein expression in four-day monolayer differentiation cultures. IF images (200x) showed that (i) Activin A, (ii)
Wnt3a and (iii) serum cultures displayed comparable BRACHYURY protein levels, while (iv) BMP4 cultures
appeared to have less BRACHYURY+ cells. (v) BRACHYURY was not detected in untreated cultures.
2.3.4 BMP4, Activin A or Wnt3a induced BRACHYURY+ primitive streak-like populations in monolayer differentiation cultures
To corroborate with the FLK1 results (Fig. 2.3A), four-day monolayer cultures were
immunostained for expression of the primitive streak/early mesoderm marker BRACHYURY.
Activin A-, Wnt3a- or serum-supplemented cultures showed comparable levels of
BRACHYURY expression (Fig. 2.5i-iii). BMP4 did not induce BRACHYURY expression as
robustly as Activin A or Wnt3a (Fig. 2.5iv); however, qPCR analysis results demonstrated
similar Brachyury transcript levels in all growth factor-supplemented cultures (Fig. 2.6A). HCI
and IF analyses showed that BRACHYURY was induced in a dose-dependent manner (Figs.
2.6B, A.2A). Addition of Activin A or Wnt3a to BMP4-supplemented cultures increased
BRACHYURY expression, suggesting that Activin A and Wnt3a were synergistic inducers of
BRACHYURY
DAPI/Hoechst
65
primitive streak-like cells at the tested concentrations (Fig. A.2Bi-ii) but their simultaneous
presence did not further increase BRACHYURY expression (Fig. A.2Biii). SF media alone did
not induce noticeable BRACHYURY expression (Fig. 2.5v). As expected, BRACHYURY
expression was significantly higher in serum-containing cultures than in SF conditions, while
serum components masked the inductive effect of Activin A on BRACHYURY expression (Figs.
2.6C and A.2Biv).
A qPCR
B HCI analysis
C HCI analysis
Fig. 2.6 – Early mesoderm specification in four-day growth factor-supplemented SF monolayer differentiation cultures. (A) qPCR results suggested that Activin A, BMP4 and Wnt3a exerted similar inductive
effects on Brachyury transcription while serum effect was the most potent. Transcript levels were compared to
those in undifferentiated ESCs. Plotted values represent means±SEM (n≥3). (B) HCI analysis demonstrated that
BRACHYURY protein level was directly correlated with growth factor concentration (e.g. Activin A), while this
effect was masked in serum cultures (C). Plotted values represent means±SEM (n=2).
% B
RA
CH
YU
RY
-positiv
e c
ells
% B
RA
CH
YU
RY
-positiv
e c
ells
66
2.3.5 Mesoderm marker genes expression patterns correlated with those in EB cultures and in murine embryos studies
Previous reports showed that BMP4 has a posteriorizing effect on differentiating ESCs,
while Activin A promotes the formation of increasingly more anterior populations in a
concentration-dependent manner (reviewed in (Murry and Keller 2008)). Based on marker
expression, I observed similar growth factor-dependent enrichment of mesoderm subsets in my
four-day monolayer cultures. Expression of the posterior mesoderm markers Even-skipped
homeobox 1 (Evx1), Homeobox B1 (HoxB1), T-cell acute leukemia 1 (Tal1) and GATA2 was
dramatically up-regulated in BMP4-supplemented cultures (Fig. 2.7i-iv). LIM homeobox 1
(Lhx1) expression was induced by Activin A, BMP4 and Wnt3a (Fig. 2.7v) while BMP4 and
Wnt3a supplementation led to higher transcript levels of the paraxial mesoderm marker Pdgfrα
compared to Activin A (Fig. 2.7vi). Activin A and Wnt3a, but not BMP4, induced the
expression of the anterior marker Mesenchyme homeobox 2 (Meox2) (Fig. 2.7vii), while all three
growth factors exerted similar inductive effects on Follistatin (Fst) and Mesoderm posterior 2
(Mesp2) expression (Fig. 2.7viii-ix). As expected, expression of the mesendoderm markers
Goosecoid (Gsc) and Forkhead box a2 (Foxa2) was up-regulated by Activin A (Fig. 2.7x-xi).
Wnt3a appeared to have a pan-mesodermal inductive effect based on transcript level analysis.
Therefore, differential growth factor supplementation at the onset of differentiation facilitated
enrichment of mesoderm subsets in monolayer cultures without cell sorting.
67
i) Evx1
ii) HoxB1
iii) Tal1
iv) GATA2
v) Lhx1 vi) Pdgfrα
vii) Meox2
viii) Fst
ix) Mesp2
x) Gsc
xi) Foxa2
Fig. 2.7 – Quantitative PCR analysis showed that BMP4, Activin A and Wnt3a induced the expression of marker genes of various mesoderm subsets. BMP4 was more inductive in the up-regulation of the posterior
primitive streak markers (i) Evx1, (ii) HoxB1, (iii) Tal1 and (iv) GATA2 while Activin A appeared to be equally
inductive in (v) Lhx1. (vi) BMP4 was more effective in inducing the paraxial mesoderm marker Pdgfrα than
Activin A, which up-regulated the anterior mesoderm marker (vii) Meox2, (viii) Fst and (ix) Mesp2 to a lesser extent. Activin A effectively up-regulated the mesendoderm markers (x) Gsc and (xi) Foxa2, and Wnt3a appeared
to have a pan-mesodermal inductive effect. Transcript levels were compared to those in undifferentiated ESCs.
Plotted values represent means±SEM (n≥2).
Re
lativ
e E
xp
ressi
on
of P
dg
frα
68
2.3.6 Activin A facilitated chondrogenic differentiation in SF monolayer cultures
Fifteen-day growth factor-supplemented monolayer cultures were established to
determine if prolonged exposure to mesoderm inducers could trigger chondrogenic induction.
Activin A-supplemented (30ng/ml) cultures (Fig. 2.8Ai) showed more intense Alcian blue
staining than those treated with BMP4 (10ng/ml), Wnt3a (100ng/ml) or serum (Fig. 2.8Aii-iv);
also, robust COL2A1 networks were only present in Activin A-supplemented cultures (Fig.
2.8C). SOX9-positive cells were also present in Activin A-supplemented cultures (Fig. 2.8D).
Similar to four-day cultures, 15-day untreated SF differentiation cultures demonstrated poor cell-
matrix adhesion with the formation of EB-like structures that were loosely anchored via
filamentous protrusions (Fig. 2.8B) and were easily dislodged during media replenishment.
Real-time qPCR analysis showed that Activin A-supplemented cultures showed marked
up-regulation of the chondrogenic markers Col2a1, Sox9 and Aggrecan while cultures with
BMP4, Wnt3a and serum showed minimal changes in gene expression (Fig. 2.9A-C). Activin A
did not strongly enhance the expression of Col10a and Runx2 compared to non-inductive
conditions (Fig. 2.9D), suggesting the maintenance of non-hypertrophic chondrocytes after 15
days of differentiation.
69
A
C COL2A1
B
D SOX9
Fig. 2.8 – 15-day Activin A-treated SF monolayer cultures underwent chondrogenic differentiation. (A)
Activin A culture (i) was more intensely stained with Alcian blue than BMP4 (ii), Wnt3a (iiii) and serum (iv)
cultures. (B) Untreated SF cultures adhered poorly and formed aggregates loosely anchored on the culture surface
(400x). (C) COL2A1 networks were formed in (i) Activin A but not (ii) BMP4, (iii) Wnt3a or (iv) serum cultures
(200x). (D) SOX9 was expressed in 11-day (i) Activin A cultures but not in (ii) BMP4-, (iii) Wnt3a- or (iv) serum-
treated cultures (200x).
COL2A1
DAPI/Hoechst
SOX9
DAPI/Hoechst
70
A
B
C
D
Fig. 2.9 – Real-time qPCR results confirmed the up-regulation of (A) Col2a1, (B) Sox9 and (C) Aggrecan in
day 7 and day 15 of Activin A-supplemented SF monolayer differentiation cultures, while the levels of hypertrophic markers Col10a and Runx2 were similar to non-inductive conditions (D). Expression levels were
compared to those in undifferentiated ESCs. Transcript levels were compared to those in undifferentiated ESCs.
Plotted values represent means±SEM (n≥3).
Comparison of the expression levels of chondrogenic marker genes between monolayer
and micromass cultures suggested that both systems behaved similarly. Interestingly, I was
unable to generate micromasses in cultures supplemented with chondrogenic media (Woods,
Wang et al. 2007) due to poor adhesive properties of the droplets. Micromass cultures
established in SF media supplemented with Activin A (30ng/ml) exhibited similar levels of
71
Col2a1 and Col10a as my monolayer cultures, with slightly enhanced Sox9 levels and lower
Aggrecan expression (Fig. 2.10A compared to Fig. 2.9A-D). However, IF analysis of COL2A1
expression highlighted the shortcoming of the 3D micromass culture in that clear network
formation could only be visualized at the periphery of the micromass (Fig. 2.10B compared to
Fig. 2.8Ci), while the resolution of the image deteriorated towards the centre of the micromass.
As such, it would be difficult to quantify protein expression in these 3D cultures using HCI
strategies.
A
B
Fig. 2.10 – Formation of micromasses after 15 days of differentiation in SF medium supplemented with Activin A (30ng/ml). (A) Real-time qPCR analysis of chondrogenic marker gene expression in 15-day micromass
cultures established in SF media supplemented with Activin A (30ng/ml). Compared to the Activin A-treated SF
monolayer cultures, Col2a1 and Col10a expression levels were similar in both culture systems; however, Sox9
expression appeared to be higher in micromass cultures while Aggrecan expression was slightly inferior to that in
monolayer cultures. Transcript levels were compared to those in undifferentiated ESCs. Plotted values represent
means±SEM (n=2). (B) Bright field (i) and IF (ii) images of COL2A1 protein expression in micromass established
in SF media supplemented with Activin A (30ng/ml). COL2A1 network was visible at the periphery of the
micromass while the staining became blurred and out of focus towards the denser part of the structure, hence
highlighting the disadvantage of using 3D cultures in imaging applications.
COL2A1
DAPI/Hoechst
Col2a1 Sox9 Aggrecan Col10a
72
2.3.7 TGFβ3 induced chondrocyte formation when added at the onset of differentiation
Treatment of SF monolayer cultures with TGFβ3 (10ng/ml) (Fig. 2.11Ai-ii) or FGF8
(50ng/ml) (Fig. 2.11Aiii-iv) induced chondrogenic differentiation with evident COL2A1 network
formation beginning on day 7 of differentiation. However, cells cultured in FGF8 alone
exhibited poor cell-matrix adhesion similar to untreated SF cultures. Aside from COL2A1, both
FGF8- and TGFβ3-treated cultures also possessed SOX9-expressing populations (Fig. 2.11B).
TGFβ3 and FGF8 were not superior to Activin A in their chondrogenic inductive abilities.
Compared to Activin A-supplemented cultures, Sox9 and Col10a transcript expression only
increased minimally in TGFβ3- or FGF8-supplemented cultures, respectively (Fig. 2.11C).
COL2A1 protein was undetectable in BMP4-supplemented cultures treated with TGFβ3
or FGF8 beginning on day 5 of differentiation (Fig. 2.12Ai-ii). Despite its confirmed role as a
chondrogenic inducer, Activin A addition to BMP4-supplemented cultures failed to induce
COL2A1 or proteoglycans production (Fig. A.3A-B, respectively). These data suggest that
either BMP4 exerted a dominant chondrogenic inhibitory effect on my SF monolayer cultures, or
Activin A, TGFβ3 and FGF8 functioned early on during chondrogenic induction. Although
strong COL2A1 networks were formed in Activin A-supplemented cultures containing TGFβ3 or
FGF8 (Fig. 2.12Aiii-iv) and this result was corroborated by Alcian blue staining (Fig. 2.12B),
qPCR results indicate that TGFβ3 or FGF8 addition to Activin A-supplemented cultures did not
further enhance chondrogenic markers gene expression. Interestingly, the presence of TGFβ3 or
FGF8 in BMP4-supplemented cultures increased the gene expression of Col2a1, Sox9 and
Aggrecan (in the case of TGFβ3) compared to BMP4 alone (Fig. 2.12C).
73
A COL2A1
B SOX9
C
Fig. 2.11 – Supplementation of SF differentiating cultures with FGF8 or TGFβ3, beginning on day 0 of differentiation, was able to induce chondrogenic differentiation. (A) FGF8 (i-ii) and TGFβ3 (iii-iv) were also
found to induce COL2A1 expression when added alone to SF monolayer differentiation cultures. However, FGF8
cultures exhibited similar morphology as shown in Fig. 2.8D. (B) 11-day (i) FGF8- and (ii) TGFβ3-treated cultures
also consisted of SOX9-positive populations. (C) Compared to Activin A, TGFβ3 appeared to be more potent in
inducing Sox9 expression, while FGF8 further up-regulated Col10a transcript level. Transcript levels were compared to those in undifferentiated ESCs. Plotted values represent ratios of means±relative errors (n≥3).
COL2A1
DAPI/Hoechst
SOX9
DAPI/Hoechst
74
A
B
C
Fig. 2.12 – Supplementation of SF BMP4- or Activin A-treated differentiating cultures with FGF8 or TGFβ3 did not dramatically enhance chondrocyte formation. (A) When added as a potential enhancer to BMP4 (i-ii) or
Activin A (iii-iv), TGFβ3 and FGF8 did not have a noticeable effect on COL2A1 expression, as supported by Alcian blue staining (B). Interestingly, the addition of those two factors to BMP4-supplemented cultures markedly
improved Col2a1, Sox9 and Aggrecan expression from BMP4 addition alone. However, their effects were not as
pronounced in Activin A-supplemented cultures (C). Transcript levels were compared to those in undifferentiated
ESCs. Plotted values represent ratios of means±relative errors (n≥3).
COL2A1
DAPI/Hoechst
75
2.3.8 Five-day Activin A treatment achieved competitive chondrogenic differentiation in SF monolayer cultures
Since my data suggest that Activin A acts as an early inducer of chondrogenic
differentiation, I examined the feasibility of shortening the duration of supplementation. Robust
COL2A1 networks were present in 15-day SF monolayer cultures supplemented with Activin A
for the first five days of differentiation but not in BMP4 or Wnt3a cultures (Fig. 2.13Ai-iii).
Similarly, SOX9 protein expression was detected in Activin A-supplemented cultures (Fig.
2.13Bi); however, there appeared to be very weak SOX9 expression in Wnt3a-treated cultures
also (Fig. 2.13Biii). In terms of transcript levels, five-day Activin A supplementation led to
increased expression of Col2a1, Sox9, Aggrecan and Col10a compared to BMP4- and Wnt3a-
treated cultures (Fig. 2.13C).
I examined whether the non-inductive BMP4 (10ng/ml) and Wnt3a (100ng/ml) would
inhibit the progression of chondrogenic induction initiated by five-day Activin A
supplementation. IF data indicated that BMP4 or Wnt3a addition from day 5-15 of
differentiation to Activin A-supplemented cultures did not hinder COL2A1 network formation
(Fig. 2.14Ai-ii). The replacement of BMP4 or Wnt3a with TGFβ3 or FGF8 did not further
enhance COL2A1 protein expression in differentiation cultures initiated by Activin A (Fig.
2.14Aiii-iv). However, the presence of FGF8 or TGFβ3 in Activin A-supplemented cultures
increased Aggrecan expression, while those with TGFβ3 showed up-regulation in Sox9 and
Runx2 to a very small extent. FGF8 treatment also led to a marginal increase in Col10a
expression. Interestingly, addition of Wnt3a to Activin A-supplemented differentiation cultures
also marginally enhanced Sox9, Aggrecan and Runx2 expression, suggesting that Wnt3a may
play a minor role as a chondrogenic inducer (Fig. 2.14B). Similar to the results obtained from
76
cultures with continuous BMP4 supplementation, Activin A, TGFβ3 or FGF8 addition to
cultures with five-day BMP4 treatment did not induce COL2A1 expression (Fig. A.4).
A
B
C
Fig. 2.13 – Chondrogenic differentiation was achieved in SF monolayer cultures supplemented with Activin A from day 0-5 of differentiation. (A) IF images (200x) showed that (i) Activin A addition on the first five days of
differentiation was sufficient to generate COL2A1 networks in 15-day cultures, while (ii) BMP4 and (iii) Wnt3a
treatment failed to do so. (B) IF analyses (400x) also confirmed the expression of SOX9 in 11-day cultures
subjected to five-day Activin A supplementation while (ii) BMP4- and (iii) Wnt3a had faint to no positive staining.
(C) Real-time qPCR analyses of five-day supplementation cultures reflected similar up-regulation patterns in Col2a1, Sox9 and Aggrecan as 15-day supplementation cultures. Col10a transcript level was slightly increased in
cultures with five-day Activin A treatment, but Runx2 expression was unaffected. Transcript levels were compared
to those in undifferentiated ESCs. Plotted values represent means±SEM (n≥3).
COL2A1
DAPI/Hoechst
SOX9
DAPI/Hoechst
CO
L2
A1
S
OX
9
77
A
B
Fig. 2.14 – Sequential addition of growth factors did not lead to dramatically enhanced chondrogenic induction. (A) IF images (200x) of day 15 differentiation cultures supplemented with Activin A for the first five
days followed by 10-day addition of (i) BMP4, (ii) Wnt3a, (iii) FGF8 and (iv) TGFβ3 all showed similar extent of
COL2A1 network formation. (B) Real-time qPCR results suggested that culture supplemented with Activin A for
five days followed by BMP4 for 10 days did not have notable effect on chondrogenic induction. Replacement of
BMP4 with FGF8 caused a marginal increase in Aggrecan and Col10a expression, while addition of Wnt3a or
TGFβ3 facilitated slight increases in Sox9, Aggrecan and Runx2. Transcript levels were compared to those in
undifferentiated ESCs. Plotted values represent ratios of means±relative errors (n≥3).
COL2A1
DAPI/Hoechst
78
Fifteen-day cultures with continuous Activin A supplementation maintained higher
expression of Prg4 than those subjected to a five-day treatment regime (Fig. 2.15). Prg4 is
specifically expressed in chondrocytes located at the surface of articular cartilage. Replacement
of Activin A with TGFβ3 on day 5 of differentiation induced similar or higher Prg4 transcript
levels than Activin A alone, while the presence of FGF8 did not further promote Prg4 expression
regardless of the length of Activin A supplementation. Therefore, sustained Activin A
supplementation or the combination of Activin A and TGFβ3 appeared to facilitate articular
chondrocyte formation in my SF monolayer culture system.
Fig. 2.15 – Real-time qPCR analysis of Prg4 expression suggested that sustained
Activin A supplementation (“A”) or the
sequential addition of Activin A followed
by TGFβ3 (“T”) appeared to promote
articular chondrocyte formation. Transcript levels were compared to those in
undifferentiated ESCs. Plotted values
represent means±SEM (n≥3). Note:
“F”=FGF8.
2.3.9 High BMP4 concentration induced chondrogenic differentiation, while Wnt3a acted as a late chondrogenic inducer
To further investigate the role of BMP4 and Wnt3a in my SF monolayer chondrogenic
cultures, I differentiated ESCs in the presence of Wnt3a (100ng/ml) (for 15 days or five days)
followed by BMP4 (10ng/ml) (added from day 5-15 of culture) and in cultures supplemented by
the two growth factors in the reversed order. IF analyses of COL2A1 deposition confirmed that
Rela
tive E
xpre
ssio
n o
f P
rg4
79
Wnt3a was ineffective in chondrogenic induction when added on day 0 of differentiation, while
further addition of BMP4 exerted minimal effect on chondrogenic differentiation (Fig. 2.16Ai-
ii). Addition of Activin A, TGFβ3 or FGF8 to Wnt3a-supplemented cultures did not facilitate
COL2A1 network formation or proteoglycans production (Fig. A.5A-B), reinforcing their
described roles as early chondrogenic inducers. When the order of Wnt3a and BMP4
administration was reversed, however, COL2A1 networks were successfully formed (Fig.
2.16Aiii-iv). Compared to cultures supplemented with Wnt3a at the onset of differentiation,
treatment with BMP4 followed by Wnt3a led to enhanced expression of Col2a1 and Sox9 as well
as the late chondrogenic marker Col10a and the osteogenic transcription factor Runx2 (Fig.
2.16B), suggesting that Wnt3a acted as a late inducer of chondrogenesis in place of BMP4
(10ng/ml). Alcian blue staining was only present in cultures supplemented with BMP4 followed
by Wnt3a (Fig. 2.16Ciii-iv) albeit with less intensity than those present in chondrogenic cultures
induced by Activin A. The decreased proteoglycan deposition was also reflected in Aggrecan
transcript expression levels (Fig. 2.16B).
Contrary to published data establishing BMP4 as an inducer of ESC chondrogenesis
(Heng, Cao et al. 2004; van Osch, Brittberg et al. 2009; Vinatier, Mrugala et al. 2009), BMP4
(10ng/ml) did not have an appreciable effect on chondrogenic differentiation in my culture
system. To explain this disparity, I examined the concentration effect of BMP4 on my
monolayer differentiation cultures. With 25ng/ml of BMP4, robust COL2A1 networks were
evident regardless of the duration of supplementation (Fig. 2.17Ai-ii). Similar to Activin A,
addition of TGFβ3 or FGF8 to BMP4-supplemented cultures showed positive COL2A1 staining
as BMP4 alone (Fig. 2.17Aiii-iv, v-vi, respectively). Although overall transcript levels were
lower than those in Activin A-treated cultures, IF data were corroborated by qPCR (Fig. 2.17B).
Specifically, Aggrecan gene expression was similar to data obtained from cultures treated with
80
BMP4 (10ng/ml) followed by Wnt3a and was similarly reflected by Alcian blue staining (Fig.
2.17C). These findings confirm that Activin A (30ng/ml) and TGFβ3 (10ng/ml) are more
effective than BMP4 (25ng/ml) as early inducers of chondrogenesis.
A
B
C
Fig. 2.16 –Wnt3a acted as a late inducer to amplify the effect of BMP4 (10ng/ml). (A) Wnt3a addition at the
onset of differentiation did not lead to COL2A1 expression even with further addition of BMP4 (i-ii), but robust
networks were formed in BMP4 (10ng/ml) cultures supplemented with Wnt3a as a secondary factor (iii-iv) (200x).
(B) Compared to the treatment regime of adding Wnt3a (“W”) at the onset of differentiation followed by BMP4
(“B”), Wnt3a treatment of BMP4-treated cultures beginning on day 5 of differentiation led to increases in Col2a1,
Sox9, Col10a and Runx2 transcripts levels but not Aggrecan, regardless of the duration of BMP4 supplementation.
“F1”=factor added at the onset of differentiation. Transcript levels were compared to those in undifferentiated
ESCs. Plotted values represent ratios of means±SEM (n≥3). (C) Alcian blue staining reinforced the observation that Wnt3a acted as a late inducer of chondrogenesis.
COL2A1
DAPI/Hoechst
81
A
B
C
Fig. 2.17 –BMP4 (25ng/ml) acted as an early inducer of chondrogenesis. (A) BMP4 acted as an early
chondrogenic inducer with robust COL2A1 network formation regardless of a 15-day (i, iii, v) or five-day (ii, iv, vi)
supplementation regime. Further addition of (iii-iv) TGFβ3 or (v-vi) FGF8 did not have noticeable enhancing effect
on COL2A1 network formation (200x). (B) qPCR analysis showed slight increases in Col2a1 and Sox9 in five-day
BMP4 (“25B”) cultures compared to a 15-day treatment schedule. Additional treatment with TGFβ3 or FGF8 did not have significant enhancing effects on chondrogenic markers expression. Transcript levels were compared to
those in undifferentiated ESCs. Plotted values represent means±SEM (n≥3). (C) Alcian blue staining confirmed the production of proteoglycans in cultures with BMP4 under both (i-iii) 15-day and (iv-vi) five-day supplementation
schedules. Presence of TGFβ3 (ii, v) and FGF8 (iii, vi) did not lead to increased proteoglycan production. Staining
intensity in BMP4 (25ng/ml) cultures was weaker than those supplemented with Activin A.
COL2A1
DAPI/Hoechst
82
2.4 Discussion
In this study, I examined if long-term treatment of mESC SF monolayer cultures with
BMP4, Activin A, Wnt3a, TGFβ3 and FGF8 at the onset of differentiation could direct
chondrogenic differentiation with minimal culture manipulation.
ECM selection was crucial as two-day LIF-supplemented SF ESC cultures established on
gelatin+fibronectin exhibited accelerated differentiation with 5-10% lower OCT4 levels
compared to cultures on gelatin or collagen IV (Fig. 2.1A- B). The bimodal OCT4 expression
profile was commonly observed in other HCI assays established on gelatin+fibronectin (Davey
and Zandstra 2006; Walker, Ohishi et al. 2007). Although fibronectin is endogenously expressed
by differentiating ESCs (Hayashi, Furue et al. 2007) and promotes cell adhesion and spreading
(Dufour, Duband et al. 1986), I rejected gelatin+fibronectin for my system to minimize
spontaneous ESC differentiation towards undesired lineages in the absence of inductive factors.
Gelatin, being a mixture of collagens, was less defined than collagen IV, and collagen IV has
been shown to facilitate ESC differentiation towards the mesodermal lineages (Nishikawa,
Nishikawa et al. 1998; Tada, Era et al. 2005; Sakurai, Era et al. 2006). Despite the successful
establishment of adherent chondrocyte cultures on fibronectin or collagen (Ho, Yang et al. 2009;
Khan, Bishop et al. 2009), gelatin+fibronectin cultures did not show enhanced BRACHYURY or
chondrogenic markers expression compared to collagen IV cultures (data not shown).
Similar to published EB studies (Nostro, Cheng et al. 2008), BMP4, Activin A and
Wnt3a all induced FLK1 (Fig. 2.3A-B) and BRACHYURY expression (Figs. 2.5 and 2.6A) in
my four-day monolayer differentiation cultures. Activin A- or Wnt3a-treated cultures consisted
of flattened colonies with stronger adhesion and spreading on collagen IV than with BMP4 (Fig.
83
2.2). Conversely, there was ~6-8% more of ANNEXIN V+ apoptotic cells present in BMP4
cultures than in Wnt3a and Activin A cultures (Fig. 2.3C). Activation of the TGFβ signaling
pathway induces EMT, leading to the up-regulation of Neural cell adhesion molecule (NCAM)
(Thiery and Sleeman 2006). NCAM promotes the phosphorylation of Focal adhesion kinase
(FAK) and integrin-dependent cell spreading (Frame and Inman 2008). FAK phosphorylation
alters its downstream target Growth factor receptor-bound protein 2 (GRB2) and facilitates its
interaction with the Ras/Mitogen-activated protein kinase (MAPK) pathway, which modulates
cell survival and proliferation (Schlaepfer, Hanks et al. 1994; Harburger and Calderwood 2009).
Members of the canonical Wnt and integrin signaling pathways (specifically the collagen-
binding integrins α1β1 and α2β1) have been shown to act synergistically via GRB2, (Crampton,
Wu et al. 2009), possibly contributing to the satisfactory cell spreading and survival observed in
Wnt3a-supplemented cultures. The non-uniform morphology of differentiating colonies in BMP4
culture (Fig. 2.2Aiv) could be due to the potency of BMP4 at 10ng/ml as the cultures also
showed weaker BRACHYURY protein expression (Fig. 2.5iv); consequently, serum-deprivation
promoted apoptosis in the slowly differentiating cells. Alternatively, although BMP4 (10ng/ml)
was less potent than Activin A or Wnt3a in EMT initiation and mesoderm induction, its presence
may be sufficient to prevent neuroectoderm differentiation in my culture system by inducing
apoptosis in early precursors of neural cells (Gambaro, Aberdam et al. 2006).
Up-regulation of endogenous Wnt3a in both four-day untreated and BMP4-supplemented
monolayer differentiation cultures (Fig. 2.4C) suggested possible crosstalk between BMP4 and
Wnt3a. Recently, exogenous BMP4 was found to cause increases in Wnt3a levels in a similar
monolayer differentiation system and both signaling pathways functioned synergistically to
induce different mesoderm populations (Tanaka, Jokubaitis et al. 2009). Components in the
N2B27 medium may also induce Wnt3a expression that contributed to the seemingly pan-
84
mesodermal inductive ability of the Wnt3a ligand (Fig. 2.7). However, qPCR data from 15-day
cultures showed that exogenous Wnt3a was less inductive than Activin A in the expression of the
anterior cardiac markers α Myosin heavy chain (αMHC) and NK2 transcription factor related,
locus 5 (Drosophila) (Nkx2.5) (Fig. A.6i-ii and A.7i-ii) while it promoted the expression of the
posterior hematopoietic marker GATA1 (Fig. A.6iii and A.7iii). The data was consistent with
reports showing that WNT3a inhibited cardiomyocyte differentiation upon mesoderm induction
(Naito, Shiojima et al. 2006; Ueno, Weidinger et al. 2007). My SF monolayer differentiation
system did not appear to support the formation of definitive endoderm (Fig. A.6iv and A.7iv).
Posterior and anterior mesodermal populations were enriched without cell sorting in
growth factor-supplemented SF monolayer cultures. Similar to EB studies (Gadue, Huber et al.
2006), there were clear increases in posterior mesoderm marker genes expression (Evx1, HoxB1,
Tal1 and GATA2) in BMP4-supplemented cultures compared to Activin A-supplemented
cultures (Fig. 2.7i-iv), while the mesendoderm markers Gsc and Foxa2 exhibited the opposite
expression patterns (Fig. 2.7x-xi). This distinction was not as definitive in the expression of
paraxial mesoderm marker genes like Fst and Mesp2 (Fig. 2.7viii-ix). This phenomenon was
expected because lateral plate and paraxial mesoderm form adjacent to each other in
development with some overlapping of gene expression patterns. Similarly, although Lhx1 has
been identified as a marker for lateral plate mesoderm (Tam and Loebel 2007) and I anticipated
higher Lhx1 expression in BMP4-treated cultures than in Activin A cultures, I observed
comparable Lhx1 up-regulation in Activin A-, BMP4- and Wnt3a-supplemented cultures (Fig.
2.7v). This was logical because Lhx1 is a known target of the Nodal signaling pathway (Shen
2007) and is also expressed in lateral-intermediate mesoderm, anterior mesendoderm and
visceral endoderm (Shawlot, Wakamiya et al. 1999; Tsang, Shawlot et al. 2000; Tam, Khoo et al.
2004). In contrast, despite the use of Pdgfrα to characterize ESC-derived paraxial mesoderm
85
(Sakurai, Era et al. 2006; Sakurai, Okawa et al. 2008) and reports showing that Pdgfrα
expression was induced by NODAL activation (Takenaga, Fukumoto et al. 2007) in ESC
cultures cultured established on collagen IV (Sakurai, Era et al. 2006), Pdgfrα up-regulation was
more responsive to exogenous BMP4 and Wnt3a than Activin A in my culture system (Fig.
2.7vi). Indeed, BMP4 has also been shown to induce Pdgfrα in ESCs (Sakurai, Inami et al.
2009; Tanaka, Jokubaitis et al. 2009) and such a reversed expression pattern has been observed
in monolayer cultures of differentiating hESCs (Lee, Peerani et al. 2009).
R1 ESCs have been shown to have poor chondrogenic differentiation capabilities in EB
studies (Kramer, Hegert et al. 2005). Although Activin A has been shown to be both an inducer
(Jiang, Yi et al. 1993) and an inhibitor (Chen, Yu et al. 1993) of chondrogenic differentiation in
limb bud mesodermal cells, I showed that Activin A induced chondrocyte formation in my R1
SF monolayer cultures with intense Alcian blue staining (Fig. 2.8A), robust COL2A1 network
formation (Fig. 2.8C), detection of SOX9 protein expression (Fig. 2.8D) and marked up-
regulation of Col2a1, Sox9 and Aggrecan expression (Fig. 2.9A-C). TGFβ3-supplemented
cultures achieved comparable chondrogenic differentiation as Activin A (Fig. 2.11Aiii-iv, Bii-C),
validating that TGFβ is required at the initial stages of chondrogenesis (Nakayama, Duryea et al.
2003; Kawaguchi, Mee et al. 2005; Diekman, Rowland et al. 2010). Although FGF8 was shown
to induce chondrogenesis (Abzhanov and Tabin 2004; Bobick, Thornhill et al. 2007; Yu and
Ornitz 2008), it could not be used alone in my culture system because of poor cell-matrix
attachment. This finding is consistent with the role of FGF8 in anchorage-independent cell
growth and survival through interaction with the adaptor protein called crk-like protein (Seo,
Suenaga et al. 2009). Neither TGFβ3 nor FGF8 compensated for the non-inductive effect of
BMP4 (10ng/ml) or further enhanced the progress of chondrocyte formation initiated by Activin
86
A when they were added from day 5-15 of differentiation (Fig. 2.12A-C), reinforcing the stage-
specific nature of TGFβ- and FGF-modulated chondrogenic induction.
I demonstrated that five-day supplementation of Activin A was sufficient to induce
chondrogenesis in 15-day monolayer cultures (Fig. 2.13A-C), suggesting that ESCs acquired the
capacity to become chondrocytes within the first five days of differentiation in Activin A-
supplemented cultures. BMP4 has been shown to induce ESC chondrogenic differentiation
(Kramer, Hegert et al. 2000), and developing chondrocytes appear to undergo a BMP-dependent
stage after initiation by TGFβ in vivo (Nakayama, Duryea et al. 2003). I achieved BMP4-
induced chondrogenic differentiation only when BMP4 concentration increased from 10ng/ml to
25ng/ml, with robust COL2A1 network formation (Fig. 2.17Ai-ii) and Sox9 up-regulation (Fig.
2.17B), indicating that BMP4 also acted as an early inducer. However, BMP4 failed to up-
regulate Aggrecan expression significantly when compared to Activin A-supplemented cultures.
Also, prolonged exposure to BMP4 (25ng/ml) led to marginally lower transcript levels of Col2a1
and Sox9 but slightly higher Runx2 expression compared to cultures with five-day BMP4
treatment (Fig. 2.17B). Activation of canonical Wnt signaling in nascent chondrocytes has been
shown to block downstream chondrocyte development (Akiyama, Lyons et al. 2004). Limb-bud
and ESCs studies have concluded that WNT3a is required during late-stage chondrocyte
maturation, hypertrophy and mineralization (Enomoto-Iwamoto, Kitagaki et al. 2002; Kitagaki,
Iwamoto et al. 2003; Tamamura, Otani et al. 2005; Davis and Zur Nieden 2008). Similarly, early
Wnt3a treatment of my monolayer differentiation system generated mesoderm progenitors but
did not promote chondrocyte formation. However, delayed Wnt3a supplementation of
differentiation cultures initialized by Activin A slightly enhanced Sox9, Aggrecan and Runx2
expression (Fig. 2.14B), while Wnt3a treatment of BMP4 (10ng/ml)-supplemented cultures
resulted in robust COL2A1 network formation, superior expression of Col2a1, Sox9, Col10a and
87
Runx2, and more intense Alcian blue staining than in BMP4 alone (Fig. 2.16A-C). Since Wnt3a
treatment of BMP4- and Activin A-supplemented cultures appeared to up-regulate early and late
chondrogenic markers, respectively, Wnt3a may have a compensatory pro-chondrogenic role in
BMP4-containing cultures, while it promoted chondrocyte maturation in cells already induced by
Activin A.
In short, I have established a differentiation protocol for the SF monolayer derivation of
ESC-derived chondrocytes. In my culture system, Activin A, BMP4 and TGFβ3 acted as early
inducers of chondrogenesis while Wnt3a exerted its pro-chondrogenic effect only after
mesoderm specification (Fig. 2.18).
Fig. 2.18 – Schematic of my SF monolayer chondrogenic differentiation strategy. Supplementation of ESC
cultures with BMP4 (10ng/ml), Activin A (30ng/ml) or Wnt3a (100ng/ml) on day 0 of differentiation (dark blue
thunderbolt) successfully induced mesoderm progenitors. Expression levels of mesoderm markers in SF monolayer
cultures were in agreement with the notion that BMP4 and Wnt3a induced more posterior populations of mesoderm
(PM) while Activin A induced anterior mesoderm subsets (AM). Prolonged supplementation with Activin A,
TGFβ3 (10ng/ml) or an increased concentration of BMP4 (25ng/ml) (yellow thunderbolts) could induce chondrogenic differentiation after 15 days of culture. However, chondrogenic induction was not compromised when
the duration of supplementation was shortened to five days (green arrows). Wnt3a was found to be a late inducer of
chondrogenesis, and TGFβ3 could replace Activin A on day 5 of differentiation to promote the formation of
articular cartilage (light blue thunderbolts).
88
2.5 Potential uses of 2D culture system in HTS/HCI applications
I developed my SF monolayer chondrogenic differentiation protocol such that it could be
adopted in the establishment of HTS assays to be used in examining the effect of candidate
molecules on chondrocyte formation from ESCs. By defining the seeding density based on
culture area, one could easily scale-down my culture system (e.g. from 24-well format to 96-well
format) to facilitate screening in a high-throughput manner. To set up the differentiation assay as
a baseline tool for a screen, one can induce chondrogenic differentiation by adding Activin A
(30ng/ml) at the onset of differentiation and withdraw it after five days of differentiation. To test
the efficacy of candidate molecules in a primary drug screen, they can be added at varying time
points and concentrations during the 15 days of culture to determine the optimal conditions for
chondrogenic induction. The order in which combinations of molecules will be added can also
be a test parameter. A suitable readout for HCI-based HTS will be fluorescence intensity based
on IF analyses of protein expression of chondrogenic markers such as COL2A1 and/or SOX9
(Fig. 2.19). To avoid the formation of terminally differentiated ESC-derived chondrocytes,
similar IF-based analyses can also be conducted for hypertrophic chondrocyte markers such as
COL10A and RUNX2.
To move towards the identification of an actual therapeutic that can be used clinically,
one has to translate the results obtained from a system that is based on embryonic development
into the context of an adult. Indeed, MSCs that participate in embryonic development (e.g. limb
formation) may not behave the same way as MSCs that play a role such as wound healing in the
adult body. Amputated limbs of neonatal mice could be partially regenerated when limb buds of
mouse embryos were grafted to the limb stump (Masaki and Ide 2007). However,
transplantation of adult MSCs into damaged cartilage tends to lead to the formation of scar
89
tissues such as fibrocartilage. In addition, it has been determined that the earliest transient
population of MSCs that arose during embryogenesis was actually derived from neuroepithelium
and neural crest, only to be replaced by MSCs derived from other sources such as the bone
marrow (Takashima, Era et al. 2007). As such, it is possible that the effect of exogenous
reagents on ESC-derived chondrocytes differ from that on adult chondrocytes; however, one can
test for the expression of marker genes that may play similar roles in both embryonic
chondrocytes and in adult articular chondrocytes. For example, one can establish a secondary
screen to identify agents that will induce the expression of GDF5 and ERG. GDF5 has been
shown to promote cell adhesion during mesenchymal condensation and proliferation of
chondrocytes in growth plate cartilage (Francis-West, Abdelfattah et al. 1999; Buxton, Edwards
et al. 2001). GDF5 is also found to be a potent inducer of Erg, which is a transcription factor
expressed in articular chondrocytes of the developing synovial joint. In fact, the over-expression
of ERG was found to maintain chondrocytes in an immature, articular-like state both in vivo
(Iwamoto, Tamamura et al. 2007) and in vitro (Iwamoto, Koyama et al. 2005). Therefore, the
use of therapeutics to induce GDF5 and ERG expression in damaged articular cartilage may
contribute to its regeneration and restoration of joint function.
As shown by the results presented in this chapter, the most robust readout from my
chondrocyte differentiation assay was COL2A1 expression. However, the quantification of
COL2A1 protein network using screening platforms such as the Cellomics ArrayScan® would
not be as straight-forward as the quantification of cells that express COL2A1. The need to
identify COL2A1+ cells prompted me to design a reporter construct that could be incorporated
into ESCs to generate a transgenic cell line to be used in my differentiation assay. The assembly
of this reporter system is discussed in Chapter 3.
90
Fig. 2.19 – Schematic diagram depicting the set up of a molecule screen by establishing the ESC-derived
chondrocyte cultures using my SF monolayer differentiation system.
91
Chapter 3 Generation of a bi-colour fluorescent reporter mESC line for
potential chondrocyte-specific fate mapping and drug screen applications
3.1 Overview
The derivation of media formulations and inductive culture environments that drive
controlled differentiation of ESCs is often coupled with genetic manipulation of the cells to
allow for the identification and isolation of desired cell types. As mentioned in Section 1.6,
faithful expression of reporters, such as fluorescent proteins, β-galactosidase or luciferase, under
the transcriptional control of genes of interest in these transgenic ESCs facilitates the
visualization of gene expression patterns; therefore, they are used regularly in chimeric studies
for lineage mapping and mutagenesis. For example, the BRACHYURY:GFP ESC line (Fehling,
Lacaud et al. 2003) is widely used in in vitro and in vivo differentiation studies involving
mesodermal derivatives. This cell line has also been modified with the addition of human CD4
knocked into the Foxa2 locus, and it was used in the development of an in vitro primitive streak
model where distinct populations of cells were identified based on the expression levels of GFP
and CD4 (Gadue, Huber et al. 2006).
To have further control on the timing of reporter markers expression, conditional
mutagenesis using SSR strategy such as the Cre/loxP system is frequently employed in fate
mapping studies. The targeting of reporters to specific loci of interest is an efficient method of
tracking gene expression in vitro and in vivo; however, the abolishment of one of the alleles, as is
the case for the BRACHYURY:GFP line, causes haploinsufficiency and hence does not
92
recapitulate wild-type expression of the genes of interest and can affect ESC cell fate. As a
result, it may be beneficial to devise another reporter system that does not disrupt endogenous
protein expression.
As outlined in Section 1.7, I designed and created components of a versatile Cre/loxP
recombinase system-based transgenic cell line that can be used for any maker gene of interest
with minimal modifications required. A Rosa26 locus-targeted, Cre-inducible R1 ESC line
(EST2B) that changes from being puromycin resistant to expressing DsRedT3 and conferring
blasticidin resistance upon Cre excision was previously created in our laboratory (Fig. 3.1)
(Handy 2005). The Cre-inducible construct was targeted to the Rosa26 locus because gene
trapping studies have confirmed that reporter gene targeted to the Rosa26 locus exhibited
ubiquitious expression during embryonic development (Friedrich and Soriano 1991;
Zambrowicz, Imamoto et al. 1997). Therefore, the EST2B cells would be ideal for fate mapping
studies because upon transgene activation, all the progeny of the trasgene-expressing cells would
express the same reporter, allowing them to be tracked both in vitro and in vivo. The MultiSite
Gateway® cloning platform (Invitrogen) was used to assemble the Cre-expressing construct T2A
under the transcriptional control of a Col2a1 promoter. The incorporation of T2A into EST2B
cells results in the creation of the EST2 ESC line that could be used to monitor the progression of
ESC chondrogenic differentiation. While it was unnecessary for me to design such an elaborate
two-step system for the identification of COL2A1+ cells in my differentiation cultures, the
derivation of the EST2 line could be used to test the feasibility of using such a tissue-specific,
Cre-inducible construct system to fate map any transient population of choice. In the case of
chondrogenic differentiation, the emergence of Venus+DsRed T3
+ cells would signify the
expression of COL2A1. As the cells continue to differentiate, the loss of the double-positive
population and the generation of Venus- DsRed T3
+ (i.e., YFP
-RFP
+) cells would suggest that the
93
cells may have stopped the production of COL2A1 and have begun the terminal differentiation
program whereby they would undergo hypertrophy and eventually become calcified.
Fig. 3.1 – Schematic diagram of the targeted insertion of Cre-inducible vector T2B into the Rosa26 locus. T2B
consists of a floxed PuroR and polyadenylation (pA) signal, followed by the DsRedT3 RFP and BlastR. Upon Cre
excision, the ubiquitous CAGGS promoter (a chicken β-actin promoter coupled with a cytomegalovirus enhancer element (Niwa, Yamamura et al. 1991)) drives the constitutive expression of DsRedT3 and BlastR, allowing the
treated transgenic ESCs to remain RFP+ and blasticidin resistant.
3.2 Materials and Methods
3.2.1 Differentiation of EST2B cells
EST2B cells were subcultured twice on gelatinized tissue culture plastic to deplete MEFs.
At the onset of differentiation, cells were trypsinized and seeded onto 6-well low cluster plates
(Costar) for EB induction. EBs were cultured in ES media without LIF (ES differentiation
medium) for 10 days, with medium addition (50% of total volume) and passaging (1:2 ratio)
taking place on alternating days. EST2B cells were also differentiated into cells of the three
germ layers to verify their pluripotency. For seven-day ectodermal differentiation cultures,
104cells/cm
2 were seeded onto gelatinized tissue culture plastic and induced to form neural cells
in N2B27 medium containing retinoic acid (Ying, Stavridis et al. 2003). For cardiomyocyte
differentiation, day 3 EBs were plated onto gelatin-coated tissue culture plastic and cultured for
94
another six to nine days in ES differentiation medium. Endoderm differentiation was achieved
by initiating EB formation with 4x104cells/cm
2 in SF medium developed in (Gouon-Evans,
Boussemart et al. 2006), consisting of I-MDM (75%), Ham’s F12 medium (25%), N2 and B27
supplements (0.5x each), penicillin/streptomycin (1%), BSA (0.05%), GlutaMAX™-1 (2mM),
ascorbic acid (0.5mM, Sigma) and monothioglycerol (4.5x104M, Sigma). Day 2 EBs were
cultured for an additional four days in the presence of Activin A (50ng/ml).
3.2.2 Transient transfection of T2A plasmid into HEK 293T cells
Human embryonic kidney (HEK 293T) cells (Graham, Smiley et al. 1977) were thawed
onto non-coated tissue culture-treated 6-well plate (Greiner Bio-One) and cultured in media
containing D-MEM (89%), FBS (10%) and penicillin/streptomycin (1%) until 70% confluency.
A mixture of human Sox9 cDNA (~1.5µg, gift from Dr. T. Michael Underhill) and the four-way
Gateway® expression clone (~1.5µg) was diluted with NaCl (200µl at 150mM). ExGen 500 in
vitro Transfection Reagent (10µl, Fermentas) was added to the DNA/NaCl mixture and
incubated for 10min. at room temperature. The DNA/NaCl/ExGen 500 transfection mixture was
added to one well of HEK 293T cells and the plate was rocked back and forth until the reagent
was evenly distributed within the culture media. Transfected culture was incubated for 48hrs.
prior to examination. As a positive control, HEK 293T cells were co-transfected with Sox9
cDNA and the Col2a1-eYFP plasmid (gift from Dr. T. Michael Underhill), while HEK 293T
cells transfected with the Col2a1 promoter-driven plasmids alone acted as negative controls.
3.2.3 Generation of stable transgenic EST2 line
T2A targeting vector was linearized by overnight digestion with XhoI or PmeI and
purified by ethanol precipitation. Dissociated EST2B cells were resuspended at a concentration
of 107cells/800µl ice-cold EmbryoMax® ES cell qualified electroporation buffer (Millipore).
95
Linearized T2A plasmid (20µg) in sterile water was combined with cells (800µl) in a 4mm
cuvette (VWR). Electroporation was carried out using the GenePulserXcell™ system (BIO-
RAD) at 250V, 500µF capacitance and ∞ Ω resistance. Twenty-four hours post-electroporation,
the transfected cells underwent antibiotic selection for nine days using puromycin (2µg/ml,
Invitrogen) and G418 (150-170µg/ml, Invitrogen), after which resistant clones were isolated and
expanded in culture.
3.2.4 Validation of targeting to the Rosa26 locus via PCR
For verification of targeted insertion of the T2B transgene into the Rosa26 locus, Expand
Long Range dNTPack PCR kit (Roche) was used to amplify the 5kb product spanning the 3’
insertion site. Genomic DNA (250ng) isolated from EST2B cells was used as template in a
reaction mixture (25µl) consisting of 5x buffer (5µl) with MgCl2 (12.5mM), PCR nucleotide
mix (1.25µl), dimethyl sulfoxide (DMSO, 3µl), forward and reverse primers (0.4µM), enzyme
mix (0.35µl) and DNase/RNase-free water. Long PCR conditions were: 94oC for 2min. followed
by 10 cycles (94oC for 10s, 61
oC for 15s and 68
oC for 5s), then 25 cycles (94
oC for 10s, 61
oC for
15s and 68oC for 5min.+20s/cycle), and lastly 68
oC for 7min. Targeting PCR for the 5’ insertion
site was performed using Phusion™ high fidelity DNA polymerase (Finnzymes). Reactions were
performed in 20µl volumes and contained 5x GC buffer (4µl), 5x Q-solution (4µl, Qiagen),
10mM dNTP (0.4µl), DMSO (3%) and DNA polymerase (0.2µl), along with genomic DNA
template (50-100ng), forward and reverse primers (0.5µM) as well as DNase/RNase-free water.
PCR conditions were: 98oC for 2.5min., 35 cycles (98
oC for 10s, 67
oC for 30s and 72
oC for 75s)
then 72oC for 10min.
96
3.2.5 PCR
Reverse transcriptase PCR (RT-PCR) was performed in 20µl volumes consisting of
cDNA (see Section 2.2.7), Taq DNA polymerase (0.1µl), 10x reaction buffer (2µl), dNTP mix
(0.4µl from 10mM stock), MgCl2 (0.6µl from 50mM stock) and forward and reverse primers
(0.5µM) as well as DNase/RNase-free water (all from Invitrogen). PCR primer sequences are
listed in Table B.1 in Appendix B. Reaction conditions were 94oC for 3min., 30 cycles (94
oC for
45s, 60oC for 30s and 72
oC for 1.5min.) then 72
oC for 10min.
For the amplification of cloning fragments, PCR was performed in multiples of 50µl
volumes containing Phusion Taq (0.5µl, Finnzymes), 5x HF buffer (10µl, Finnzymes), dNTP
mix (1µl from 10mM stock, Fermentas), forward and reverse primers (2.5µl each, 0.5µM), and
DNase/RNase-free water. Reaction conditions were 98oC for 30s, 35 cycles (98
oC for 10s, 55
oC
for 30s and 72oC for 1min.) then 72
oC for 10min.
3.2.6 Immunostaining
Cells cultured in monolayer were fixed with formaldehyde (3.7%) for 20min. at room
temperature and washed with PBS with Ca2+
/ Mg2+
. They were then permeabilized with Triton
X-100 (0.1%) in BSA, (0.1%) for 20min. at room temperature. Cells were blocked with Difco™
skim milk (5%) or FBS (10%) overnight at 4oC. Cells were stained with primary antibody
(1:1000 dilution) overnight at 4oC, followed by incubation with the secondary antibody
(Molecular Probes AlexaFluor antibodies) (1:1000 dilution) for 1hr. in the dark and with DAPI
or Hoechst nuclei stain at 1:10,000 dilution for 15min. at room temperature. For
immunostaining of EBs, paraformaldehyde (4%, Sigma) was used to fix the cells for 30min.
followed by permeabilization using Triton X-100 (0.25%) for 30min. at room temperature. The
EBs were blocked with BSA (3%) overnight at 4oC and stained accordingly. Primary antibodies
97
used: mouse monoclonal anti-NESTIN (1:1000 dilution, Abcam), MF20 (1:1000 dilution,
Hybridoma Bank), mouse monoclonal anti-human/mouse α-fetoprotein (AFP) antibody (1:1000
dilution, R&D) and mouse monoclonal anti-Cre (1:200, Sigma).
3.2.7 Ethanol precipitation
Sodium acetate (0.1x volume at 3M) and anhydrous ethanol (2.5x volume, Sigma) were
added to the DNA sample. Sample was allowed to precipitate at -30oC overnight, and it was
centrifuged at 4oC for 30min. at 16,000xg. The supernatant was discarded and the DNA pellet
was washed with ethanol (70%) for 5min. at room temperature, after which it was centrifuged for
5min. at 16,000xg at room temperature. After discarding the supernatant, the pellet was air-dried
and eluted in Tris-EDTA buffer.
3.2.8 Transformation
DH5α competent cells were thawed on ice. For every 50µl of competent cells, plasmid
DNA (25ng) was added to it in a volume not exceeding 5% of the volume of cells. The plasmid
DNA and cells were gently mixed with manual pipetting, after which it was incubated on ice for
30min. Cells underwent heat shock treatment for 90s at 42oC and were immediately transferred
back on ice for 2min. SOC medium (800µl, Invitrogen) was added to the cells and the culture
was incubated in a shaking incubator for 45min. at 37oC. Up to 200µl of the recovered culture
was transferred to LB agar (Lennox L Agar, Invitrogen) containing the appropriate antibiotic.
3.2.9 Directional cloning of NLS-Cre and SV40pA into pBlueScript
Sequence encoding Cre recombinase preceded by a nuclear localization signal (NLS-Cre)
was PCR-amplified from the plasmid pML78 using the forward primer:
attagcggccgcatggggacaacttttctatacaaagttacatgggcccaaagaagaagagaaagg and the reverse primer:
actggaattcatactaatcgccatcttccagcaggcgcaccattgc, which inserted the NotI and attB4r sites to the 5’
98
end of NLS-Cre and EcoRI site on the 3’ end of the product. SV40pA was PCR-amplified from
pIRESPuro3 (Clontech) using the forward primer: acgtatgaattcatctagataactgatcataatcagc and the
reverse primer: acgtataagcttggggacaactttattatacaaagttgtactaagatacattgatgagtttggac. As a result,
the EcoRI site was added to the 5’ end and attB3r as well as HindIII sites were inserted into the
3’ end of SV40pA. PCR products were resolved in agarose gel and were isolated using
NucleoSpin® Extract II kit (Macherey-Nagel). They were then ethanol-precipitated and digested
with NotI and EcoRI, resolved in agarose gel (2%) and purified using the NucleoSpin® Extract
II kit. The cloning plasmid pBlueScript II KS(-) was digested with the same restriction enzymes
and purified with PEG8000 (Invitrogen). Briefly, the restriction digest was mixed with Tris-
EDTA buffer (3x volume) and PEG8000 (2x volume). Solution was centrifuged at 10,000xg for
15min. at room temperature. The resulting pellet was air-dried after the removal of the
supernatant and dissolved in Tris-EDTA buffer. The linearized backbone was dephosphorylated
with shrimp alkaline phosphatase (SAP, Fermentas) (0.1x volume of 10x SAP buffer with 1µl of
SAP; incubated at 37oC for 1hr. followed by enzyme inactivation at 65
oC for 15min.). The NLS-
Cre fragment was cloned into pBlueScript using T4 DNA ligase (Invitrogen) with 1hr.
incubation at room temperature. The ligation mixture was transformed into DH5α and
propagated in the presence of ampicillin (75µg/ml, Sigma), and ampicillin-resistant colonies
were cultured in liquid Luria Broth (LB, Miller’s LB broth base®, Invitrogen) overnight.
Plasmid DNA was isolated using NucleoSpin® Plasmid kit (Macherey-Nagel), and restriction
digests were performed followed by sequencing to identify the clones with the correct insertion.
The procedure was repeated for the insertion of SV40pA into the NLS-Cre-containing
pBlueScript via EcoRI and HindIII.
99
3.2.10 Gateway® cloning
PCR products used in BP reaction were resolved in agarose gel (1%) and the fragments
were excised and purified using either PureLink™ Quick Gel Extraction kit (Invitrogen) or
NucleoSpin® Extract II kit. Purified PCR product was concentrated via ethanol precipitation.
BP reaction mixture consisted of the attB PCR product and pDONR™ vector at a molar ratio of
6:1 to 8:1, and the reaction volume was comprised of 1-7µl of PCR product and 1µl of
pDONR™ vector. The reaction mixture was topped up to 8µl with Tris-EDTA buffer, after
which BP Clonase® II enzyme mix (2µl, Invitrogen) was added. The reaction mixture was
incubated at 25oC for 1hr., followed by the addition of Proteinase K solution (1µl, Invitrogen)
and incubation for 10min. at 37oC. BP reaction was transformed into DH5α and cultured on LB
agar in the presence of kanamycin (25µg/ml, Sigma), and antibiotic resistant clones were isolated
and tested via restriction digests and sequencing.
pENTR L1-R5 5x48 Col2a1 – 5x48 Col2a1 promoter was PCR-amplified from pGL3(4x48) (as
referenced in (Weston, Sampaio et al. 2003), a gift from Dr. T. Michael Underhill) using the
forward primer: ggggacaagtttgtacaaaaaagcaggctcatcgataggtaccgagctcttacgcg and the reverse
primer: ggggacaacttttgtatacaaagttgtaccggaatgccaagctttctgcgtc, which added the attB1 and attB5r
sites on the 5’ and 3’ ends of the PCR product, respectively.
pENTR R4-R3 NLS-Cre SV40pA – The entire attB4r-NLS-Cre SV40pA-attB3r insert was
PCR amplified from the modified pBlueScript (described in Section 3.2.8) using the forward
primer: ggggacaacttttctatacaaagttgacatgggcccaaagaagaagagaaagg and the reverse primer:
ggggacaactttattatacaaagttgttaagatacattgatgagtttggac.
To perform four-fragment MultiSite Gateway® cloning, the entry vectors were
transformed into DH5α and the destination vector into One Shot® ccdB Survival™ 2 T1 Phage
100
Resistant (T1R) competent cells (Invitrogen). Cells were propagated overnight in LB (100ml)
with (1) kanamycin for entry vectors and (2) ampicillin for destination vector. Plasmid DNA
was isolated from the liquid culture using PureLink™ HiPure Plasmid Maxiprep Kit (Invitrogen)
and eluted in Tris-EDTA buffer. LR reaction mixture contained the entry vectors (10fmoles
each) and the destination vector (20fmoles). The reaction volume was topped up to 8µl with
Tris-EDTA buffer and LR Clonase® II Plus enzyme mix (2µl, Invitrogen) was added to the
reaction. The reaction mixture was incubated for 16hrs. at 25oC. Similar to the BP reactions, the
reaction mixture was then treated with Proteinase K solution (1µl), transformed into DH5α and
cultured on LB agar treated with ampicillin, after which antibiotic resistant clones were isolated
and tested via restriction digests and sequencing.
3.3 Results
3.3.1 Validation of EST2B clones
Previously, flow cytometry analysis has shown that EST2B cells expressed DsRedT3
upon Cre excision, and it was also demonstrated that they were blasticidin resistant (Handy
2005). However, the targeted insertion of T2B into the Rosa26 locus was not conclusively
shown by southern hybridization. Therefore, genomic PCR amplification of the targeted regions
in the Rosa26 locus was performed by amplifying the junctions between the locus and the vector,
and the results confirmed the correct insertion of T2B with an approximately 2kb band and a 5kb
band spanning the 5’ and 3’ insertion sites, respectively (Fig. 3.2).
101
Fig. 3.2 – PCR results showing the correct
insertion of vector T2B into the Rosa26 locus of
the mouse genome.
To determine the developmental potential of EST2B cells, they were differentiated as
EBs to demonstrate that the cells could maintain constitutive expression of RFP after Cre
excision. Both EST2B undifferentiated colonies (Fig. 3.3i-iii) and EBs (Fig. 3.3ii-iv) were
morphologically similar to wild-type R1 ESCs.
Fig. 3.3 – Fluorescent images showing
expression of DsRedT3 RFP in live EST2B cells upon Cre excision. The plasmid pCAGGS-
NLS-Cre which conferred constitutive expression
of Cre recombinase was transfected into EST2B
cells. The undifferentiated DsRedT3+ EST2B cells maintained their fluorescent reporter
expression after 10 days of differentiation as EBs.
DsRedT3 RFP
102
To further demonstrate pluripotency of EST2B transgenic ESCs, cells with and without
Cre excision were differentiated as EBs for 10 days in suspension. RT- PCR time course
illustrated that EST2B cells expressed markers of the three germ layers pre- and post-Cre
excision, and the expression patterns of all tested genes (including Oct4) corresponded to those
observed in wild-type R1 ESCs (Fig. 3.4A). To further reinforce my findings, EST2B cells were
subjected to various inductive culture conditions to generate specific derivatives of the germ
layers. Cells were cultured in N2B27 media for seven days had the same potential as R1 ESCs
in generating NESTIN+ immature neurons (Fig. 3.4Bi-iv). Cells that stained positively for the
cardiac marker αMHC were generated when day 3 EST2B EBs were plated onto gelatinized
tissue culture plastic and cultured for an additional six to nine days (Fig. 3.4Bii-v). In addition,
beating patches were observed in cultures of both unmanipulated and Cre-excised EST2B cells
(data not shown). In terms of endodermal differentiation, day 2 EBs that were cultured in the
presence of Activin A (50ng/ml) for an additional four days expressed AFP in the cytoplasm
(Fig. 3.4Biii-vi). These results demonstrate that EST2B is a suitable Cre-inducible cell line to
use for fate mapping studies.
103
A
B
Fig. 3.4 – Verification of EST2B pluripotency. (A) RT-PCR analysis showed that EST2B cells exhibited similar
germ layer gene expression patterns as wild-type R1 cells before and after Cre excision. In addition to transcript
analysis, (B) IF analysis showed appropriate protein expression of representative germ layer markers (i, iv)
NESTIN, (ii, v) αMHC and (iii, vi) AFP. For (vi), inset shows the cytoplasmic staining of AFP.
3.3.2 Construction of vector T2A
To facilitate the visualization of the endogenous expression of COL2A1 during
chondrogenic differentiation of EST2 cells, construct T2A was designed to be under the
transcriptional control of the Col2a1 minimal promoter (-89 to +6) downstream of a five-time
repeat of the 48bp SOX9 binding sequence (referred to as 5x48 Col2a1 promoter). The promoter
would drive the expression of Venus YFP followed by NLS-Cre. Construct T2A also contained
NESTIN
DAPI/Hoechst
αMHC
DAPI/Hoechst
AFP
DAPI/Hoechst
104
a frt site-flanked cassette that conferred neomycin/kanamycin resistance (NeoR/KanaR) under
the transcriptional control of the ubiquitous PGK promoter (referred to as PGKneofrt).
Fig. 3.5 – Schematic of construct T2A
I employed the Gateway® cloning technology to assemble construct T2A. Specifically,
the Multisite Gateway® Pro 4.0 system was used to incorporate the components of T2A into a
promoterless destination vector as four DNA fragments. The Gateway® technology utilizes the
bacteriophage λ SSR system (see Section 1.6.4.3) to integrate DNA into the E.coli chromosome.
Fragments of interest flanked by specific attB sites are PCR-amplified from the parental vectors.
PCR products are integrated into donor vectors with the corresponding attP sites via the
lysogenic pathway when catalyzed by the phage λ Integrase and Integration Host Factor proteins
(both of which are components of the BP Clonase™ II enzyme mix). Consequently, the PCR
product is incorporated in the donor vector, flanked by the newly formed attL or attR sites, to
generate an entry clone while the attP-flanked ccdB killer gene originally located within the
donor vector is removed, allowing the entry clone to propagate in E. coli (Fig. B.1A). To
incorporate the entry clones into a destination vector, the specific attL or attR sites recombine via
the lytic pathway in the presence of the phage λ Integrase, Excisionase as well as Integration
Host Factor (LR Clonase™ II Plus enzyme mix). The corresponding attL and attR sites among
the entry clones recombine with one another while the attL site on the 5’ end of the first fragment
105
and the attL site on the 3’ end of the last fragment recombine with the attR sites of the
destination vector, which leads to the removal of the ccdB killer gene from the destination vector
in the process (Fig. B.1B) (Invitrogen 2006; Katzen 2007).
For my four-fragment Gateway® cloning reaction, the components of construct T2A
were partitioned into four fragments: 5x48 Col2a1 promoter, Venus followed by an artificial
intron called the intervening sequence (IVS) and an inter-ribosomal entry site (IRES), NLS-Cre
with a SV40pA signal, and lastly the PGKneofrt cassette. These fragments were cloned into
donor vectors with specific attB sites via the BP reaction such that they will be cloned into the
destination vector in a pre-determined order. The 5x48 Col2a1 promoter was cloned into
pDONR™ 221 P1-P5r (Figs. 3.6A and B.3A), Venus-IVS-IRES was inserted into pDONR™
221 P5-P4 (Figs. 3.6B and B.3B), NLS-Cre SV40pA into pDONR™ 221 P4r-P3r (Figs. 3.6C
and B.3C) and PGKneofrt into pDONR™ 221 P3-P2 (Figs. 3.6D and B.3D). The entry clones
containing Venus-IVS-IRES and PGKneofrt were previously made by Dr. Jon Chesnut’s team at
Invitrogen Corporation with the cloning fragments PCR-amplified from construct T1b provided
by me (Fig. B.4).
The final expression clone was assembled by combining all the entry vectors and the
destination vector in the presence of LR Clonase® II Plus enzyme. The destination vector I used
was modified from the pcDNA™ 6.2/V5 PL-DEST promoterless vector (Invitrogen) where the
BlastR gene was removed. As shown in Fig. B.2, the destination vector contained the
recombination sites attR1 and attR2, which dictated the order in which the four entry vectors
would appear in the final expression clone. The 5’ most fragment to be inserted was attL1-5x48
Col2a1 promoter-attR5 (Fig. 3.6A) as attL1 recombined with attR1. The next piece of DNA to
be inserted would be attL5-Venus-IVS-IRES-attL4 (Fig. 3.6B) as attR5 and attL5 recombined.
106
The attL4 site then joined with the attR4 site of attR4-NLS-Cre SV40pA-attR3 (Fig. 3.6C), and
lastly, attL3-PGKneofrt-attL2 (Fig. 3.6D) became the 3’ most fragment to be inserted as attR3
recombined with attL3 and attL2 on the insert recombined with attR2 on the destination vector
(Fig. 3.7).
A
B
C
D
Fig. 3.6 – Schematic diagrams of the entry clones generated via Gateway® BP reactions.
708 XhoI (1)702 SmaI (1)702 XmaI (1)701 SrfI (1)683 SacI (1)677 Acc65I (1)677 AccB1I (1)677 KpnI (1)670 ClaI (1)651 BsrGI (1)636 PsiI (1)
563 ApaI (1)563 Bsp120I (1)563 DraII (1)
499 HincII (1)499 HpaI (1)
363 AclI (1)326 AcyI (1)
172 PvuII (1)
5x48 Sox5/6 enhancer element 717...976
977 BglII (1)983 EcoRI (1)
1013 SacII (1)Col2a1 promoter 997...1091
1092 HindIII (1)1117 AccI (1)1117 BstZ17I (1)
attR5 1109...12331267 PstI (1)1274 NotI (1)1275 EagI (1)1282 EcoRV (1)
1521 NruI (1)
1863 PvuI (1)1862 SgfI (1)
1789 SspI (1)1774 EcoNI (1)
2627 AlwNI (1)2727 ApaLI (1)
2933 DrdI (1)3041 BspLU11I (1)
3041 NspI (1)
pENTR L1-R5 5x48Col2a1
3047 bp
554 AflII (1)544 Eam1105I (1)
attL1 570...670 887 DrdI (1)
1327 AcyI (1)
1500 HincII (1)1500 HpaI (1)
1545 Eam1105I (1)1555 AflII (1)1561 AvaI (1)
attL5 1571...16661653 AccI (1)1653 BstZ17I (1)1666 BamHI (1)1673 NcoI (1)
1955 PfoI (1)
3127 DraIII (1)3083 BsaAI (1)
3083 PmlI (1)3065 BglI (1)2920 AvrII (1)
2743 SphI (1)2661 MscI (1)2656 BglII (1)2569 SacII (1)
VenusIVSIRES 1667...33422485 ScaI (1)2435 BstXI (1)
2402 StuI (1)2395 EcoRI (1)2384 BsrGI (1)
3210 Acc65I (1)3210 KpnI (1)
3310 BtrI (1)attL4 3343...3438
3463 EcoRV (1)3702 NruI (1)
3970 SspI (1)4043 SgfI (1)4044 PvuI (1)
pENTR L5-L4 Venus IVS IRES
4227 bp
3955 EcoNI (1)
581 AlwNI (1)
554 AflII (1)544 Eam1105I (1)
1053 RsrII (1)1108 BamHI (1)
1558 ClaI (1)
1788 EcoRI (1)
1898 MfeI (1)
2200 EagI (1)2199 NotI (1)2192 PstI (1)2188 TatI (1)
attR3 2034...2158
3048 PflMI (1)
3652 ApaLI (1)3652 BsiHKAI (1)
3858 DrdI (1)
pENTR R4-R3 NLS-Cre SV40pA
3972 bp
2699 EcoNI (1)
560 AvaI (1)
1584 PshAI (1)
1795 XbaI (1)1848 DraI (1)
SV40pA 1794...2033
563 DraII (1)attR4 603...726
794 AgeI (1)
990 BssHII (1)
NLS-Cre 729...1784
326 AcyI (1)172 PvuII (1)
866 PflMI (1)
605 SgfI (1)532 SspI (1)517 EcoNI (1)
264 NruI (1)25 EcoRV (1)17 NotI (1)
1470 ApaLI (1)
1784 BspLU11I (1)2153 AclI (1)
3127 BglII (1)3100 XcmI (1)
2916 AccIII (1)2910 PpuMI (1)
2789 StuI (1)2769 BlpI (1)2742 SpeI (1)
2607 AgeI (1)attL3 2360...2473
2353 ApaI (1)2353 Bsp120I (1)
2350 AvaI (1)2344 AflII (1)
2334 Eam1105I (1)2289 HincII (1)2289 HpaI (1)
PGKneofrt 2475...42503371 MscI (1)3391 FspI (1)
3406 Tth111I (1)3593 BsaAI (1)
3723 NcoI (1)3724 MslI (1)3806 RsrII (1)
3972 BstBI (1)4066 PfoI (1)4145 SacI (1)
4157 EcoRI (1)4163 Acc65I (1)
4163 KpnI (1)4216 AscI (1)4276 BsrGI (1)
4276 TatI (1)attL2 4274...4362
pENTR L3-L2 PGKneofrt4362 bp
606 PvuI (1)
107
Fig. 3.7 – Schematic of the final
expression clone assembled via
Multisite Gateway® Pro 4.0 system. Recombination between
L and R sites, as displayed on the
map, is achieved computationally
using the program A plasmid
Editor (ApE) v1.17.
The LR reaction mixture was transformed into DH5α, bacterial clones were isolated and
expanded in liquid cultures, after which plasmid DNA was isolated from them. The sizes of the
linearized plasmids resolved in agarose gel were slightly bigger than the theoretical size of the
resultant vector (Fig. 3.8A); however, this phenomenon happens occasionally when larger DNA
fragments could not resolve effectively, especially in higher percentage agarose gels. Double
restriction digests performed on the plasmid DNA suggested that the recombination reaction was
successful as the expected fragment sizes were generated (Fig. 3.8B). Sequencing results also
confirmed the results of the digests (Fig. 3.9).
1227 NotI (1)attL5 466...479attR5(rev) 458...465
Col2a1 promoter 346...4405x48 Sox5/6 enhancer element 66...325
57 XhoI (1)50 SrfI (1)46 NheI (1)attL1 1...19
2415 NruI (1)
2657 SgfI (1)NLS-Cre 2179...32342752 EcoRV (1)
3034 PshAI (1)3348 MfeI (1)3359 HpaI (1)SV40pA 3244...3483
attR3 3484...3491attL3 3492...3523
3792 SpeI (1)3819 BlpI (1)
3960 PpuMI (1)3966 AccIII (1)
4150 XcmI (1)PGKneofrt 3525...53004456 Tth111I (1)
5424 PmeI (1)attR2 5324...5338attL2 5317...5323
5266 AscI (1)
8081 Eam1105I (1)
9004 AatII (1)
attR1 9267...9274
Col2a1VenusCreNeo Final
9274 bp
T7 promoter 9219...92389004 ZraI (1)
1248 BstXI (1)VenusIVSIRES 480...2155
attL4 2156...2162attR4 2163...2176
108
A
B
Fig. 3.8 – Restriction digest analyses of the expression clones suggested the successful generation of the T2A construct to be integrated into EST2B cells. (A) Linearization of plasmid clones using the restriction enzyme
XhoI generated a single fragment >10kb, which was slightly bigger than the expected size of the expression vector.
(B) Restriction digests carried out with EcoRV+NotI, PmeI+SpeI and XhoI+NotI generated DNA fragments of
sizes: 1633bp, 1526bp and 1171bp, respectively, which corroborated with the theoretical fragment sizes (see Fig.
3.7).
109
NLS-Cre-SV40pA attR3 attL3
110
Fig. 3.9 – Sequencing results confirmed the proper integration of cloning fragments into destination vector
using the Multisite Gateway® Pro 4.0 system.
To determine the functional efficacy of the expression clone, it was transiently
transfected into HEK 293T cells in the presence of human Sox9 cDNA, which activated the
Col2a1 promoter via the five-time repeat of the 48bp SOX9 enhancer element. After 48hrs.,
Venus expression was visible in cultures transfected with the expression clones (Fig. 3.10Aii,
Bii) and the control plasmid (Fig. 3.10Cii). Although the distribution of Venus expression was
similar between the two cultures, cells transfected with the control plasmid had more intense
Venus expression. As expected, cells lacking the Sox9 cDNA did not express Venus (Fig.
3.10D-E); however, there were a few positive cells in the culture containing the control plasmid
only (Fig. 3.10Fii).
Aside from Venus YFP, expression of Cre recombinase was also detected 48hrs. after
HEK 293T cells were transiently co-transfected with the T2A expression clone and Sox9 cDNA.
Cells that co-expressed both Venus YFP and Cre recombinase were identified (Fig. 3.11).
Conversely, cells transfected with the control plasmid Col2a1-eYFP and Sox9 cDNA did not
exhibit any Cre expression, while cells transfected with pCAGGS-NLS-Cre showed a lack of
Venus YFP expression.
111
A D
B E
C F
Fig. 3.10 – Bright field (i) and fluorescence (ii) images (100x) documenting transgene expression of plasmid
T2A in live HEK 293T cells 48hrs. after transient co-transfection with human Sox9 cDNA via lipofection. Plasmid clone 1 (A, D) and clone 2 (B, E) behaved similarly in terms of the distribution and level of Venus YFP
expression in the presence (A, B) and absence (D, E) of Sox9 cDNA. (C) Cells transfected with the Col2a1-eYFP
control plasmid and Sox9 cDNA expressed eYFP at a significantly higher intensity than those containing T2A;
however, a small fraction of the cells containing control plasmid alone also showed eYFP expression (D).
Fluorescence images were taken using the same amount of exposure time.
Venus YFP
eYFP
112
Fig. 3.11 – IF analysis of the expression of Cre recombinase in HEK 293T cells transiently transfected with construct T2A and Sox9 cDNA. Images (200x) displayed the co-expression of Venus YFP and Cre recombinase
in cells transfected with both construct T2A and Sox9 cDNA (see insets), while cells transfected with the control
plasmids only expressed Venus (in the case of Col2a1-eYFP+Sox9 cDNA) or Cre recombinase (in the case of
pCAGGS-NLS-Cre).
3.3.3 Validation of the transgenic EST2 line
Linearized expression plasmid was electroporated into EST2B cells and ESC clones
resistant to both G418 and puromycin were isolated after antibiotic selection. To test the
functionality of the resulting EST2 cells, they were first transiently transfected with Sox9 cDNA
to determine if transgene expression could be detected. Only faint Venus expression was seen in
a few cells. To further characterize the cells, they were differentiated into chondrocytes in
Venus YFP
Cre
Hoechst
113
monolayer cultures, as outlined in Chapter 2. However, neither Venus or DSRedT3 expression
was detected when cultures were examined at multiple time points, leading to my speculation
that there were insufficient copy numbers of the plasmid present in the EST2 cells. The cells
were re-electroporated in an attempt to increase the copy numbers; however, a four-fold increase
in G418 concentration failed to isolate new clones after an extended period of selection. As
such, the lines would need to be re-established.
The re-derivation of the EST2 transgenic cell line was achieved via electroporation using
the Neon™ Transfection System from Invitrogen. We have previously established optimized
transfection conditions for hESCs, mESCs and human fibroblasts using this transfection system.
Expression plasmid was linearized with PmeI, and it was purified as well as concentrated via
ethanol precipitation. EST2B cells were trypsinized, washed with PBS and resuspended in
Resuspension Buffer R at a concentration of 5x106cells/ml. Linearized T2A plasmid was mixed
with cells at a concentration of 1µg of plasmid per 100µl of cells. Electroporation was
performed in 100µl reactions under the conditions outlined in Table 3.1 and each reaction was
plated onto gelatinized 6-well tissue culture plate (i.e., one reaction condition per well). Clones
were isolated via antibiotic selection with G418 and puromycin.
It was discovered that transfection carried out in three pulses at 1400V and a pulse width
of 10ms generated the most colonies after antibiotic selection. Therefore, electroporation was
performed on a larger scale at this reaction condition where every 106cells were transfected with
1.5µg of plasmid. A total of 96 clones were isolated after antibiotic selection and the clones
were cryopreserved. Functionality of the cells will be validated.
114
Well Pulse Voltage (V) Pulse Width (ms) Pulse Number
1 1400 10 3
2 1200 20 2
3 1500 20 1
4 1500 20 2
5 1000 20 1
6 1000 20 2
Table 3.1 – Test conditions for the transfection of EST2B cells with T2A expression plasmid using Neon™
Transfection System.
3.4 Current work
To examine the efficacy of the EST2 cell line, cells will be transfected with Sox9 cDNA
and will undergo chondrogenic differentiation to activate the 5x48 Col2a1 promoter in order to
induce transgene expression. Temporal Venus YFP pattern will be compared with endogenous
COL2A1 expression to determine the faithfulness of transgene expression. The co-expression of
DsRedT3 RFP and Venus YFP will signify the activation of the Col2a1 promoter, which leads to
the expression of Cre recombinase, and the subsequent constitutive DsRedT3 RFP expression
can be used to track the cells that transiently expressed COL2A1.
3.5 Future work
Since construct T2A was assembled using Multisite Gateway® technology where the
promoter, fluorescent protein, Cre recombinase and selectable marker were separated into
different entry vectors, the modular nature of this construct system provides great versatility as
different elements of the vector can be substituted to be used in various fate mapping and HCI
115
applications. For example, the 5x48 Col2a1 promoter can be replaced with other chondrogenic
markers such as the Sox9 promoter, and parallel screens for novel therapeutics can be conducted
to discover agents that promote the expression of all the markers or selectively activate some of
the promoters. Candidate agents that fail to maintain the expression of any early chondrogenic
marker of choice, as indicated by the sole expression of DsRedT3 due to the loss of Venus YFP,
will be easily identified.
Upon verifying the function of the two-step reporter system, the same experimental steps
can be applied to generate various transgenic cell lines using promoters specific to other cell
types of interest by re-assembling construct T2A using the Multisite Gateway® cloning method.
In addition to using the resulting reporter cell lines to identify the formation of ESC-derived cell
types of interest in vitro, they can be used to generate chimeric mice to facilitate in vivo fate
mapping, which allows one to visualize and track the emergence of specific transient cell types
and the localization of their progeny through development. For example, it will be interesting to
track cells that express the paraxial mesoderm-specific markers such as Mesp2 or the neural crest
marker Paired box 3 (Pax3), both of which can give rise to chondrocytes as well as other cell
types such as bone and muscles during development. In addition to tissue-specific markers,
signaling pathway-specific genes such as Lef/Tcf, which are downstream targets of β-CATENIN,
and members of the Notch signaling pathway are also interesting candidates because of the
oscillatory expression patterns of Wnt and Notch signaling during somitogenesis. In addition,
tracking the expression of the BMP inhibitor Noggin will also be very informative due to the
temporal and spatial specificity of Noggin expression during embryonic development. It will be
interesting to visualize the development of somites-derived tissues in vitro and in vivo as well as
observe the effects caused by perturbations of the expression of these genes.
116
Chapter 4 Discussion and conclusion
In Chapters 2 and 3, I have demonstrated my progress towards the establishment of a
screening platform for novel therapeutics that promote endogenous cartilage repair. It involves
the development of a growth-factor mediated, SF monolayer differentiation system for ESC-
derived chondrocytes. I have also assembled a Col2a1 promoter-driven reporter construct (T2A)
that can be used to identify and quantify chondrocytes generated using the monolayer
differentiation system. Although it was not necessary for my project, I have modified T2A to
include the gene for encoding Cre recombinase such that it can be incorporated into an existing
Cre-inducible reporter ESC line (EST2B). This two-step reporter system can identify cells that
express COL2A1; in addition, due to the ubiquitous expression of a DsRed T3 RFP upon Cre
excision, all the progeny of COL2A1+ cells will also be identified. The expression pattern of
Venus YFP and DsRed T3 will allow one to track the progression of chondrocyte differentiation
both in vitro and in vivo.
In Chapter 2, I have shown that I was able to generate ESC-derived chondrocytes in
monolayer cultures in a defined chemical condition. I used IF, qPCR and Alcian blue staining to
confirm the presence of chondrogenic cells in my cultures. Real-time qPCR analyses provided
transcript level information to verify the faithful up-regulation of chondrogenic marker genes. IF
analyses confirmed marker gene expression at the protein level, while positive Alcian blue
staining indicated proteoglycan production. Transcript and protein expression provided
sufficient evidence of chondrogenic differentiation using my ESC SF monolayer differentiation
system. However, to obtain additional phenotypic and functional data that can specify the type
117
of chondrocytes being produced, one can measure GAG production, which increases as cells
differentiate into chondrocytes as well as perform additional histochemistry analyses with stains
such as Masson’s trichrome stain for collagen detection and Toluidine blue for cartilage
detection. Functional assays can be performed on the ESC-derived chondrogenic cultures if one
wants to be truly rigorous with the characterization process. For example, ESC-derived
chondrocytes can be implanted into SCID mice and the tissue at the point of injection will be
retrieved at a later time point to assess the proliferation and maturation of the injected cells.
Alternatively, the cells can be incorporated into scaffolds or engineered constructs to be
implanted into an injury site to assess the extent of cartilage repair. However, for the purpose of
generating a cell source for drug/small molecule screens, the establishment of a cartilage repair
model using the ESC-derived chondrocytes may be too exhaustive and time consuming.
Heng et al. suggested that a defined SF culture milieu for directed chondrogenic
differentiation should include the incorporation of cytokines/growth factors, chemicals and ECM
in conjunction with biophysical parameters such as oxygen tension, temperature and cell density
(which mediates the amount of cell-cell contact) (Heng, Cao et al. 2004). In addition to ECMs,
media formulation, seeding density and exogenous growth factors, one can examine the
enhancing effects of chemical additives on the chondrogenic differentiation cultures. Although I
have briefly examined the effect of dexamethosone and ascorbic acid addition on my cultures
and did not observe any additional benefit in terms of chondrogenic induction (data not shown),
one can test the efficacy of these factors and others such as thyroid hormones more rigorously as
they were shown to promote chondrogenesis in other culture systems. Dexamethosone is a
glucocorticoid that has been shown to induce chondrogenic differentiation in human MSCs
(Johnstone, Hering et al. 1998; Mackay, Beck et al. 1998). Ascorbic acid has been shown to
stimulate cartilage matrix production (Farquharson, Berry et al. 1998), while thyroid hormones
118
are steroid derivatives of cholesterol metabolism that have been shown to play a role in
chondrogenic differentiation (Wakita, Izumi et al. 1998). In terms of oxygen tension, hypoxia
(1-2% O2) has been demonstrated to increase the chondrogenic potential of cells differentiated
from MSCs (Robins, Akeno et al. 2005), ESCs (Koay and Athanasiou 2008) and primary
articular chondrocytes (Egli, Bastian et al. 2008) by promoting the increased expression of
chondrogenic marker genes and the production of GAG. Specifically, it was discovered that the
inductive effects of low oxygen tension was more potent in cells undergoing early differentiation
or expansion, while hypoxic conditions had minimal effect on the cells during late-stage
differentiation compared to normoxic conditions (Egli, Bastian et al. 2008; Koay and Athanasiou
2008).
Despite the successful derivation of ESC-derived chondrocytes, I discovered that
differentiating ESCs cultured in SF media had inferior cell spreading, adhesive properties and
possibly a slower rate of proliferation compared to those established in serum media, consistent
with reported studies on SF ESC culture (Ying, Nichols et al. 2003; Chaudhry, Vitalis et al.
2008). To ensure even cell spreading and strong cell-ECM adhesion, the undifferentiated cells
can be plated in serum-containing medium for a few hours to establish cell-ECM adhesion before
changing to SF differentiation medium. However, this strategy may cause delays in the up-
regulation of differentiation marker genes (especially early differentiation markers) due to
residue serum effect present in the culture microenvironment.
It has also been shown that mesoderm induction in serum monolayer cultures was inferior
to that in EB cultures (Nishikawa, Nishikawa et al. 1998). There is an increasing preference for
3D cultures because they better recapitulate the cell-cell, cell-ECM and paracrine interactions
that exist in vivo, while cells established in 2D cultures are subjected to unnatural geometrical
119
constraints and therefore lack many of the mechanical and biochemical cues that define cellular
behaviour (Birgersdotter, Sandberg et al. 2005; Sun, Jackson et al. 2006; Maltman and
Przyborski 2010). Interestingly, these advantageous qualities of 3D cultures over monolayer
cultures are also the cause of much criticism against 3D cultures. The microenvironment within
a 3D structure such as an EB is highly variable due to the different kinds of cellular interactions
present within an EB, leading to significant heterogeneity both within any given EB but also
between different EBs during differentiation (Metallo, Mohr et al. 2007; McDevitt, Carpenedo et
al. 2008). In addition, the transport of soluble morphogens and other crucial molecules into EBs
is often hindered by diffusion limitations, which are dependent on factors such as aggregate size
and ECM content (Carpenedo, Seaman et al. 2010). Various strategies have been devised to
attain better control of ESC fate in both undifferentiated colonies and EBs. Studies in hESCs
suggested that the EB size itself and the size of undifferentiated hESC colonies used to generate
these EBs exerted certain biases towards the tendency to generate different germ layers, and
together these parameters influenced the efficiency in the formation of specific cell types such as
cardiomyocytes (Bauwens, Peerani et al. 2008; Niebruegge, Bauwens et al. 2009). In addition,
hESC colony and EB sizes can be precisely and reproducibly controlled via the integration of
technologies such as microcontact printing and the use of microwells (e.g. AggreWell™ from
STEMCELL Technologies), respectively. (Ungrin, Joshi et al. 2008; Lee, Peerani et al. 2009;
Sakai, Yoshiura et al. 2011). Aside from controlling the size of colonies and EBs, strategies
have also been devised to improve the delivery of soluble morphogens into EBs by aggregating
ESCs with morphogen-containing biodegradable microspheres in rotary suspension cultures
(Carpenedo, Bratt-Leal et al. 2009; Carpenedo, Seaman et al. 2010).
In spite of the development of novel strategies to enrich for the cell types of interest when
differentiating ESCs as EBs, it remains impossible to obtain 100% pure cell populations from
120
these 3D cultures. Oftentimes transgenic cell lines need to be created to facilitate the isolation of
cell types of interest via FACS or antibiotic selection, both of which are labour intensive
processes that significantly compromise the health of the cells. In addition, the removal of
specific cell types from their 3D culture environment poses similar concerns as those listed for
2D cultures in that the isolated cells are no longer exposed to the appropriate cellular signals.
Furthermore, it is difficult to observe the cellular behaviour of subsets of cells within an EB
using conventional imaging techniques without the aid of confocal microscopy, which can be
very time-consuming and costly especially when put in the context of the development of HTS
and HCI platforms.
Conversely, although it is argued that 2D cultures cannot provide the full spectra of
cellular signals to recapitulate the proper physiological environment for the generation of ESC-
derived cell types, it remains the easiest method of establishing platforms for first-phase drug
and small molecule screens due to the limited amount of manual manipulation required to
establish these cultures, the low cost associated with culture setup and the speediness at which
testing can be done (Giese, Kaufmann et al. 2002). Although 2D ESC differentiation cultures
may not generate many of the differentiated cell types efficiently (Nishikawa, Nishikawa et al.
1998), it may be advantageous for directed differentiation because one can obtain a higher
percentage of the cell type of interest (i.e. chondrocytes). In addition, it provides more flexibility
in terms of culture manipulation and the ability to do so with ease (Heo, Lee et al. 2005), as
demonstrated by my ECM/media/seeding density screen using HCI as described in Chapter 2.
Another advantage of using 2D cultures in HTS is the ability to identify changes in cellular
behaviour in cell types of interest with the option of not isolating the cells via FACS or selection.
Although it is ideal to perform cellular assays with pure cell populations, it may not be
detrimental to have supportive cell types present in the culture so long as they do not interfere
121
with the results of the assays. Since the cultures are in 2D, cell types of interest can be easily
identified via immunostaining or with any reporter genes as in the case of transgenic cell lines,
and they can be easily imaged and quantified in HTS applications.
One of the important questions that remain to be answered at the current stage of my
screening platform is the quantification of the yield of chondrocytes from my 2D cultures, that is,
the percentage of ESCs that actually differentiate into chondrocytes versus other cell types. I
agree that presently, it is difficult to quantify the percentage of chondrogenic cells in my culture
system based on COL2A1 protein expression using HCI strategies because IF stains for the
collagen networks and not individual cells. However, with the successful derivation of the EST2
line, one can count the number of COL2A1+ cells based on live-cell imaging of Venus YFP and
DsRedT3 RFP co-expression, which can be corroborated with IF analyses of SOX9 or other
chondrogenic markers. Furthermore, one can identify the chondrogenic cells that have
undergone terminal differentiation based on the down-regulation of Venus YFP expression and
the maintenance of DsRedT3 RFP. As mentioned in Chapter 3, because T2A construct was
assembled in a modular manner using Gateway® technology, one can generate different
transgenic lines using various promoters of chondrogenic marker genes, and HCI results
accumulated from data generated from all the different transgenic lines can be compared.
Another critical consideration is the ability to adapt this screening platform to hESC
studies. Unfortunately, major parameter re-testing will probably be involved because the
culturing technique for hESCs varies substantially from that for mESCs. The use of collagen IV
as a potential ECM for hESC adhesion has been examined (Draper, Moore et al. 2004), but
hESCs differentiating on collagen IV appeared to form epithelial-like cells (Ahmad, Stewart et
al. 2007). On the other hand, Matrigel™, a heterogeneous mixture of ECMs, is routinely used in
122
MEF-free culture of hESCs. Human ESCs have been reported to undergo osteogenic
differentiation, along with the formation of chondrocyte-like cells, in monolayers on gelatin-
coated tissue culture plastic. However, monolayer differentiation cultures were not established
from single cell suspensions; hESCs were seeded as clumps that were partially dissociated via
collagenase digestion and mechanical scraping (Karner, Unger et al. 2007). Despite the fact that
undifferentiated hESCs can be dissociated and replated as single cells (Bauwens, Peerani et al.
2008), the efficiency of establishing hESC monolayer mesodermal differentiation cultures from
single cells has not been thoroughly validated. However, with the advancements in microcontact
printing and patterning technologies it is believed that single cell-derived long-term hESC
monolayer differentiation cultures can soon be routinely established. In terms of the generation
of an equivalent transgenic line as EST2 cells using hESCs, one can use a similar approach as
that used to generate EST2B cells to target the T2B construct into the human Rosa26 locus
(Irion, Luche et al. 2007) or the R4 targeting locus (Lieu, Machleidt et al. 2009).
Apart from the differences in culture techniques, one has to be mindful of the influences
of exogenous factors on hESC cell fate decisions and how they may differ from those on mESC
differentiation. Combinations of exogenous BMP2, BMP7, TGFβ1, TGFβ3 and even Insulin-
like growth factor 1 (IGF1) have been reported to promote hESC chondrogenic differentiation as
EBs, micromasses or pellets (Koay, Hoben et al. 2007; Toh, Yang et al. 2007; Nakagawa, Lee et
al. 2009; Gong, Ferrari et al. 2010). However, TGFβ1 has also been shown to inhibit
chondrogenic differentiation, albeit in cultures maintained in a chondrogenic medium containing
10% FBS as opposed to the usual concentration of 1% FBS or no serum (Yang, Sui et al. 2009).
Interestingly, many of these studies used BMP concentrations of 100-300ng/ml, which were
about 5-10 folds more than what would be used in mESC studies. Activin A and Wnt3a have
similar effect on mESCs and hESCs in that they promote the formation primitive streak-like cells
123
(Lee, Peerani et al. 2009; Evseenko, Zhu et al. 2010) as well as definitive endoderm at higher
concentrations (D'Amour, Agulnick et al. 2005). It was also found that the addition of Activin A
helped maintain the undifferentiated state of hESCs (Beattie, Lopez et al. 2005; James, Levine et
al. 2005; Xiao, Yuan et al. 2006), and as mentioned in Section 1.5.2.1.4, it has been shown that
Wnt3a stimulated the proliferation of undifferentiated hESCs (Dravid, Ye et al. 2005). In terms
of FGFs, FGF2 is one of the requisite components in the maintenance of undifferentiated hESC
cultures under SF conditions (Amit, Carpenter et al. 2000; Xu, Rosler et al. 2005). It has been
suggested that FGF2 and NOGGIN work synergistically to maintain hESC pluripotency in the
absence of feeder layers (Wang, Zhang et al. 2005; Xu, Peck et al. 2005). Therefore, although
some of the exogenous growth factors have overlapping functions in both mESCs and hESCs,
others such as Activin A also exert a divergent influence on hESC cell fate. As such, careful
testing of the various growth factors at different concentrations is critical when adapting my
monolayer culture system for hESC differentiation purposes.
In conclusion, I have developed a one-step strategy for generating monolayers of ESC-
derived chondrogenic cells on collagen IV in a chemically defined condition. My system
recapitulated the published expression patterns of a plethora of mesoderm marker genes and
confirmed the stage-specific nature of TGFβ-, BMP- and Wnt-modulated chondrogenesis. The
simplicity of my system facilitates the establishment of test cultures for HCI/HTS with minimal
manipulation. The 2D nature of my system also provides a platform that permits easy
visualization of changes in chondrogenic markers or reporter expression in knock-down/over-
expression studies and in the identification of novel chondrogenic modulators. By combining the
establishment of a monolayer differentiation protocol for ESC-derived chondrocytes with the
generation of a transgenic ESC line under the transcriptional control of the chondrogenic marker
Col2a1, this system has the potential to generate multiple sets of quantitative data, from the
124
expression levels of key chondrogenic marker genes to the percent formation of chondrocytes in
cultures supplemented with different molecules. Using the Gateway® cloning system, one can
re-assemble the Cre-expressing vector T2A with ease using different promoters to create parallel
screens to test the efficacy of candidate molecules. One can also target the Cre-inducible T2B
construct into the Rosa26 locus in hESCs. With optimization, my system can be adapted to carry
out similar screens in hESCs to determine if the candidate molecules identified in the mESC
screens have similar chondrogenic inductive effects in hESCs.
125
References
Aberle, H., A. Bauer, et al. (1997). "beta-catenin is a target for the ubiquitin-proteasome
pathway." Embo J 16(13): 3797-804.
Abzhanov, A. and C. J. Tabin (2004). "Shh and Fgf8 act synergistically to drive cartilage
outgrowth during cranial development." Dev Biol 273(1): 134-48.
Ahmad, S., R. Stewart, et al. (2007). "Differentiation of human embryonic stem cells into corneal
epithelial-like cells by in vitro replication of the corneal epithelial stem cell niche." Stem
Cells 25(5): 1145-55.
Ahmed, N., W. L. Stanford, et al. (2007). "Mesenchymal stem and progenitor cells for cartilage
repair." Skeletal Radiol 36(10): 909-12.
Akiyama, H., M. C. Chaboissier, et al. (2002). "The transcription factor Sox9 has essential roles
in successive steps of the chondrocyte differentiation pathway and is required for
expression of Sox5 and Sox6." Genes Dev 16: 2813-2828.
Akiyama, H., J. P. Lyons, et al. (2004). "Interactions between Sox9 and beta-catenin control
chondrocyte differentiation." Genes Dev 18(9): 1072-87.
Akizuki, S., V. C. Mow, et al. (1986). "Tensile properties of human knee joint cartilage: I.
Influence of ionic conditions, weight bearing, and fibrillation on the tensile modulus." J
Orthop Res 4(4): 379-92.
Alper, J. (2009). "Geron gets green light for human trial of ES cell-derived product." Nat
Biotechnol 27(3): 213-4.
Amit, M., M. K. Carpenter, et al. (2000). "Clonally derived human embryonic stem cell lines
maintain pluripotency and proliferative potential for prolonged periods of culture." Dev
Biol 227(2): 271-8.
Anraku, Y., H. Mizuta, et al. (2008). "The chondrogenic repair response of undifferentiated
mesenchymal cells in rat full-thickness articular cartilage defects." Osteoarthritis
Cartilage 16(8): 961-4.
Arnold, S. J. and E. J. Robertson (2009). "Making a commitment: cell lineage allocation and axis
patterning in the early mouse embryo." Nat Rev Mol Cell Biol 10(2): 91-103.
Arnold, S. J., J. Stappert, et al. (2000). "Brachyury is a target gene of the Wnt/beta-catenin
signaling pathway." Mech Dev 91(1-2): 249-58.
Artelt, P., R. Grannemann, et al. (1991). "The prokaryotic neomycin-resistance-encoding gene
acts as a transcriptional silencer in eukaryotic cells." Gene 99: 249-254.
126
Austin, T. W., S. Salimi, et al. (2000). "Long-term multilineage expression in peripheral blood
from a Moloney murine leukemia virus vector after serial transplantation of transduced
bone marrow cells." Blood 95(3): 829-36.
Avilion, A. A., S. K. Nicolis, et al. (2003). "Multipotent cell lineages in early mouse
development depend on SOX2 function." Genes Dev 17(1): 126-40.
Bafico, A., G. Liu, et al. (2001). "Novel mechanism of Wnt signalling inhibition mediated by
Dickkopf-1 interaction with LRP6/Arrow." Nat Cell Biol 3(7): 683-6.
Baird, G. S., D. A. Zacharias, et al. (2000). "Biochemistry, mutagenesis, and oligomerization of
DsRed, a red fluorescent protein from coral." Proc Natl Acad Sci U S A 97(22): 11984-9.
Baroffio, A., M. Hamann, et al. (1996). "Identification of self-renewing myoblasts in the progeny
of single human muscle satellite cells." Differentiation 60(1): 47-57.
Barrallo-Gimeno, A. and M. A. Nieto (2005). "The Snail genes as inducers of cell movement and
survival: implications in development and cancer." Development 132(14): 3151-61.
Bartek, J. and J. Lukas (2001). "Pathways governing G1/S transition and their response to DNA
damage." FEBS Lett 490(3): 117-22.
Battler, A., J. Leor, et al. (2006). Cartilage. Stem Cell and Gene-Based Therapy, Springer
London: 179-193.
Bauwens, C. L., R. Peerani, et al. (2008). "Control of human embryonic stem cell colony and
aggregate size heterogeneity influences differentiation trajectories." Stem Cells 26(9):
2300-10.
Beattie, G. M., A. D. Lopez, et al. (2005). "Activin A maintains pluripotency of human
embryonic stem cells in the absence of feeder layers." Stem Cells 23(4): 489-95.
Becker, A. J., E. A. McCulloch, et al. (1963). "Cytological demonstration of the clonal nature of
spleen colonies derived from transplanted mouse marrow cells." Nature 197: 452-4.
Beddington, R. S., P. Rashbass, et al. (1992). "Brachyury--a gene affecting mouse gastrulation
and early organogenesis." Dev Suppl: 157-65.
Beddington, R. S. and E. J. Robertson (1989). "An assessment of the developmental potential of
embryonic stem cells in the midgestation mouse embryo." Development 105(4): 733-7.
Belteki, G., M. Gertsenstein, et al. (2003). "Site-specific cassette exchange and germline
transmission with mouse ES cells expressing phiC31 integrase." Nat Biotechnol 21(3):
321-4.
Benjamin, M. and E. J. Evans (1990). "Fibrocartilage." J Anat 171: 1-15.
Beris, A. E., M. G. Lykissas, et al. (2005). "Advances in articular cartilage repair." Injury 36
Suppl 4: S14-23.
127
Bernardo, M. E., F. Locatelli, et al. (2009). "Mesenchymal stromal cells." Ann N Y Acad Sci
1176: 101-17.
Bevis, B. J. and B. S. Glick (2002). "Rapidly maturing variants of the Discosoma red fluorescent
protein (DsRed)." Nat Biotechnol 20(1): 83-7.
Bi, W., J. M. Deng, et al. (1999). "Sox9 is required for cartilage formation." Nat Genet 22(1): 85-
9.
Birgersdotter, A., R. Sandberg, et al. (2005). "Gene expression perturbation in vitro--a growing
case for three-dimensional (3D) culture systems." Semin Cancer Biol 15(5): 405-12.
Bobick, B. E., F. H. Chen, et al. (2009). "Regulation of the chondrogenic phenotype in culture."
Birth Defects Res C Embryo Today 87(4): 351-71.
Bobick, B. E., T. M. Thornhill, et al. (2007). "Fibroblast growth factors 2, 4, and 8 exert both
negative and positive effects on limb, frontonasal, and mandibular chondrogenesis via
MEK-ERK activation." J Cell Physiol 211(1): 233-43.
Boiani, M. and H. R. Scholer (2005). "Regulatory networks in embryo-derived pluripotent stem
cells." Nat Rev Mol Cell Biol 6(11): 872-84.
Bollag, R. J., Z. Siegfried, et al. (1994). "An ancient family of embryonically expressed mouse
genes sharing a conserved protein motif with the T locus." Nat Genet 7(3): 383-9.
Bolos, V., H. Peinado, et al. (2003). "The transcription factor Slug represses E-cadherin
expression and induces epithelial to mesenchymal transitions: a comparison with Snail
and E47 repressors." J Cell Sci 116(Pt 3): 499-511.
Booth, C., J. A. O'Shea, et al. (1999). "Maintenance of functional stem cells in isolated and
cultured adult intestinal epithelium." Exp Cell Res 249(2): 359-66.
Bouwmeester, S. J., J. M. Beckers, et al. (1997). "Long-term results of rib perichondrial grafts
for repair of cartilage defects in the human knee." Int Orthop 21(5): 313-7.
Bradley, A., M. Evans, et al. (1984). "Formation of germ-line chimaeras from embryo-derived
teratocarcinoma cell lines." Nature 309(5965): 255-6.
Branda, C. S. and S. M. Dymecki (2004). "Talking about a revolution: The impact of site-
specific recombinases on genetic analyses in mice." Dev Cell 6(1): 7-28.
Broach, J. R., V. R. Guarascio, et al. (1982). "Recombination within the yeast plasmid 2mu
circle is site-specific." Cell 29(1): 227-34.
Broxmeyer, H. E., E. Gluckman, et al. (1990). "Human umbilical cord blood: a clinically useful
source of transplantable hematopoietic stem/progenitor cells." Int J Cell Cloning 8(Suppl
S1): 76-91.
128
Buckwalter, J. A. and H. J. Mankin (1998). "Articular cartilage repair and transplantation."
Arthritis Rheum 41(8): 1331-42.
Burdon, T., A. Smith, et al. (2002). "Signalling, cell cycle and pluripotency in embryonic stem
cells." Trends Cell Biol 12(9): 432-8.
Buxton, P., C. Edwards, et al. (2001). "Growth/differentiation factor-5 (GDF-5) and skeletal
development." J Bone Joint Surg Am 83-A Suppl 1(Pt 1): S23-30.
Cano, A., M. A. Perez-Moreno, et al. (2000). "The transcription factor snail controls epithelial-
mesenchymal transitions by repressing E-cadherin expression." Nat Cell Biol 2(2): 76-83.
Caplan, A. I. (1991). "Mesenchymal stem cells." J Orthop Res 9(5): 641-50.
Carpenedo, R. L., A. M. Bratt-Leal, et al. (2009). "Homogeneous and organized differentiation
within embryoid bodies induced by microsphere-mediated delivery of small molecules."
Biomaterials 30(13): 2507-15.
Carpenedo, R. L., S. A. Seaman, et al. (2010). "Microsphere size effects on embryoid body
incorporation and embryonic stem cell differentiation." J Biomed Mater Res A 94(2):
466-75.
Chambers, I., D. Colby, et al. (2003). "Functional expression cloning of Nanog, a pluripotency
sustaining factor in embryonic stem cells." Cell 113(5): 643-55.
Chambers, I., J. Silva, et al. (2007). "Nanog safeguards pluripotency and mediates germline
development." Nature 450(7173): 1230-4.
Chang, F., T. Ishii, et al. (2008). "Repair of large full-thickness articular cartilage defects by
transplantation of autologous uncultured bone-marrow-derived mononuclear cells." J
Orthop Res 26(1): 18-26.
Chaudhry, M. A., T. Z. Vitalis, et al. (2008). "Basal medium composition and serum or serum
replacement concentration influences on the maintenance of murine embryonic stem
cells." Cytotechnology 58(3): 173-9.
Chazaud, C., Y. Yamanaka, et al. (2006). "Early lineage segregation between epiblast and
primitive endoderm in mouse blastocysts through the Grb2-MAPK pathway." Dev Cell
10(5): 615-24.
Chen, P., Y. M. Yu, et al. (1993). "Chondrogenesis in chick limb bud mesodermal cells:
reciprocal modulation by activin and inhibin." Exp Cell Res 206(1): 119-27.
Chew, J. L., Y. H. Loh, et al. (2005). "Reciprocal transcriptional regulation of Pou5f1 and Sox2
via the Oct4/Sox2 complex in embryonic stem cells." Mol Cell Biol 25(14): 6031-46.
Citri, N. and N. Garber (1962). "The nature of resistance of a penicillin to hydrolysis by
pencillinase." J Pharm Pharmacol 14: 784-93.
129
Clark, J. M. and P. T. Simonian (1997). "Scanning electron microscopy of "fibrillated" and
"malacic" human articular cartilage: technical considerations." Microsc Res Tech 37(4):
299-313.
Clarke, D. C. and X. Liu (2008). "Decoding the quantitative nature of TGF-beta/Smad
signaling." Trends Cell Biol 18(9): 430-42.
Cliffe, A., F. Hamada, et al. (2003). "A role of Dishevelled in relocating Axin to the plasma
membrane during wingless signaling." Curr Biol 13(11): 960-6.
Cohen, S. N. (1993). "Bacterial plasmids: their extraordinary contribution to molecular genetics."
Gene 135(1-2): 67-76.
Colbere-Garapin, F., F. Horodniceanu, et al. (1981). "A new dominant hybrid selective marker
for higher eukaryotic cells." J Mol Biol 150(1): 1-14.
Collignon, J., S. Sockanathan, et al. (1996). "A comparison of the properties of Sox-3 with Sry
and two related genes, Sox-1 and Sox-2." Development 122(2): 509-20.
Corona, B. T., C. L. Ward, et al. (2010). "Regenerative medicine: basic concepts, current status,
and future applications." J Investig Med 58(7): 849-58.
Crampton, S. P., B. Wu, et al. (2009). "Integration of the beta-catenin-dependent Wnt pathway
with integrin signaling through the adaptor molecule Grb2." PLoS One 4(11): e7841.
Cselenyi, C. S. and E. Lee (2008). "Context-dependent activation or inhibition of Wnt-beta-
catenin signaling by Kremen." Sci Signal 1(8): pe10.
Cubitt, A. B., R. Heim, et al. (1995). "Understanding, improving and using green fluorescent
proteins." Trends Biochem Sci 20(11): 448-55.
D'Amour, K. A., A. D. Agulnick, et al. (2005). "Efficient differentiation of human embryonic
stem cells to definitive endoderm." Nat Biotechnol 23(12): 1534-41.
Daar, A. S. and H. L. Greenwood (2007). "A proposed definition of regenerative medicine." J
Tissue Eng Regen Med 1(3): 179-84.
Darling, E. M. and K. A. Athanasiou (2005). "Rapid phenotypic changes in passaged articular
chondrocyte subpopulations." J Orthop Res 23(2): 425-32.
Davey, R. E. and P. W. Zandstra (2006). "Spatial organization of embryonic stem cell
responsiveness to autocrine gp130 ligands reveals an autoregulatory stem cell niche."
Stem Cells 24(11): 2538-48.
Davis, L. A. and N. I. Zur Nieden (2008). "Mesodermal fate decisions of a stem cell: the Wnt
switch." Cell Mol Life Sci 65(17): 2658-74.
Dawid, I. B. (1994). "Intercellular signaling and gene regulation during early embryogenesis of
Xenopus laevis." J Biol Chem 269(9): 6259-62.
130
De Coppi, P., G. Bartsch, Jr., et al. (2007). "Isolation of amniotic stem cell lines with potential
for therapy." Nat Biotechnol 25(1): 100-6.
de Crombrugghe, B., V. Lefebvre, et al. (2001). "Regulatory mechanisms in the pathways of
cartilage and bone formation." Curr Opin Cell Biol 13(6): 721-7.
DeLise, A. M., L. Fischer, et al. (2000). "Cellular interactions and signaling in cartilage
development." Osteoarthritis Cartilage 8(5): 309-34.
Dessau, W., H. von der Mark, et al. (1980). "Changes in the patterns of collagens and fibronectin
during limb-bud chondrogenesis." J Embryol Exp Morphol 57: 51-60.
Diekman, B. O., C. R. Rowland, et al. (2010). "Chondrogenesis of adult stem cells from adipose
tissue and bone marrow: Induction by growth factors and cartilage derived matrix."
Tissue Eng Part A 16(2): 523-533.
Dietrich, J. E. and T. Hiiragi (2007). "Stochastic patterning in the mouse pre-implantation
embryo." Development 134(23): 4219-31.
Dobrovolskaia-Zavadskaia, N. (1927). "Sur la mortification spontanee de la queue chez la souris
nouveau-nee et sur l'existence d'un caractere heriditaire "non viable"." C R Hebd Seanc
Soc Biol 97: 114-116.
Dorotka, R., U. Windberger, et al. (2005). "Repair of articular cartilage defects treated by
microfracture and a three-dimensional collagen matrix." Biomaterials 26(17): 3617-29.
Draper, J. S., H. D. Moore, et al. (2004). "Culture and characterization of human embryonic stem
cells." Stem Cells Dev 13(4): 325-36.
Dravid, G., Z. Ye, et al. (2005). "Defining the role of Wnt/beta-catenin signaling in the survival,
proliferation, and self-renewal of human embryonic stem cells." Stem Cells 23(10): 1489-
501.
Dufour, S., J. L. Duband, et al. (1986). "Role of a major cell-substratum adhesion system in cell
behavior and morphogenesis." Biol Cell 58(1): 1-13.
Egli, R. J., J. D. Bastian, et al. (2008). "Hypoxic expansion promotes the chondrogenic potential
of articular chondrocytes." J Orthop Res 26(7): 977-85.
Ema, M., S. Takahashi, et al. (2006). "Deletion of the selection cassette, but not cis-acting
elements, in targeted Flk1-lacZ allele reveals Flk1 expression in multipotent mesodermal
progenitors." Blood 107(1): 111-117.
Enomoto-Iwamoto, M., J. Kitagaki, et al. (2002). "The Wnt antagonist Frzb-1 regulates
chondrocyte maturation and long bone development during limb skeletogenesis." Dev
Biol 251(1): 142-56.
Enomoto, H., M. Enomoto-Iwamoto, et al. (2000). "Cbfa1 is a positive regulatory factor in
chondrocyte maturation." J Biol Chem 275(12): 8695-702.
131
Evans, M. J. and M. H. Kaufman (1981). "Establishment in culture of pluripotential cells from
mouse embryos." Nature 292(5819): 154-6.
Evseenko, D., Y. Zhu, et al. (2010). "Mapping the first stages of mesoderm commitment during
differentiation of human embryonic stem cells." Proc Natl Acad Sci U S A 107(31):
13742-7.
Falkner, F. G. and H. G. Zachau (1984). "Correct transcription of an immunoglobulin kappa
gene requires an upstream fragment containing conserved sequence elements." Nature
310(5972): 71-4.
Fanto, M. and H. McNeill (2004). "Planar polarity from flies to vertebrates." J Cell Sci 117(Pt
4): 527-33.
Farquharson, C., J. L. Berry, et al. (1998). "Ascorbic acid-induced chondrocyte terminal
differentiation: the role of the extracellular matrix and 1,25-dihydroxyvitamin D." Eur J
Cell Biol 76(2): 110-8.
Fehling, H. J., G. Lacaud, et al. (2003). "Tracking mesoderm induction and its specification to
the hemangioblast during embryonic stem cell differentiation." Development 130: 4217-
4227.
Feldman, B., W. Poueymirou, et al. (1995). "Requirement of FGF-4 for postimplantation mouse
development." Science 267(5195): 246-9.
Felgner, J. H., R. Kumar, et al. (1994). "Enhanced gene delivery and mechanism studies with a
novel series of cationic lipid formulations." J Biol Chem 269(4): 2550-61.
Felgner, P. L., T. R. Gadek, et al. (1987). "Lipofection: a highly efficient, lipid-mediated DNA-
transfection procedure." Proc Natl Acad Sci U S A 84(21): 7413-7.
Fenderson, B. A., E. M. Eddy, et al. (1990). "Glycoconjugate expression during embryogenesis
and its biological significance." Bioessays 12(4): 173-9.
Flannery, C. R., C. E. Hughes, et al. (1999). "Articular cartilage superficial zone protein (SZP) is
homologous to megakaryocyte stimulating factor precursor and Is a multifunctional
proteoglycan with potential growth-promoting, cytoprotective, and lubricating properties
in cartilage metabolism." Biochem Biophys Res Commun 254(3): 535-41.
Foster, J. W., M. A. Dominguez-Steglich, et al. (1994). "Campomelic dysplasia and autosomal
sex reversal caused by mutations in an SRY-related gene." Nature 372(6506): 525-30.
Fraley, R., S. Subramani, et al. (1980). "Introduction of liposome-encapsulated SV40 DNA into
cells." J Biol Chem 255(21): 10431-5.
Frame, M. C. and G. J. Inman (2008). "NCAM is at the heart of reciprocal regulation of E-
cadherin- and integrin-mediated adhesions via signaling modulation." Dev Cell 15(4):
494-6.
132
Francis-West, P. H., A. Abdelfattah, et al. (1999). "Mechanisms of GDF-5 action during skeletal
development." Development 126(6): 1305-15.
Friedrich, G. and P. Soriano (1991). "Promoter traps in embryonic stem cells: a genetic screen to
identify and mutate developmental genes in mice." Genes Dev 5(9): 1513-23.
Fujiwara, H., Y. Hayashi, et al. (2007). "Regulation of mesodermal differentiation of mouse
embryonic stem cells by basement membranes." J Biol Chem 282(40): 29701-11.
Gabriel, B. and J. Teissie (1997). "Direct observation in the millisecond time range of
fluorescent molecule asymmetrical interaction with the electropermeabilized cell
membrane." Biophys J 73(5): 2630-7.
Gadue, P., T. L. Huber, et al. (2006). "Wnt and TGF-β signaling are required for the induction of
an in vitro model of primitive streak formation using embryonic stem cells." PNAS
103(45): 16806-16811.
Gage, F. H. (2000). "Mammalian neural stem cells." Science 287(5457): 1433-8.
Galceran, J., S. C. Hsu, et al. (2001). "Rescue of a Wnt mutation by an activated form of LEF-1:
regulation of maintenance but not initiation of Brachyury expression." Proc Natl Acad
Sci U S A 98(15): 8668-73.
Gambaro, K., E. Aberdam, et al. (2006). "BMP-4 induces a Smad-dependent apoptotic cell death
of mouse embryonic stem cell-derived neural precursors." Cell Death Differ 13(7): 1075-
87.
Gearing, D. P., M. R. Comeau, et al. (1992). "The IL-6 signal transducer, gp130: an oncostatin
M receptor and affinity converter for the LIF receptor." Science 255(5050): 1434-7.
Ghazizadeh, S. and L. B. Taichman (2001). "Multiple classes of stem cells in cutaneous
epithelium: a lineage analysis of adult mouse skin." Embo J 20(6): 1215-22.
Giese, K., J. Kaufmann, et al. (2002). "Unravelling novel intracellular pathways in cell-based
assays." Drug Discov Today 7(3): 179-86.
Goldring, M. B., K. Tsuchimochi, et al. (2006). "The control of chondrogenesis." J Cell Biochem
97(1): 33-44.
Gong, G., D. Ferrari, et al. (2010). "Direct and progressive differentiation of human embryonic
stem cells into the chondrogenic lineage." J Cell Physiol 224(3): 664-71.
Gouon-Evans, V., L. Boussemart, et al. (2006). "BMP-4 is required for hepatic specification of
mouse embryonic stem cell-derived definitive endoderm." Nat Biotechnol 24(11): 1402-
11.
Graham, F. L., J. Smiley, et al. (1977). "Characteristics of a human cell line transformed by
DNA from human adenovirus type 5." J Gen Virol 36(1): 59-74.
133
Griesbeck, O., G. S. Baird, et al. (2001). "Reducing the environmental sensitivity of yellow
fluorescent protein. Mechanism and applications." J Biol Chem 276(31): 29188-94.
Griffiths, M. J., D. Bonnet, et al. (2005). "Stem cells of the alveolar epithelium." Lancet
366(9481): 249-60.
Groth, A. C., E. C. Olivares, et al. (2000). "A phage integrase directs efficient site-specific
integration in human cells." Proc Natl Acad Sci U S A 97(11): 5995-6000.
Gubbay, J., J. Collignon, et al. (1990). "A gene mapping to the sex-determining region of the
mouse Y chromosome is a member of a novel family of embryonically expressed genes."
Nature 346(6281): 245-50.
Guo, X. and X. F. Wang (2009). "Signaling cross-talk between TGF-beta/BMP and other
pathways." Cell Res 19(1): 71-88.
Gupta, S., C. Verfaillie, et al. (2006). "Isolation and characterization of kidney-derived stem
cells." J Am Soc Nephrol 17(11): 3028-40.
Gurtner, G. C., S. Werner, et al. (2008). "Wound repair and regeneration." Nature 453(7193):
314-21.
Guzman-Ayala, M., N. Ben-Haim, et al. (2004). "Nodal protein processing and fibroblast growth
factor 4 synergize to maintain a trophoblast stem cell microenvironment." Proc Natl Acad
Sci U S A 101(44): 15656-60.
Hadjantonakis, A. K., S. Macmaster, et al. (2002). "Embryonic stem cells and mice expressing
different GFP variants for multiple non-invasive reporter usage within a single animal."
BMC Biotechnol 2: 11.
Hadjantonakis, A. K. and A. Nagy (2001). "The color of mice: in the light of GFP-variant
reporters." Histochem Cell Biol 115(1): 49-58.
Hall, B. K. (1987). "Earliest evidence of cartilage and bone development in embryonic life." Clin
Orthop Relat Res(225): 255-72.
Hammer, M. H., A. Flugel, et al. (2000). "Potential of allospecific gene-engineered T cells in
transplantation gene therapy: specific T cell activation determines transgene expression in
vitro and in vivo." Hum Gene Ther 11(9): 1303-11.
Handy, C. Z. (2005). A Genetic Reporter/Selection System for Optimization of Lineage Specific
Embryonic Stem Cell Differentiation. Institute of Biomaterials and Biomedical
Engineering. Toronto, University of Toronto. MASc: 136.
Hangody, L. and P. Fules (2003). "Autologous osteochondral mosaicplasty for the treatment of
full-thickness defects of weight-bearing joints: ten years of experimental and clinical
experience." J Bone Joint Surg Am 85-A Suppl 2: 25-32.
134
Hanna, J., K. Saha, et al. (2009). "Direct cell reprogramming is a stochastic process amenable to
acceleration." Nature 462(7273): 595-601.
Haraguchi, M., T. Okubo, et al. (2008). "Snail regulates cell-matrix adhesion by regulation of the
expression of integrins and basement membrane proteins." J Biol Chem 283(35): 23514-
23.
Harbour, J. W. and D. C. Dean (2000). "The Rb/E2F pathway: expanding roles and emerging
paradigms." Genes Dev 14(19): 2393-409.
Harbour, J. W., R. X. Luo, et al. (1999). "Cdk phosphorylation triggers sequential intramolecular
interactions that progressively block Rb functions as cells move through G1." Cell 98(6):
859-69.
Harburger, D. S. and D. A. Calderwood (2009). "Integrin signalling at a glance." J Cell Sci
122(Pt 2): 159-63.
Harley, V. R., R. Lovell-Badge, et al. (1994). "Definition of a consensus DNA binding site for
SRY." Nucleic Acids Res 22(8): 1500-1.
Hassler, C., C. M. Cruciat, et al. (2007). "Kremen is required for neural crest induction in
Xenopus and promotes LRP6-mediated Wnt signaling." Development 134(23): 4255-63.
Hata, A., G. Lagna, et al. (1998). "Smad6 inhibits BMP/Smad1 signaling by specifically
competing with the Smad4 tumor suppressor." Genes Dev 12(2): 186-97.
Hayashi, Y., M. K. Furue, et al. (2007). "Integrins regulate mouse embryonic stem cell self-
renewal." Stem Cells 25(12): 3005-15.
Heard, E. (2004). "Recent advances in X-chromosome inactivation." Curr Opin Cell Biol 16(3):
247-55.
Heim, R., A. B. Cubitt, et al. (1995). "Improved green fluorescence." Nature 373(6516): 663-4.
Heim, R., D. C. Prasher, et al. (1994). "Wavelength mutations and posttranslational autoxidation
of green fluorescent protein." Proc Natl Acad Sci U S A 91(26): 12501-4.
Heinegard, D. (2009). "Proteoglycans and more--from molecules to biology." Int J Exp Pathol
90(6): 575-86.
Heisenberg, C. P., M. Tada, et al. (2000). "Silberblick/Wnt11 mediates convergent extension
movements during zebrafish gastrulation." Nature 405(6782): 76-81.
Henderson, J. K., J. S. Draper, et al. (2002). "Preimplantation human embryos and embryonic
stem cells show comparable expression of stage-specific embryonic antigens." Stem Cells
20(4): 329-37.
Heng, B. C., T. Cao, et al. (2004). "Directing stem cell differentiation into the chondrogenic
lineage in vitro." Stem Cells 22(7): 1152-67.
135
Heo, J., J. S. Lee, et al. (2005). "Spontaneous differentiation of mouse embryonic stem cells in
vitro: characterization by global gene expression profiles." Biochem Biophys Res
Commun 332(4): 1061-9.
Herr, W. and M. A. Cleary (1995). "The POU domain: versatility in transcriptional regulation by
a flexible two-in-one DNA-binding domain." Genes Dev 9(14): 1679-93.
Herr, W., R. A. Sturm, et al. (1988). "The POU domain: a large conserved region in the
mammalian pit-1, oct-1, oct-2, and Caenorhabditis elegans unc-86 gene products." Genes
Dev 2(12A): 1513-6.
Herrmann, B. G. and A. Kispert (1994). "The T genes in embryogenesis." Trends Genet 10(8):
280-6.
Herrmann, B. G., S. Labeit, et al. (1990). "Cloning of the T gene required in mesoderm
formation in the mouse." Nature 343(6259): 617-22.
Heuberger, J. and W. Birchmeier (2010). "Interplay of cadherin-mediated cell adhesion and
canonical Wnt signaling." Cold Spring Harb Perspect Biol 2(2): a002915.
Ho, S. T., Z. Yang, et al. (2009). "A serum free approach towards the conservation of
chondrogenic phenotype during in vitro cell expansion." Growth Factors 27(5): 321-33.
Huang, J. I., M. M. Durbhakula, et al. (2006). "Lunate arthroplasty with autologous
mesenchymal stem cells in a rabbit model." J Bone Joint Surg Am 88(4): 744-52.
Huangfu, D., R. Maehr, et al. (2008). "Induction of pluripotent stem cells by defined factors is
greatly improved by small-molecule compounds." Nat Biotechnol 26(7): 795-7.
Hunziker, E. B. (2002). "Articular cartilage repair: basic science and clinical progress. A review
of the current status and prospects." Osteoarthritis Cartilage 10(6): 432-63.
Ihle, J. N. (1996). "STATs: signal transducers and activators of transcription." Cell 84(3): 331-4.
Invitrogen (2006). MultiSite Gateway(R) Pro User Manual, Invitrogen(TM) by Life
Technologies
Irion, S., H. Luche, et al. (2007). "Identification and targeting of the ROSA26 locus in human
embryonic stem cells." Nat Biotechnol 25(12): 1477-82.
Iwamoto, M., E. Koyama, et al. (2005). "The balancing act of transcription factors C-1-1 and
Runx2 in articular cartilage development." Biochem Biophys Res Commun 328(3): 777-
82.
Iwamoto, M., Y. Tamamura, et al. (2007). "Transcription factor ERG and joint and articular
cartilage formation during mouse limb and spine skeletogenesis." Dev Biol 305(1): 40-
51.
136
Izumi, M., H. Miyazawa, et al. (1991). "Blasticidin S-resistance gene (bsr): a novel selectable
marker for mammalian cells." Exp Cell Res 197(2): 229-33.
James, D., A. J. Levine, et al. (2005). "TGFbeta/activin/nodal signaling is necessary for the
maintenance of pluripotency in human embryonic stem cells." Development 132(6):
1273-82.
Jiang, T. X., J. R. Yi, et al. (1993). "Activin enhances chondrogenesis of limb bud cells:
stimulation of precartilaginous mesenchymal condensations and expression of NCAM."
Dev Biol 155(2): 545-57.
Johansson, B. M. and M. V. Wiles (1995). "Evidence for involvement of activin A and bone
morphogenetic protein 4 in mammalian mesoderm and hematopoietic development." Mol
Cell Biol 15(1): 141-51.
Johnstone, B., T. M. Hering, et al. (1998). "In vitro chondrogenesis of bone marrow-derived
mesenchymal progenitor cells." Exp Cell Res 238(1): 265-72.
Jones, P. H., S. Harper, et al. (1995). "Stem cell patterning and fate in human epidermis." Cell
80(1): 83-93.
Jorgensen, R. A., S. J. Rothstein, et al. (1979). "A restriction enzyme cleavage map of Tn5 and
location of a region encoding neomycin resistance." Mol Gen Genet 177(1): 65-72.
Karner, E., C. Unger, et al. (2007). "Bone matrix formation in osteogenic cultures derived from
human embryonic stem cells in vitro." Stem Cells Dev 16(1): 39-52.
Karsenty, G., H. M. Kronenberg, et al. (2009). "Genetic control of bone formation." Annu Rev
Cell Dev Biol 25: 629-48.
Karsenty, G. and E. F. Wagner (2002). "Reaching a genetic and molecular understanding of
skeletal development." Dev Cell 2(4): 389-406.
Katanaev, V. L., R. Ponzielli, et al. (2005). "Trimeric G protein-dependent frizzled signaling in
Drosophila." Cell 120(1): 111-22.
Katzen, F. (2007). "Gateway® recombinational cloning: a biological operating system." Expert
Opin Drug Discov 2(4): 571-589.
Kavsak, P., R. K. Rasmussen, et al. (2000). "Smad7 binds to Smurf2 to form an E3 ubiquitin
ligase that targets the TGF beta receptor for degradation." Mol Cell 6(6): 1365-75.
Kawabata, M., A. Chytil, et al. (1995). "Cloning of a novel type II serine/threonine kinase
receptor through interaction with the type I transforming growth factor-beta receptor." J
Biol Chem 270(10): 5625-30.
Kawaguchi, J., P. J. Mee, et al. (2005). "Osteogenic and chondrogenic differentiation of
embryonic stem cells in response to specific growth factors." Bone 36(5): 758-69.
137
Khan, I. M., J. C. Bishop, et al. (2009). "Clonal chondroprogenitors maintain telomerase activity
and Sox9 expression during extended monolayer culture and retain chondrogenic
potential." Osteoarthritis Cartilage 17(4): 518-28.
Kiefer, J. C. (2007). "Back to basics: Sox genes." Dev Dyn 236(8): 2356-66.
Kim, C. F., E. L. Jackson, et al. (2005). "Identification of bronchioalveolar stem cells in normal
lung and lung cancer." Cell 121(6): 823-35.
Kimura, M., A. Takatsuki, et al. (1994). "Blasticidin S deaminase gene from Aspergillus terreus
(BSD): a new drug resistance gene for transfection of mammalian cells." Biochim
Biophys Acta 1219(3): 653-9.
Kinder, S. J., T. E. Tsang, et al. (1999). "The orderly allocation of mesodermal cells to the
extraembryonic structures and the anteroposterior axis during gastrulation of the mouse
embryo." Development 126(21): 4691-701.
Kispert, A. and B. G. Herrmann (1993). "The Brachyury gene encodes a novel DNA binding
protein." Embo J 12(8): 3211-20.
Kispert, A., B. Koschorz, et al. (1995). "The T protein encoded by Brachyury is a tissue-specific
transcription factor." Embo J 14(19): 4763-72.
Kitagaki, J., M. Iwamoto, et al. (2003). "Activation of beta-catenin-LEF/TCF signal pathway in
chondrocytes stimulates ectopic endochondral ossification." Osteoarthritis Cartilage
11(1): 36-43.
Klemm, J. D. and C. O. Pabo (1996). "Oct-1 POU domain-DNA interactions: cooperative
binding of isolated subdomains and effects of covalent linkage." Genes Dev 10(1): 27-36.
Knudson, C. B. (2003). "Hyaluronan and CD44: strategic players for cell-matrix interactions
during chondrogenesis and matrix assembly." Birth Defects Res C Embryo Today 69(2):
174-96.
Knudson, C. B. and B. P. Toole (1985). "Changes in the pericellular matrix during differentiation
of limb bud mesoderm." Dev Biol 112(2): 308-18.
Koay, E. J. and K. A. Athanasiou (2008). "Hypoxic chondrogenic differentiation of human
embryonic stem cells enhances cartilage protein synthesis and biomechanical
functionality." Osteoarthritis Cartilage 16(12): 1450-6.
Koay, E. J., G. M. B. Hoben, et al. (2007). "Tissue engineering with chondrogenically
differentiated human embryonic stem cells." Stem Cells 25(9): 2183-90.
Kobayashi, N., J. D. Rivas-Carrillo, et al. (2005). "Gene delivery to embryonic stem cells." Birth
Defects Res C Embryo Today 75(1): 10-8.
Koenig, B. B., J. S. Cook, et al. (1994). "Characterization and cloning of a receptor for BMP-2
and BMP-4 from NIH 3T3 cells." Mol Cell Biol 14(9): 5961-74.
138
Kogler, G., S. Sensken, et al. (2004). "A new human somatic stem cell from placental cord blood
with intrinsic pluripotent differentiation potential." J Exp Med 200(2): 123-35.
Komori, T., H. Yagi, et al. (1997). "Targeted disruption of Cbfa1 results in a complete lack of
bone formation owing to maturational arrest of osteoblasts." Cell 89(5): 755-64.
Kramer, J., C. Hegert, et al. (2000). "Embryonic stem cell-derived chondrogenic differentiation
in vitro: activation by BMP-2 and BMP-4." Mech Dev 92(2): 193-205.
Kramer, J., C. Hegert, et al. (2005). "Mouse ES cell lines show a variable degree of
chondrogenic differentiation in vitro." Cell Biol Int 29(2): 139-46.
Kubo, A., K. Shinozaki, et al. (2004). "Development of definitive endoderm from embryonic
stem cells in culture." Development 131(7): 1651-62.
Kulyk, W. M., W. B. Upholt, et al. (1989). "Fibronectin gene expression during limb cartilage
differentiation." Development 106(3): 449-55.
Kuo, C. K., W. J. Li, et al. (2006). "Cartilage tissue engineering: its potential and uses." Curr
Opin Rheumatol 18(1): 64-73.
Kuroda, R., K. Ishida, et al. (2007). "Treatment of a full-thickness articular cartilage defect in the
femoral condyle of an athlete with autologous bone-marrow stromal cells." Osteoarthritis
Cartilage 15(2): 226-31.
Lako, M., S. Lindsay, et al. (2001). "Characterisation of Wnt gene expression during the
differentiation of murine embryonic stem cells in vitro: role of Wnt3 in enhancing
haematopoietic differentiation." Mech Dev 103: 49-59.
Lamb, K. A. and A. Rizzino (1998). "Effects of differentiation on the transcriptional regulation
of the FGF-4 gene: critical roles played by a distal enhancer." Mol Reprod Dev 51(2):
218-24.
Landy, A. (1989). "Dynamic, structural, and regulatory aspects of lambda site-specific
recombination." Annu Rev Biochem 58: 913-49.
Larue, L., C. Antos, et al. (1996). "A role for cadherins in tissue formation." Development
122(10): 3185-94.
Lavker, R. M. and T. T. Sun (1983). "Epidermal stem cells." J Invest Dermatol 81(1 Suppl):
121s-7s.
Lawson, K. A., J. J. Meneses, et al. (1991). "Clonal analysis of epiblast fate during germ layer
formation in the mouse embryo." Development 113(3): 891-911.
Lee, J. Y., Z. Qu-Petersen, et al. (2000). "Clonal isolation of muscle-derived cells capable of
enhancing muscle regeneration and bone healing." J Cell Biol 150(5): 1085-100.
139
Lee, L. H., R. Peerani, et al. (2009). "Micropatterning of human embryonic stem cells dissects
the mesoderm and endoderm lineages." Stem Cell Res 2(2): 155-62.
Lefebvre, V., W. Huang, et al. (1997). "SOX9 is a potent activator of the chondrocyte-specific
enhancer of the Proα1(II) collagen gene." Mol Cell Biol 17(4): 2336-2346.
Lefebvre, V., P. Li, et al. (1998). "A new long form of Sox5 (L-Sox5), Sox6 and Sox9 are
coexpressed in chondrogenesis and cooperatively activate the type II collagen gene."
Embo J 17(19): 5718-33.
Lefebvre, V. and P. Smits (2005). "Transcriptional control of chondrocyte fate and
differentiation." Birth Defects Res C Embryo Today 75(3): 200-12.
Lewandoski, M. (2001). "Conditional control of gene expression in the mouse." Nature Reviews
Genetics 2(10): 743-755.
Lieu, P. T., T. Machleidt, et al. (2009). "Generation of site-specific retargeting platform cell lines
for drug discovery using phiC31 and R4 integrases." J Biomol Screen 14(10): 1207-15.
Lindsley, R. C., J. G. Gill, et al. (2006). "Canonical Wnt signaling is required for development of
embryonic stem cell-derived mesoderm." Development 133(19): 3787-96.
Linsenmayer, T. F., R. L. Trelstad, et al. (1973). "The collagen of osteogenic cartilage in the
embryonic chick." Biochem Biophys Res Commun 52(3): 870-6.
Liu, C., Y. Kato, et al. (1999). "beta-Trcp couples beta-catenin phosphorylation-degradation and
regulates Xenopus axis formation." Proc Natl Acad Sci U S A 96(11): 6273-8.
Liu, P., M. Wakamiya, et al. (1999). "Requirement for Wnt3 in vertebrate axis formation." Nat
Genet 22(4): 361-5.
Loebel, D. A. F., C. M. Watson, et al. (2003). "Lineage choice and differentiation in mouse
embryos and embryonic stem cells." Developmental Biology 264: 1-14.
Logan, C. Y. and R. Nusse (2004). "The Wnt signaling pathway in development and disease."
Annu Rev Cell Dev Biol 20: 781-810.
Lu, W., V. Yamamoto, et al. (2004). "Mammalian Ryk is a Wnt coreceptor required for
stimulation of neurite outgrowth." Cell 119(1): 97-108.
Macias-Silva, M., P. A. Hoodless, et al. (1998). "Specific activation of Smad1 signaling
pathways by the BMP7 type I receptor, ALK2." J Biol Chem 273(40): 25628-36.
Mackay, A. M., S. C. Beck, et al. (1998). "Chondrogenic differentiation of cultured human
mesenchymal stem cells from marrow." Tissue Eng 4(4): 415-28.
Maherali, N. and K. Hochedlinger (2008). "Guidelines and techniques for the generation of
induced pluripotent stem cells." Cell Stem Cell 3(6): 595-605.
140
Maltman, D. J. and S. A. Przyborski (2010). "Developments in three-dimensional cell culture
technology aimed at improving the accuracy of in vitro analyses." Biochem Soc Trans
38(4): 1072-5.
Mao, B., W. Wu, et al. (2002). "Kremen proteins are Dickkopf receptors that regulate Wnt/beta-
catenin signalling." Nature 417(6889): 664-7.
Mao, B., W. Wu, et al. (2001). "LDL-receptor-related protein 6 is a receptor for Dickkopf
proteins." Nature 411(6835): 321-5.
Mao, J., J. Wang, et al. (2001). "Low-density lipoprotein receptor-related protein-5 binds to Axin
and regulates the canonical Wnt signaling pathway." Mol Cell 7(4): 801-9.
Martin, B. L. and D. Kimelman (2008). "Regulation of canonical Wnt signaling by Brachyury is
essential for posterior mesoderm formation." Dev Cell 15(1): 121-33.
Martin, G. R. (1981). "Isolation of a pluripotent cell line from early mouse embryos cultured in
medium conditioned by teratocarcinoma stem cells." Proc Natl Acad Sci U S A 78(12):
7634-8.
Masaki, H. and H. Ide (2007). "Regeneration potency of mouse limbs." Dev Growth Differ
49(2): 89-98.
Matsuda, T., T. Nakamura, et al. (1999). "STAT3 activation is sufficient to maintain an
undifferentiated state of mouse embryonic stem cells." Embo J 18(15): 4261-9.
Matz, M. V., A. F. Fradkov, et al. (1999). "Fluorescent proteins from nonbioluminescent
Anthozoa species." Nat Biotechnol 17(10): 969-73.
McCall, J. G. (1969). "Load-deformation studies of articular cartilage." J Anat 105(Pt 1): 212-4.
McDevitt, T. C., R. L. Carpenedo, et al. (2008). "Engineering the 3D microenvironment of
embryonic stem cells undergoing differentiation." Biomed Mater Eng 18(4-5): 179-81.
McMahon, A. P. (1992). "The Wnt family of developmental regulators." Trends Genet 8: 236-
242.
Messina, E., L. De Angelis, et al. (2004). "Isolation and expansion of adult cardiac stem cells
from human and murine heart." Circ Res 95(9): 911-21.
Metallo, C. M., S. M. Azarin, et al. (2008). "Engineering tissue from human embryonic stem
cells." J Cell Mol Med 12(3): 709-29.
Metallo, C. M., J. C. Mohr, et al. (2007). "Engineering the stem cell microenvironment."
Biotechnol Prog 23(1): 18-23.
Mikels, A. J. and R. Nusse (2006). "Purified Wnt5a protein activates or inhibits beta-catenin-
TCF signaling depending on receptor context." PLoS Biol 4(4): e115.
141
Mimeault, M., R. Hauke, et al. (2007). "Stem cells: a revolution in therapeutics-recent advances
in stem cell biology and their therapeutic applications in regenerative medicine and
cancer therapies." Clin Pharmacol Ther 82(3): 252-64.
Minas, T. and S. Nehrer (1997). "Current concepts in the treatment of articular cartilage defects."
Orthopedics 20(6): 525-38.
Mitchell, K. E., M. L. Weiss, et al. (2003). "Matrix cells from Wharton's jelly form neurons and
glia." Stem Cells 21(1): 50-60.
Mitsui, K., Y. Tokuzawa, et al. (2003). "The homeoprotein Nanog is required for maintenance of
pluripotency in mouse epiblast and ES cells." Cell 113(5): 631-42.
Miyabayashi, T., J. L. Teo, et al. (2007). "Wnt/beta-catenin/CBP signaling maintains long-term
murine embryonic stem cell pluripotency." Proc Natl Acad Sci U S A 104(13): 5668-73.
Moreno-Bueno, G., F. Portillo, et al. (2008). "Transcriptional regulation of cell polarity in EMT
and cancer." Oncogene 27(55): 6958-69.
Morshead, C. M., B. A. Reynolds, et al. (1994). "Neural stem cells in the adult mammalian
forebrain: a relatively quiescent subpopulation of subependymal cells." Neuron 13(5):
1071-82.
Moustakas, A. and C. H. Heldin (2002). "From mono- to oligo-Smads: the heart of the matter in
TGF-beta signal transduction." Genes Dev 16(15): 1867-71.
Moustakas, A. and C. H. Heldin (2009). "The regulation of TGFbeta signal transduction."
Development 136(22): 3699-714.
Mrugala, D., C. Bony, et al. (2008). "Phenotypic and functional characterisation of ovine
mesenchymal stem cells: application to a cartilage defect model." Ann Rheum Dis 67(3):
288-95.
Muramatsu, T., Y. Mizutani, et al. (1997). "Comparison of three nonviral transfection methods
for foreign gene expression in early chicken embryos in ovo." Biochem Biophys Res
Commun 230(2): 376-80.
Murry, C. E. and G. Keller (2008). "Differentiation of embryonic stem cells to clinically relevant
populations: lessons from embryonic development." Cell 132: 661-680.
Nagai, T., K. Ibata, et al. (2002). "A variant of yellow fluorescent protein with fast and efficient
maturation for cell-biological applications." Nat Biotechnol 20(1): 87-90.
Nagy, A. (2000). "Cre recombinase: the universal reagent for genome tailoring." Genesis 26: 99-
109.
Nagy, A., J. Rossant, et al. (1993). "Derivation of completely cell culture-derived mice from
early-passage embryonic stem cells." Proc Natl Acad Sci U S A 90(18): 8424-8.
142
Naito, A. T., I. Shiojima, et al. (2006). "Developmental stage-specific biphasic roles of Wnt/beta-
catenin signaling in cardiomyogenesis and hematopoiesis." Proc Natl Acad Sci U S A
103(52): 19812-7.
Nakagawa, T., S. Y. Lee, et al. (2009). "Induction of chondrogenesis from human embryonic
stem cells without embryoid body formation by bone morphogenetic protein 7 and
transforming growth factor beta1." Arthritis Rheum 60(12): 3686-92.
Nakaya, Y. and G. Sheng (2008). "Epithelial to mesenchymal transition during gastrulation: an
embryological view." Dev Growth Differ 50(9): 755-66.
Nakaya, Y., E. W. Sukowati, et al. (2008). "RhoA and microtubule dynamics control cell-
basement membrane interaction in EMT during gastrulation." Nat Cell Biol 10(7): 765-
75.
Nakayama, N., D. Duryea, et al. (2003). "Macroscopic cartilage formation with embryonic stem-
cell-derived mesodermal progenitor cells." J Cell Sci 116(Pt 10): 2015-28.
Nesic, D., R. Whiteside, et al. (2006). "Cartilage tissue engineering for degenerative joint
disease." Adv Drug Deliv Rev 58(2): 300-22.
Ng, E. S., L. Azzola, et al. (2005). "The primitive streak gene Mixl1 is required for efficient
haematopoiesis and BMP4-induced ventral mesoderm patterning in differentiating ES
cells." Development 132(5): 873-84.
Nichols, J., B. Zevnik, et al. (1998). "Formation of pluripotent stem cells in the mammalian
embryo depends on the POU transcription factor Oct4." Cell 95(3): 379-91.
Niebruegge, S., C. L. Bauwens, et al. (2009). "Generation of human embryonic stem cell-derived
mesoderm and cardiac cells using size-specified aggregates in an oxygen-controlled
bioreactor." Biotechnol Bioeng 102(2): 493-507.
Nishikawa, S., R. A. Goldstein, et al. (2008). "The promise of human induced pluripotent stem
cells for research and therapy." Nat Rev Mol Cell Biol 9(9): 725-9.
Nishikawa, S. I., S. Nishikawa, et al. (1998). "Progressive lineage analysis by cell sorting and
culture identifies FLK1+VE-cadherin+ cells at a diverging point of endothelial and
hemopoietic lineages." Development 125(9): 1747-57.
Niswander, L. and G. R. Martin (1992). "Fgf-4 expression during gastrulation, myogenesis, limb
and tooth development in the mouse." Development 114(3): 755-68.
Niwa, H., T. Burdon, et al. (1998). "Self-renewal of pluripotent embryonic stem cells is mediated
via activation of STAT3." Genes Dev 12(13): 2048-60.
Niwa, H., J. Miyazaki, et al. (2000). "Quantitative expression of Oct-3/4 defines differentiation,
dedifferentiation or self-renewal of ES cells." Nat Genet 24(4): 372-6.
143
Niwa, H., Y. Toyooka, et al. (2005). "Interaction between Oct3/4 and Cdx2 determines
trophectoderm differentiation." Cell 123(5): 917-29.
Niwa, H., K. Yamamura, et al. (1991). "Efficient selection for high-expression transfectants with
a novel eukaryotic vector." Gene 108(2): 193-9.
Norris, D. P. and E. J. Robertson (1999). "Asymmetric and node-specific nodal expression
patterns are controlled by two distinct cis-acting regulatory elements." Genes Dev 13(12):
1575-88.
Nostro, M. C., X. Cheng, et al. (2008). "Wnt, activin, and BMP signaling regulate distinct stages
in the developmental pathway from embryonic stem cells to blood." Cell Stem Cell 2(1):
60-71.
Oganesian, A., Y. Zhu, et al. (1996). "Localization of type IIA procollagen during
chondrogenesis." Ann N Y Acad Sci 785: 311-3.
Oganesian, A., Y. Zhu, et al. (1997). "Type IIA procollagen amino propeptide is localized in
human embryonic tissues." J Histochem Cytochem 45(11): 1469-80.
Oh, S. P. and E. Li (1997). "The signaling pathway mediated by the type IIB activin receptor
controls axial patterning and lateral asymmetry in the mouse." Genes Dev 11(14): 1812-
26.
Oishi, I., H. Suzuki, et al. (2003). "The receptor tyrosine kinase Ror2 is involved in non-
canonical Wnt5a/JNK signalling pathway." Genes Cells 8(7): 645-54.
Okamoto, K., H. Okazawa, et al. (1990). "A novel octamer binding transcription factor is
differentially expressed in mouse embryonic cells." Cell 60(3): 461-72.
Okita, K., M. Nakagawa, et al. (2008). "Generation of mouse induced pluripotent stem cells
without viral vectors." Science 322(5903): 949-53.
Olsen, B. R., A. M. Reginato, et al. (2000). "Bone development." Annu Rev Cell Dev Biol 16:
191-220.
Orkin, S. H. and L. I. Zon (2008). "Hematopoiesis: an evolving paradigm for stem cell biology."
Cell 132(4): 631-44.
Ormo, M., A. B. Cubitt, et al. (1996). "Crystal structure of the Aequorea victoria green
fluorescent protein." Science 273(5280): 1392-5.
Otto, F., A. P. Thornell, et al. (1997). "Cbfa1, a candidate gene for cleidocranial dysplasia
syndrome, is essential for osteoblast differentiation and bone development." Cell 89(5):
765-71.
Parameswaran, M. and P. P. Tam (1995). "Regionalisation of cell fate and morphogenetic
movement of the mesoderm during mouse gastrulation." Dev Genet 17(1): 16-28.
144
Park, C., I. Afrikanova, et al. (2004). "A hierarchical order of factors in the generation of FLK1-
and SCL-expressing hematopoietic and endothelial progenitors from embryonic stem
cells." Development 131(11): 2749-62.
Parslow, T. G., D. L. Blair, et al. (1984). "Structure of the 5' ends of immunoglobulin genes: a
novel conserved sequence." Proc Natl Acad Sci U S A 81(9): 2650-4.
Pera, M. F. and P. P. Tam (2010). "Extrinsic regulation of pluripotent stem cells." Nature
465(7299): 713-20.
Pesce, M., M. K. Gross, et al. (1998). "In line with my ancestors: Oct-4 and the mammalian
germ." Bioessays 20(9): 722-32.
Peterson, L., M. Brittberg, et al. (2002). "Autologous chondrocyte transplantation. Biomechanics
and long-term durability." Am J Sports Med 30(1): 2-12.
Poole, A. R. (1986). "Proteoglycans in health and disease: structures and functions." Biochem J
236(1): 1-14.
Poole, A. R., T. Kojima, et al. (2001). "Composition and structure of articular cartilage: a
template for tissue repair." Clin Orthop Relat Res(391 Suppl): S26-33.
Primrose, S. B., R. M. Twyman, et al. (2001). Advances in transgenic technology. Principles of
gene manipulation. Oxford, Blackwell Science Ltd.: 253-259.
Primrose, S. B., R. M. Twyman, et al. (2001). Gene transfer to animal cells. Principles of gene
manipulation. Oxford, Blackwell Science Ltd.: 174-201.
Provot, S. and E. Schipani (2005). "Molecular mechanisms of endochondral bone development."
Biochem Biophys Res Commun 328(3): 658-65.
Purpura, K. A., J. Morin, et al. (2008). "Analysis of the temporal and concentration-dependent
effects of BMP-4, VEGF, and TPO on development of embryonic stem cell-derived
mesoderm and blood progenitors in a defined, serum-free media." Exp Hematol 36(9):
1186-98.
Rahimi, R. A. and E. B. Leof (2007). "TGF-beta signaling: a tale of two responses." J Cell
Biochem 102(3): 593-608.
Ralston, A. and J. Rossant (2008). "Cdx2 acts downstream of cell polarization to cell-
autonomously promote trophectoderm fate in the early mouse embryo." Dev Biol 313(2):
614-29.
Rao, T. P. and M. Kuhl (2010). "An updated overview on Wnt signaling pathways: a prelude for
more." Circ Res 106(12): 1798-806.
Rappolee, D. A., C. Basilico, et al. (1994). "Expression and function of FGF-4 in peri-
implantation development in mouse embryos." Development 120(8): 2259-69.
145
Reissmann, E., H. Jornvall, et al. (2001). "The orphan receptor ALK7 and the Activin receptor
ALK4 mediate signaling by Nodal proteins during vertebrate development." Genes Dev
15(15): 2010-22.
Reubinoff, B. E., M. F. Pera, et al. (2000). "Embryonic stem cell lines from human blastocysts:
somatic differentiation in vitro." Nat Biotechnol 18(4): 399-404.
Robins, J. C., N. Akeno, et al. (2005). "Hypoxia induces chondrocyte-specific gene expression in
mesenchymal cells in association with transcriptional activation of Sox9." Bone 37(3):
313-22.
Rodriguez, T. A., S. Srinivas, et al. (2005). "Induction and migration of the anterior visceral
endoderm is regulated by the extra-embryonic ectoderm." Development 132(11): 2513-
20.
Rosenzweig, B. L., T. Imamura, et al. (1995). "Cloning and characterization of a human type II
receptor for bone morphogenetic proteins." Proc Natl Acad Sci U S A 92(17): 7632-6.
Rosner, M. H., M. A. Vigano, et al. (1990). "A POU-domain transcription factor in early stem
cells and germ cells of the mammalian embryo." Nature 345(6277): 686-92.
Ross, M. H., G. I. Kaye, et al. (2003). Cartilage. Histology: a text and atlas: with cell and
molecular biology. Philadelphia, Lippincott Williams and Wilkins: 164-179.
Rossant, J. (1986). Development of extraembryonic cell lineages in the mouse embryo.
Experimental approaches to mammalian embryonic development. J. Rossant and R. A.
Pedersen. Cambridge, Cambridge University Press: 97-120.
Rossant, J. and P. P. Tam (2009). "Blastocyst lineage formation, early embryonic asymmetries
and axis patterning in the mouse." Development 136(5): 701-13.
Rotter, N., J. Oder, et al. (2008). "Isolation and characterization of adult stem cells from human
salivary glands." Stem Cells Dev 17(3): 509-18.
Ryan, M. C. and L. J. Sandell (1990). "Differential expression of a cysteine-rich domain in the
amino-terminal propeptide of type II (cartilage) procollagen by alternative splicing of
mRNA." J Biol Chem 265(18): 10334-9.
Saburi, S. and H. McNeill (2005). "Organising cells into tissues: new roles for cell adhesion
molecules in planar cell polarity." Curr Opin Cell Biol 17(5): 482-8.
Sadowski, P. D. (1995). "The Flp recombinase of the 2-microns plasmid of Saccharomyces
cerevisiae." Prog Nucleic Acid Res Mol Biol 51: 53-91.
Sagrinati, C., G. S. Netti, et al. (2006). "Isolation and characterization of multipotent progenitor
cells from the Bowman's capsule of adult human kidneys." J Am Soc Nephrol 17(9):
2443-56.
146
Saito, S., B. Liu, et al. (2004). "Animal embryonic stem (ES) cells: self-renewal, pluripotency,
transgenesis and nuclear transfer." Hum Cell 17(3): 107-15.
Sakai, Y., Y. Yoshiura, et al. (2011). "Embryoid body culture of mouse embryonic stem cells
using microwell and micropatterned chips." J Biosci Bioeng 111(1):85-91.
Sakurai, H., T. Era, et al. (2006). "In vitro modeling of paraxial and lateral mesoderm
differentiation reveals early reversibility." Stem Cells 24(3): 575-86.
Sakurai, H., Y. Inami, et al. (2009). "Bidirectional induction toward paraxial mesodermal
derivatives from mouse ES cells in chemically defined medium." Stem Cell Res 3(2-3):
157-69.
Sakurai, H., Y. Okawa, et al. (2008). "Paraxial mesodermal progenitors derived from mouse
embryonic stem cells contribute to muscle regeneration via differentiation into muscle
satellite cells." Stem Cells 26(7): 1865-73.
Sarugaser, R., L. Hanoun, et al. (2009). "Human mesenchymal stem cells self-renew and
differentiate according to a deterministic hierarchy." PLoS One 4(8): e6498.
Sarugaser, R., D. Lickorish, et al. (2005). "Human umbilical cord perivascular (HUCPV) cells: a
source of mesenchymal progenitors." Stem Cells 23(2): 220-9.
Sato, N., L. Meijer, et al. (2004). "Maintenance of pluripotency in human and mouse embryonic
stem cells through activation of Wnt signaling by a pharmacological GSK3-specific
inhibitor." Nat Med 10(1): 55-63.
Sauer, B. (1998). "Inducible gene targeting in mice using the Cre/lox system." Methods 14(4):
381-92.
Sauer, B. and N. Henderson (1989). "Cre-stimulated recombination at loxP-containing DNA
sequences placed into the mammalian genome." Nucleic Acids Res 17(1): 147-161.
Savatier, P., S. Huang, et al. (1994). "Contrasting patterns of retinoblastoma protein expression
in mouse embryonic stem cells and embryonic fibroblasts." Oncogene 9(3): 809-18.
Savatier, P., H. Lapillonne, et al. (1996). "Withdrawal of differentiation inhibitory
activity/leukemia inhibitory factor up-regulates D-type cyclins and cyclin-dependent
kinase inhibitors in mouse embryonic stem cells." Oncogene 12(2): 309-22.
Schlaepfer, D. D., S. K. Hanks, et al. (1994). "Integrin-mediated signal transduction linked to
Ras pathway by GRB2 binding to focal adhesion kinase." Nature 372(6508): 786-91.
Scholer, H. R., G. R. Dressler, et al. (1990). "Oct-4: a germline-specific transcription factor
mapping to the mouse t-complex." Embo J 9(7): 2185-95.
Scholer, H. R., A. K. Hatzopoulos, et al. (1989). "A family of octamer-specific proteins present
during mouse embryogenesis: evidence for germline-specific expression of an Oct
factor." Embo J 8(9): 2543-50.
147
Scholer, H. R., S. Ruppert, et al. (1990). "New type of POU domain in germ line-specific protein
Oct-4." Nature 344(6265): 435-9.
Schumacher, B. L., C. E. Hughes, et al. (1999). "Immunodetection and partial cDNA sequence of
the proteoglycan, superficial zone protein, synthesized by cells lining synovial joints." J
Orthop Res 17(1): 110-20.
Seaberg, R. M., S. R. Smukler, et al. (2004). "Clonal identification of multipotent precursors
from adult mouse pancreas that generate neural and pancreatic lineages." Nat Biotechnol
22(9): 1115-24.
Seo, J. H., A. Suenaga, et al. (2009). "Structural and functional basis of a role for CRKL in a
fibroblast growth factor 8-induced feed-forward loop." Mol Cell Biol 29(11): 3076-87.
Shao, X., J. C. Goh, et al. (2006). "Repair of large articular osteochondral defects using hybrid
scaffolds and bone marrow-derived mesenchymal stem cells in a rabbit model." Tissue
Eng 12(6): 1539-51.
Shawlot, W., M. Wakamiya, et al. (1999). "Lim1 is required in both primitive streak-derived
tissues and visceral endoderm for head formation in the mouse." Development 126(22):
4925-32.
Shen, M. M. (2007). "Nodal signaling: developmental roles and regulation." Development
134(6): 1023-34.
Shi, Y. and J. Massague (2003). "Mechanisms of TGF-beta signaling from cell membrane to the
nucleus." Cell 113(6): 685-700.
Shimomura, O., F. H. Johnson, et al. (1962). "Extraction, purification and properties of aequorin,
a bioluminescent protein from the luminous hydromedusan, Aequorea." J Cell Comp
Physiol 59: 223-39.
Siminovitch, L., E. A. McCulloch, et al. (1963). "The Distribution of Colony-Forming Cells
among Spleen Colonies." J Cell Physiol 62: 327-36.
Sinclair, A. H., P. Berta, et al. (1990). "A gene from the human sex-determining region encodes
a protein with homology to a conserved DNA-binding motif." Nature 346(6281): 240-4.
Smith, A. (1998). "Cell therapy: in search of pluripotency." Curr Biol 8(22): R802-4.
Smith, A. G. (2001). "Embryo-derived stem cells: of mice and men." Annu Rev Cell Dev Biol
17: 435-62.
Smith, A. G., J. K. Heath, et al. (1988). "Inhibition of pluripotential embryonic stem cell
differentiation by purified polypeptides." Nature 336(6200): 688-90.
Smits, P., P. Li, et al. (2001). "The transcription factors L-Sox5 and Sox6 are essential for
cartilage formation." Dev Cell 1(2): 277-90.
148
Solter, D. and B. B. Knowles (1979). "Developmental stage-specific antigens during mouse
embryogenesis." Curr Top Dev Biol 13 Pt 1: 139-65.
Song, J., S. P. Oh, et al. (1999). "The type II activin receptors are essential for egg cylinder
growth, gastrulation, and rostral head development in mice." Dev Biol 213(1): 157-69.
Soriano, P. (1999). "Generalized lacZ expression with the ROSA26 Cre reporter strain." Nat
Genet 21(1): 70-1.
Stadtfeld, M., M. Nagaya, et al. (2008). "Induced pluripotent stem cells generated without viral
integration." Science 322(5903): 945-9.
Stanley, E. G., C. Biben, et al. (2002). "Efficient Cre-mediated deletion in cardiac progenitor
cells conferred by a 3'UTR-ires-Cre allele of the homeobox gene Nkx2-5." Int J Dev Biol
46(4): 431-9.
Stead, E., J. White, et al. (2002). "Pluripotent cell division cycles are driven by ectopic Cdk2,
cyclin A/E and E2F activities." Oncogene 21(54): 8320-33.
Steinert, A. F., S. C. Ghivizzani, et al. (2007). "Major biological obstacles for persistent cell-
based regeneration of articular cartilage." Arthritis Res Ther 9(3): 213.
Sternberg, N., D. Hamilton, et al. (1981). "Bacteriophage P1 site-specific recombination. II.
Recombination between loxP and the bacterial chromosome." J Mol Biol 150(4): 487-
507.
Stocum, D. L. (2002). "Regenerative biology and medicine." J Musculoskelet Neuronal Interact
2(3): 270-3.
Sucheston, M. E. and M. S. Cannon (1969). "Variations in the appearance of human elastic
cartilage." The Ohio Journal of Science 69(6): 366-371.
Sun, T., S. Jackson, et al. (2006). "Culture of skin cells in 3D rather than 2D improves their
ability to survive exposure to cytotoxic agents." J Biotechnol 122(3): 372-81.
Surani, M. A., K. Hayashi, et al. (2007). "Genetic and epigenetic regulators of pluripotency."
Cell 128(4): 747-62.
Sutcliffe, J. G. (1978). "Nucleotide sequence of the ampicillin resistance gene of Escherichia coli
plasmid pBR322." Proc Natl Acad Sci U S A 75(8): 3737-41.
Suzuki, A., A. Raya, et al. (2006). "Nanog binds to Smad1 and blocks bone morphogenetic
protein-induced differentiation of embryonic stem cells." PNAS 103(27): 10294-10299.
Suzuki, C., G. Murakami, et al. (2002). "Smurf1 regulates the inhibitory activity of Smad7 by
targeting Smad7 to the plasma membrane." J Biol Chem 277(42): 39919-25.
Swieszkowski, W., B. H. Tuan, et al. (2007). "Repair and regeneration of osteochondral defects
in the articular joints." Biomol Eng 24(5): 489-95.
149
Tada, S., T. Era, et al. (2005). "Characterization of mesendoderm: a diverging point of the
definitive endoderm and mesoderm in embryonic stem cell differentiation culture."
Development 132(19): 4363-4374.
Takahashi, K., K. Tanabe, et al. (2007). "Induction of pluripotent stem cells from adult human
fibroblasts by defined factors." Cell 131(5): 861-72.
Takahashi, K. and S. Yamanaka (2006). "Induction of pluripotent stem cells from mouse
embryonic and adult fibroblast cultures by defined factors." Cell 126(4): 663-76.
Takashima, Y., T. Era, et al. (2007). "Neuroepithelial cells supply an initial transient wave of
MSC differentiation." Cell 129(7): 1377-88.
Takeichi, M. (1995). "Morphogenetic roles of classic cadherins." Curr Opin Cell Biol 7(5): 619-
27.
Takenaga, M., M. Fukumoto, et al. (2007). "Regulated Nodal signaling promotes differentiation
of the definitive endoderm and mesoderm from ES cells." J Cell Sci 120(Pt 12): 2078-90.
Tam, P. P., J. M. Gad, et al. (2001). "Morphogenetic tissue movement and the establishment of
body plan during development from blastocyst to gastrula in the mouse." Bioessays
23(6): 508-17.
Tam, P. P., P. L. Khoo, et al. (2004). "Regionalization of cell fates and cell movement in the
endoderm of the mouse gastrula and the impact of loss of Lhx1(Lim1) function." Dev
Biol 274(1): 171-87.
Tam, P. P. and D. A. Loebel (2007). "Gene function in mouse embryogenesis: get set for
gastrulation." Nat Rev Genet 8(5): 368-81.
Tam, P. P., D. A. Loebel, et al. (2006). "Building the mouse gastrula: signals, asymmetry and
lineages." Curr Opin Genet Dev 16(4): 419-25.
Tam, P. P. and J. Rossant (2003). "Mouse embryonic chimeras: tools for studying mammalian
development." Development 130(25): 6155-63.
Tamai, K., X. Zeng, et al. (2004). "A mechanism for Wnt coreceptor activation." Mol Cell 13(1):
149-56.
Tamamura, Y., T. Otani, et al. (2005). "Developmental regulation of Wnt/beta-catenin signals is
required for growth plate assembly, cartilage integrity, and endochondral ossification." J
Biol Chem 280(19): 19185-95.
Tanaka, M., V. Jokubaitis, et al. (2009). "BMP inhibition stimulates WNT-dependent generation
of chondrogenic mesoderm from embryonic stem cells." Stem Cell Res 3(2-3): 126-41.
Technau, U. (2001). "Brachyury, the blastopore and the evolution of the mesoderm." Bioessays
23(9): 788-94.
150
ten Berge, D., W. Koole, et al. (2008). "Wnt signaling mediates self-organization and axis
formation in embryoid bodies." Cell Stem Cell 3(5): 508-18.
ten Dijke, P., H. Yamashita, et al. (1994). "Identification of type I receptors for osteogenic
protein-1 and bone morphogenetic protein-4." J Biol Chem 269(25): 16985-8.
Thiery, J. P. and J. P. Sleeman (2006). "Complex networks orchestrate epithelial-mesenchymal
transitions." Nat Rev Mol Cell Biol 7(2): 131-42.
Thomson, J. A., J. Itskovitz-Eldor, et al. (1998). "Embryonic stem cell lines derived from human
blastocysts." Science 282(5391): 1145-7.
Thorpe, H. M., S. E. Wilson, et al. (2000). "Control of directionality in the site-specific
recombination system of the Streptomyces phage phiC31." Mol Microbiol 38(2): 232-41.
Thyagarajan, B., E. C. Olivares, et al. (2001). "Site-specific genomic integration in mammalian
cells mediated by phage phiC31 integrase." Mol Cell Biol 21(12): 3926-34.
Tiberghien, P. (2001). "Use of suicide gene-expressing donor T-cells to control alloreactivity
after haematopoietic stem cell transplantation." J Intern Med 249(4): 369-77.
Till, J. E. and E. A. McCulloch (1963). "Early repair processes in marrow cells irradiated and
proliferating in vivo." Radiat Res 18: 96-105.
Toh, W. S., Z. Yang, et al. (2007). "Effects of culture conditions and bone morphogenetic protein
2 on extent of chondrogenesis from human embryonic stem cells." Stem Cells 25(4): 950-
60.
Tranchant, I., B. Thompson, et al. (2004). "Physicochemical optimisation of plasmid delivery by
cationic lipids." J Gene Med 6 Suppl 1: S24-35.
Tree, D. R., J. M. Shulman, et al. (2002). "Prickle mediates feedback amplification to generate
asymmetric planar cell polarity signaling." Cell 109(3): 371-81.
Tropepe, V., B. L. Coles, et al. (2000). "Retinal stem cells in the adult mammalian eye." Science
287(5460): 2032-6.
Tsang, T. E., W. Shawlot, et al. (2000). "Lim1 activity is required for intermediate mesoderm
differentiation in the mouse embryo." Dev Biol 223(1): 77-90.
Tuan, R. S. (2004). "Biology of developmental and regenerative skeletogenesis." Clin Orthop
Relat Res(427 Suppl): S105-17.
Ueno, S., G. Weidinger, et al. (2007). "Biphasic role for Wnt/beta-catenin signaling in cardiac
specification in zebrafish and embryonic stem cells." Proc Natl Acad Sci U S A 104(23):
9685-90.
151
Ungrin, M. D., C. Joshi, et al. (2008). "Reproducible, ultra high-throughput formation of
multicellular organization from single cell suspension-derived human embryonic stem
cell aggregates." PLoS One 3(2): e1565.
Usui, T., Y. Shima, et al. (1999). "Flamingo, a seven-pass transmembrane cadherin, regulates
planar cell polarity under the control of Frizzled." Cell 98(5): 585-95.
Uusitalo, M., M. Heikkila, et al. (1999). "Molecular genetic studies of Wnt signaling in the
mouse." Exp Cell Res 253: 336-348.
van Osch, G. J., M. Brittberg, et al. (2009). "Cartilage repair: past and future--lessons for
regenerative medicine." J Cell Mol Med 13(5): 792-810.
Vara, J., F. Malpartida, et al. (1985). "Cloning and expression of a puromycin N-acetyl
transferase gene from Streptomyces alboniger in Streptomyces lividans and Escherichia
coli." Gene 33(2): 197-206.
Venn, M. F. (1979). "Chemical composition of human femoral and head cartilage: influence of
topographical position and fibrillation." Ann Rheum Dis 38(1): 57-62.
Vessey, C. J. and P. M. de la Hall (2001). "Hepatic stem cells: a review." Pathology 33(2): 130-
41.
Vestweber, D., A. Gossler, et al. (1987). "Expression and distribution of cell adhesion molecule
uvomorulin in mouse preimplantation embryos." Dev Biol 124(2): 451-6.
Vinatier, C., D. Mrugala, et al. (2009). "Cartilage engineering: a crucial combination of cells,
biomaterials and biofactors." Trends Biotechnol 27(5): 307-14.
Voziyanov, Y., S. Pathania, et al. (1999). "A general model for site-specific recombination by
the integrase family recombinases." Nucleic Acids Research 27: 930-941.
Wagner, J. E. and J. Kurtzberg (1997). "Cord blood stem cells." Curr Opin Hematol 4(6): 413-8.
Wagner, T., J. Wirth, et al. (1994). "Autosomal sex reversal and campomelic dysplasia are
caused by mutations in and around the SRY-related gene SOX9." Cell 79(6): 1111-20.
Wakita, R., T. Izumi, et al. (1998). "Thyroid hormone-induced chondrocyte terminal
differentiation in rat femur organ culture." Cell Tissue Res 293(2): 357-64.
Wakitani, S., T. Mitsuoka, et al. (2004). "Autologous bone marrow stromal cell transplantation
for repair of full-thickness articular cartilage defects in human patellae: two case reports."
Cell Transplant 13(5): 595-600.
Wakitani, S., M. Nawata, et al. (2007). "Repair of articular cartilage defects in the patello-
femoral joint with autologous bone marrow mesenchymal cell transplantation: three case
reports involving nine defects in five knees." J Tissue Eng Regen Med 1(1): 74-9.
152
Walker, E., M. Ohishi, et al. (2007). "Prediction and testing of novel transcriptional networks
regulating embryonic stem cell self-renewal and commitment." Cell Stem Cell 1(1): 71-
86.
Wang, G., H. Zhang, et al. (2005). "Noggin and bFGF cooperate to maintain the pluripotency of
human embryonic stem cells in the absence of feeder layers." Biochem Biophys Res
Commun 330(3): 934-42.
Wang, H. S., S. C. Hung, et al. (2004). "Mesenchymal stem cells in the Wharton's jelly of the
human umbilical cord." Stem Cells 22(7): 1330-7.
Warman, M. L. (2000). "Human genetic insights into skeletal development, growth, and
homeostasis." Clin Orthop Relat Res(379 Suppl): S40-54.
Warren, L., P. D. Manos, et al. (2010). "Highly efficient reprogramming to pluripotency and
directed differentiation of human cells with synthetic modified mRNA." Cell Stem Cell
7(5):618-30.
Watanabe, S., N. Kai, et al. (1995). "Stable production of mutant mice for double gene converted
ES cells with puromycin and neomycin." Biochem Biophys Res Commun 213(1): 130-
137.
Watson, C. M. and P. P. Tam (2001). "Cell lineage determination in the mouse." Cell Struct
Funct 26(3): 123-9.
Weinberg, R. A. (1995). "The retinoblastoma protein and cell cycle control." Cell 81(3): 323-30.
Weston, A. D., A. V. Sampaio, et al. (2003). "Inhibition of p38 MAPK signaling promotes late
stages of myogenesis." J Cell Sci 116(Pt 14): 2885-93.
Widelitz, R. (2005). "Wnt signaling through canonical and non-canonical pathways: recent
progress." Growth Factors 23(2): 111-6.
Wilkinson, D. G., S. Bhatt, et al. (1990). "Expression pattern of the mouse T gene and its role in
mesoderm formation." Nature 343: 657-659.
Williams, J. T., S. S. Southerland, et al. (1999). "Cells isolated from adult human skeletal muscle
capable of differentiating into multiple mesodermal phenotypes." Am Surg 65(1): 22-6.
Wong, H. C., A. Bourdelas, et al. (2003). "Direct binding of the PDZ domain of Dishevelled to a
conserved internal sequence in the C-terminal region of Frizzled." Mol Cell 12(5): 1251-
60.
Wong, T. K. and E. Neumann (1982). "Electric field mediated gene transfer." Biochem Biophys
Res Commun 107(2): 584-7.
Woods, A., G. Wang, et al. (2007). "Rac1 signaling stimulates N-cadherin expression,
mesenchymal condensation, and chondrogenesis." J Biol Chem 282(32): 23500-8.
153
Xiao, L., X. Yuan, et al. (2006). "Activin A maintains self-renewal and regulates fibroblast
growth factor, Wnt, and bone morphogenic protein pathways in human embryonic stem
cells." Stem Cells 24(6): 1476-86.
Xu, C., E. Rosler, et al. (2005). "Basic fibroblast growth factor supports undifferentiated human
embryonic stem cell growth without conditioned medium." Stem Cells 23(3): 315-23.
Xu, R. H., R. M. Peck, et al. (2005). "Basic FGF and suppression of BMP signaling sustain
undifferentiated proliferation of human ES cells." Nat Methods 2(3): 185-90.
Xu, R. H., T. L. Sampsell-Barron, et al. (2008). "NANOG is a direct target of TGFbeta/activin-
mediated SMAD signaling in human ESCs." Cell Stem Cell 3(2): 196-206.
Yamaguchi, T. P., S. Takada, et al. (1999). "T (Brachyury) is a driect target of Wnt3a during
paraxial mesoderm specification." Genes & Dev 13: 3185-3190.
Yamamoto, M., Y. Saijoh, et al. (2004). "Nodal antagonists regulate formation of the
anteroposterior axis of the mouse embryo." Nature 428(6981): 387-92.
Yamanaka, S. (2008). "Induction of pluripotent stem cells from mouse fibroblasts by four
transcription factors." Cell Prolif 41 Suppl 1: 51-6.
Yamanaka, S. (2009). "Elite and stochastic models for induced pluripotent stem cell generation."
Nature 460(7251): 49-52.
Yamashita, H., P. ten Dijke, et al. (1995). "Osteogenic protein-1 binds to activin type II receptors
and induces certain activin-like effects." J Cell Biol 130(1): 217-26.
Yan, H. and C. Yu (2007). "Repair of full-thickness cartilage defects with cells of different
origin in a rabbit model." Arthroscopy 23(2): 178-87.
Yang, J., S. A. Mani, et al. (2004). "Twist, a master regulator of morphogenesis, plays an
essential role in tumor metastasis." Cell 117(7): 927-39.
Yang, Z., L. Sui, et al. (2009). "Stage-dependent effect of TGF-beta1 on chondrogenic
differentiation of human embryonic stem cells." Stem Cells Dev 18(6): 929-40.
Yeom, Y. I., G. Fuhrmann, et al. (1996). "Germline regulatory element of Oct-4 specific for the
totipotent cycle of embryonal cells." Development 122(3): 881-94.
Ying, Q. L., J. Nichols, et al. (2003). "BMP induction of Id proteins suppresses differentiation
and sustains embryonic stem cell self-renewal in collaboration with STAT3." Cell
115(3): 281-92.
Ying, Q. L., M. Stavridis, et al. (2003). "Conversion of embryonic stem cells into
neuroectodermal precursors in adherent monoculture." Nat Biotechnol 21(2): 183-186.
Yu, J., K. Hu, et al. (2009). "Human induced pluripotent stem cells free of vector and transgene
sequences." Science 324(5928): 797-801.
154
Yu, J., M. A. Vodyanik, et al. (2007). "Induced pluripotent stem cell lines derived from human
somatic cells." Science 318(5858): 1917-20.
Yu, K. and D. M. Ornitz (2008). "FGF signaling regulates mesenchymal differentiation and
skeletal patterning along the limb bud proximodistal axis." Development 135(3): 483-91.
Zambrowicz, B. P., A. Imamoto, et al. (1997). "Disruption of overlapping transcripts in the
ROSA beta geo 26 gene trap strain leads to widespread expression of beta-galactosidase
in mouse embryos and hematopoietic cells." Proc Natl Acad Sci U S A 94(8): 3789-94.
Zelzer, E., D. J. Glotzer, et al. (2001). "Tissue specific regulation of VEGF expression during
bone development requires Cbfa1/Runx2." Mech Dev 106(1-2): 97-106.
Zhang, G., V. Gurtu, et al. (1996). "An enhanced green fluorescent protein allows sensitive
detection of gene transfer in mammalian cells." Biochem Biophys Res Commun 227(3):
707-11.
Zhang, J., R. E. Campbell, et al. (2002). "Creating new fluorescent probes for cell biology." Nat
Rev Mol Cell Biol 3(12): 906-18.
Zhou, H., S. Wu, et al. (2009). "Generation of induced pluripotent stem cells using recombinant
proteins." Cell Stem Cell 4(5): 381-4.
Zuk, P. A., M. Zhu, et al. (2001). "Multilineage cells from human adipose tissue: implications
for cell-based therapies." Tissue Eng 7: 211-228.
155
Appendix A
Supplementary Data for Chapter 2
Gene Sequences
Aggrecan Forward:
Reverse:
TGGCTTCTGGAGACAGGACT
TTCTGCTGTCTGGGTCTCCT
αMHC Forward:
Reverse:
GACGCCCAGATGGCTGACTT
GTCACCGTCTTTCCGTTTTC
βIII-tubulin Forward:
Reverse:
TAGACCCCAGCGGCAACTAT
GTTCCAGGTTCCAAGTCCACC
Bmp4 Forward:
Reverse:
AGCCAACACTGTGAGGAGTTTCCA
TGCTGCTGAGGTTGAAGAGGAAACGA
Brachyury Forward:
Reverse:
TCCTCCATGTGCTGAGACTTGT
TGCCACTTTGAGCCTAGAAGATC
Col2a1 Forward:
Reverse:
CCGTCATCGAGTACCGATCA
CAGGTCAGGTCAGCCATTCA
Col10a Forward:
Reverse:
AAGGAGTGCCTGGACACAAT
GTCGTAATGCTGCTGCCTAT
Ef1 Forward:
Reverse:
GGCGATGCTGCCATTGTT
GGAGGGTAGTCAGAGAAGCTCTCA
Evx1 Forward:
Reverse:
CAACCTAGTAGCTCAGACACCGAA
CGGTCTTGAAACGTAGTTCTCCCT
Foxa2 Forward:
Reverse:
GACATACCGACGCAGCTACA
GGCACCTTGAGAAAGCAGTC
Flk1 Forward:
Reverse:
CACCTGGCACTCTCCACCTTC
GATTTCATCCCACTACCGAAAG
156
Fst Forward:
Reverse:
GGGCAGATCCATTGGATTAGC
CCTTGGAATCCCATAGGCATT
GAPDH Forward:
Reverse:
TGAGGACCAGGTTGTCTCCT
CCCTGTTGCTGTAGCCGTAT
GATA1 Forward:
Reverse:
GATGGAATCCAGACGAGGAA
ACCAGCTACCACCATGAAGC
GATA2 Forward:
Reverse:
CGGCCTCTTCTTCTGCAGG
TGGTACTTGACGCCATCCTTG
Gsc Forward:
Reverse:
CGGCACCGCACCATCT
TGGGTACTTCGTCTCCTGGAA
HoxB1 Forward:
Reverse:
CAATGAAACGCAGGTGAAGA
GACTGGTCAGAGGCATCTCC
Lhx1 Forward:
Reverse:
CACCTCAACTGCTTCACCTG
TGTTCTCTTTGGCGACACTG
Meox2 Forward:
Reverse:
GTCTGTGGCAGTGTGGCTTA
AGCCAAAGCAAACATCCATC
Mesp2 Forward:
Reverse:
GGCTCAGATGCTTGGTCCTA
TCCCAAGGTTTTCAGGTGAG
Nestin Forward:
Reverse:
CTCGAGCAGGAAGTGGTAGG
GCCTCTTTTGGTTCCTTTCC
NeuroD Forward:
Reverse:
GCATGCACGGGCTGAACGC
GGGATGCCCGGGAAGGAAG
Nkx2.5 Forward:
Reverse:
AGTGGAGCTGGACAAAGCC
GACAGGTACCGCTGTTGCTT
Nodal Forward:
Reverse:
ACTTTGCTTTGGGAAGCTGA
CCAGCCAATCAGGTTGAAGT
157
Pdgfrα Forward:
Reverse:
TGCGTACATCGGTGTCACTT
GGGGATGATGTAGCCACTGT
PRG4 Forward:
Reverse:
GAACCGCCGGCTGTGGATGA
TGTGGTGACTTTGCTGTGTGGAGT
Runx2 Forward:
Reverse:
ACCATGGTGGAGATCATCG
GGCAGGGTCTTGTTGCAC
Sox9 Forward:
Reverse:
GCTGAACGAGAGCGAGAAGA
GAGGAGGAATGTGGGGAGTC
Sox17 Forward:
Reverse:
CCGAGATGGGTCTTCCCTAC
CGTCAAATGTCGGGGTAGTT
Tal1 Forward:
Reverse:
CCCACCAGACAAGAAACTAAGCA
GGCCAGGAAATTGATGTACTTCA
Wnt3a Forward:
Reverse:
GCTCTGCCATGAACCGTCACAACAAT
ATAGCCCGTGGCATTTGCACTTGA
Table A.1 – Primer sequences for qPCR analysis
158
A
B
Fig. A.1 – (A) HCI analysis of OCT4 expression from two-day CDM (i-iii) and X-Vivo™10 (iv-vi) cultures
showing similar biphasic profiles from cultures established on gelatin+fibronectin. (B) Compiled HCI data
indicated that OCT4 expression remained stable when cultures were established on gelatin, although cultures in N2B27 appeared to have variable OCT4 expression when initiated at a high seeding density. Dark grey bars
stands for N2B27 cultures, light grey stands for X-Vivo cultures and white represents cultures in CDM. Plotted
percentages represent means±SEM (n=2).
159
A
B
Fig. A.2 – (A) Four-day SF differentiation culture supplemented with Activin A (10ng/ml) had less
BRACHYURY+ cells compared to that with Activin A (30ng/ml). (B) Addition of both BMP4 and Activin A
(i) or Wnt3a (ii) on day 0 of differentiation enhanced the proportion of BRACHYURY+ cell population
compared to BMP4 alone. Cultures supplemented with Activin A+Wnt3a (iii) or serum+Activin A (iv) did
not appear to generate more BRACHYURY+ cells than cultures with Activin A, Wnt3a or serum alone.
Images were taken at 200x magnification.
A B
Fig. A.3 – (A) IF image (200x) of COL2A1 antibody staining and (B) Alcian blue staining for 15-day SF
monolayer differentiation culture supplemented with BMP4 (10ng/ml, from day 0 to day 15) and Activin A
(30ng/ml, from day 5 to day 15) confirmed the lack of COL2A1 networks and proteoglycan production, respectively.
BRACHYURY
DAPI/Hoechst
BRACHYURY
DAPI/Hoechst
COL2A1
DAPI/Hoechst
160
Fig. A.4 – Addition of (i) Activin A, (ii) TGFβ3 (10ng/ml) and (iii) FGF8 (50ng/ml) on day 5 of differentiation
to BMP4-treated cultures (from day 0 to 5) did not compensate for the non-inductive nature of BMP4, as
exhibited by the lack of COL2A1 networks (IF images at 200x).
COL2A1
DAPI/Hoechst
161
A
B
Fig. A.5 – (A) As part of the confirmation that Wnt3a acted as a late chondrogenic inducer, IF images (200x)
showed minimal COL2A1 staining in SF monolayer cultures supplemented with Wnt3a for (i-iii) 15 days or (iv-vi) five days. Addition of (i, iv) Activin A, (ii, v) TGFβ3 and (iii, vi) FGF8 to Wnt3a-supplemented
cultures from day 5 to 15 of differentiation did not improve COL2A1 network formation. This observation
was corroborated by the weak Alcian blue staining of the same cultures showing the lack of proteoglycan
production (B).
COL2A1
DAPI/Hoechst
162
αMHC Nkx2.5
GATA1 Sox17
Fig. A.6 – qPCR analysis of αMHC, Nkx2.5, GATA1 and Sox17 transcript levels in 15-day SF monolayer differentiation cultures subjected to 15-day BMP4, Activin A or Wnt3a supplementation. (i) Activin A or
serum treatment induced αMHC expression to similar levels as those in EB cultures. (ii) Serum-treated EB and
monolayer cultures had higher Nkx2.5 expression than Activin A cultures; BMP4 exerted the least enhancing
effect and Wnt3a caused a reduction in gene expression. (iii) Activin A exerted the least inductive effect on
GATA1 expression than other test conditions. (iv) All monolayer culture conditions showed decreased levels of
Sox17. Expression levels were compared to those in undifferentiated ESCs. Plotted values represent
means±relative error (n≥2).
163
αMHC Nkx2.5
GATA1 Sox17
Fig. A.7 – qPCR analysis of αMHC, Nkx2.5, GATA1 and Sox17 transcript levels in 15-day SF monolayer differentiation cultures subjected to five-day BMP4, Activin A or Wnt3a supplementation. Activin A
treatment dramatically enhanced the expression of αMHC (i) and Nkx2.5 (ii) compared to BMP4 and Wnt3a. Wnt3a
induced GATA1 gene expression (iii), while all three growth factors exerted similar effects on Sox17 expression (iv).
Expression levels were compared to those in undifferentiated ESCs. Plotted values represent means±SEM (n≥2).
164
Appendix B
Supplementary Data for Chapter 3
Gene Sequences
β-actin
Forward: GGCCCAGAGCAAGAGAGGTATCC
Reverse: ACGCACGATTTCCCTCTCAGC
Oct4
Forward: GGCGTTCTCTTTGGAAAGGTGTTC
Reverse: CTCGAACCACATCCTTCTCT
Brachyury
Forward: ATGCCAAAGAAAGAAACGAC
Reverse: AGAGGCTGTAGAACATGATT
α-MHC
Forward: GGAAGAGTGAGCGGCGCATCAAGG
Reverse: CTGCTGGAGAGGTTATTCCTCG
Foxa2
Forward: TGGTCACTGGGGACAAGGGAA
Reverse: GCAACAACAGCAATAGAGAAC
Sox17
Forward: GCCAAAGACGAACGCAAGCGGT
Reverse: TCATGCGCTTCACCTGCTTG
Pax6
Forward: GCTTCATCCGAGTCTTCTCCGTTAG
Reverse: CCATCTTGCTTGGGAAATCCG
NeuroD
Forward: CTTGGCCAAGAACTACATCTGG
Reverse: GGAGTAGGGATGCACCGGGAA
Targeting Primer Sequences
Rosa 5’ Forward TCTGTTGGACCCTTACCTTGAC
CAGGS Reverse GCCAAGTAGGAAAGTCCCATAAG
BSD Forward CATAGTGAAGGACAGTGATGGACAGC
Rosa 3’ Reverse AGCAACATTTAACACAGTG
Table B.1 – Primer sequences for RT-PCR and targeting PCR analyses
165
A
B
Fig. B.1 – Schematic of (A) the BP reaction that generates an entry clone from PCR-amplified DNA fragment
and the donor vector and (B) the LR reaction that creates an expression clone from an entry clone and a
destination vector (Invitrogen 2006).
Fig. B.2 – Schematic of the promoterless destination vector used in MultiSite Gateway® cloning (Invitrogen
2006).
166
A
B
C
D
Fig. B.3 – Schematics of the MultiSite Gateway® donor vectors used in a four-fragment cloning reaction (Invitrogen 2006). Fragments of interest were cloned into the donor vectors in a specific order such that the 5’ most fragment was inserted into (A) while the 3’ most fragment was cloned into (D).
167
Fig. B.4 – Schematic of plasmid T1b.