Design and Generation of a Recombinant Hepatitis B-Based Viral Vector System for Use in Cellular Receptor Studies

BY

Robert G. Garces

A thesis submitted in conformity with the requirements for the degree Master of Science

Graduate Department of Medical Biophysics University of Toronto

O Copyright by Robert G. Garces 2001.

National library ofCanada

Bibliothèque nationale du Canada

Acquisitions and Acquisitions et Bibliographic Services services bibliographiques

395 Wellington Street 395. nie Wellington Ottawa ON KI A O N 4 Ottawa ON K I A ON4 Canada Canada

The author has granted a non- exclusive licence allowing the National Library of Canada to reproduce, loan, distribute or seil copies of this thesis in microfom, paper or electronic formats.

The author retains ownership of the copyright in this thesis. Neither the thesis nor substantial extracts fiom it may be printed or otherwise reproduced without the author's permission.

L'auteur a accordé une licence non exclusive permettant a la Bibliothèque nationale du Canada de reproduire' prêter, distribuer ou vendre des copies de cette thèse sous la forme de microfiche/film, de reproduction sur papier ou sur foxmat électronique.

L'auteur conserve la propriété du droit d'auteur qui protège cette thèse. Ni la thèse ni des extraits substantiels de celle-ci ne doivent être imprimés ou autrement reproduits sans son autorisation.

Abstract

The hepatitis B v i r ~ ~ . ~ rem- a prevdent global problem despite the availability of

recombinant vaccines. One of the greatest challenges facing hepatitis B researchers is the

unavailahiiity of an in vitro hepatitis B vins replication system. As a resutt, mitial viral entry steps

as well as the cellular receptor for HBV remain undehed. In this study, construction and

genmtion of recombuiant hepatitis B viral particles carrying a reporter gene has been attempted.

DiBerent immortalized cell lines were tested for their ability to dnve hepatitis B promoters. The

enhancecl green fluorescent protein (EGFP) was placed under control of the ciiffirent hepatitis B

promoter regions and transfected into Chang Liver, Chinese Hamster Ovary (CHO), HeLa,

Hepatoblastoma G2 (Hep G2), Human Hepaîoma 7 @uH-7), Ost-7, and SB cells. Onty Hep G2

and HUEZ-7 cells were capable of driving EGFP expression under d HBV promoters.

Recombinant bacdoWuses car- replication-defectke HBV genomes and HBV packaging

genes were generated to deliver HBV DNA into Hep G2 and HuH-7 ce&. The ability of these

ceil lùies to secrete replication-defective HBV particles was codkmed using specific PCR

reactiom and electron microscopy. Further development of this viral systern wodd eventually

provide us a usefhi tool to help elucidate the early stages of the hepatitis B vinis replication cycle.

This, in turn, will M e r the development of drugs and therapies for those infected with the

hepatitis B virus.

First and foremost, I would like to thank my parents who have given their unwavering

support throughout my lifetime. Since b i r - they have shaped my life with their care, love, and

support even through the most trying of times. 1 am eternally gratefid for aiI they bave done for

me,

1 wouid particularly iike to thank my supervisor, mentor, and fiîend, Chris Richardson,

who has opened my eyes M e r in the world of science and We. His advice, ideas, and anecdotes

have made working under his supervision very mernorable and enjoyable. 1 would also like to

thank Dr. GilPrivé and Dr. Dwayne Barber for their support and helpfbi suggestions during my

project.

Special tbanks to my brother, De& and my love, Linda, for all their encouragement and

support over the years.

In closhg, 1 would also like to thank Farida Sarangi Jimgyu Diao, and Jason Davis for

their assistance with my project and providing advice, both in science and in We. Thanks should

also go out to the entire Richardson lab, both past and present, for all the memorable moments

gone by.

1. Background and Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 1.1. A brief history of modem studies on the hepatitis B virus 1 1.2. The hepatitis B virus WV) structure 2 1.3. The hepatitis B genome 4 1-4. The hepatitis B vins Wecycle 7

1 -4.1 . Vira2 attachmenf 7 1 -4.2. Viral entry, uncoating and nuclear transport 9 1 -4.3. Genorne repair and transmption 9 1.4.4. Nucleocapsid assembly 10 1 -4.5. Eü3 V DNA replication 11 1.4.6. Budding and secretion of HBVparticZes 13

1 -5. Hepatitis B Proteins 14 1 -5. 1. Hepatitis B core and e proteins 14 1 -5 -2. Hepatitis B sm-jiace proteins 17 1 -5 -3. Hepatitis B poljmerase protein 22 1 -5.4. Hepatr-tis B Xprotein 22

1.6. Hepatitis B epidemiology 25 1.7. Hepatitis B viral expression systems 27 1.8. Use of baculovinis as a DNA delivery system 28 1 -9. General research objectives 28

2.MaterialsaodMethods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3 0 2.1. Cell lines and virus 30 2.2. Generation of recombinant baculoviruses carrying distinct hepatitis B viral proteins

3 0 2.3. Bacdovirus Plaque Assay 32 2.4. DNA Sequencing 32 2.5, Anti'bodies 32 2 -6. SDS-polyaqIamide gel eletrophoresis and inununo blot andysis 33 2.7. ~ite-s&xinc mutagenesis of hepatitis B virus genorne and prornoter constmct

generation 3 4 2.8. Mutagenized HBV DNA transfections into various cell lines 37 2.9. Fluorescent analysis of transfected ce& 38 2.10. Generation of hepatitis B virus replication defective genome and packaging vectors

38

2.1 1. Transfection of hepatitis B virus replication defective genome and packaging vectors 43

2.12. Generation of recombinant baculovinis carrying the hepatitis B virus repfication- defative genome and packagbg vectors 43

2.13. Amplification and preparation of recombinant bacdovirus stocks 44 2.14. Pseudo-infection optïmization usmg recombinant baculovinis on Hep G2 cells 45 2.1 5. Flow cytometry analysis of pseudo-infected cell lines 46 2.16. Harvesting HBV particles fiom baculovkus infections of SB, Hep G2 and HuH-7

cells 47 2.17. Harvesting hepatitis B particles ftom transfected HuH-7 cells 47 2.1 8. Sucrose gradient d y s k of secreted particles 48 2.19. DNA analysis of concentrated media fiom transfected HuH-7 cells 49 2.20. Southem blot analysis of Hep G2 ceh transfected with defectne genome and

packaging vectors 51 2.21. Embedding and sectioning of SB, Hep G2 and HuH-7 for electron microsopic

d y s i s 54 2.22. Tmmunogold labehg of thin-sectimed embedded specimens 56 2.23. Tmmunogold labelhg of concentrated particles nom concentrated cell culture media

56 2.24. Neg&e staining of prepared grids 57 2.25. Electron microscope analysis 58

3.Results ..-.....--.................----.......-.........1.....-....1...,59 3.1. Acknowledgements 59 3.2. Site-specific mutagenesis can be used to analyze hepatitis B promoter strengths in

different immortalized cell h e s 59 3.3. Generation of hepatitis B Wa1 proteins ushg the bacdovirus expression system 62 3.4. Generation of CMV-promoter driven hepatitis B genomic transcript constmcts in

bacdovirus expression vectors and creation of recombinant baculovinises 65 3.5. Hepatitis B protein expression in Hep G2 and HuH-7 cells 66 3.6. Cornparison between Superfeçtm transfections and recombinant baculovirus

infections in CHO, Chang Liver, and Hep G2 cek 69 3.7. Effects of varying the mdtiplicity of infection of recombinant baculovkus on EGFP

expression 72 3.8. Effects of varying inoculation times of recombinant bacdovirus on EGFP expression

72 3.9. Secretion of hepatitis B Surface proteins following incubation with recombinant

baculoMus in Hep G2 cells 74 3.1 0. Secretion of hepatitis B surface proteins after transfection of HBV-bacdoviral

vectors in HuH-7 cells 76 3.12. PoZymerase chai. reacfon analysis of media fiom cells infected with hepatitis B Wal

genome carryïng recombinant kculov8uç 81 3.13. Electron mîcroscopic anasis of hepatitis B sub-viral particles found in thin sections

of recornbmaat baculovjrus infected cells 83 3.14. Electron microscope analysis of hepatitis B sub-viral particles found in the media of

recombinant bacdovnuS hfiected tek 85 3.15. Eiectron microscope analysis of hepatitis B subviral particles foimd in the media of

recombinant baculovird-vector transfected HuH-7 celis 87

Section 1 Figure 1.1. Hepatitis B virus particle types Figure 1.2. Hepatitis B virus genome Figure 1.3. Hepatitis B virus He cycle Figure 1-4. Hepatitis B genome replication Figure 1 -5. ORF C and the hepatitis B wre protein domains Figure 1.6. ORF S and the hepatitis B &e protein domains Figure 1 -7: Hepatitis B surfàce protein folding models Figure 1.8. ORF P and the hepatitis B po1ymerase protein domains Figure 1.9. ORF X and the hepatitis B X protein domains Figure 1.10. Global dishiution of chronic hepatitis B carriers

Section 2 Figure 2.1. Regions of the hepatitis B genome altered by site-directed mutagenesis 35 Figure 2-2. HBV-Bacdovirus constnict design 39 Figure 2.3. HBV-Bacdoviral vector system

-- 41 - 42

Section 3 Figure 3.1. Expression of EGFP by endogenous hepatitis B viral promoters in 60 - 61

various cell lines Figure 3.2. SB - HBV protein expression Figure 3 -3. HepG2 - HBV protem expression Figure 3.4. HuH-7 - HBV protein expression Figure 3 -5. Cornparison between SuperFectTM transfection & recombinant

bacdovinis Xection Figure 3.6. MOI and inoculation t h e variation Figure 3 -7. Secreted samples fiom BacHBV infected HepG2 ce& Figure 3-8. Secreted samples fiom tradected HuH-7 ce& Figure 3.9. Southem blot andysis of DNA samples harvested fiom BacHBV vector

transfwted H a - 7 cek Figure 3.10. Detection of DNA using PCR in concentrated media ffom HuH-7

transfected with various HBV constructs Figure 3.11. Electron microscope analysis of SB cells infected with recombinant

baculovinis Figure 3.12. Electron microscope analysis of particles derived fiom S B celis infectecl

with recombinant baculovinis Figure 3.13. Electron microscope analysis of concentrated media from HuH-7 cells 88 - 89

transfected with recombinant baçulovinis vectors

vii

1. (ABSTRACT) Davis JAy Garces RGy Diao JY, and Ottensmeyer FP (2000) Localization of green fluorescent protein absrbance by energy filtered trammission electron microscopy. Microscopy and Microanalysis 6 suppl. 2: 324-325.

2. (TEXTBOOK CHAPTER) Garces RG and Richardson CD. (In press) The Hepatitis B Virus in Nicholas Acheson (Ed), MoZenZlor Biology of Vinrses.

3 - (REVIEW) Diao J, Garces RG, and Richardson CD. (Submitted) (2000) X Protein of Hepatitis B Virus Modulates Cytokme and Signal Transduction Pathways During The Course of Viral Infections and Hepatocarcinogenesis. Cytokine and Receptor Review.

LIST OF ABBREVIATIONS

AcMNPV Autographa californica mononuclear polyhedrosis virus

CCCDNA Covalently closed-circulâr deorryn'bonucleic acid

CMV Cytomegalovinis

DHBV Duck hepatitis B virus

d N T F s Deoxyn.'bonuc1eic triphosphates

DR Direct repeat

EDTA Ethyhe diamine tetra-acetate

EGFP Enhanced green fluorescent protein

ER Endoplasmic reticulum

FACS Flow cytometry

FITC Fluorescein hthiocyanate

HBc Hepatitis B core protein

HBe Hepatitis B early protem

HBP Hepatitis B polymerase protein

HBs Hepatitis B surface protein

HBx Hepatitis B X protein

HBV HepatÎtis B Vins

D a KiloDaltons

LHBs Large hepatitis B surface protem

MHBs Middle hepatitis B surface protein

MOI Multiplicity of infection

mRNA

ORFs

PBS

PC

PCR

P W A

PL

PS

PX

r P m

SDS

SHBs

v/v

VSV

Messenger nbnucleic acid

Open reading h m e s

Phosphate buffered saline

Core/pregenome promoter

Polymerase chah reaction

Pregenomic n'bonucleic acid

Pie-S 1 promoter

Pre-S2 promoter

HSx promoter

Revolutions per minute

Sodium do decyl sulphate

Small hepatais B surfke protem

volume per volume

Vesticular Stomatitis Virus

weight per volume

World Health OrganiSration

Woodchuck Hepatitis V h

1. BACKGROUND AND INTRODUCTION

1.1. A brief history of modem studies on the hepatitis B vims

The terms, hepatitis A and hewtis B, were fit introduced by MacCalium in 1947 in

order to Merentiate infectious (enteric) hepatitis £rom serum hepatitis (1). Before the vinises

causing hepatitis were identifieci, these pathogens were classified by their mode of transmission

and epidemiology. Type A hepatrtis was deemed to be trammitteci predominantly through the

fecal-oral route, while type B hepatitis was thought to be transmitted via blood and sexual

contact. Viral proteins for hepatitis B were discovered in the 1960's by Blumberg (2). One of

them was a previously unidentifïed protein, found in the blood of an Australian aborigine, and was

termed the Australia antigen (Au). However, the viral nature of hepatitis B was not conhned

until the 1970's when Dane found Wzis-like particles in the serum of patients infecteci with type B

hepatitis. Dane called these vinis-like particles Done ~ c 2 e s (3). Kaplan confirmed the viral

nature of the Dane particle when he detected endogenous DNA-dependant DNA polymerase

activity within the particle's core (4). Following this discovery, Robinson was able to detect and

characterize the hepatitis B virus (HBV) genome (4). The human hepatitis B virus is the

archetype of the hepadnavirus famiy, HepoLaan'he (5) .

The World Heaith Organization (WHO) estimates that over 2 billion people have been

idected by the hepatitis B virus. Approximately 500 million are chronic carniers. Despite the

availability of a recombinant vaccine, hepatitis B infection still remains a global problem.

1.2. The hepatitis B virus (HBV) structure

The hepatitis B virus is the srnallest known human DNA virus. At least three distinct

hepatitis B particle types have been observed in the sera fiorn an infécted patient using electron

microscopy (6). (See Fig. 1.1.) The smallest nib-Wal particle is known as the hepatitis B sphere,

which consists solely of viral envelope prote&. The diameter of the sphere is approxbately

22 m. This sub-viral particle c m be found in very high ievels during an acute HBV infection (7).

Another nib-Wal particle, hown as the hepatitis B filament, also consists solely of viral envelope

proteins and can be found in the circulaîing blood of a carrier. Like hepatitis B spheres, hepatitis

B filaments do not possess any genetic information and have a diameter of approxïmately 22 2.

However, the length of the filaments varies, some reaching lengths beyond 200 m. Since both

forms of sub-viral particles possess the HBV envelope proteins, these structures can induce a

significant immune response. It is hypothesized that these sub-virai particies may aliow the third

type of particle, known as the mature vinon or the Dane particle, to traverse the circulatory

system, undetected by binding neutralizuig antibodies and complement.

The mature virion has a diameter of 42 m It is an enveloped, partially double-stranded

DNA virus. The viral envelope consims of the three major hepatitis B d a c e proteins icnown as

the small surface protein (SHBs), the rniddle surface protein @EBs), and the large surface

protein (LHBs). Interaction between the surface proteins is very selective and host mernbrane-

bound proteins are not incorporated into the viral particles.

The viral envelope surrounds an inner nucleocapsid, which is composed of 180 hepatitis B

core proteins WC) in an icosahedral arrangement(7-10). The enveloped nucleocapsid contains

at least one hepatitis B polymerase protein (HF3p) and an HBV genome (1 1). Empty nucleocapsid

k- Pre S I Oomain Bi Pre S2 Domain

/- S Domain

HBc Genome

,,/ Polymerase

m

Hepatitis B Virion (a.k.a. Dane Parücle)

Secreted Filament

Figure 1.1 - Hepatitis B virus particle types

The three forms of hepatitis B particles are illustrated above, The hepatitis B virion (a.k.a. The Dane particle) has a diameter of 42 nrn. The virion contains ail three hepatitis B surface proteinas as well as the hepatitis B core protein, at least one copy of the polymerase protein, and the hepatitis B genome. The hepatitis B fdament and sphere have a diameter of 22 nrn, though the length of the filament varies. The sub--viral particles are cornprised sotely of hepatitis B surfacer proteins. They do not possess any hepatitis B core proteins nor any genetic information, thus a r e considered non-infec tious.

particles may be generated XHBc is overexpressed, but empty nucleocapsids are not enveloped

and secreted (12).

1.3. The hepatitis B genome

Electron microscopy gave the initial views of the HBV genome (13). In mature virions,

the genome appears to be circular, yet only partialiy double-stranded (14). The genome contains

approxïmately 3,200 nucleotides. Numbering of base pairs on the HBV genome is typically

referenced nom the cleavage position for the restriction enzyme EcoiU or at a homologous site,

if the EcoRi site is absent, Unlike most vinises, HBV virions contain both DNA and RNA in

their nucleocapsid. Moreover, regions of the packaged genome may be single-stranded, double

stranded or even triple-stranded (13, 15). These peculiar features of the packaged genome are a

direct result of the rnechanism of replication employed by HBV in the Uifected ce11 (26).

There are four dehed overlapping open reading fiames (ORFs) in the genome. (See Fig.

1.2.) These four ORFs lead to the transcription and expression of seven dserent hepatitis B

proteins. Each base pair in the genome is involved in encoding at least one HBV protein. The

genome contains many genetic elements that regulate levels of transcription, determinethe site of

polyadenylation, and designate a specific large transaipt for encapsidation by HBp and HBc

proteins.

The dBerent HBV proteins are generated through transcription and translation fkom

several start sites and in-fkarne initiation codons. For example, SHBs protein is generated when a

ribosome begins translation fiom the AUG of the mRNA located at position 155 ofthe adw

genome. MHBs protein is generated when a ribosome starts at an upstream AUG corresponding

to position 321 1, resulting in the adattion of 55 residues to the 5' end of the SHBs protein. LHBs

Figure 1.2 - Hepatitis B virus genome

(adw su b-type)

Some Reg ions of lnterest

E 1847-1 907 DR1 1824-1 835 DR2 1590-1 600 Enh 1 1060-1 260 Enh 2 1635-1 71 4 Genomic RNA start 181 8, 1819 Poly A Signal 191 6-1 921

The adw sub-type of the HBV genome is shown above. Base pair numbering is based on the unique EcoRl site. Open Reading Frarnes(0RFs) have been noted with their start and stop codons labelled. Other key regions of the genome have been Iisted.

is derived when a ribosome uses the AUG at position 2854 and results in the addition of 119

residues onto the MHBs protek

ORF S contains the coding sequences for the three HBV envelope proteins (Heermann,

1984). ORF P spans the majority of the HBV genome and only encodes the hepatitis B

polymerase protein (HBp). ORF C encodes both the hepatitis early (HBe) and hepatitis core

W C ) proteins (17). ORF X encodes the only non-structural HBV protein, the hepatitis B X

protein (HBx)(18, 29).

Regdation of transcription and translation is accomplished by four prornoter elements:

preS 1 (PL), preS2 (pS), core (pC), and X @X) promoter regions. There are also two known

transcription enhancer elements (Enh 1 and Enh It)- ALI HBV transcripts share a common

polyadenylation signal located at nucleotides 19 16 to 192 1. Resulting transcripts range from 0.9

kilobases to 3.5 kilobases in Iength. Due to the overlapping arrangement of the cordpregenomic

promoter, the polyadenylation site is used differentially (20). HBV uses the nucleotide

polyadenylation sequence (TATAAA) as opposed to the canonical eukaryotic polyadenylation

signal (AATAAA). The TATAAA is known to wark inefllciently during viral transcription

Consequently, it is not used iftranscription initiation occurs close to its location (21).

Viral replication macbery targets a specsc HBV RNA transcript known as pregenomic

RNA @&RNA) for encapsidation through recognition of a region known as the epsilon-stem loop

(€-stem loop) (22-24). Only the pgRNA is encapsidated despite the fact that the E-stem loop

coding region is present at the 3' end o f d HBV transcripts. It appears that only the 5' E-stem

loop retains its fimctionality (25). Sequence analysis of this region predicts a series of inverted

repeats that are thought to fold into a three-dimensional stem-loop structure. This stem-loop is

conserved among all hepadnaviruses despite ciifferences in the primary sequence (23). The HBV

polymerase is thought to interact directiy wah the €-stem loop, initiating both encapsidation and

reserve transcription of the HBV pgRNA (26)-

1.4. The hepatitis B virus lifecycle

1.4.1, Erd dachment

The hepatitis B virus must nrst bind to a ceIl capable of supporthg its replication. (See

Fig. 1.3 .) Though hepatocytes appear to be most efficient at supporîing HBV replication, other

extrahepatic sites have been found to support the growth of the virus. HBV replicatke

intermediates or viral transcripts have been observed in monocytes (26-30), bile duct epithelial

cells, endothelial ceiis, pancreatic acinar ceus, and smooth muscle tissue. Viral intermediates have

been found to a lesser extent in adrenal glands, gonads, and cultured bone marrow (3 l), kidneys

(32), lymph nodes (33), spleen (34), and thyroid glands ofacutely infected HBV patients.

Viral attachent often determines host and tissue specificity. For HBV, there are

currently no laboratory ceil h e s which are capable of supporting HBV replication- Only duck

hepatocytes which are fiesMy explanted from the liver appear able to support duck HBV infecfion

(3 5-3 7). Thus, the initial steps of HBV entry are poorly understood. However, several cells

lines, if transfiited .&h HBV DN& are capable of supporting viral protein and DNA replication.

These cell systems have helped determine rnuch of the HBV lXe cycle- Many proteins have been

reported to associate with the difEerent HBV surface proteins. Attempts to determine the viral

receptor which would allow for HBV attachent and entry into ceUs have yielded many candidate

proteins such as apolipoprotein H (apo-H)(38), an altered fonn of apolipoprotein H

This is a scliematic representation of the HBV lifecycle. Major steps of viral seplication are denoted. Specific details about the replication cycle are discussed in the text.

(ait. apo-H)(3 9), poly-human serum albumin (pHSA) (40), fibronectin (41), and interleukin-6 (IL,-

6) (42). For the duck hepatitis B virus (DHBV), a protein known as gp180 has been identifieci

that interacts with the preSl domain (43,444). More recently, an 80 kd protein has been found to

bmd to human HBV though it has yet to be identined (45). Despite these potential candidate

receptors, the mechanism of HBV entry into ceUs rernains obscured and the identification of a

cellular receptor must be fùrther elucidated..

1.4.2. Eral en@, uncwting and nuclear bmqort

The steps immediateiy following HBV attachment are also poorly characterized. It is

thought that a proteolytic event occurs within the LHBs protein during its interaction with the

cellular membrane (46). This event is thought to expose a fusion peptide, which mediates the

fusion of virion and host ceIl membranes, ailowing the nucleocapsid to enter the cytoplasm-

Though previous studies have suggested that HBV entry uses receptor-mediated endocytosis (47,

48), current studies indicated that viral-host fusion occurs at the plasma ceU membrane and not

within an acidic vesicle (49)-

Once uncoated, the nucleocapsid is thought to be transported to the nuclear membrane.

The DHBV system has suggested that the release of the HBV genome fiom the nucleocapsid

occurs on the surface of the nucieus (50).

1.4.3. Genome repair and transcription

HBV DNA is transported into the nucleus where it is repaired and circularized to a

covalently closed-circular form (cccDNA). This repair requires completion of the dsDNA f o w

removal of the 5' terminal structures (an RNA primer and the HBV polymerase protein) as well as

covalent ligation of the strands. HBV polymerase is not required for the generation of HBV

cccDNA (5 1). Uniike retrovimses, integration of HBV DNA into host ceII DNA is not required

for replication to occur. In fact, integration of HBV DNA would result in the disruption of one or

more HBV ORFs and would prevent the transcription of fùnctional pgRNA

Once in cccDNA f o q HBV enhancer and promoter elements direct the synthesis of RNA

transcripts required for viral protein synthesis and pgRNA generation. These transcripts can be

divided into two categories: subgenomic and genomic RNA The subgenomic transcripts serve as

mRNA for the expression of HBV X and the three HBV surface proteins. Genomic transcnpts

are longer than one genome length and serve as the mRNA for the expression of HBV e, core,

and polymerase proteins. A particdar form of genomic RNA lacking the ATG start codon for the

e protein is specifically cliosen by the HBV polymerase for encapsidation and is designated as the

pregenomic RNA @gRNA) (52). It has been hypothesized that ribosome-mediated suppression

may account for the inability of HBV to package genome transcnpts containing the e start codon.

Mutations that delete the ATG of the e protein allow the oîher long RNAs to be encapsidated

(53)-

1.4-4- Nucïeocapsid assernbly

Expression of high levels of HBV core protein c m lead to empty nucleocapsid formation

(54-56). However, these empty sheils are not enveloped and secreted. Binding of HBp to the E-

stem loop of the pgRNA is required for encapsidation by HBc proteins to occur (26, 57).

Deletion of the C-terminus of HE3p does not affect binding of HBp onto the E-stem loop, but does

prevent encapsidation, supporting the hypothesis that the C-terminus is involved in HBp

interaction with HBc proteins.

The hepocinm>indae packaging mechanism is different from that found in retroviruses.

Retrovinises produce gag-pol polyproteins which are assembled into fiinctional capsids through

interactions between its gag-domains. For HBV, only HBp bound to €-stem loops are packaged

by core proteins. Expression of HBc and HBp alone does not result in the formation of HBp

containing mcleocapsids (58).

1.4-5, El3V DNA replication

The HBp protein is a reverse transcriptase which is similar to the enzyme found in

retroviruses. Reverse transcription of HBV pgRNA occurs only after HBc binds onto the HBV

polymerase.

Initiation of the reserve transcription procas occurs when HBp binds to the €-stem loop

near the 5' end of the p g R N k (See Fig. 1.4.) The polymerase protein uses a bulge in the €-stem

loop as its template for initiating reverse transcription (59-61). The first base pairs reverse

transcribed share identity with four nucleotides in the direct repeat 1 @RI) region (62).

Upon binding, the polymerase serves as its own primer and begins to reverse transcribe the

pgRNA template for three to four base pairs. As such, the polymerase protein ends up covalently

attached to the growing negative-sense DNA strand. This was determined by incubating the

polymerase protein in v i ~ o with mRNA containing the €-stem loop and 3?-labelled ( iNTPs,

resuIting in the labelling of the polymerase protein (62).

The first segment of DNA transmied is transferred Ma an unknown mechanism to the

3' DR1 region. At this point, reverse transcription can continue dong the length of the pgRNA

template. Reverse transcription of HBV pgRNA yields negative-sense D N 4 which is termindy

redundant due to the nature of its terminaily-redundant template.

As negative-sense DNA generation occurs, the copied pgRNA template is degraded by the

1. Polyrnerase attachment ont0 epsilon-stem Ioop of the pgRNA

2. l nitiation of RT activitv

poly A tail

3. HBp-DNA transfer to 3'DRl site r r t

poly A tail

4- Elongation of minus-sense DNA and RNA template degradation Note: 5' end of newty synthesized

5' DNA K covalentiy attad-ted to the potyrnerase protein Base pairs added to 3' end

5. RNA oligomer Ieft at 5' end of template Note: RNA oligomer ends ~p translocated onto DR2 and ads as primer fbr pius DNA strand synthesis

6. Elongation of plus strand DNA Note: Plus DNA Strand synthesis continues to 5' end of minus strand template

Figure 1.4 - Hepatitis B genorne replication

The steps employed by HBV to replicate its virai DNA are outline above. Specific details about each step are discussed in the text,

RNAse H activity of the polymerase protein (63,64). However, 15 to 18 oligon%onucleotides at

the 5' end of the pgRNA template remain undegraded once the negative-sense DNA synthesis

t e d t e s . This oligonionucleotide cap serves as a primer for consequent positive-sense DNA

strand synthesis (1 6). The nature of the 15 to 18 ribonucleotide primer is independent of

sequence speciticity (25). This RNA primer is moved and base-paired to the 5' DR2 region on the

negative-sense DNA strand. Fdure of this translocation event resuks in the generation of linear

dsHBV DNA which occurs in 1% to 5% of primers (65)-

Once translocated, positive-sense DNA strand synthesis begins, continuhg to the end of

the 5' negative-sense DNA template. To complete positive-strand synthesis an intramolenilar

transfer is required to give the growing positive-sense DNA strand access to the uncopied portion

of the negative sense DNA. However, positive-sense DNA synthesis is usudy not completed by

the thne the virion is secreted fiom the host cell, resulting in areas of single-stranded DNA found

within purified virions. It is unclear whether this is due to stearic hindrance within the

nucieocapsid sheil or whether pgRNA encapsidation r e d t s in the sequestering of fkee

deoxynucleotides away fiom the HBV polymerase, thus inhibitiag M e r HBV DNA replication-

1.4.6. Budding and semeîion of RB Vpatticles

SHBs and MHE%s are produced in greater abundance than LHBs proteins, reflecting the

quantities of the correspondhg d a c e protein m . A s withui the ceil. These proteins are co-

translationally inserted into the endoplasmic reticulum (ER)(66). The HBV surface proteins

aggregate in regions of the Golgi complex through a process that excludes hom membrane

proteins (67). Regions high in SHBs protein, with minimal MHBs, are able to bud into the lumen

of the ER, yielding the secreted 22 nm-sub-viral spheres and filaments. LHBs is rarely

ulcorporated into these HE3V sub-viral particles since high arnounts of LHBs in particles result in

ER retention (68-71).

The assembled nucleocapsid is deemed to associate with regions ofthe Golgi rich in HBs

proteins (72). LHBs is believed to interact with areas on HBc protein at the cytoplasmic face of

the Golgi (72). This interaction pulls the nucleocapsid into a vesicle which forms a 42 nm

enveloped particle that buds into the lumen of the Golgi. This mature virion is then secreted by

the cell through the process of exocytosis into the extracellular environment (73).

1.5. Hepatitis B Proteins

1.5.1. Hqutitis B core m d eproteins

ORF C encodes two sequence-related, yet fiuictionally distinct proteins: the hepatitis B

core protein WC) and the hepatitis B early protein (HBe). (See Fig. L -5 .)

The hepatitis B core protein (HBc) makes up the majority of the nucleocapsid shell

packaging the HBV genome. This 185 amino acid protein is expressed in the cytoplasm of

infected cells. Sequence analysis of HBc suggests that it is predominantly composed of

hydrophilic and charged residues. HBc is not glycosylated and is not modii6ed through addition

of lipids.

The region of HBc associated with nucleocapsid assembly Lies withïn its first 149 residues

(55). Recently, the crystai structure of the nucleocapsid has given more insight into the folding

of the H B c protein (74). Hi3c is composed of 5 a-helices. This dBers fkom other viruses M a t

most nucleocapsid proteins which form icosahedral shells typically fold into P-barre1 structures

such as those seen in the HIV-1 capsid (75, 76).

HBc dirners which are required for the formation of the nucleocapsid are associated via

29 Protein ! h . ~ .: c 214

HBc

DNA

4

Sianal Seauence Phos~horvlated Sennes

NucIeic Acid Binding Reg ion

- O;? L DR1 € Poly A Signal

Figure 1.5 - ORF C and the hepatitis B core protein domains

Key regions of ORF C are shown schematically above. PhosphoryIation sites are denoted by light blue lines. The nucleic acid binding region is labeled as well. Other open reading frames which overlap ORF C, as well as important genetic regulatory regions, are labelled on the DNA schematic.

thei. a-helical hairpin structures, forming a four-helix bundle (74). A disulfide bridge forms on

the dimer interface between the Cys-6 1 residues, stabili7ing the association (77,78). However,

deletion of this residue does not appear to impair dimer fodon(77-79). The critical residues

involved in dimer formation appear to be Tyr- 132, Arg- 127, Pro- 129 and ne-13 9 (74).

The C-terminal end of HBc contains four a r m e clusters which appear to be involved in

nucleotide packaging (78,80). KE3c can also be phosphorylated on serine residues at positions

157, 170 and l72(8 1,82). Phosphorylation at serines 1 6 4 and 172 impair pgRNA packaguig (8 1,

83).

HBc is able to form particles even ifforeîgn peptide sequences are spliced into the H B c

coding region. As such, HBc can be used for displaying foreign protein domains on the d a c e of

HBV nucleocapsids (84).

The e antigen is named for its "'early" appearance in the senun during an acute HBV

infection- HBe is expressed by the translation of the sequences upstream of the HBc coding

region hown as the pre-C region. The pre-C sequence encodes a hydrophobie transmembrane

domain, resultuig in the cm-translationai insertion of HBe into the lumen of the ER (85). This

fundamental change in the location of HBe expression alters the antigenicity of HBe such that it

does not share antigenic homofogy with HBc despite having nearly identical amino acid

sequences.

In the ER, 19 of the 29 residues of the pre-C region are cleaved by a signal peptidase.

The remaining pre-C residues prevent HBe fiom fonning into core particles (86). Part of the

arginhe rich C-terminai domain of HBe is dss cleaved f?om B e in the Golgi complex (87).

The fûnction of HBe has not been established. One theory is that high levels of HBe may

suppress the host immune system f?om eliminating cells that contain HBV. This is supported by

the fact that the woodchuck hepatitis virus (WHV) variants that lack HBe are incapable of

establishg persistent Wai infections in woodchucks.

1.5-2. Hqafrafrtis B surface profeins

ORF S contains three in-frame start codons which share a common termination codon.

(See Fig. 1.6.) As a result, ail HBV surface proteins are related by their common small S-domain

(SHBs). The HBV surface proteins are involved in HBV envelope formation as well as the

formation of non-infectious sub-viral particles found within the senun of infîected individuals.

The small hepatitis-B surface protein (SHBs) is the smallesî, most abundant HBV d c e

protein produced. Hmorically, it is also known as the Australia antigen (Au) (88). SNBs is

comprised of four hydrophobie regions, at least two of which are considered to be transmembrane

domains. (See Fig. 1.7.) Computer modehg of SHBs implicate helices a3 and a4 as

transmembrane regions. These two helices are also believed to be the location of the

multirnerization domains (89). Truncated versions of SHBs fail to form particles and remain

withh the ER (90). SHBs also contains 14 cystehe residues which are cross-linked with one

another for stability.

SHBs is CO-translationally inserted into the ER-membrane. It also wntains a glycosylation

site at Asp-146. Both giycosylated and non-glycosylated f o m of SHBs can be dserentiated on

SDS-PAGE gels of p d e d HBV particles. This modification is sensitive to glycan processing

(91)-

SHBs is the prime constituent of all secreted HBV particles (92). Its highly antigenic

epitopes are used to characterize different Hi3V sub-types (93). Sub-types of HBV are defined

Putative Fusion Sub-type Determining Peptide Seauence Domain

Protein 1 S b

296 334 400

LHBs 1

12 gfycosylation - ~ s p ( ~ ~ ~ M yristylation

Signal MHBs

201

H 6s

DNA

glycosylau'on - Asp 1 122 160

146 321 W l

Figure 1.6 - ORF S and the hepatitis B surface protein domains

Key regions of OEW S are shown schernaticdly above. Glycosylation sites are marked with dark green iines. The myristylation signal in the pre-SI region is indicated by a red line. The location of the putative fusion domain in the S-domain as well as the subtype determining domain are labeled. Overlapping ORFs are indicated in the DNA schematic.

Small HBs Protein m: Extracel 1 t

Middle HBs Protein

Extracellu

Large HBs Protein (Virion)

Large HBs Protein (Endoplasmic Reticulum)

Extracellu

n ic

Figure 1.7 - Hepatitis B surface protein folding models

The above figure shows the hypothesized folding pattern and transmembrane regions in the three hepatitis B surface proteins. Extracellular and intracellular sides are denoted. The smallest hepatitis B surface protein is comprked solely of the S-domain. The middle hepatitis B surface protein has the additional pre-S2 domain as well as the S-domain. The large hepatitis B surface protein contains the pre-S 1, pre-S2, and S-domains. Glycosylation sites are indicated by the blue branched structures. The myristylation site on the pre-S1 domain is denoted by the green he.

onginally by antibody specincity. The antigenic domain present on all known HBs isolateci is

classified as determinant a. There are four major sub-types: d or y and w or r (88,94). These

sub-types are paired since each pair is mutually exclusive. Determinant d has a lysine at residue

122 while y has an arginine (92). Determinant w has a lysine at residue 160 whiIe r has an

a r m e (95). More recently, other determinants have been found containing antigenic epitopes

that are not recognized by antiiodies directed agaiast the previously mentioned sites (96).

The hi& level of SHBs production appears necessary for KBV infected cells. Reduced

SHBs production results in Uitracellular retention of HBV and can also lead to viral misassembly

(97)-

The second most abundant envelope protein produced is known as the middle hepatitis B

surface protein (MHBs). Translation of this protein begins at an in-fiame start codon upstream of

the SHBs start site- Thus, in addition to the S-domain, the MHBs protein contains additionai 55

residues on the N-terminus. This region has been denoted as the pre-S2 domain (98). The pre-S?

domain is compriseci primarily of hydrophilic residues and resides on the face of HBV particles.

The pre-S2 domain contains an additional glycosylation site at Asp 4. The preS2 site

appears to always be glycosylated , while the site within the S-domain remains partially

giycosylated resulting in either a fuily or partially modified protein. Though some have suggested

that îbis protein may be involveci in viral attachment ont0 host cek, it has been found that vimses

lacking the ability to express MKBs remain infectious (99).

The largest hepatitis B envelope protein is the large hepatitis B surface protein (LHBs). It

is the least expressed of the HBV envelope proteins. LHBs spans the full length of ORF S and

contains three domains: pre-SI, pre-S2, and S-domains (100). The pre-S1 sequence appears to

Vary in infecteci patients, suggesting that it may be involveci in host cell attachent. The pre-SI

domain does not wntain any additional glycosylation sites, but is myristylated at its N-terminus,

anchoring the N-terminus to the membrane (101). The myristyl group may assist LHE3s fold

appropriately on the membrane surface.

The pre-S 1 and pre-S2 domains in L B s were tfiought to predorninantly reside on the

outside of HBV particles. However, it was found in DHBV that LHBs resided on the

cytoplasrnic side of the ER (1 02). As such, the glycolysation site in the pre-S2 domain of LHBs

rernains non-giycosylated while the N-terminus is myristylated- Residing on the cytoplasmic side

of the ER, LHi3s may serve as a site of interaction between the assembling HBV nucleocapsid and

regions of the ER rich in HBV surface proteins, allowing for proper viral envelope formation

(72). When and where the pre-S domains are translocated across the membrane has yet to be

characterized. Current models suggest that the pre-S domains are transported through the

membrane via an aqueous pore formed by the oligomerization of the trammembrane regions in

the S-domain (103)-

Levels of LHBs expression are important for viral replication and rnorphogenesis.

Overexpression of LHBs resdts in retention of the protein in the ER (68, 104). Overexpression

of LHBs alone does result in particle formation in the ER (105). However, these particles are not

secreted due to an ER retention domain within the pre-SI region. It has been hypothesized that a

calnexin binding domah within pre-S 1 is responsible for the inhibition of LHBs-particle secretion

(105).

The role of L H B s in viral attachment has been implicated by experiments that demonstrate

that monoclonal antibodies directed against the pre-S 1 domain can block attachment of HBV ont0

HepG2 cells (1 06- 108). Duck carboxypeptidase D (gp 1 80) interacts directly with the pre-S

domain of DHBV (43,44). Various other proteins have been reported to interact with the pre-S 1

region of human LHBs. These proteins include interleukin-6 (42), amexin-V (109), and an

uncharacterïzed 80 kd protein (45)- However, the early attachent and entry steps associated

with HBV infections remain poorly characterized- The relevance of these viral protein-host

protein interactions is sti l l under scrutïny.

1.5.3. Hepatitis B poiymerase protein

The largest ORF in the HBV genome encodes for the hepatitis B polymerase protein

(HBp). (See Fig. 1.8). This protein is 90 kd in size and has RNA and DWependant

polymerase activity (1 10). As previously mentioned, HBp plays a key role in HBV genome

generation and pgRNA encapsidation. In mature virions, there is at least one copy of HBp

packaged w i t b the nucleocapsid (1 1 1)-

HBp has four characteristic domains: an N-terminai primase domain which serves to prime

negative-sense DNA Strand synthesis, a spacer domain, an RNA/DNA-dependant polymerase

domain occupying roughly 40% of the protein, and a RNAse H-iike domain (1 12). However,

HBp requires the presence of metd ions, HBc and the €-stem bop of the pregenome for

polymerasdreverse transcriptase activiîy to occur (1 1 3 - 1 15).

15.4. Heptatitis B Xprotein

The ORF X encodes for the smallest, non-structural hepatitis B virus protein known as the

hepatitis B X protein (HE3x). (See Fig. 1.9.) The hepatitis B X protein is a 154 amino acid

protein with an apparent weight of 17 kd. Though its fiinction and cehdar locaïization are

controversial, the protein does contain sequences conserved between human, woodchuck, and

Protein

Primase Spacer Reverse Transcriptase RNase H 304 Domain Domain

DNA

Figure 1.8 - ORF P and the hepatitis B polymerase protein domains

Key regions of ORF P are shown schematically above. The four major domains of HBp are indicated: Primase, Spacer, Reverse Transcriptase, and EWase H. Overlapping ORFs are indicated in the DNA schematic.

Protein SerinefProIine Rich Region

21 50

m X Binding Reg ion ing Region p ion * r 1

& .* 3 *

. - Strongly Conserved Regions -. " . 39 a Transactivation Domains 8

DNA '1 374 P

Figure 1.9 - ORF X and the hepatitis B X protein domains

Key regions of ORF X are shown schematically above. Highly conserved regions are denoted in orange-Other regions involved h protein-protein interactions have also been denoted. Other ORFs which overlap ORF X are indicated on the DNA schernatic.

ground squirrel hepadnavinises. However, avian hepadnaWuses lack an HBx protein (67).

HBx is not found in mature vinons nor is it associated with nucleocapsid particles, but it

can stimulate gene transcription (1 16-121). Most of the HBx has recently been shown to reside

in the cytoplasm, suggesting that HBx may not act directly as a transcription factor. Schneider

was the first investigator to suggest that HBx may be involved in upregulating signal transduction

pathways (122). HBx has been reported to upregulate ras/rafMAPK (122), stress kinase (SAPK)

(12 l), protein kinase C (1231, JAK/STAT (124), and NF-- pathways (1 18). Other investigators

have claimed that HBx interacts with the tumour suppressor protein, p53 (125).

1.6. Hepatitis B epidemiology

Many individuals throughout the world are infected with the hepatitis B vhs. (See Fig

1.10.) Though hepatitis B has been found in other primates, humans remain the principal resenroir

(126). However, the prevalence of HSV has been decr&sing in developed countries due to the

availability of the hepatitis B vaccine, increased knowledge of how the virus is spread, and the

screening of donated blood.

Hepatitis B virus is primariiy found in the blood of infecteci individuals. V i s titres as

high as 10 billion virions per millilitre of blood have been reported. However, detectable amounts

of virus have also been found in other body fluids including urine, salivahasopharngeal fluids,

semen, and menstrual fluids (127, 128). HBV has not been detected in feces, perhaps due to

inactivation and degradation within the intestinal mucosa or by bacterial flora (129). -

Transmission of HBV occurs primarily through blood or se& contact. In areas where

the vaccine is available, HE3V remallis a problem for certain groups includhg those living with an

infected individual, health care workers, the police, fire fighters, tattoo-parlour workers, daycare

Intemediate

Figure 1.10 - Global distribution of chronic hepatitis B carriers

The map above outlines the global distribution of chronic hepatitis B carriers. The percentages Iisted are based on the average percentage of individuals in a given population who end up chronically infected with hepatitis B.

workers, and barbers. Other potenîially hazardous activities indude intravenous drug use and

unprotected intercourse witb multiple partners.

1.7. Hepatitis B viral expression systems

Hepatitis B viral and sub-viral particles have been expressed in a number ofnon-human as

well as human ce11 culture systems. In 1986, the recombinant yeast-denved hepatitis B vaccine

was introduced- Yeast has been used to generate sub-viral particles containhg SHBs only (130-

132). However, production of SHBs in yeast results in hepatitis B sub-viral sphere formation

within the recombinant yeast celis,

T r a n s f i o n of HBV cccDNA has been used to express Wal particles and low levels of

Wions in mammalian cell culture systerns (133, 134). Cloned HBV DNA has also been used to

produce transient Iow Ieveb of virus expression in immortalized cell lines (135).

Recombinant viral vector systems have also been used to generate various hepatitis B

proteins and particles. The vaccinia virus has been used to study the hepatitis B d a c e proteins

(1 36). Baculovinis has been used to synthesize hepatitis B proteins such as d a c e proteins

(13 7- 139), core, and polymerase proteins (140).

More recently, many efforts have been made to generate defective hepatitis B vinons

carryîng foreign DNA. Replacing various sections of the HBV genome with other proteins and

supp1yïng the missing HBV proteins in tram has led to the development of various hepatitis B

virai vectors (141, 142). Generation of consistent Wal particles is impeded by the fact that two

constructs must be transfected into c d lines which are not readily transfectable.

1.8. Use of baculovirus as a DNA delivery system

It has been determinecl that baculovinises can enter, but not replicate, in non-insect cells.

As such, baculovinis has been used for efficient gene traosfer into various mamrnalian c d s

including Hela, Hep G2 ,and COS-7 cells (143). Hepatitis B virus replication has also been

generated through use of a recombinant bacuIovirus to deiiver the HBV genome into HepG2 ceUs

(144). The advantage of using baculovirus over transfection is its simplicity and p a t e r efficiency

in temu of the ratio of cells expressing hepatitis B viral proteins.

1.9, General research objectives

Very M e is understood about the initial steps that occur during the attachent and en-

of the hepatitis B virus into the host celi. The lack of a cell culture system for replicating this

virus has made analysis of these fïrst steps quite diflicuft. We are interested in: (1) examining

potential cell h e s which may be able to support hepatitis B virus morphogenesis; (2) designhg

and constructing replication-defective hepatitis B virus; and (3) uhlize of the recombinant

replication-defective hepatitis B virus to elucidate the early stages of hepatitis B viral eotry.

To evaluate candidate immortalized cell Lines for their ability to express HE3V proteins,

constructs were generated containing the enhanced green fluorescent protein @GFP) under

endogenous HBV promoters. The relative strength of EGFP expression c d d be anaiyzed by

fluorescent microscopy. These experiments would also show which HBV promoter drives EGFP

expression most efficiently .

Based on the outcome of the promoter study, hepatitis B viral vectors were constructed

for use in expressing replication-defective particles. Hepatitis B virus requires a greater-than-one

genome length transcnpt to denve the viral genome. As such, greater-than-one genome length

constmcts were designed with and without the EGFP reporter under control of a HBV promoter.

These vectors were subsequently integrated with baculovinis genomes to improve DNA delivery

efficiency for hepatocyte-derived ceIl lines. Expression of HBV proteins and EGFP were tested

by Western immunoblot and fluorescent microscopy. Generation of HBV DNA-replicative

intermediates in transfected ceiis was con£inned by Southern blot analysis-

To determine whether replication-defective virai particles were being generated,

bacdovirus uifected ceus and media fiom these experiments were analyzed by HBV and EGFP-

specific polymerase chah reactions and electroo rnicroscopy. These replication-defective hepatitis

B viral particles could be used for receptor studies.

Understanding what proteins are involved in HBV entry could allow future development

of anti-vird dmgs that block virus entry into the host ceil and prevent the spread of virions in

uifected and non-infected individuals. As weil, the hepatitis B viral vector system could be used

as a gene therapy tool, permitthg the specific delivery of genetic information to the iiver.

2. MATERIALS AND ~METHODS

2.1. CeU lines and virus

He14 HepG2, Hep 3B, and Ost-7 were purchased fiom the American Type Culture

Collection (Rockville, MD). HeLa and HepG2 cells were grown in Dulbecco's Modified

Essential Medium purchased fiom GIBCO/BRL. (Gaithersburg, MD) supplemented with 10Y0

fetal-calf senun. Hep 3B cells were grown Ui Eagle Minimum Essential Media supplemented with

10% fetal calf senim, 0.1 m . non-essential amino acids and ImM sodium pymvate. HuH-7 cells

were graciously supplied by Dr. Robert Lanford at the University of Texas and grown in

Dulbecco's ModSed Essential Medium bought fkom GIBCO/BRL (Gaithersburg, MD)

supplemented with 10% fetal-calf serum. Sf9 insect ceus were supplied by Invitrogen (San Diego,

CA) and were grown in Grace's Insect Media purchased nom GIBCO/BRL (Gaithersburg, MD)

supplemented with 10% fetal calfserum. The a& strain of hepatitis B virus was obtained firom

the American Type Culture Collection (Rockville, MD).

2.2. Generation of recombinant baculoviruses carrying distinct hepatitis B viral proteins

Different regions of HBV genome were selectively generated using s p e a c primers in a

PCR reaction. DNA fragments spanning the entire S ORF were generated by using primers

specific to the 5' end of the pre-S 1 domain

(5'-CTTTCCGCTAGCCACCATGGGGACGAATCTT-3') and the 3' end ofthe S-domain

(5'-TCCAAAGCTAGCTTAAATGTATACCCAGAGACG-3 DNA fragments spanning

the S-domain were generated by using primers specEc to the 5' end of the S-domain

(5'-CCTTTCGCTAGCATGGAGAACATCACATCAG-3') and the 3' end of the S-domah

(5'-TCCAAAGCTAGCTTAAATGTATACCCAGAACG-3) DNA fkagments spanning

the hepatitis B core protein were generated by using primers specifïc for the 5' end of the

C-domain (5'-CTTTCCGCTAGCCACCATGGACATTGACCCG-3') and the 3' end of the

C-domain (5'-CTTTCCGCTAGCCTAACATTGAGATTC-3')- PCR products were digested with

lVhe 1, then cloned into pETL baculovîrus expression vector also cut with Me L Orientation and

sequence were determined by sending the recombinant vectors for DNA sequencing- Sequence

results were wmpared to the original dd-type adw sub-type KBV clone.

Completed constructs were transfected dong with linearized bacdoviral DNA usuig the

~ a c u l o ~ o l d ~ Transfection Kit fiom PharMingen ~ s s i s s a u g a , Canada). SB cells were seeded

on a T-25 flask and allowed to adhere for 15 mînutes. Ceil culture media was then removed fiom'

the S B cells and replaced with 1 mL BaculoGoldM Transfection BufYer A 0.5 pg of Iuiearized

BaculoGold virus DNA was mixed with 2 pg of the recombinant plasmid DNA containhg the

gene of interest. This rnjxture was incubated at room temperature for 5 b u t e s , then 1 mL of

~ a c u l o ~ o l d ~ Transfection B d e r B was added. The mixture of Transfection B&er B and DNA

was subsequently applied dropwise ont0 the S B cells, rocking the flask fiom side-to-side after the

addition of 2 to 3 drops. The flasks were incubated at 28"C, 0% CO, for 4 hours. Afterwards,

the transfection mixture was aspirated and the cells were gently washed with 3 mL of complete

media. Mer the wash was removed, 3 rnL of fhsh complete media was added and ceUs were

incubated at 2g°C, 0% CO, for 5 days. Afterwards, transfection media was harvested and

recombinant virus was p d e d through plaque assay.

2.3. Baculovirus Plaque Assay

S B cells were seeded at a density of8 x 106 cells per 100 mm plate. Ceüs were allowed

to adhere to the plates for 15 minutes. Serial dilutions of Wus were set up in 5 mL volumes. For

recombinant baculovims screening, dilutions of 10" to 1 o5 were used. For determinhg virus

titres, dilutions of IO4 to 10-'O were used. Once cells were attached to the plates, growth media

were aspirated and the duted virus was gently overlayed onto the ceils. The plates were then

incubated at 28"C, 5% CO2 for 1 hou. An overlay mixture containing 10 m . 5% Sea Plaque

Agarose f?om Mandel Scientific (Guelph, Canada), 40 mL Grace's Insect Media and 100 (50

rng/rnL) Bluogal fkom GibcoBRL (Gaithersburg MD) dissoIved in dimethyIfomamide was

preheated to 42OC. One hour post-infection, virus-containing media were aspirated off the plates

and the agarose-media mixture was gently overlayed onto the c e k Celis were left at room

temperature until the overlay soiidified. Plates were then incubated at 28°C' O% CO2 for 5 to 7

days to allow plaques to form.

2.4. DNA Sequencing

DNA fragments contained in pUC19, pZBac, and pMeIBac A vectors were sequenced,

using an Applied Biosystems 43 01 autornated sequencer located at the Amgen DNA sequencing

facility (Amgen, Thousand Oaks, CA). Sequences and alignments were analyzed using Lasergene

DNASTAR software (Madison, W.

2 5 Antibodies

Polyclonal antibodies against the hepatitis B surface protein were purchased fkom

Biodesign International (Kennebudq ME). Polyclonal antibodies against the hepatitis B core

protein were purchased f?om NovoCastra (Newcastle, United Kingdom).

A polyclonal antibody against the pre-S 1 region was generated by Y.E.S. Biotechnology

Laboratories (Mïssissauga, Canada) against a pre-Sl peptide.

Monoclonal antibodies agaiDst the hepatiûs B surface protein were purchased f?om

Biodesign International Wemebunk, ME). Monoclonal dbod ies directed against mouse and

rabbit 1gG-f-IgM and conjugated with 12 nm colloidal gold were purchased fiom Jackson

ImmunoResearch Laboratories, Inc. (West Grove, PA).

2.6. SDS-polyacrylamide gel eletrophoresis and immunoblot analysis

SDS-polyacrylarnide gel electrophoresis (SDS-PAGE) and Western immmoblot analysis

were performed using pre-cast Novex gels (San Diego, CA). SDS-PAGE gels were run at 200 V

for 1 hour at room temperature using a Pharmacia-Biotech EPS-200 power supply. Transfers

were run at 300 rnA for 1 hour at 4°C onto precut Novex nitroceUulose membranes (San Diego,

CA). Mer transfer, blots were blocked, using a 10% powdered milk solution in phosphate

buEered s a h e (PB S) for 3 0 minutes. Following blocking, blots were probed with primary

antibody diluted in 10% milk in PBS for either 2 hours at 37OC or overnight at 4OC with rocking.

Blots were washed, using a wash solution of 0.2% Tween-20 in PBS three tirnes for 10 minutes.

Afterwards, blots were probed with secondary antibody conjugated to horse radish peroxïdase

purchased fiom Jackson ImmunoResearch Laboratories, Inc. (West Grove, PA) diluted at

1: 10000 in 10% milk for 1 hour at 37°C with rockuig. BIots were washed again with the wash

soiution 3 times for 20 minutes. BindÏng ofsecondary antiiody was detected by ECL

chemiiurninescence reagent purchased fiom Arnersham (Arlington Heights, TL).

2.7. Site-specific mutagenesis of hepatitis B vims genome and promoter construct

generation

Parts of the hepatitis B viral genome were dtered through mutagenesis to insert a unique

restriction site for cloning purposes. Mutations were introduced kto a linearized version of the

hepatitis B virus genome using the QuickChangeTM site-directed mutagenesis kit fiom Stratagene

(La Joila, CA). The hepatitis B genome (subtype adw) was cloned hto pUC19 plasmid,

denatured using heat, and annealed with two complementary oligonucleotides containhg specific

mutations. The oiigonucIeotide strands containhg the mutation were then extended using the P'

polymerase. Positions of site-specific mutations are outlined in Fig. 2.1.

An Me 1 restriction site was inserted into ORF C (nt 193O), uskg the primers

corresponding to the mutated HBc domain

(5'-GAATTTGGAGCTAGCGTGGAGTTACTCTCG-3') and its complement primer

(5'-CGAGAGTAACTCCACGCTAGCTCCAAATTC-3'). An Nhe 1 restriction site was inserted

into ORF P (nt 2481), using primers conrespondùig to the mutated HBp domain

(5'-GGACTCATAAGGTCGCTAGCTTTACGGGGCTTTATTC-3') and its complement primer

(5'-GAATAAAGCCCCGTAAAGCTAGCGACCTTATGAGTCC-3'). An Mie 1 restriction site

was inserted into ORF S under the pre-S 1 promoter (nt 2885), using primers corresponding to the

pre-S 1 domain (5'-GGGACGMTCTTTCTGCTAGCAACCCTCTGGEATTC-3') and its

*-- - 0 Nhe l

O ~GAA~~~GGAGCTAGCGTGGAGTTACTCTC~J' + ATGGACATTGACCC AAlTTGGAGCTACTGTGGAGTTACTCTCGlTiTGCCT

0

Nhe l 2621

~GGCTGCTAGGCTGGCTAGCCAACTGGATC~~ ' 5 ACATCGmCCATGGCTGCTAGGCTGTACTGCCAACTGGATCCTTCGCGGGACGTCC

X start codon + 1419

Figure 2.1 - Regions of the hepatitis B genome altered by site-directed mutagenesis Above is a schematic diagram showing regions of the HBV genome which were altered by site- direct mutagenisis. In most cases, an Nhe 1 site was inserted. Mutations are denoted in red. Numbering is based on the middle of the unique Eco R I restriction site found in the adw HBV genome-

complement (5'-GAATCCCAGAGGGTTGCTAGCAGAAAGA'iTCGTCCC-3')- An Nhe I

restriction site was inserted into ORF S under the S promoter (nt 175), using prïmers

corresponding to the S-domain coding strand

(5'-GAGAACATCACATCAGCTAGCCTAGGACCCCTGCTC-3') and its wmplement

(5'-GAGCAGGGGTCCTAGGCTAGCTGATGTTCTC-3'). An Nhe 1 restriction site

was inserted into ORF X under the X promoter (nt 1388), using p h e r s corresponding to the

mutated HBx domain (5'-GGCTGCTAGGGTGGCTAGCCAACTGGATCC-3') and its

cornplement (5'-GGATCCAGTTGGCTAGCCACCCTAGCAGCC-3')-

Methylated, non-mutated parental DNA template was specifically digested with Dpn I and

the mutated plasmid was used to transform XL2-Blue ultracompetent cells-fkom Stratagene (La

Joua, CA). Colonies were isolated, grown, and their plasmid DNA were harvested for sequence

confirmation.

The mutagenized hepatitis B virus genome was verified by digesting the constmct using

the newly inserted restriction site. A DNA fiagrnent encoding the fidl length of the enhanced

green fluorescent protein (EGFP) was arnplined by polymerase chah reaction (PCR) using

oligonucleotide primers corresponding to the 5' end

(5'-GAATTTGGAGCTAGCGTGGAGTTACTCTCG-3') and the 3' end

(5'-CGAGAGTAACTCCACGCTAGCTCCAAATTC-3') of EGFP fiom pEGFP-C2 plasmid

purchased from Invitrogen (San Diego, CA). The EGFP fragment was cloned ïnto mutagenized

hepatitis B virus genome under control of various hepatitis B virus promoters in fiame with the

start codon of a particuiar HBV protein. DNA sequencing was performed on these recombinant

genome constructs to ve* correct insertion of EGFP.

To study the effectiveness of the hepatitis B sdace antigen promoter, the mutagenized

EGFP-HBV genome wnstruct with EGFP cloned downstream of the SHBs start codon was

excised fiom ptTC19, using the unique EcoRI site. The DNA fiagment wntaining nucleotides

18 14 to 3200 fiom the HBV genome was then cloned into pcDNA3.1, placing the hepatitis B

surface antigen promoter @ S ) region at the proper position upstream of the hepatitis B surface

antigen coding region. The entire HBV coding region was cloned anti-sense to the CMV

promoter found in ~ C D N A ~ 11 to prevent CMV fiom driving HBV mRNA transcription.

Control constructs were generated by cloning EGFP into empty pUC19 and pMelbacA

plasmids.

2.8. Mutagenized EIBV DNA transfections into various cell lines

The various mutagenized HBV DNA constnicts were transfected into a variety of cell

h e s using the SuperFectTM tritllsfection reagent supplied by Qiagen (Qiagen Inc., USA).

Transfections were perfomed on cells which were 50% to 80% confiuent and perfonned in 6-

well plates according to the protocol supplied with the S u p e r ~ e f l reagent. The protocol is

briefly outlined as follows. Cells were cultureci in their recommended media and passaged the day

before transfection. On the day of transfection, 2pg of DNA were rnixed with 100 pL+ with

serum-free media in separate vials. 10 pL S u p e r ~ e c t ~ was added directly to the diluted DNA

and mixed immediately by vortexhg for 10 seconds. This mixture was leR at room temperature

for 45 minutes to aüow for ~ N ~ - ~ u ~ e r ~ e c t ~ complex formation. During the incubation, growth

media was aspirated fiom the cells. CeUs were washed once with 2 rnL Dulbecco's Phosphate

BuEered Saline (PBS) purchased from GIBCOIBRL (Grand Island, NY). Upon completion of

the ~ ~ ~ - S u p e r f e c t ~ ~ incubation, the PBS was aspirateci fiom the cells. 600 of media

containhg serum was added to the DN~-Supe r fkc t~~ complexes. This mixture was applied

dropwise onto the cells. Cells were then incubated at 37OC, 5% CO2 for 4 hours. Aflerwards, the

transfection mixture was removed fiom the cells and replaced with one volume of cell culture

media containing 10Y0 fetd-calfsenim @CS). CelIs were kept at 37OC, 5% CO, Three days post

transfection, cells were analyzed for fluorescence.

2.9. Fluorescent anaiysis of transfected cens

Celis transfected with the various DNA constructs were visualized using a Leica DM IRE3

Inverted ff uorescent microscope containing a W filter for EGFP excitation as weii as a 3 5 mm

camera for acquiring pictures (Leica Microsystems, Canada).

2.10. Generation of hepatitis B virus replication defective genome and packaging vectors

The HBV constmcts used contain a terrninally redundant HBV genome, aib-type a h ,

under control of the cytomegalovîrus immediate early promoter. Constnict design is outlhed in

Fig. 2.2. The basis of the baculovirus gene transfer system are cartooned in Fig 2.3. The

constnicts were generated as foiiows. A DNA fiagrnent spanning the HBe antigen start codon to

the unique Eco R I restriction site was generated by polymerase chah reaction @CR) with

oligonucleotide primers correspondhg to the H B e 5' end

(5'-GGCGCTAGCATGCAACTTTTTCACC-3') and 3' end

(5'-GGCGAATTCCACTGCATGGCCTG-3'). The PCR products were digested with Eco RI

and Me 1, then subsequently cloned into pcDNA3.1 cut with the same enzymes. The pcDNA 3.1

wtHBV Construct

genomic transcript region

Defective Reporter Construct

Packaging Construct

Figure 2.2 - HBV-Bacuiovirus construct design

This is a schematic representation of the daerent HBV-baculoviral constructs used for the generation of recombinant HBV-carrying baculovinis. T h e HBV ORFs and main cloning sites are noted.

constnict was then utilized as a template for the generation of a DNA fiagrnent containing the

HBV DNA fragment under control of the cytomegalovinis (CMV) promoter. This larger

hgment was generated by PCR, using the oligonucleotide primers corresponding to the CMV

promoter 5' end (5'-GCCTCGAGCGATGTACGGGCCAGATATAC-3 ') and the 3' HBV Eco Ri

site end (5'-CGAATTCCACTGCATGGCCTGAGC-3'). The PCR product was digested with

Xho 1 and Eco Rl and cloned into pMelbac A which was also digested with the sarne enzymes-

The pUC19-HBV construct, containhg EGFP under control of the SHBs promoter, was digested

with Avr 11 and Hpa 1 enzymes, removing 783 nucleotides from the HBV genome. Nucleotide

overhangs were removed ushg Mung Bean Nuclease purchased fiom New England Biolabs

~ss i s sauga , Canada) and religated. The tnincated HBV genome, wntaining EGFP under the

HBs promoter, was excised using Eco RI. The pMelbac A-CMV:HBe(start) constnict was then

linearized with Eco R I and ligated to the tnincated HBV genome containing EGFP, under control

of the SHB s promoter element to generate the reporter constnict, pMelbac A-CMV: e-HBV(S : G).

The packaging conçtnict was generated in a nearly identical manner. However, the

packaging constnict does not contain the pre-C region ofthe HE3V genome nor does it have

EGFP. Instead, a DNA fiagrnent spannuig the region fiom the HBc start codon to the unique

Eco R1 restriction site was generated using primers corresponding to the HBc start codon region

( 5'-GGCGCTAGCATGGACATTGACCC-3') and the 3' HBV Eco RI site end

(Sr-GGCGAATTCCACTGCATGGCCTG-3').

The packaging constmct, pMelbacA-CMV:c-wtHBV, contains HBV nucleotides 190 1 to

321 1 to 3212/1 to 321 1, numbering fi-om the fÏrst T in the EcoRI restriction site. The wtHBV

construct, pMelbacA-CMV:e-wtHsV, contains HBV nucleotides f 8 14 to 32 1 1 to 3212/1 to

Figure 2.3 - HBV-Baculoviral vector system

This is a schematic representation of the HBV-baculoviral vector system. A pair of recombinant baculoviruses (a packaging virus and reporter virus canying EGFP) would be used to CO-infect a ce11 line capable of supporting hepatitis B viral synthesis. CMV and endogenous HBV viral promoters would be used to drive the transcription of the different HBV transcripts. The packaging virus lacks the region containing the epsilon stem-loop. The defective viral construct has EGFP disrupting ORF S and ORF P, but still retains the 5' epsilon stem-loop region. Thus, only the defective viral construct would generate pgRNA which could then be packaged by HBp, HBc, and HBs proteins. The resulting progeny HBV virions would be structurally identical to wtHBV, but would be unable to replicate. Instead of the SHBs gene, they would carry the EGFP gene under control of the S-promoter region as a reporter.

321 1. The reporter constnict, pMe1bacA-CMV:e-HBV(S:G), contains HBV nucleotides 18 14 to

32 1 1 to 32 12/1 to 32 1 1, but has EGFP cloned at nucleotide 175 and has the region spanning

nucleotides 178 to 961 in wtHBV removed-)

2.1 1, Transfection of hepatitis B virus replication defective genome and packaging vectors

The hepatitis B virus constucts were transfected into Hep G2 and HuH-7 cells using

GenePORTERTM purchased from Gene Therapy Systems (San Diego, CA). Ceits were passaged

the day before transfection in complete growth media. Transfections were performed on cells that

were 50% to 80% confluent grown in T-75 flasks. For transfections, 15 pg of DNA was mixed

with 2-5 mL of serurn-fie media. In a separate vi& 80 @ of GenePORTER was mixed with

2.5 mL of serum-fiee media. The diluted DNA was added to the diluted GenePORTER and

mixed rapidy. The GenePORTER-DNA mixture was incubated at room temperature for 45

minutes. M e r the incubation was complete, media was aspirated fiom the cells and the

transfection mixture was added carefblly to the ceii culture- Celis were incubated with the

transfecbon mixture for 5 hours at 37"C, 5% CO,. 5 hours post-transfection, one volume of

media, containing 20% fetal caifserum, was added to the ceils and the culture was incubated

ovenught at 37T, 5% CO,,

2.12. Generation of recombinant baculovirus cawying the hepatitis B virus replication-

defective genome and packaging vectors

The Bac-N-Blue kit was obtained fiom Invitrogen (San Diego, CA). For each

transfection, 3 x 106 SB cells were passed into a T-25 flask and allowed to adhere to the flask

surface for 15 minutes. Meanwhile9 one tube of linear AcMNPV DNA (0.1 pg/pL, 10 $1 was

rnixed with 3 pg of recombinant plasmid, 1 mL senun-fiee Grace7s Insect media, and 20 pi,

lnsectinTM liposomes. The mixture was briefly vortexed for 10 seconds, followed by incubation

at room temperature for 15 minutes, dowing tirne for DNA-cornplex formation. During

incubatioq media was aspirated fiom the SB cells and replaced with 2 mL serum-fiee Grace's

Insect media. Once the transfection mixture incubation t h e was complete, media was aspirated

fkom the ceus and the transfection mùrture was added dropwise onto the cells. Cells were then

incubated at room temperature on a slowly rocking platfom for 4 hours- Four hours post-

tramfection, 1 mL of media containing 10% fetal-calf semm was added into each flask and cells

were üicubated at 27OC, 0% CO, for 72 hours. Afterwards, the transfection media was harvested

and recombinant Wuses were purified through plaque assays.

2.13. Amplification and preparation of recombinant baculonnis stocks

Large amounts of recombinant bacdovirus were generated by amplifiring virus obtained

fkom a single viral plaque. For each round of amplification, a rnultiplicity of infection (M.O.I.) of

0.1 pfu per cell was used to infect flasks of SB cells grown in Grace7s Insect media with 10%

fetal-cal€ serum. Cells were incubated for 1 week at 280C7 0% CO,. One week post-infection,

the media was harvested. CelI debris was removed by centrifbging the media at 1500 rpm for 25

minutes at 4OC in a Svvinging-bucket rotor. The supernatant was stored at 4°C. Viral titre was

detennined by plaque assay and the process was repeated using more ceils as higher titres were

generated.

For high-titre recombinant baculoviral stock generation, six T-175 flasks were seeded with

2 x 10' S B ceils. Ceils were ailowed 15 minutes to adhere to the flask- Cells were wnsequently

infected with recombinant baculovirus at M-0-1 of 0.1, then incubated for 7 days at 28OC, 0%

C 4 - M e r amplification, media was harvested and centfigeci at 1500 rpm, 20 minutes at 4OC in

a swinging bucket rotor to remove ceil debris. The supernatant was transfemed into SW28

UltraClear Ultracentrifùge tubes with a volume of 30 mL of bacdovirus stock per tube. An

underlay of X%(w/v) sucrose was added to each tube and balanced. The media was then

centrifûged in a Beckxnann (Pa10 Aito, CA) XL-70 Ultracentrifuge using a Beckmann SW28 rotor

at 24000 rpm for 75 minutes at 4OC. M e r the spin, the supernatant was rernoved carefidly and

the pellets were resuspended in Dulbecco's Modïfied Essential Media without serum in an

appropriate volume (Typically 2 mL for 6 SW28 tubes). V i s titres were detennined using

bacdovirus plaque assays.

2.14. Pseudo-infection optimization usiog recombinant bacuiovims on Hep 6 2 cek

Recombinant bacuiovims containing the mamrnalian CMV-EGFP expression cassette were

used to determine the optimai pseudo-infection conditions on Hep G2 hepatoma celis.

For M-0.1. optimization, Hep G2 cells were passaged the day before and plated onto 6-

well plates. On the &y of the pseudo-infection, ceils were typically 50% to 80% codiuent.

Actud ceii counts were detexminesi by typsinizing one of the six weiis on the plate and counting

using a haemocytometer. Once determined, bigh titre virus stock was dituted in 2 mL of media to

yield solutions containing 0, 10, 100, 500, and 1000 M.0.I.s ofrecombinant baculovirus. Each

M.O.I. was set up in tripkate. Ceiis were incubated with virus overnight at 37OC, 5% CO,. The

next day, the media was removed and ceiis were washed once with 2 mL hilbecco's Phosphate

Buffered Saline fiom GibcoBRL (Gaithersburg, MD). Fresh media wntaining 10% fetal-calf

senun was then added to each welI a m d cells were le& at 37"C, 5% CO2 for 2 more days. Three

days post-pseudo-infection, media wâas removed from the ceiis and flow cytometry was performed

to determine the level of infection by measuring EGFP fluorescence.

For inoculation time optimizaL-tion, Hep G2 ceiis were passageci the day before and plated

ont0 6-well plates. On the &y of the: pseudo-infection, ceiis were typically 50% to 80%

confiuent. Actual cell counts were determineci by trypsinizing one of the six welis on the plate

and counting using a haemocytometeir. Once calibrated, high titre virus stock was diluted in 2 mL

of media to yield solutions containing ; 500 M.0.I.s of recombinant baculovirus. Each time point

was set up in triplicate. At 1 hour, 5 Ihours, 24 hours, 48 hours and 72 hours post-pseudo-

infection, media containing the recomiibinant baculovinis was removed and ceils were washed

twice in 2 mL Dulbecco's PBS. Fresth media containing 10% fetal-&semm was then added to

the cells. 72 hours post-pseudo-ideclion, media was removed fiorn al l cells and flow cytometry

was performed to determine EGFP flmorescence.

2.15. Flow cytometry andysis of pseudo-infected ceii lines

Medium from the pseudo-infected Hep G2 ceUs was removed and ceUs were washed once

with 2 rnL PBS while still attached to -the plate. Afterwards, 1 mL of non-enzymatic Cell

Dissociation Buffer fiom Sigma (St. Louis, MO) was added to each well and left for 5 to 10

minutes to detach cells f?om the plate. CeUs were then transferred into individual tubes and

centrifuged at 1500 rpm for 5 minutes to pellet the cells. Supernatant was removed and cells

were resuspended in 1 mL FACS buffer (1% bovine semm albumin, 5 mM EDTA, 0.1% sodium

atide in PBS). Celis were subsequentl3 analyzed on a Becton-Dickinson analyzer equipped with a

15 mW argon laser at 488 nm. The data were collected and andyzed using CellQuest Software.

2.16. Harvesting HBV particles from baculovirus infections of SB, Hep 6 2 and HuH-7 ceils

Supernatant fiom recombinant baculovirus-infected SB celis was removed fiom the ce11

layer and placed into Beckmann SW28 U1traClear uitracentrifûge tubes (PaloAlto, CA). Medium

was centrifbged at 10000 rpm for 15 minutes at 4OC to pellet cell debris. The supematant was

subsequently transfemed into clean Beckmann SW28 UitraClear u1tracentrifÙge tubes (Palo Alto,

CA) and centrifbged at 25000 rpm for 24 hours at 4°C. Upon cornpletion of the centrifugation,

the supematant was removed and pellets were resuspended in a solution containing 50 mM NaCl

and 20 mL Tris-HCI @H 7.4).

Medium ftom recombinant baculovims-infected Hep G2 and HuH-7 cells was removed

f?om the ceU layer and placed into Beckmann SW41 UltraClear ultracentrifbge tubes (PaloAlto,

CA). Medium was centnfùged at 10000 rpm for 15 minutes at 4°C to pellet cell debris. The

supernatant was transferred into clean Beckmann SW4 1 UitraClear dtracentrifbge tubes (Palo

Alto, CA) which contained a 1 mL 25%(w/v) sucrose cushion. These tubes were then centrifùged

at 30,000 rpm for 3 hours at 4°C. Upon completion of the spin, the supematant was removed and

pellets were resuspended in 300 pL of a solution containing 50 m . NaCl and 20 mM

Tris-HCl(pH 7.4).

2.17. Harvesting hepatitis B particles from transfected HuH-7 cells

Media fiom recombinant banilovinis plasmid transfections of HuH-7 ceEs were removed

fkom the ceil layer and placed into Beckmann SW41 UltraClear ultracentrifuge tubes (PaloAlto,

CA). Media was centrifuged at 10,000 rpm for 15 minutes at 4OC to pellet cell debris. The

supernatant was subsequently transferred into clean Beckmann S W4 1 UltraClear ultracentrifige

tubes (Pa10 Alto, CA) which contained a 1 mL 25%(w/v) sucrose cushion The tubes were then

centrifuged at 30000 rpm for 3 hours at 4°C. Upon completion of the spin, the supernatant was

removed and pellets were resuspended in 300 pL of a solution containing 50 mM NaCl and

20 mM Tris-HCl(pH 7.4).

2.18. Sucrose gradient analysis of secreted particles

W e s t e d particles were prepared as previously descnbed (See Hepatits B pmcIe

harvesfrigfi-om recombinunt bactïIowvlms infections of Si', Hep G2 andHuH-7 cells and

Hepottis B particle harvestingflom frmsfected HuH- 7 tells). DiEerent density sucrose

solutions were prepared using PBS. The range of solutions made were from 20%(w/v) to

60%(w/v) at 5%(w/v) increments and were filter sterilized using 0.22 micron MiIlipore (Bedford,

MA) filters. The stock sucrose solutions were stored at room temperature until needed.

To prepare the gradient, 1.2 mL of each sucrose solution was carefùuy overlayed upon

each other in a Beckmann SW41 UitraClear ultracentfige tube (Palo Alto, CA) beginning with

the 60%(w/v) sucrose solution on the bottom ofthe tube and continuing to overlay at 5%(w/v)

intervals until reachuig 20%(w/v). This step-wise gradient was allowed to diffuse ovemight at

4OC. The foliowing day, 1 mL of concentrated media was gently overlayed on top of the gradient.

The tubes were then centrifuged in a Beckmann XL70 Ultracentrifuge at 30000 rpm for 24 hours

at 4OC. The centrifuge braking fùnction was tumed off to d o w the rotor to decelerate slowly in

order to prevent disruption of the gradient.

Once complete, the gradients were harvested by puncturing a smd opening into the base

of the SW41 UtraCIear tube and collecting fiactions dropwise into separate, clean tubes.

Different 5actions were anaiyzed by SDS-PAGE and western blot to determine which fiactions

contained proteins of intexest. Fractions of interest were also analyzed to determine their

approximate density.

2.19. DNA analysis of cmncentrated media from transfected HuH-7 ceils

DNA constnicts wntainllig genes of interest were transfected into HuH-7 celis using

G ~ ~ ~ P O R T E R ~ transfection reagent. Media fiom HuH-7 cells were harvested 5 to 7 days post-

transfection and concentrated as described earlier. Concentrateci samples were then divided into

aliqyots for analysis.

For the ikst set o f experiments, samples were treated with proteinase K fiom Gibco BRL

(Grand Island, NY). 50 p L concentrated media was mixed with 150 pL water and 20 pL

20rnglmL proteinase K. Fhe mixtures were incubated at 50°C for 1 hour, then phenolchloroform

extracted and ethano1 precipitated.

For second set of experiments, samples were treated with DNAse 1 fiom GtbcoBRL

(Grand Island, NY). 50 concentrated media was mixed with 150 & water, 20 p.L DNAse 1

reaction bufEer (200 mM Tris-pH 8.3, 500 mM KCI, 20 mM MgCl, in water) and 1 pL DNAse 1.

These mixtures were incubated at room temperature for 1 hour, then phenol-chloroform extracted

and ethanol precipitated.

For the third set o f experiments, sarnples were treated first with with DNAse I, the DNAse

was inactivated, followed by proteinase K digestion. 50 concentrated media was mixed with

50 pL water and 1 pL DNAse 1. Mixtures were incubated at room temperature for 30 minutes.

1 pL 0.5 M EDTA was added to each reaction to inhiiit DNAse 1 activity and the mixture was

heated at 65°C for 10 muiutes.Afler coohg on ice for 5 minutes, 100 pL water and 20 pL 20

m@mL proteinase K were added to each sample. Mvaures were then incubated at 50°C for 1

hour, foilowed by phenol-chlorofom extraction and ethanol precipitatioa

AU phenol-chioroform extractions were performed as follows. To the treated mixtures,

220 pL of phenol and 220 pL chloroform was added. Samples were vortexed, then centrïfbged in

a table-top centrifùge at 13200 rpm for 5 minutes at room temperature. 200 pL aqueous phase

was removed fkom the top to which 5 $ glycogen, 20 j L 3 3 sodium acetate and 440 pL cold

anhydrous ethanol was added. This solution was vortexed briefly, then lefi at -20°C for 20

minutes to facilitate DNA precipitation Tubes were then centrifiiged in a microfbge at 14000

rpm for 30 minutes at 4OC. Supernatants were removed and pellets were washed once in cold

70% ethanol and pelleted in a microfùge at 14000 rpm for 15 minutes at 4OC. Supernatants were

rernoved and pellets were allowed to air dry for 30 minutes. The dry peilets were then

resuspended in 30 pL water.

Pelleted DNA was tested for the presence of SHBs and EGFP DNA using specific primer

pairs. PCR reactions e e carrieci out as follows. 1 pi, remspended DNA sample was rnixed

with 1 pL forward 5' SHBs or 5' EGFP primer, 1 p.L reverse 3' SHJ3s or 3' EGFP primer, 1 pL

20 mM d N ï P q e , 5 pL 100 m M MgCl, 5 pL PCR reaction buffer, 35.8 pL water and

0.2 pL Taq polymerase nom Stratagene (La Joua, CA). PCR reaction conditions consisted of one

cycle of denaturation at 94°C for 10 minutes, 3 5 cycles of amplification, each cycle requiring

heating at 94°C for 1 minute, 45°C for 1 minute, 72°C for 1.5 minutes, and finally followed by

one cycle of extension at 72OC for 10 minutes. AmplXed DNA was separated on an agarose gel

and visualized by staining with ethidiun bromide.

2-20. Southern blot analysis of Hep 6 2 ceils transfected with defective genome and

packaging vectors

HuH-7 cells were passaged the day before bansfection into T- 150 flasks. The

mutagenized HBV DNA constructs were transfected hto HuH-7 ceils using G ~ ~ ~ P O R T E R ~ ~

purchased fiom Gene Therapy Systems (San Diego, CA). Transfections were performed on ceiis

that were 50% to 8% confluent- For transfections, 60 pg of DNA was miîxed with 5 mL of

serum-fiee media. In a separate vial, 200 pL of GenePORTER was mixed with 5 mL of senim-

&ee media. The diluted DNA was added to the diluted GenePORTER and mixed rapidly. The

GenePORTER-DNA mixture was incubated at room temperature for 45 minutes. Once the

incubation was complete, media was aspirated fiom the celis and the transfection mixture was

added carefidy to the cell culture. Cells were încubated with the transfection mixture for 5 hours

at 37"C, 5% CO,. 5 hours post-transfection, one volume of media, containing 20% fetal calf

serum, was added to the cells and the culture was indubated for 3 days at 37OC, 5% CO2.

Three days post-transfection, media was removed fiom the cells. Cells were washed once

with PBS, then 10 mL of Hirt extraction bufZer (0.6% SDS, 0.0 1M Tris pH 7.9, 0.0 1M EDTA)

was applied to the monolayer. Cells were aiiowed to lyse for 15 minutes at room temperature-

The lysed ceII suspension was transferred into 50 mL conical tubes and vorîexed to break apart

large membrane pieces. M e r vortexïng, 5 mL 3M sodium acetate pH7.0 was added to the lysed

cell suspension and vorîexed again. The mixture was left on ice in cold room for 16-18 hrs. The

foiiowing day, the lysed cell suspension was centrifùged at 10000 rpm for 30 mimat 4°C in an

Eppendorf centrifuge. The supernatant was taken and extracted ushg phenol, then a 1: 1 phenol-

chioroform mixture, followed by a chloroform extraction. The resulting solution was subject to

ethanol precipitation by the addition of 20 pL of glywgen (5 mg/mL in H20) and twice the

volume of cold ethanol. The suspension was incubated at -20°C for 1 hour before being

centrifùged at 12000 rpm for 30 minutes at 4OC. The resulting pellets were washed twice using

cold 70% ethanol then air dried before being resuspended in 50 to 100 pL of water. The amount

of DNA collected was determined by taking the optical density of a diluted solution.

Ten pg of DNA from each tranfection was digested using Nco 1 restriction endonuclease.

The digestion reaction was canied out overnight at 37OC. One pg of undigested or digested

transfection samples were loaded into a 1% agarose gel. The gel was run at 70V for 4 hours at

room temperature. Once adequate separation was achieved, the gel was photographed and

subject to denaturing conditions using 0 - 5 M N a m 1.5 M NaCl for 45 minutes at room

temperature on a rocking platform. The gel was then neutralized using 1.5 M NaCl, 0.5 M Tris

pH7.4 for 45 minutes at room temperature on a rocking platforni- The Southeni blot transfer

apparatus was assembled as followed @om top to bottom): weight, glass, paper towels, several

layers 3mm filter paper presoaked in 2 x SSC (wet), HybondW-N membrane (Amersham Life

Science, UK), gel, filter paper sitting on platfiorm with a Hter wick r e h g in a pool of 20 x SSC

(3M NaCl, 0.3M Na,citrate). The entire set-up was wrapped in cling wrap and aiiowed to

transfer overnight at room temperature- The following day, the set-up was disassembled and the

location of the lanes on the gel were marked on the Hybond membrane. The membrane was then

washed twice using 2 x SSC, then wrapped in c h g wrap- The membrane was W crosslinked

using auto-crosslink fùnction 2 times on each side.

The radioactively labelled probes were generated using the Ready-To-Go DNA Labelling

Kit (-dCTP) fkom Amersham Pharmacia Biotech (Buckinghamshire, England) Templates for

probe generation were excised fiom an appropriate plasmid and purified by gel extraction.

Cleaned DNA was then quantifïed by using a spectrophotometer. The 3 2 ~ labelling was

performed according to the kit's directions as follows. 50 ng of template DNA was dissolved in

25 pL of water. The contents of the supplied reaction mix were reconstituted by adding 20 pL

distilled water to tube. The mumires was allowed to sit on ice for 5 minutes. The template DNA

was denatured by heating for 2 to 3 minutes at LOO0C, then placed Unmediately on ice for

2 minutes. This DNA mixtures was then added to the reconstituted Reaction Mix dong with

5 & of dCTP (3000Ci~mmol). The solution was mixed by pipetting up and down several

times, pulse centfigeci to remove bubbles, then incubated at 37°C for 15 minutes. Once the

incubation period was over, the reaction mixture was loaded onto clean 5200 spin column and

centnfùged for 2 minutes spin at 3 000 rpm at room temperature- Radioactivity of the generated

probe was determined by mixing 1 pL of cleaned probe with 5 rnL of Ready Safe Liquid

Scintillation Cocktail fiom Beckmann (Mississauga, Canada), then counted using a Beckman LS

6500 Multipurpose Scintillation counter (Mïssissauga, Canada) -

Membranes were ptaced into roller bottles and 10 mL of pre-warmed ExpressHyb solution

fiom Clontech at 60°C and incubated for 30 minutes in a rotating oven set at 60°C. RadioIabelled

probes were denatured by incubating at 100°C for 5 minutes, then chilled on ice.

Radiolabelled probe was rnixed with 10 mL of ffesh ExpressHyb at a ratio of 1 x 10S counts per

minute per millilitre. The solution on the membranes was exchanged with the radiolabelled mix

and incubated in a rotating oven at 60°C for 1 hour. Once the incubation was completed, the

membranes were washed twice at 60°C for 30 minutes each using the following solutions:

2 x SSC with 0.05% SDS and 0.1 x SSC with0.1% SDS. Washed blots were wrapped with ciing

wrap and exposed to a Molecular Dynarnics Phosphoirnager Screen overnight at room

temperature (Sunnyvale, CA). The following day, the screen was scanned using a Storm 860

P hosp hoimager by Molecular Dynamics (Sunnyvale, CA).

2.21. Embedding and sectioning of Sm, Hep 6 2 and HuH-7 for electron microsopic analysis

Bacdovirus infected SB cells fiom T-75 flash were harvested 3 days post-infection and

pelieted by centrifiiging cells at 1200 rpm for 10 minutes at 4°C. Cells were washed once with

1 mL PBS, transferred into sterile tubes and collected by centrifugation. The supernatant was

removed and discarded. Ceiis were fked using a solution of 4% parafomaldehyde and 0.5%

glutaraldehyde (Electron Microscopy Sciences, Fort Washington, PA) in PBS for 20 muiutes at

room temperature. Afterwards, cells were washed three times with 1 mL PBS. CeUs were then

fixed using a solution of 1% osmium tetroxide (Electron Microscopy Sciences, Fort Washington,

PA) in phosphate buffer for 30 minutes at room temperature in a fume hood. Foilowing osmium

fixation, cells were washed three more times with 1 mZ, sterile water.

Ceil dehydration was performed using a graded series of ethanol solutions: 5096, 70% and

95% ethanol in water. For each step, cens were resuspended in 1 mL of solution and allowed to

incubate 5 minutes at room temperature. CeUs were then coliected by centrifugation before

exchanging solutions.

Ceil pellets were infiltrated with LR White Resin (London Resin Company, Berkshire,

England) using a graded series of LR White and ethanol mixtures. Treatrnents was as foIlows.

Pellets were ïnfiltrated with 50% LR White in ethanol for 1 hour with gentle rocking at 4"C, then

with 75% LR White in ethanol for 1 hour with gentle rocking at 4°C. Pellets were then infiltrateci

wi-th 100% L R White overnight with gentle rockhg at 4OC to prevent polymerization. The

following day, f?esh LR White was added to the cell pellets. Pellets were then transferred into

gelatin 00 capsules f h m Electron Microscopy Sciences (Fort Washington, PA) and allowed to

polymerize overnight by incubating at 60°C. After cornplete polymerization, embedded SB cells

were sectioned on a Sorvall Instruments MT6000 microtome (WiIlmington, DE). Sections were

subsequently mounted onto 300-mesh nickel grids bought fiom Electron Microscopy Sciences

(Fort Washington, PA) for imrnuno-staining and counter-staùling.

Baculovinis pseudo-infected Hep G2 or transfected HuH-7 cells grown in T-75 flasks

were harvested 5 to 7 days post-infection or transfection. CeUs were collected by centrifugation

at 1200 rpm for 10 minutes at 4°C- Cells were washed once with 1 mL PBS, transferred into

sterile tubes and recentrifiiged. The supernatant was removed and discarded. Cells were fixed

using a solution of 4% paraformaidehyde, 0.5% giutaraldehyde in PBS for 20 minutes at room

temperature. Afterwards, ceils were washed three times with 1 mL PB S. Cells were then k e d

using a solution of 1% osmium tetroxide (Electron Microscopy Sciences, Fort Washington, PA)

in phosphate b&er fo 30 minutes at room temperature in a fime hood. Following osmium

fixation, cells were washed three more times with Z mL sterile water. Cell dehydration was

performed using a graded senes of ethanol solutions: 50%, 70% and 95% ethanol in water. For

each step, ceus were resuspended in 1 mL of solution and allowed to incubate 5 minutes at room

temperature. Ceils were then collected by centnnigation before exchanging solutions. Pellets

were infiltrated with LR White Resin using a graded series of LR White and ethanol mixtures-

Pellets were idtrated with 50% LR White in ethanol for 1 hour with gentle rocking at 4OC, then

with 75% LR 'White in ethanol for 1 hour with gentle rocking at 4°C. Pellets were then infiltrated

with 100% LR White oveniight with gentle rocking at 4OC to prevent pdymerization. The

foliowing day, fresh LR White was added to the cell pellets. Pellets weme then transferred into

gelatin 00 capsules and allowed to polymerize ovemight by incubating at 60°C. FoUowing

complete polymerization, ernbedded Hep G2 and HuH-7 cells were sectrioned and mounted onto

3 00 mesh nickel grids for immuno-st aining and counter-stairiing.

232. Immunogold labelling of thin-sectioned embedded specimens

Grids were floated, specimen side down, on 100 pL of saturated sodium periodate f?om

Sigma (St. Louis, MO) for 10 minutes at room temperature. Gnds werie washed by floating them

once with 500 pL Htered water. Grids were then incubated with a blocking solution containhg

200 pL of 0.2%(v/v) fish gelatin fiom Sigma (St. Louis, MO) in PBS for 30 minutes at room

temperature. Primary antibody was diluted at 1: 100 in blocking solutio:-n. Grids were fioated on

100 pL of diuted primas. antibody for either 2 hours at room temperature or overnight at 4OC.

Foiiowing primary antibody incubation, grids were washed by floating grids specimen side down

on six consecutive 500 pL droplets of water for 2 minutes each. Secondary antibody conjugated

with 12 nm colIoidal gold was diluted at 1: 100 in blocking solution. Gmids were floated on 50 &

secondary antibody for 1 hour at room temperature. Following secondrary antibody incubation,

grids were washed by Boating grids specimen side down on six consecmtive 500 pL droplets of

water for 2 minutes each. Grids were then allowed to air dry before colunter-staining.

2.23. Immunogold labelling of concentrated particies from concentrated ce11 culture media

Concentrated samples were applied ont0 formvar-nickel grids f?om Electron Microscopy

Sciences (Fort Washington, PA). 5 pL of concentrated media was ailowed to interact with the

coated gxids for 15 minutes, then removed. Grids were allowed to dry before labelling. Grids

were floated, specimen side do- on a blocking solution containing 200 pL of 0.2%(v/v) fish

gelatin (Sigma, St. Louis, MO) in PBS for 30 minutes at room temperature. Primary antibody was

diluted at 1: 100 in blocking solution Grids were floated on 100 pL of diluted p r i m q antibody

for 3 hours at room temperature. Following primary antibody incubation, grïds were washed by

floating grids specimen side down on six consecutive 500 pL droplets of water for 2 minutes

each. Secondary antibody conjugated with 12 nm colIoidal gold was diluted at 1: 100 in blocking

solution. Grids were floated on 50 p L secondary antibody for 1 hour at room temperature.

Following secondary antibody incubation, grids were washed by floating grids specimen side

down on six consecutive 500 pL droplets of water for 2 minutes each. Grids were then allowed

to air dry before counter-staining.

2.24. Negative staining of prepared grids

Grids with samples were counter-stained ushg uranyl acetate and lead citrate. Gnds were

floated on 50 yL 2%(w/v) uranyl acetate from Electron Microscopy Sciences (Fort Washington,

PA) in aqueous methanol at room temperature for 3 minutes. Grids were washed by floating

twice on 500 pL. droplets ofwater, 2 minutes for each incubation. Grids were then counter-

stained by floating them on O.Z%(w/v) lead citrate fiom Electron Microscopy Sciences (Fort

Washington, PA) in 1 N NaOH at room temperature for 3 minutes. Grids were washed by

fioating twice on 500 pL droplets of water for 2 minutes each. Gnds were aüowed to air dry for

at ieast 1 O minutes before being examined on an electron microscope,

2-25. Electron microscope anaiysis

Specimens were examined and photographed in a Hitachi H600 transmission electron

microscope at an accelerating voltage of 75 kV. AU electron microscope work and photography

was performed at the Medicai Sciences Building at the Universisr of Toronto.

3. REXJLTS

3.1. Acknowledgements

1 would like to thank the following individuals for their contribution to the following

experirnental results. Thanks to Cathy Iorio for providimg the initial recombinant hepatitis B

protein baculovirus constructs. Thanks also to Farida Sarangi for general clonhg assistance,

Southem blotting., and advice.

1 would like to thank Jason Davis in Dr. Peter 0ttensmeyer7s lab in the Department of

Medical Biophyics at the University of Toronto as well as Steven Doyle at the Universiv of

Toronto Electron Microscope Facility for their assistance in embedding Güng, sectioning,

staining and visualization of both cell and particle preparations.

3.2. Sitespecifie mutagenesis can be used to analyze hepatitis B promoter strengths in

different immortaiized ceU lines

Hepatitis B promoter regions with the HBV genome are known to have varying strengths

in drïving production of their corresponding mRNAs. In order to assess a variety of cell h e s for

their abilities to generate hepatitis B Wal particles, EGFP-HBV constnicts were generated by

introducing unique restriction enzyme sites into the HBV genome. The regions chosen permitted

cloning of EGFP into the HBV genome under the control of one of the four previously dehed

HBV promoter regions. The EGFP-HBV constructs were transfected into various ceii lines to

assess the ability of the various HBV promoters to drive EGFP expression. Control constructs

were also generated to ensure that the bacterial promoters present in the ber vectors did not

drive EGFP expression. Cells transfected with the EGFP constructs were analyzed on a

fluorescent inverted microscope.

Figure 3.1 - Expression of EGFP by endogenous hepatitis B viral promoters in various cell lines

Cells were transfected with a baculoviral construct using ~ u ~ e r ~ e c t ' " containing the EGFP gene cloned under control of one of the hepatitis B viral promoters. Cells were examined and photographed 3 days post-transfection. Ce11 types are indicated to the left of each row. The promoter driving GFP expression is indicated above each colurnn.

Ceils h e s that were examined included Chang Liver, Chinese Hamster Ovary (CHO),

HeLa, Hep G2, HuH-7,Ost-7, and SB ce&. (See Fig. 3.1 .) EGFP expression was not observed

in either control plasrnid constmct in any of the cell Lines used. EGFP production was observed

f?om the transfection of the construct with EGFP under control of the hepatitis B core promoter

@C) in all the ceU lines with the exception of HeLa and Sf9 ceus. EGFP production was

observed fiom the transfection of the constnict with EGFP under control of the s m d hepatitis B

surface antigen promoter @S) in aU the cell h e s except SB. EGFP production under control of

the large hepatitis B surface antigen promoter @L) was only observed in Hep G2 and HuH-7

ceils. Faht EGFP production &orn the polymerase region was observed in Hep G2, HuH-7, and

Ost-7 cells, but not in other cell lines used. Surprisingly, EGFP production fiom the transfection

of the constnict with EGFP under control of the hepatitis B X promoter regioa @X) was quite

strong across ai l cell h e s used with the exception of SB ceils. Interestingly, none of the

endogenous hepatitis B promoters appeared to fimction in S B cells, suggesting that HE3V

promoter activity rnay be restricted to rnammalian ceLl lines.

3.3. Generation of hepatitis B virai proteins using the baculovims expression system

A baculovirus expression vector containing the hepatitis B srnaii surface antigen was

generated by inserting SHBs cDNA into the Mie 1 site of the pETL baculovinis transfer plasmid.

This vector contains the baculovirus polyhedron promoter used for directhg expression of the

cloned insert, a P-galactosidase gene under control of the baculovirus Early promoter, and

regions homologous to parts of the bacdovirus genome to aiiow for linear recombination during

CO-transfection with baculovims. Baculovirus vectors which contain the hepatitis B large s d a c e

Figure 3.2 - SB-HBV protein expression

A. Blot was probed with anti-SHBs (polyclonal) antibodies. Lane 1 : ce11 lysate fiom Sf9 ceils Uifected with wild-type baculovinis. Lane 2: cell lysate from S B cells infected with recombinant baculovinis expressing EGFP. Lane 3: ceil lysate fiom S B cells infected with recombinant baculovinis expressing HBc. Lane 4: ce11 lysate fiom S B cells infected with recombinant baculovinis expressing LHBs. Laue 5: ce11 lysate fiom S B cells infected with recombinant baculovinis expressing SHBs. Lane 6: cell lysate fiom S B cells infected with recombinant baculovinis expressing both SHBs and LHBs. B. An identically loaded blot as in A was probed with anti-HBc (polyclonal) antibody.

63

antigen and hepatitis B core protein were generated in an analogous mariner.

Completed constmcts were transfected into SB insect cells together with a linearized

bacdovirus genome using PharMuigen's BaculoGold tranfdon module. Three days post-

transfection, media fiom the cells were harvested and screened by plaque assay to look for

recombinant baculovims. Recombinant baculovinis plaques would turn blue under the plaque

assay conditions since the recombinant vims would contain the P-galactosidase gene whereas the

wild-type baculovims would not. Blue plaques were picked and amplified. Western immunoblot

anaiysis was used to CO& the ability of the recombinant bacdovinises to express the genes of

interest in infecteci SB cells.

The SHBs and LHBs proteins were also cloned into a dual-baculovirus expression vector

known as p2Bac. The SHBs protein was cloned under control of the baculovims polyhedron

promoter whereas the LHBs protein was cloned downstream of the bacdovirus p 10 promoter.

The completed p2Bac construct was transfected into SB cells along with a linearized baculovinis

genome using Invitrogen's Bac-N-Blue trançfection kit. Three days post-transfectioq media was

harvested and plaque assays were performed. Seven days later, plaques were picked and

amplifieci. Recombinant viruses were then tested by Western immunoblot for their ability to

express both SHBs and LHBs in Sf9 ceils.

Results demonstrated that the hepatitis B viral proteins SHBs, LHBs and HBc could be

expressed by baculovims when expression was driven by baculoWal promoters. (See Fig. 3 -2.)

3.4. Generation of CMV-promoter driven hepatitis B genomic transcript constructs in

bacuIovirus expression vectors and creation of recombinant baculovimses

To generate greater-than-one hepatitis B genome length containhg vectors, PCR was

used to ampl@ regions of the Hi3V genome starting at either the HBc protein start codon or the

HBe siart codon and terminating at the unique HBV Eco R I restriction enzyme site. These DNA

fkagments were cloned into pcDNA3.1 under conîrol of the cytomegalovirus promoter ( C m .

PCR was used to generate DNA fiagments containing the CMV promoter upstrearn of the two

similar-length regions of the HBV genome. niese CMV containïng fiagments were subsequently

cloned into the pMelbacA baculovinis transfer vectors and verified by DNA sequence analysis.

Constructs were linearized ushg the Eco RI restriction site and a hear full-length wild-type or

enhanceci green fluorescent protein (EGFP) containing HBV genome was cloned to generate the

geater-than-fidl length genome constnicts. (The packaging line, pMelbacA-CMV:c-wtHBV,

contains HBV nucleotides 1901 to 321 1 to 3212/1 to 321 1, numbering f?om the first T in the

EcoR1 restriction site. The wildtype constnict, pMelbacA-CMV:e-wtHBV, contaios HBV

nucleotides 18 14 to 321 1 to 321 2/1 to 32 1 1. The reporter construct,

pMelbacA-CMV:e-HBV(S:G), contains HBV nucleotides 18 14 to 32 1 1 to 3212/1 to 3 2 1 1, but

has EGFP cloned at nucleotide 175 and has the region spanning nucleotides 278 to 962 rernoved

fiom the wildtype sequence.)

A EGFP-expression control construct was generated by cloning the EGFP protein into

pcDNA3.1 under control of the CMV promoter. The CMV-EGFP region was then ampued by

PCR and cloned into pMelbac A bacdovirus vector.

Consîructs were transfected into Hep G2 cells and HuH-7 cells. HBV protein expression

in ceUs was confimed using Western irnmtinoblot analysis.

Upon venfication, the completed constmcts were used to generate recombinant

bacdoviruses by transfecting the construct DNA dong with a I i n e e d form of the baculovirus

genome using the Invitrogen Bac-N-Blue Transfection systea Media fiom transfected cells were

harvested three days post transfection and plaque assays were performed. Blue plaques were

picked, amplifie& and screened for their ability to generate hepatitis B Wal proteins andlor EGFP

when pseudo-infectkg Hep G2 cells. Successful recombinants weire amplified and viral stocks

were made by concentrathg the baculovirus through a sucrose cushioa The resulting stock

baculovirus titres were detemiuied by plaque assay. Typical titres ranged nom 1 x 109 to 1 x 10''

plaque forming units per milliliter.

3.5. Hepatitis B protein expression in Hep 6 2 and H u s 7 cek

Hep G2 and HuH-7 cells were tested for their ability to gemerate hepatitis B proteins when

protein expression was driven by endogenous hepatitis B promoters. Since expression f?om

endogenous promoters would be crucial for the generation of a hepatitis B viral vector system,

ceU Lines were transfected with the hepatitis B packaging vector co-nstnict and expression was

ve&ed by Westem immunoblot. (See Figs. 3 -3 and 3 -4.)

The results showed that hepatitis B surface proteins could be generated by transfection of

HuH-7 cells or pseudo-infection of Hep G2 cells using the recombhant baculovinis carrying the

hepatitis B packaging vector. These results suggest that endogenorus hepatitis B promoters are

functional in both celis lines and viral proteins of the correct molecdar weight can be generated.

However, these results alone do not c0nfk-m the fùnctionality, folding, or correct cellular

116.3 - 97.4 - 66.3 - 55.4 - = LHBs

t

36.5 - + MHBs 31.0 - - - SHBS 21.5 -

Probed with a-SHBs

LHBs DMHBS

Probed with a-PreS2

Figure 3.3 - Hep G2 - HBV protein expression

A. Biot was probed with anti-SHBs (polyclonal) antibodies. Lane 1: ce11 lysate fiom S B cells infected with recombinant baculovirus expressing HBs. Lane 2: ce11 lysate Hep G2 cells infected with recombinant baculovinis expressing HBs. Lane 3: concentrated media fiom Hep G2 cells 7 days post-infected with recombinant baculovinis expressing KBs. Lane 4: concentrated media from Hep G2 cells 14 days post-infected with recombinant baculovinis expressing HBs. B. An identically Ioaded blot as in A was probed with anti-pre-S 1 (polyclonal) antibody. Control lanes loaded with Hep G2 cells alone and Hep G2 ceils trmsfected with empty vector tested negative when probed with either antibody (Data not shown).

67

LHBs MHBs

SHBs

Probed with a-SHBs

55*4- I) - L +-HBc (dirners) 36.5 -

- HBc (monomers)

- Probed with a-HBc

Figure 3.4 - HuH-7 - HBV protein expression

A. Blot was probed with anti-SHBs (polyclonal) antibodies. Lane 1 : ce11 lysate fiom S B ceUs infected with recombinant baculovirus expressing HBs. Lanes 2 and 3: cell lysates fiom HuH-7 cells transfected with pMelbac-CMVC-wtHBV constnict expressing al1 HBV packaging proteins. B. Blot was probed with anti-HBc (polyclonal) antibodies. Lane 1 : cell lysate f?om S B cells infected with recombinant baculovirus expressing HBc. Lanes 2 and 3: ceIl lysates fÎom HuH-7 cells transfected with pMelbac-CMV.C-wtHE3V constnict expressing all HBV packaging proteins. Control lanes loaded with HuH-7 cells alone and HuH-7 cells transfected with empty vector tested negative when probed with either antibody (Data not shown).

68

localization of the generated viral proteins.

3.6. Cornparison between SuperfectTM trandections and recombinant baculovirus infections

in CHO, Chang Liver, and Hep 6 2 ceUs

Other groups have suggested that high titres of baculovirus are able to deliver DNA into a

wide variety of cell h e s (143). In order to determine generai DNA delivery efficiencies, the

vectors pMeIbacA-CMV-EGFP and pMelbacA-CMV:e-HBVf S :G) and the recombinant

baculovinises generated fiom the plasmids were compared in their ability to yield EGFP in CHO,

Chang Liver, and Hep G2 cells. (See Fig. 3 -5 .)

For CHO cells, SuperFectTM transfection appeared more efficient at delivering DNA than

hi&-titre bacdovirus infection, suggesting that baculovirus does not enter CHO cells efficiently.

In Chang Liver cells, more green fluorescent protein was observed fkom the baculovirus infections

when compared to the levels seen in the CHO c e k However, there did not appear tu be an

advantage in ushg recombinant baculovinis as compared to SuperFectTM DNA transfection.

However, in Hep G2 celIs, very Litde EGFP was observed fiom the S u p e r ~ e c t ~ ~ transfections.

On the other hand, large quantities of EGFP were observed from the pMelbacA-CMV-EGFP

recombinant bacdovirus infections. EGFP was also readiiy observed f?om the

pMelbacA-CMV:e-HBV(S:G) recombinant baculovinis infections. These results indicate that

efficiency of recombinant bacuiovirus as a vector for DNA transfection is dependent on cell type.

However, efficiency of DNA delivery by baculovinis infection could also be affecteci by viral

titres, duration of infection, and nature of inserted DNA.

Figure 3.5 -Cornparison behveen SuperPectTnl transfection & recombinant baculovirus infection

Cells were either transfected with a baculoviral construct using s u p e r ~ e c t ~ ' or infected using a recombinant baculovinis derived fiom the same construct. Cells were examined and photographed 3 days post-infection or transfection. Ce11 types are indicated to the left of each row. The promoter driving GFP expression is indicated above each column.

3.7. Effects of varying the multiplicity of infection of recombinant baculovirus on EGFT

expression

Other groups have suggested that using dif£ierent titres of recombinant baculovinis will

result in varying eEciencies of c d transfection(l44). To detemine the bea multiplicity of

Uifection (MOI) to use for Hep G2 ceus, cells were treated with varying MOIs of recombinant

bacdovirus containing the CMV-EGFP construct, MOIs of 10, 100,500 and 1000 were used.

Hep G2 ceils were passaged the day before infection. MOIs were calculated by performing

plaque assays with recombinant baculovinises on Sf9 ceUs and counting the Hep G2 cells on the

day on infection. V i s was ailowed to bind for 5 hours after which it was removed. Ceus were

incubated for 3 days while EGFP was synthesized. Fiow cytometry was performed to determine

EGFP expression levels fiom mock-uifected and EGFP-baculovinis infecteci Hep G2 d s . (See

Fig. 3 -6k)

As expected, increasing levels of recombinant baculovirus MOI on the Hep G2 ceiis

produced greater numbers of ceUs that contained the EGFP gene. However, there was a dramatic

improvement in efficiency of EGFP expression as MOIS were raised f?om 100 to 500, as increase

in EGFP fluoresence did not occur between 500 to 1000 MOI. Whether this is an indication of

cell-receptor saturation or due to some cytotoxic effect from hi& levels ofbaculovinis has not

been investigated.

3.8. Effects of varying inoculation times of recombinant baculov i~s on EGFP expression

m e r groups have found that difEerent inoculation times with viral recombinant

baculovimses af5ected the efficiency ofgene transfection into the ceil. To deterrnine the best

-ve 1 5 24 48 72 Inoculation Time

Figure 3.6 - MOI and inoculation time variation

A. Varying multiplicities of infection (MOI) of recombinant bacdovirus carrying the CMV- EGFP construct were used to infect Hep G2 celis. MOIS of 10, 100,500, and 1000 were used. Fluorescent activity was measured using flow cytometry. Sarnples were done in triplicate and standard deviation is indicated for each MOI measured. B. Hep G2 cells were exposed for varying lengths of time to recombinant baculovinis carrying the CMV-EGFP construct at an MOI of 500. After exposure, unbound virus was washed off. Mean fluorescence was determined 3 day post-viral application. T i e points were performed in triplicate. Standard deviation is indicated over eacb time point, 73

inoculation time to use for Hep G2 cells, cells were treated with 500 MOIS of recombinant

baculovims containhg the CMV-EGFP construct for different durations of time. Hep G2 ceUs

were passaged the day before infection. Recombinant virus was applied and unbound virus was

washed fiom cells at 1 hour, 5 hours, 24 hours, 48 hours, and 72 hours post-infection. Cells were

incubated for 3 days over which EGFP was synthesized and flow cytometry was performed to

determine EGFP-expression levels eom mock-infected and EGFP-bacdovirus infecteci Hep G2

ceus-

Increasing the inoculation time of recombinant baculovirus with Hep G2 cells resulted in

greater numbers of cells expressing the EGFP gene . (See Fig. 3.6B.) However, this effect is only

seen between the 1 hou and 5 hours time points. Prolonged exposure to recombinant virus did

not signiscantly improve the amount of green fluorescence observed. It should be noted that cells

which were incubated with baculovinis for 48 hours and 72 hours did not appear as healthy as

those exposed for shorter periods of the. Whether this is due to an unknown cytotoxic effect

caused by prolonged exposure to bacdovirus has not been investigated m e r -

3.9. Secretion of hepatitis B surface proteins foilowing incubation with recombinant

baculovinis in Hep G2 cells

In vivo HBV Sections result in the secretion of 22 MI subviral particles into the senun of

infected patients. Since infection of Hep G2 with recombinant baculovinis was performed to

mirnic natural HBV DNA delivery into hepatocytes, secretion of viral and sub-viral particles

needed to be verified. Media fiom Hep G2 cells treated with the HBV-baculoWus was harvested

7 days and 14 days post-infection, concentrated, and analyzed by density gradient centrifugation

7 days post-infection Probed with aSHBs

SHBs

- 8 1- LHBs

0 M t SHBs

14 days post-infection Probed with aSHBs

Figure 3.7 - Secreted samples from BacHBV infected HepG2 cells

media fiom recombinant baculovinis Wected Hep G2 was harvested 7 and 14 days post- infection, concentrated, then separated on a sucrose gradient Western blots were done on hctions collected fkom the gradient and probed with anti-HBs antibody (polyclonai). Molecular weight standards are indicated and key bands corresponding to hepatitis B viral proteins are noted. Lane 1 : ceIl lysate fiom S B cells expressing SHBs through recombinant baculovirus expression. Lanes 2 to 10: Decreasing density sucrose gradient fi-action samples. Lane 11 : Debris pellet at the base of the sucrose gradient. 75

using a 20% to 60% sucrose gradient. Results show that hepatitis B surface antigen could be

readily purified using the sucrose gradient, susgesting that the antigens had adopted a sub-viral

particle fom. (See Fig. 3-7J It is also apparent that expression and secretion of hepatitis B

suface antigen continues beyond two weeks post-infection whth baculovirus.

3.10. Secretion of hepatitis B surface proteins after transfection of HBV-baculoviral vectors

in HUE-7 ceUs

Media from HuH-7 cells was concentrated 7 days po~st-transfection with recombinant

baculovirus vectors carrying the wild-type, packaging and reporter HBV genome constructs.

Results show that hepatitis B viral surface antigen could be detected in the media, suggesbng the

fiinctionality of the constructs used- (See Fig. 3 -8.)

3 4 5 6 7

4rY rc - 4--- LHBs

mm- a b - .

-- - SHBs

Probed with a-SHBs

Figure 3.8 - Secreted samples from BacHBV vector transfected HuH-7 cells

Media from recombinant bacdovirus infected HuH-7 was harvested 7 days post-transfection, concentrated, and samples were loaded ont0 SDS-PAGE gels. Western blots were done on media samples and probed with anti-HBs antibody (polyclonal). Molecular weight standards are indicated and key bands corresponding to hepatitis B viral proteins are noted. Lane 1 : cell lysate fkom S B cells expressing SHBs through recombinant baculovinis expression; Lanes 2 through 7 are ce11 lysates from HuH-7 cells transfected with dBerent constructs: Lane 2: pMelbacA- CMV-EGFP construct; Lane 3: pMelbacA-CMVe-wtHBV clone I constnict; Lane 4: pMelbacA-CMVe-wtHBV clone 2 constnict; Lane 5: pMelbacA-CMVc-wtHBV packaging construct; Lane 6: pMelbacA-CMVe-HBV(S:G) reporter construct; Lane 7: CO-transfected pMelbacA-CMVc-wtHBV packaging and pMelbacA-CWe-HBV(S:G) reporter constructs.

3.11. Southem blot analysis of lysate from cells tranfected with hepatitis B viral constructs

To confirm the ability of wildtype, packaging and defective genome constructs to generate

Hi3V cccDNA, cell lysate Eom transfected HuH-7 cells was separated on a 1% agarose gel,

trmferred to Hybond-N positively charged nylon membrane and probed using radiolabeled

polynucleotides complementary to either EGFP or SHBs sequences.

Fig. 3.9A shows that DNA harvested &om the control transfection of pMelbacA-CMV-

EGFP into H a - 7 cells contains some of the original transfected plasrnid which is labeiled by the

32P-iabelled EGFP probe. Upon digesting the DNA sample with Nco 1, the plasmid was linearized

and ran at its correct size of 6.0 kilobases, The Nco 1 restriction endonudease was chosen since it

cuts all the transfected constnicts only once to linearize them. This enzyme would also cut any

cccDNA generated £tom HBV-gemme containing sarnples only once such that vector signal

could be distinguished fkom replicated HBV DNA signal. Lanes Ioaded with DNA fkom the wild

type and HBV-packaging constnict transfections show no Iabelling since these constructs to not

contain the EGFP sequence- The lanes loaded with DNA £kom the HBV-EGFP-reporter

construct transfection show Iabelling. Digestion of this DNA sample with hko 1 yielded a sinde

specific band at approxknately 3.2 kilobases in size, suggesîing that the defective genome was

being converted into cccDNA by the host cell and replicated. The loss of the Larger-ninning

bands in the undigested sample suggest that these bands represent the relaxed circular f o m of

HBV cccDNA which would migrate slower through agarose. Identical banding patterns are also

seen in the lanes ioaded with DNA from the CO-transfection of the HBV-packaging and

HBV-EGFP-reporter constnicts, showing that CO-transfection does not appear to inhibit

generation of the defective genome cccDNA.

In Fig. 3 .9B, DNA harvested îrom the control transfection of pMelbacA-CMV-EGFP into

K a - 7 cells is not labelled by the 3*-labelled SHBs probe, confirming that non-specinc labelling

is not present. Lanes loaded with DNA fiom the wiid type and HBV-packaging construct

transfections show labelling. Nco 1 digest of these DNA samples yields a single specifdly

labelled band &g at 3 -2 kilobases. This corresponds with the correct size of HBV cccDNA

which is expected to be generated ftom the wildtype transfection. The presence of the 3.2

Hobase band in the HBV-packaging transfection suggests that the E-stem bop is not required for

H3V cccDNA generation. The lanes loaded with DNA fiom the HBV-EGF'P-reporter construct

transfection are not labeiled since SHBs wzis removed fiom the onginal genome. The HBV

cccDNA and hear DNA banding patterns reappear in the lanes loaded with DNA f?om the co-

transfection of the HE3V-packaging and HBV-EGW-reporter constructs, showing that co-

transfection does not appear to inhibit generation of the packaging genome cccDNA

-2

& DNA length (kb)

4--- rc

5.0 - 4.0 - 3.0 lin.

2.0 - Figure 3.9 - Southero blot analysis of DNA samples harvested from BacEBV vector transfected HUE-7 cells

Lysate from vector transfected HuH-7 was harvested 3 days post-transfection and DNA was harvested through a crude Hirt extraction. Part of the collected DNA samples were subject to overnight Nco 1 restriction endonuclease digest. DNA samples were separated on a 1% agarose gel, then transferred onto Hybond nylon membrane using Southern blot transfer. The membranes were then probed with radioactively labelled probes complementary to either EGFP or SHBs gene sequences. Blot A was probed with "P-labelled EGFP DNA while blot B was probed with 32~-1abelled SHBs DNA. Molecular weight standards are indicated and key bands corresponding to dBerent forms of hepatitis B Wal DNA are noted: (rc) relaxed circle, (lin.) linear. Sample 1 : DNA fiom cells transfected with pMelbacA-CMV-EGFP constnict; Sample 2: DNA from cells transfected with pMelbacA-CMVe-wtHBV clone 2 constnict; Sample 3: DNA fiom cells transfected with pMelbacA-CMVc-wtHBV packaging consîruct; Sample 4:DNA fiom cells ûansfected with pMelbacA-CMVe-HBV(S:G) reporter constnict; Sample 5: DNA from cells CO-transfected pMelbacA-CMVc-wtHBV packaging and pMelbacA-CMVe- HJ3V(S:G) reporter constructs.

3.12. Poiymerase chain reaction analysis of media from ceils infected with hepatitis B viral

genome carrying recombinant bacuiovirus

Though hepatitis B protein expression could be venfied by Western immunoblot, we

wished to generate defective viral particles, not simply sub-viral particles. In order to test for the

presence of Wal particles, concentrated media fiom H a - 7 celis îxansfected with various

constructs canying either wild-type or mutagenized hepatitis B viral genomes were harvested 7

days post transfection and subjected to PCR to test for the presence of SHBs and EGFP DNA

after being treated with either proteinase K, DNAse I, or DNAse I, foilowed by proteinase K

digest.

As shown in Fig. 3.104 SHBs DNA was readiiy detected in all samples kom HuH-7 cells

transfected with DNA constructs containhg the SHBs gene when treated with only protebase K.

Treatment of samples with DNAse 1 alone reduces the SHBs banding pattern. Pre-treatment of

samples with DNAse 1 foIlowed by proteinase K digest also yields a reduced SHBs banding

pattern. Though the SHBs band present for the wild-type HBV construct transfections was

expected to be seen, it was surprising that the SHBs band was also present when the HBV-

packaging construct was transfected alone into HuH-7 cells. This suggests that despite the lack

of a 5' epsilon stem-loop, DNA fkom the HBV-packaging constnict may stiU be packaged.

However, a SHBs signal was not obsenred fkom the cotransfection of the HBV-packaging

construct and HEW-EGFP-reporter constmct after treatment with DNAse 1 or pretreatment with

DNAse 1 followed by proteinase K digest.

As seen in Fig. 3.10B, EGFP DNA was also readily detected in all samples fkom HuH-7

ceils transfected with constmcts carrying EGF'P DNA Treatment of samples with DNAse 1 only

proteinase K treated SHBs

DNAse I treated SHBs

proteinase K treated

DNAse i treated

EGFP

EGFP

EGFP

Figure 3.10 - Detection of DNA using PCR in concentrated media from HUE-7 transfected with various HBV constructs.

HuH-7 cells were transfected with different baculoWal vector constnicts expressing EGFP and HBV proteins. Seven days post-transfection, media was cleared of ce11 debris and remaining particles were concentrated 30-fold by ultracentrihgation. Aliquots fiom each sample were subjected to either proteinase K treatment, DNAse I treatment, or DNAse 1 treatment foliowed by proteinase K treatment. A. Treated samples were phenol-chloroforrn extracted and any remaining DNA in the aqueous phase was ethanol precipitated. DNA present was ampliiied using specific primers for SHBs. Lane 1 : pMelbacA-CMV-EGFP: lanes 2 and 3 : pMelbacA-CMVe-wtHBV clones 1 and 2; lane 4: pMelbacA-CMVc-wtHBV, lane 5: pMelbacA-CMVe-S:G(-800); lane 6: pMelbacA-CMVc- wtHBV and pMelbacA-CMVe-S:G(-800) B. Treated samples were phenol-chloroform extracted and any remaining DNA in the aqueous phase was ethanol precipitated. DNA present was arnplified using specific primers for EGFP. Laue 1 : pMelbacA-CM'-EGFP; lane 2: pMelbacA-CMVc-wtHBV, lane 3 : pMelbacA-CMVe- S:G(-800); lane 4: pMelbacA-CMVc-wtHBV and pMelbacA-CMVe-S:G(-800)

82

removed ail EGFP signal, suggesting that the EGFP signal seen in the proteinase K treated

samples were due prirnarily to unprotected DNA carried dong throughout the DNA preparation.

However, pre-treatment of samples with DNAse 1 followed by proteinase K treatment yielded a

fairy strong EGFP band only when the HBV-packaging constmct was CO-transfected with the

HBV-EGFP-reporter construct, Bands in the control Iane and the HBV-EGFP-reporter constnict

lane were reduced to nearly zero- This suggests that EGFP-containing DNA fiom the

cotransfection was being protected fiom the initial DNAse 1 treatment, but was subsequently

released after proteinase K treatment. This offers some evidence that the reporter genome was

being packaged ody in the presence of the packaging construct.

3.13. Electron microscopie analysis of hepatitis B sub-viral particles found in thin sections

of recombinant baculovirus infsted cells

Viral particle formation of hepatitis B sub-viral particles in insect ceus has been previously

reported (139). Though we have established that hepatitis B Wal proteins could be expressed by

our recombinant bacdovirus promoters, functionality of the proteins expressed needed to be

verined. As such, SB cells infected with recombinant baculoWuses expressing either EGFP,

HBs, or HBc proteins were k e d and embedded in LR White resin three days post-infection.

Embedded celis were then thin-sectioned on a microtome and subjected to post-fixation

irnmunogold labelling using either SHBs or HBc polyclonal antibodies and 12 nm colloidal gold

secondary antibody. Labelled sections were counter-stained using uranyl acetate and lead citrate

and visualized on a Hitachi transmission electron microscope. Results can be seen in Fig. 3.11.

Cells infected with the CMV-EGFP bacdovirus recombinant showed very little

bar = 250nm

Figure 3.11 - Electron microscope analysis of S B cells infected with recombinant baculovirus

SB celis were infected with recombinant baculovirus expressing either GFP, KBs or HBc proteins. Cells were then fixed and embedded in LR White 3 days post-infection, then immunolabelled using gold-conjugated antibodies. A. Control GFP-baculovirus infected Sf9 ceus probed with anti-HBc (polyclonal) antibodies. B. Control GFP-baculovints uifected Sf9 cells probed with anti-SHBs (polyclonal) antibodies. C. HBc-bacdovirus Uifected S B cells probed with anti-KBc (polyclonal) antibodies. D. HBs-baculovims infected S B cells pro bed with anti-HBs (polyclonal) antibodies.

nonspecinc gold-labelling. Forming 42 nm diameter baculovinises cm be readily visualized in the

micrographs shown. Sf9 ceus infectai with bacdovirus expressing HBc protein shows the

presence of 24 nm particles in the nucleus of the infected cells which could be labellecl using the

anti-HBc polyclonal antibody. These particles are believed to be empq nucleocapsid sheUs

composed solely of HBc proteins. Sf9 ceus uifected with baculovinis expressing SHBs protein

show the presence of 22 nm particles and much less baculovirus formation- These 22 nm particles

were not easily labelled with go14 perhaps due to the fixation procedure. However, these 22 nm

particles are considered to be formed prïmarily of SHBs protein due to their abundance in infected

cells which corresponds to the intense SHBs signal seen in cell iysate. f See Fig. 3 -2.)

3.14. Electron microscope analysis of hepatitis B sub-viral particles found in the media of

recombinant bacuIovirus infected celis

Other groups have shown that expression of SWBs and CO-expression of SHBs and LHBs

can yield hepatitis B sub-viral particle secretion into the media of infected insect cells through

recombinant bacdovirus infection f 239). To verify the fùnctionality of generated EBs proteins,

concentrated media £?om Sf9 cells infecteci with recombinant baculovims was loaded onto

charged nickel-fomvar grids. Some grids were simply conter-stained usuig uranyl acetate and

lead citrate. Other grids were nibjected to immunogold labelling using anti-SHBs @olyclonal)

primary antibody and anti-pre-S 1 (polyclonal) primary antibody and 12 nm colloidal gold

secondq antibody pnor to counter-staining-

Electron microscopy showed that recombinant HBs spheres and Haments which were

similar in size and morphology to particles found in infected patients' sera were found in the

Figure 3.12 - EIectron microscope analysis o f particies derived from SB cells infected with recombinant baculovirus

Media £?om S B cells infected with recombinant baculovirus was harvested 3 days post-infection. Media was concentrated by ultracentrifugation and loaded ont0 charged carbon-formvar coated 200 mesh grids. ûrids were immunogold Iabelled using anti-SHBs (polyclonal) or anti-pre-S 1 (polyclonal) as primary antibody. A. Negatively stained grids loaded with media fiom GFP- baculovinis infected Sf9 cells. B. Anti-SHBs (polyclonal) antibody labelled grids loaded with media fiom GFP-baculovinis infected SB cells, then gold labelled. C. Anti-pre-S I (polyclonal) antibody labelled grids loaded with media fiom GFP-baculovirus infected Sf9 cells, then gold- labelled. D through H were loaded with media fiom HBs-expressing recombinant baculovirus. D. negative staining showhg 22 nm particles. E. 22 nm particles labelled with anti-SHBs (polyclonal) anfibody, then gold-labelled. F. loaded media was probed with anti-pre-S 1 (polyclonal) anfibody, then gold-labelled. G. negative staining showing filamentous particles. H. 22 nm filaments labelled with anti-SHBs (polyclonal) antibody, then gold-labelled. 86

media of recombinant baculovinis-idected SB cells. The approximate diameter of both filament

and sphere sub-viral particles was 22 nm . (See Fig. 3-12.)

3.15. Electron microscope anaiysis of hepatitis B sub-viral particles found in the media of

recombinant baculoviral-vector transfected HuH-7 ceus

M e r groups have reported their ability to generate recombina. hepatitis B Wal particles

using recombinant baculovinis in Hep G2 cells (144). However, that particular system generated

dd-type particles using a single recombinant bacdovirus carrying a 1 . 3 ~ HBV genome length of

HBV DNA In Our system, two bacu1oWal plasmids were used: one supplied the packaguig

proteins and the other one carried EGFP in place of the SHBs gene. Though EGFP DNA had

been detected in the media of HuH-7 cells transfected with both constmcts (See Fig. 3.10B), it

was uncertain whether or not this signal was a result of actual viral particle formation. Thus,

media fiom a CMV-EGFP control plamiid, a 1 . 5 ~ wtHBV DNA plasmid, and the cotransfected

packaghg and reporter plasrnid transfected cells were harvested 7 days post-transfdon. M e r

concentrathg through a 20% sucrose cushion, the pellets were resuspended in a low-salt b s e r

and applied onto a charged carbon-formvar nickel grid. Grids were immuno-labelled using anti-

SHBs (polyclonal) primary antibody and 12 nm colloidd gold secondary antibociy, followed by

counter-stahing using uranyl acetate and lead citrate.

Media fkom ceils transfected with the control CMV-EGF'P construct showed no s i p s of

labelled virai particles or non-specsc gold labelling. (See Fig. 3.13 .) Media ftom ceils transfected

with the wild-type construct appeared to contain 22 nm subviral particles as well as 42 nm

particles deemed to be complete virions. Both particles could be labelled with gold. Media fkom

G bar = 125nm

Figure 3.13 - Electron microscope analysis of cancen trated media from HuH-7 cells transfected with recombinant baculovirus vectars

HuH-7 cells were transfected with plasmids containing the CMV-EGFP, CMV-wtHBV, packaging HBV and reporter EGFP-HBV constnrcts. Media was harvested 7 days post- transfected, concentrated, and loaded onto carbon fonnvar grids. Grids were probed with anti- SHBs (polyclonal) antibodies and gold-Iabeled. A and B. CMV-wtHBV media with 22 nm and 42 nm goId-labeled particles; C. Packaging construct media with 22 nm gold-Iabeled particle; D. Reporter construct media with stray gold particles. E and F. Packaging and reporter co- transfected media with 22 nm and 42 nm gold-labeled particles; G. CMV-EGFP control media with stray gold particles.

cells CO-trdected with the packaging and reporter constnicts also showed the presence of

22 nm sub-virai particles as weH as 42 nm particles which were both labelled with gold- This

suggests that recombinant HBV viral formation was o c c h g in ceils CO-transfected with the

packaging and reporter plasmids. However, fùnctionality of these recombinant particles has yet to

be veiifïed.

4. D~scussro~

Hepatitis B promoter strengths and hc t ion in various ce11 b e s have been described in

previous studies. In particular, the pregenomic core promoter has been shown previously to be

- strongly liver-specZc (2 1, 145-1 56)- However, the X promoter has often been wnsidered weak

when used to promote luciferase activity (157). It is also known that an appropriate bdance of

HBV surface proteins is required for proper HBV morphogenesis (73). Overexpression of the

large hepatitis B surface protein c m result in retention of hepatitis B vinons within the ce11 (66,

1 05, 158- 160). The Herent strength of surface promoters has been examined (1 6 1). One study

had examùied the strength of hepatitis B promoters in a few immortalized ceil h e s (162),

concludïng that core promoter activity is greater than X promoter activity which is greater than S

promoter activity which is greater than pre SI promoter advity.

Our study of hepatitis B promoter fiuiction was performed in order to detennine which of

the available cells lines would be best suited for recombinant hepatitis B virus generation. Our

study expanded on cell lines tested, looking at hepatitis B promoter fùnction in Chang Liver,

Chinese Hamster Ovary (CHO), HeLa, Hep G2, HuH-7,Ost-7, and Sf9 ceils. From our resdts, it

appears that the X promoter is the strongest of the hepatitis B Wal promoters, driving EGFP

expression in ail marnmalian cells used. Only SB hsect celis did not show any fluorescent activity

after being transfected with the PX-EGFP constmct. The core promoter and SHBs promoter

both appeared to fùnction well in the mammalian cells. However, it is interesting to note that no

EGFP was observed fiom the pC-EGFP construct transfected into HeLa ceus. Only Hep G2 and

HuH-7 cells showed EGFP fluorescence when EGFP was placed under control of each of the

hepatitis B viral promoters. SB cells did not show any fluorescent activity, implying that hepatitis

B promoters may be mammalian cell-spec5c. Function of human hepatitis B promoters in mouse

Ost-7 and hamster CHO cells may offer some clue as to how related hepatitis B vintses may have

evolved in other non-primate species. It should be noted that flow-cytometry was not used due to -

low transfection efficiencies and autofluorescence fomd in the cell lines used, W e the

photographs of the cell lines used are meant to represent the average fluorescence of EGFP-

expressing ceils seen, the actual relative strength of the different hepatitis B promoters cannot be

quanfied based on the data collected. However, it can be concluded that lack of visualized

EGFP corresponds to very low or nonexistent fknctïonality of a particdar hepatitis B promoter w

region in that partidar ceil line.

Our results agree with the current use of Hep G2 and HuH-7 cells for expression of

hepatitis B proteins and generation of virions after HE3V cccDNA transfection (135, 14 1, 163).

For the rest of our studies of HBV, Hep G2, and HuH-7 celis were chosen as the celi Lines which

would be used for the study and generation of a hepatitis B viral vector system.

Though endogenous hepatitis B viral promoters did not fiinction in SB cells, recombinant

baculoviruses expressing core, and surface hepatitis B proteins were generated. The baculovirus

expression system has been used by other groups for studying various hepatitis B viral proteins

(1 39, 140, 164, 165). High protein yields were offered from baculoviral promoter driven

expression of hepatitis B genes. Protein samples generated were used as positive controls for

mammalian hepatitis B protein expression.

Efectron microscopie analysis ofidected SB cells showed that the overexpressed hepatitis

B proteins retained their basic functionality. SB celis expressing SHBs or SHBs and LHBs were

able to generate 22 n m diameter sub-viral nlaments and spheres (See Fig.3.12). These particles

were observed both inside infected celis as weli as in the media harvested fiom infected ceIls,

suggesting that these proteins retained their ability to bud and to be secreted. Overexpression of

HBc in Sf9 ceus resulted in the formation of intraceliular empiy nucleocapsid particles (See Fig.

3-11).

The finding that Sf9 cells were unable to support any endogenous hepatitis B promoter

firnction proved to be an asset. Overexpression of SHBs proteins in SB cells appeared to occur

at the cost of efficient baculovims replication. Electron microscopie analysis of cells infected with

recombinant baculovirus expressing SHBs showed very few weli-fomed bacdovirus particles 3

days post infection. In constrast, SE) cells infected with recombinant baculovimses expressing

either EGFP or HBc proteins clearly showed bacdovirus formation f i e r 3 days. It is possible

t h t generation of the SHBs proteins reduces baculovirus envelope protein synthesis, resulting in

lower bacdovirus titres being produced. Since baculovims was to be used as a vector for

delivering HBV DNA into cells the fact that SHBs would not be produced by endogenous HBV

promoters would mean that recombinant bacdoviral replication would be able to proceed

unimpeded by foreign protein synthesis in SB ceiis.

The primary goal of this project was to generate a recombinant hepatitis B viral particle

which &es a reporter gene. The major dficulty in studying the early steps of the hepatitis B

Mie cycle is that there is currently no c d iine available capable of supportuig viral replication.

While cell types such as Hep G2 (133, 163) and HuH-7 (141) support hepatitis B viral

morphogenesis when transfected with HBV cccDN4 these cell types are not easily transfected

and viral particle yields tend to be quite low. Some groups have attempted to generate either

wiid-type and recombinant hepaîitis B vims fiom cell lines. Small segments of foreign DNA have

been inserîed into virions using recombinant HBV DNA and HuH-7 ceils (14 1, 166). Howeever,

in one study, only 63 base pairs were inserted and the rest of the viral genome was left intact,

le-g the recombinant virus generated still M y fùnctional. There are some cell h e s such as

Hep G2 2-2-15 (163) and Hep G2-4A5 (167) which contain integrated HBV genornes and secrete

Wal particles at low levels. More recentfy, recombinant baculoWus has been found to be capable

of delivering DNA hto mamrnalian ceils (143, 168). This led to the development of a

recombinant baculovirus which carries a 1 . 3 ~ HBV genome which could be used to pseudo-infect

and yield wtHBV particles (144). The advantage that baculovirus pseudo-infection offers over

conventional transfdon methods is its ability to deliver DNA into vimially al1 ceus when using a

high enough MOI. This is particularly important when workuig with Hep G2 ceils as this ceil line

is particulady dficult to transfect efficientfy. It was surmised that a dual-recombinant baculoWal

vector system could be generated in order to yield replication-defective hepatitis B virions. A

reporter gene wodd be inserted into the coding sequence of the pgRNA to be encapsidated. The

packaguig recombinant baculovirus would carry aI.l structural proteins for HBV, but be incapable

of generating finctional pgRNA since the 5' €-stem loop would be deleted. The defective HBV

genome construct would have its 5' €-stem loop region intact, but have a reporter gene inserted

under the smaii hepatitis B surface protein promoter, knocking out expression of ail hepatitis B

surface proteins as well as the hepatitis B polyrnerase Grom that constnict. Pseudo-infection of

either HBV DNA-carrying recombinant bacdovirus would not yield any DNA-containing viral

particles. However, CO-pseudo-Section wodd lead to the production of a DNA-kntaining

particle, but the packaged viral genome would carry the reporter gene instead of hctional

surfàce and polymerase protein coding genes. A paper reieased in 1999 supports the potential of

generating recombinant HBV particles. Protzer and his group were able to generate GFP-

carrying recombinant duck hepatitis @HBV) and human hepatitis Wal particles (142).

Results fiom ow initial promoter study assisted us in choosing promoters that would

function well for dnving a reporter gene in our cell h e s of interest. Longer-than-one HBV

genome carrying constmcts were designed and cloned using E-coli. The constnrcts designed were

based on constructs used by Protzer (142). The cytomegdoviral promoter was cloned upstream

of either the HBe or HBc start codon in place of the naturally found core promoter, enhancer 1,

and enhancer 2 regions. UnLike the published constructs, our constnicts were cloned into

baculovirus transfer vectors. The packaging constnict, pMelbacA-CWc-wtHBV, lacks the 5'

€-stem loop coding region. Studies have shown that the 5' €-stem loop region is required for

encapsidation of the pgRNA by HBp and HBc proteins (59-61). As the packaging construct lacks

the 5' €-stem loop region, it alone should be unable to yield bctional viral particles. However, as

the rest of the HBV genome remains intact, this packaging constmct should be capable of driving

the synthesis of all other HBV structural and non-structural proteins with the exception of m e .

Hep G2 and HuH-7 cells were either transfected with this constmct DNA or pseudo-infiied with

a recombinant baculovims, generated fiom this construct. Western immunoblot results showed

the ability of CMV and endogenous prornoter regions in HBV to drive HBV protein expression in

these ceU lines. (See Figs. 3 -3 and 3.4.) As HuH-7 cells are more readily transfectable than

Hep G2 cells, detectable amounts of core protein are more apparent.

The reporter constnict, pMe1bacA-CMV:e-HBV(S:G), was cloned to include the 5'

epsilon-stem loop region For the reporter gene, enhanced green fluorescent protein (EGFP) was

chosen. The reasons for choosing this reporter gene are threefold. Firstly, the size of the EGFP

gene is small (roughIy 800 basepairs)- As such, EGFP couid be inserted into the HBV genome in

the S-domain without the need to rernove more than the S-domain in order to leave the pgRNA

length at approximately 3 -2 kb. Secondly, the presence of fiinctiond EGFP within ceIl types can

be easily assessed without the need t a lyse celis. Transfected or infected cells stilI in culture can be

located by l o o h g for the green signai when using a fluorescent microscope. Lady, for EGFP to

be visualized by iight microscopy, the Ievel of expression must be relativefy high- Thus, enough

constnict must enter a ceU capable o f dnving EGFP under the S-promoter. As this construct

would eventuaily be used for library screening purposes, the need for a strong signal would

correlate with efficient DNA delivery- This construct was also transfected into Hep G2 and

H a - 7 cells to ver@ its ability to express EGFP. EGFP expression was relatively bright when

compared to the control CMV-EGFP transfected ceils. (See Fig. 3 S.)

A wiid-type HBV construct, pMelbacA-CMV:e-wtHBV, was generated as a control to

verif) that normal hepatitis B virions can be generated. As in the reporter constnicf the 5' E-stem

loop region was left in place. However, unlike the reporter construct, the coding regions were lefi

intact. As such, hlly fûnctional pgRWA should be generated as weli as ail other HBV transcnpts.

This construct was used to ver@ HuEI-7 cells' ability to generate hepatitis B particles.

A CMV-EGFP constmct was also generated as a control for both EGFP expression and

recombinant baculovirus infection. The resulting bacdovirus construct was used to optimize

recombinant bacdovirus pseudo-infection conditions on Hep G2 cells nich that the major* of

cells were pseudo-infected and fluorescing.(See Figs. 3 -5 and 3.6.)

As was observed, the packagimg and reporter constructs were able to generate their

respective proteins when transfected into Hep G2 and HuH-7 cells. (See Figs. 3.3 and 3.4.)

However, the advantage of using recombinant baculovirus became apparent when bacuiovinis

DNA delivery efficiency was compared to typical tran&iection ragent efficiency. (Se Fig. 3 S.)

While high MOIS of recombinant baculovinis are needed, generation of large quantities of

recombinant baculoWus is relatively simple. Also, the pseudo-infection protocol requires much

less manipulation as compared to typical transfection protowls.

Bacdovirus pseudo-infection on Hep G2 cells was optimized using the CMV-EGFP

recombinant baculovinis. Increasing the MOI applied onto Hep G2 ceils yielded a greater

percentage of fluorescent cells when observed on an inverted fluorescent microscope as well as

greater fluorescent activity when measured using flow-cytornetry (See Fig. 3 -6). Based on our

results, it was detennined that an MOI of 500 was best for pseudo-infecting Hep G2 cells. While

an MOI of 1000 did yield higher fluorescent activity, the increase was not very significant and

non-econornical in terms of the amount of viral-stock used,

Varying inoculation times were also looked at to see whether prolonged exposure to

recombinant baculovinis would lead to greater number of cells pseudo-uifected- A signîfïcant

difference was seen between Hep G2 cells exposed to the CMV-EGFP baculovirus for one and

five hours. However, inoculation tirnes greater than five hours showed no marked increase in

levels of EGFP expression nor in percentage of cells fluorescing. It should be noted that very

Iittle or no cytotoxicity was observed in ceiis treated with recombinant baculovinis for Iess than

twenty-four hours. Cells treated with baculovirus for longer periods of time did not appear as

healthy (Data not shown). One possibility is that high levels of baculovinis in culture media

results in multiple bacdovirus-fûsion events with the cell monolayer, potentially causing celis to

undergo apoptosis. However, this phenornenon has not been fùrther explored.

The packaging construct-carrying recombinant baculovirus was capable of delivering

ninctional HBV DNA into Hep G2 cells. Pseudo-infected Hep G2 celis were thus able to express

and secrete hepatitis B sub-viral particles. (See Fig. 3.7.) These secreted particles could be

punfied on sucrose gradient.

However, problems were encountered wîth one of the initial packaging construct

recombinant baculovirus clones. Though transfection of the packaging constnict DNA into

Hep G2 and HuH-7 cells showed expression of hepatitis B surface and core proteins, pseudo-

infection with the resulting recombinant baculovirus did not- This set-back meant that the dual-

recombinant baculoviral pseudo-infection attempts would have to be postponed until fùnctional

HE3V-packaging baculovims could be generated.

While HBV-packaging bacdovirus was being generated, -dies were done using HuH-7

cens which are more permissive to standard lipid-based transfection systems such as

Genepo~TER? To determine whether the generated HBV constmcts were fhctional in a non-

baculovinis setting, HuH-7 cells were traflsfected with the baculoviral vectors canying

CMV-EGFP, 1 . 4 ~ wild-type, the packaging, and the reporter HBV constnicts. The ability of

these construct to generate hepatiîis B proteins and EGFP had been previously established (See

Fig 3.4). Since the goal of this project is to generate secreted particles, media from transfected

HuH-7 celis were harvested and their content analyzed.

HuH-7 cells transfected with wild-type and packaging constructs were able to produce

and secrete hepatitis B surface antigens into the culture media (See Fig. 3 -8). However, hepatitis

B core protein was not detectable by Western blot in the media. Whether this was due to low

viral progeny being secreted or due to a defect in the packaging machinery could not be confirmed

by Western immunoblot.

A Southem blot was performed on samples fiom transfected HuK-7 c d s to determine

whether the wildtype and packaging constructs were g e n e r a ~ g HIBV cccDNA within the c e k

(See Fig. 3.9). Formation of cccDNA is necessary since it is this template which HE3V uses to

derive the various HBV RNA transcnpts including the pgRNA transcrïpt- Since DNA was

harvested f?om transfections, samples were treated to an Nco I restriction endonuclease digestion

which wouid linearize the transfected plasmids as well as any cccDNA produced. As the sire of

the transfected plasmids is much Iarger than the size of HBV cccDNA, any plasmid rescued

during the DNA harvest fiom transf'écîed celis could easiLy be distinguished 60x11 any cccDNA

Both undigested and digested DNA samples 6om transfected HuH-7 cells were separated by an

agarose gel, transferred and probed with 3%abelled EGFP or SHBs DNA

When the blots were probed with the 3?f?-labelled EGFP probe, bands could be seen in the

control pMelbacA-CMV-EGFP lanes (See Fig. 3.9A). The presence of bands in these lanes

suggests that the crude DNA extraction used on the transfected HuH-7 ceUs was being rescued.

However, the bands could not be confused with HBV bands since their sizes were different.

Neither DNA fiom transfections of the wildtype nor the HBV-packaging construct were deteded

by the 3%-labeUed EGFP probe, uidicathg that non-specific labelling was absent. A specifically

labelled band correspondhg to 3 -2 kilobases could be seen in the lanes loaded with DNA 6om the

HBV-EGFP-reporter construct transfections. This confhns that HBV cccDNA was being

properly generated fiom the HBV-EGFP-reporter construct transfections. This also confirms that

the SHE3s-coding region is not required for cccDNA synthesis as it is absent nom this constnict.

Co-transfection of the reporter constnict with the HBV-packaging construct did not appear to

inhibit cccDNA replication of the reporter genome. It is interesMg to note that the original

vector does not appear to be present due to the absence of a larger band in the Nco 1 digested

lanes. The larger bands in the undigested lanes are believed to be the r e l d circular fom of the

HBV cccDNA since this form is retarded during its migration through agarose gels.

When the blots were probed with the 3~-labelled SHBs probe, bands were not seen in the

control pMelbacA-CMV-EGFP lanes (See Fig. 3.9B). This confbns that non-specific labelbg of

harvested DNA is not occurring- Both the DNA f?om transfections of the wildtype and the HBV-

packaging constnict were detected by the 32~-labelled SHBs probe. A spedically labelled band

correspondhg to 3.2 kilobases could be seen in lanes digested with Nco I fiom these two samples.

This confïrms that HBV cccDNA was being properly generated £kom the wildtype and HBV-

packaging constnict transfections. 'The presence of cccDNA in the HBV-packaging construct

transfections indicates that the €-stem loop is not require for cccDNA formation. This hding,

however, should not be a problem since the E-stem-loop would be required by the HBV

polymerase for packaging the pgRNA Thus, none of the HBV-packaging genome should end up

within nucleocapsids of budding viral progeny. No bands could be seen in the lanes loaded with

DNA fiom the HBV-EGFP-reporter constmct, connrmuig that the SHBs gene had been rernoved

and replaced with the EGFP sequence. Co-transfection ofthe reporter construct with the HBV-

packaging construct did not appear to inhibit cccDNA replication of the packaging genome.

However, while the Southern blot confirmed the generation of HBV cccDNA which is

imperative in the formation of defective Wal progeny, the presence of cccDNA alone within

transfected cells does not guarantee Dane particle generation.

Groups that have attempted to generate hepatitis £3 vinons in vitro typicaily detected viral

progeny by searching for HBV DNA in their culture media by Southem blot. We decided to use

polymerase chain reactions @CR) to detect secreted viral DNA fiom transfected celis since it

couid be perfonned quickly. Replication competent genomes would be distinguishable fiom

replication-incapable reporter genomes since the dd-type genomes contain the SHBs coding

region whereas the reporter constnict has the EGFP, replacing the SHBs gene. Initial PCR-

screening of concentrated media yielded background signal even f?om HuH-7 cells transfected

with the CMV-EGFP control plasmid alone. (See Fig. 3.10.) We have postulated that the signal

may be the resuit of fiee DNA left over fiom either the initial traLlSfection or fkom ceils which

have lysed while in culture. Thus, a series of experiments was set-up in an attempt to dxerentiate

packaged DNA fiom unbound DNA.

Concentrated media sarnples fiom transfected HuH-7 c d s were subjected to either

proteinase K, DNAse I, or pre-treated with DNAse 1 followed by proteinase K digest. After

treatment, any DNA remaining in solution was subjected to a phenol-chloroform extraction and

ethanol precipitation. Any DNA was then subjected to PCR to test for the presence of either the

SHBs gene or the EGFP gene.

Samples treated with proteinase K alone showed background amplification when EGFP

was amplified from the sample generated fiom cells transfected with the CMV-EGFP constnict

alone. However, when sarnples were treated with DNAse 1 alone, background bands in the PCR

reactions were reduced significantly. Samples treated with DNAse 1 and then subjected to PCR

amplification of EGFP showed no detectable DNA as compared to the same samples treated

soiely with proteinase K. However, it is unclear why SHBs DNA was still detected, though in

lesser amounts, by PCR fiom the DNAse I treated samples when compared to the proteinase K

treated samples. Any DNA packaged in a viral partide would be resistant to DNAse 1 treatment.

However, neither DNAse 1 treatment nor PCR reaction conditions would be able to fiee the

genome from viral particles. However, it is possible that non-packaged DNA may be partially

protected fkom DNAse 1 activity by non-viral DNA-binding proteins in the culture medium. It

should be noted, however, that the SHBs si& fkom the packaging and reporter constmcts

CO-transfected HuH-7 cell media, was reduced to Whially zero despite the strong signal present

when this sample was subjected to proteinase K treatment alone. Samples were thus pre-treated

with DNAse 1 to reduce signal fiom non-encapsidated DNA DNAse 1 was then deactivated

through addition of EDTA and subsequentiy digested with proteinase K to release any packaged

DNA nom the HBV nucleocapsid. SHBs was readily detectable fkom HuH-7 cell medium

transfected with the wW3V constructs, supportkg the hypothesis that mature virions were being

produced. SHBs signal remained, though significantly reduced, in the sample from HuH-7 cells

transfected with the HBV packaging constnict. Whether this is a result of incomplete DNAse 1

digest, unexpected encapsidation ofDNA by HBc, or protection of fiee DNA by proteins present

in the medium is unclear. When medium fiom transfected cells was tested for the presence of

EGFP-containing DM, strong EGFP signal was seen only in the medium fiom the

dual-transfected HuH-7 cells pre-treated with DNAse 1 foUowed by proteinase K digest. This

supports the theory that only CO-transfecting the packaging and reporter constructs would yield

EGFP-containing recombinant HBV particles. The observation that SHBs was not observed in

these samples also suggests that only the reporter pgRNA is packaged and secreted. However,

signals present in media that should not theoreticdy contain DNA limit Our ability to conclude

that the resulting EGFP signal âom the dual-transfected HuH-7 media is the result of achial virai

particle progeny.

Since the PCR experimental results could not unquestionably ver* the presence of viral

particles, media fiom the transfécted ceus were also analyzed using electron microscopy. Media

samples were applied to fomvar-coated nickel grids and probed with anti-SHBs (polyclonal)

antibody. 12 nm colloida1 gold conjugated secondary antibody was used to label samples such that

they wuld be localized under the electron beam. As a control for the electron microscopy

experiments, HBV subvird particles generated using the baculovinis-SB expression system were

also visualizecl. In sections of iofected Sf9 cells expressing with HBc or SHBs proteins, particles

corresponding in size to HBV nucleocapsids or HBV spheres codd be seen and labelled with gold

(See Fig. 3-11). While nucleocapsids are not secreted, the HBV spheres and filaments codd be

detected in media fiom infecteci SB cells (See Fig. 3.12). The fact that these structures could be

specincally labelled using the anti-SHBs polyclonal antibodies verifies the specificiîy of the

antibody as well as confinning our abiliîy to detect virai particles in the media fiom infected cells.

Media samples fkom H a - 7 cells transfected with the wild-type construct contained 22 n m

and 42 nm particles which could be labelled with gold (See Fig.3.13). These particles are of the

same size and morphology as the hepatitis B sphere and virion. This fïnding supports the

published reports that HuH-7 cells are capable of supporting hepatitis B viral morphogenesis

when transfected with a genomic constmct. This finding also verîfïed that the wild-type constnict

appears fùnctional.

Media fiom celis transfected with the packaging construct alone contained 22 nm particles

as well, but no 42 nm particles were seen. Vions are not expected to be generated due to the

lack of the 5' E-stem loop fiom the packaging constnict and no 42 MI viral particles were

observed. Media fiom cells transfected with the reporter constnict alone did not show any 22 nm

or 42 nm particles. This cornes as no surprise since the reporter constnict lacks the ability to

express any hepatitis B surface proteins. Gold particles seen were not associated with any visible

structure.

However, media fiom HÜK-7 cells CO-transfected with the HE3V packaging and reporter

constructs contained both 22 nm and 42 nm particles which could be specifïcally labelled with

gold. This result fûrther supports the notion that recombinant hepatitis B viral particles are being

generated by the two constructs. Media fiom CMY-EGFP control trandections did not contain

any particles which could be gold-labelled. Very little non-specific gold binding was observed on

the control grids.

While it appears that recombinant HE3V progeny ca. be generated by CO-transfection, the

ability of a dual recombinant bacdoviral system to generate EGFP-containhg hepatitis B virions

has not been conhned. As well, the functionality of the generated recombinant HBV particles

remains to be seen,

The presence of EGFP-HBV recombinant virus can be verifïed by ushg protease

treatment to allow the recombinant HBV to enter Hep G2 cells as described by Lu (46). Samples

would be treated with V8 protease which cleaves a region in the pre-S2 domain of the large

surface protein. The cleavage process releases a putative fusion peptide which has been shown to

allow wtHBV to infect Hep G2 cells (46). As long as the recombinant vinises carry the EGFP

gene, a green fluorescent signal should be visible under a fluorescent microscope.

The current problems with generation of these recombinant HBV particles appears to be

production of enough particles for use in M e r studies. It is possible that despite the use of

endogenous hepatitis B Wal promoters in this system, levels of HBV protein production rnay not

be optimal for proper hepatitis B particle production and secretion As a lot of hepatitis B Mace

proteins can be detected in transfected celi lysate, it is possible that secretion rnay be a problem. It

has been reported that over-expression of LHBs can resilt in ER retention of HBV particles

(105). Thus, hypotonie complemented with mechanical lysis of transfected ceils rnay increase the

yield of recombinant particles. These particles could then be purified using sucrose gradients.

There may also be problems simply due to the nature of the cell culture system used.

Though Hep G2 and HuH-7 cells were tested for their ability to use endogenous hepatitis B viral

promoters, whether all these promoters still function adequately during hepatitis B protein

synthesis has not been assessed. While there appears to be generation of hepatitis B core and

sutfafe proteins as confinneci by Western blot, there rnay be Little or no polymerase protein being

generated. As the polymerase protein is necessary for virai DNA packaging and replication,

design and generation of a helper virus which would express greater amounts of polymerase rnay

assist these cells in generating recombinant HBV particles.

EGFP-containhg HBV recombinant Wions could be used as a tool to screen for potential

receptors used by HBV to enter hepatocytes. Successfùl entry of virions cm be assessed by the

expression of EGFP in the target cells. The celi line, Hep G2, which has been shown capable of

buiding ont0 hepatitis B virions (40, 106, 107), but cannot be infècted would be a good candidate

Line to use for determinhg a fusion receptor for HBV. Identification of the HBV receptor wodd

yield a good candidate molecule against which anti-viral drugs could be targeted.

The EGFP-HBV recombinant Wus rnay also be used as a potential vaccine candidate.

Current yeast-derived vaccines confer systemic, but not long term humoral immune responses. A

replication-incapable vims would cause exposed individuals to elicit a stronger and potentially

longer-lasting immune response than current vaccines produce. As the current hepatitis B

vaccines are not effective for everyone, these defective hepatitis B viral particles may offer

non-responders an alternative to the yeast-denved vaccine.

Moreover, recombinant hepatitis B Wions may be used as a gene targetting system for the

liver. The hepatotropic nature of HBV would alIow for efficient DNA delivery into hepatocytew

This may be potentially usefid in helping treat those individuals who are chronically infected with

the hepatitis B virus. Co-infection of recombinant and wild-type virus in hepatitis B infectecf

individuals may lead to a potential reduction in the replicative capability of the wild-type vims.

Other fonns of hepatocyte gene therapy could also prove usefiil in treathg those with various

types of liver dysfiinction.

Our work and the work of other groiips worldwide point towards the feasibility of

generating HEW-based Wal particles. The continued prevalence of hepatitis B infections

worIdwide makes the quest for the elusive receptor of HBV worthy of continued pursuit.

MacCalluq F.O., HomoCogous Senim Jmmdie. Lancet, 1947. 2: p. 69 1-692. Blumberg, B. S ., et al=, AustraIia nntigen and hepatitis. N Engl J Meci, 1 970. 283(7): p. 349-54. Dane, D. S-, CH- Cameron, and M. Brïggs, Virus-Zike particles in s e m of patients with Australiadntigen- associared hepatiti~~ Lancet, 1 970. l(7649): p. 695-8. Kaplan, P M , et al-, DNA PoCymerase associuted with humun hepatitis B antigen. J Viol 1973. 12: p- 995-2005. Feitelson, MA, P r h c t s of the "Ygene in hepatitis B B related Mruses- Hepatology, 1986.6(2): p- 191-8. Hollinger, F.B ., Serologfc evaluation of viral hepatitis- Hosp Pract (O f f Ed), l987.22(2): p- 101-14. Hoofbagle, J.H., T p e B hepatitis: virology, serology and dinical course. Semin Liver Dis, 1981. l(1): p. 7-14. Crowther, RA, et al., l&ree-dimensionai structure of heptitis B virus core particles detemined by electron cryomicroscopy. Cell, 2 994. 77(6): p. 943 -50 - Nassal, M. and A Rieger, An intramoleculm disurJfIde bridge berneen Cys-7 and Cys61 determines the stnrcture of the secretory core gene product (e antigen) of hem-ris B vinsS J Virol, 1 993.67(7): p. 43 07- 15. Onodera, S., et al., Electron rnimoscopy of h a n hepatitis B vins cores by negative simi?ing-~arbonfiZ' technique- J Med Vol, 1982. lO(2): p. 147-55. GerIich, W.H. and W.S. Robinson, Heptitis B virus containsptein attached to the 5' termimrs of its compIete DNA Strand: Ce& 1980.21(3): p. 801-9. Gerelsaikhan, T., J.E.-Tavis, and V. Bmss, Hepatitis B virus mrcleocapsid enveIopment does not o c m wzthout genomic DNA synthesis. J Virol, 1996. 70(7): p- 4269-74. Delius, EL, et al., Structure of the hepatitis B virus gemme, J Viol, 1983.47(2): p. 337- 43. Robinson, W.S., D . k Clayton, and EL. Greenman, DNA of a human hepatÏtis B virus cundiùbte. J Viol, 1974. 14(2): p. 384-91- Gowans, E.J., et al., Paftems of single- amidouble-stranded hepatitis B virus DNA and viralantigen accumuIafion in infected INer ceZls. J Gen Virol, 1983.64w 6): p. 1229- 39. Lien, J.M., C.E. Aldrich, and W.S. Mason, Evzdence that a cqped oligoribomcleoti& is the primer for duck hepatitis B virus plus-sfrand DNA synfhesis. J Vuol, 1986.57(7(1): p. 229-36- Ou, J.H., O. Laub, and W.J. Rutter, iYepafrafrtis B vliusgenefunction: the precore region targets the core antigen to celluZar membranes and causes the secretion of the e antigen. Proc Nat1 Acad Sci U S 4 1986.83(6): p. 15 78-82. Kwee, L., et al,, Altemate trunslation initiation on heputitis B virus X M A produces multiple polypeptides that dzzerentiaIty traïzracrntute clms 11 and IITpromoters. J Viol, 1992.66(7): p. 4382-9. Tioliais, P., C. Pourcel, and A Dejean, The hepatitis B Nature, 1985. 317(6037): p.

489-95. Russnak, R and D. Ganem, Sequences 5' to the po&&nyIation signal mediate atflerentiaZpo&(A) site use in hepatr-tis B viruses. Genes Dev, 1990.4(5): p. 764-76. Lopez-Cabrera, M., et al., Multiple river-spec~ifc factors 6hd to the h e w t i s B B-ms core/pregeenomic promoter: Rmns-c~cfnratîon and repressïon 6y CCAAT/enhancer bindhg protein. Proc Natl Acad Sci U S 4 1990.87(13): p. 5069-73 - Chang, W.Y., et al., Relationship between f i liver, alanine arninotraylsferase, HBsAg cmd hepatitis C virus- 3 Gastroenterol Hepatol l992.7(5): p. 455-8. Junker-Neprnanq M., R Bartenscblager, and H. Schaller, A short cis-acting sequence is repired for heptitis B vinrspregenome encqsidztion ond mffcieent for packaging of foreign RNA. Embo J, 1990. 9(10): p. 3389-96. Pollack, J-R and D. Ganem, An RNA stem-hp structure directs hepafrafrtis B wMms genomic RNA enqsi&tïon, J Viroi, l993.67(6): p. 3254-63. Loeb, D.D., RC. Hirsch, and D. Ganem, Sequence-independent RNA cleavages generate the primers for plus strand DNA synthesis in hepaititis B viruses: zmpkations for other reverse framcncnbing elements. Ernbo J, 199 1. l U ( 1 1 ) : p. 353340. Pollack, J.R and D. Ganem, Site-speczjk RNA binding by a hepatitis B virus reverse franscripfase initiates two distinct reactiom: RNA packagrng and DNA gmfhesis. J Viol, 1994.68(9): p. 5579-87. Hadchouel, M., et a[., Detection of monomrclear cells eqressing he@-fis B virus in peripherul bIoodfiom HBsAg positive and negrnive patients by in situ hybridisafi-on. J Med Virol, 1988.24(1): p. 27-32. Lie-Injo, LE., et al., Hepatitis B Bms DNA in liver and white b lod cells of patients with hepatoma. Dna, 1983.2(4): p. 301-8. Noonan, CA, et al., ~achromsoPnal sequences of hepatr-tis B virus DNA in penpheral bled dmononucleaf cells of acquired i m m e deficinq syndkome patients. Proc Natl Acad Sci U S 4 1986.83(15): p. 5698-702. Shen, H.D., et al., Hepatitis B virus DNA in leubcytes of F e n t s with hepatitis B virus- associated liver disemes. J Med V i o l l986.18(3): p. 20 1 - 1 1. Eifassi, E., et al-, Evidence of extrachromosomal fonns of hep&-tis B viral DNA in a bone mmow culture obtmnedfiom apatient recently infected with hepattis B vinrs. Proc Natl Acad Sci U S A, 1984.81(11): p. 3526-8. Halpem, M.S., et al., Viral mcleic acid synthesis a d antigetigen acnrmulmion in pmcreas and kidkey of Pekin duch infected with dùck hepatitis B vinrs. Proc Natl Acad Sci U S 4 1983.80(15): p. 4865-9. Romet-Lemonne, J-L., et al., Heputitis B M m infection in cultwed human lymphobla~roid cells. Science, I983.t21(46ll): p. 667-9. Hosoda, K., et al., Ektrahepatic replication of duck hepatitis B virus: more than expected Hepatology, 1990. 11(1): p. 44-8. Galle, P.R, et al., Replication of h c k hepattis 23 virus in pnmary aick he@wtes and its dependeme on the state of dzflerentiation of the host cell. Hepatology, 1989. lO(4): p. 459-65. Pugh, J-C., et al., Characterisaton of a pre-Spolweptide on the surfaces of infectims

avian hepadhvi"s particles. J Viol, 1 98 7.61(5): p. 13 84-90. Tuttieman, LS., J-C. Pu& and I-W. Summers, In vitro expen-mental infction ofprimary duck hepatocyte cultures wilh auck hepatitis B virus. J Viol, 1986.58(1): p. 17-25. Meha H., et al., Hepaititis B B s surface mtigen bmdr to qolipoprotein H. J Viol 1994,68(4): p. 2415-24, Mehdi, H., X. Yang, and M.E. Peeples, An altered fom of apoIipoprotein H bina3 hepot-tis B virus surface antigen most eflciently. Viology, 1996.217(1): p. 58-66. Pontisso. P., et al. , PoZyalbumin receptors on hepatitis B virus and on 22 nm hepatitis B swjiace d g e n (iFBsAd2 particles. J Med Viol, 1984.13(4): p. 355-60. Budkowska, A, et al., Fibronectiin of h m a n ZNer sinusoi& b i d hepat-tis B virus: identifution by an anti-idioipic an tibajl bearing the intemal Nnllge of the pre-S2 domain J Viol, 1995.69(2): p. 840-8. Neuratk AR, N. Stnck and Y.Y. Li, Cells frQTZSfected wilh h a n interleukin 6 cDNA acquire biding sites for the hepatitis B Brus emelope protein. J Exp Med, l992.176(6): p. 1561-9. Urban, S ., et al., Avian hepatitis B virus infection is initiuted by the interaction of a distinct preS subdomaiin with the celIu2m receptor gpl8O. J Virol, 1998. 72(l O): p. 8089- 97. Breiner, KM-, S. Urbaq and H. Schaiier, Curboxypeptiahse D (gp180), a Golgi-redent protein, fclplctions in the anachment and en- of avravran hepatiitis B vimses. J Viol, 1998. 72(10): p. 8098-104. Ryu, C.I., et al., An 80-kiZ~Zton protein thai! bina5 to the pre-SI domaïin of hepatitis B virus- J Vio l 2000. 74(1): p. 1 10-6. Lu, X-, T-M Block and W.H. Gerlich, Protease-indueci infecfivity of hepattis B virus for a humm hepatoblastoma cell rine. J Virol, l996.70(4): p. 2277-85- Gagliardi, M-C., et al., Soluble tram#ewri? mediares targeting of hepafitis B envelope antigen to fransfemh receptor rmd ifs presentation by activated TcelZs. Eur J Immunol, 1994. 24(6): p. 1372-6. Treichel, U., et al., Receptor-mediated entry of heputitis B vinrspmîicIes znto lïver cells. Arch Virol, 1997.142(3): p. 493-8. Kock J., et al., Hepatitis B virus mcleic acidr associated with h a n penpheral blood mononuclem cells do no? ongrgrnute fiom replicatYzg v i m Hepatology, 1996.23(3): p. 405-13. Qiao, M., et al., Kinetics of early molenrlm evenfs in duck hem-tis B Brus repkztion in primary duck hepatocytes- J Gen Viol, 1999.80(Pt 8): p. 2 127-3 5. Kock, J. and H.J. Schlicht, Ana&sis of the earliest steps of hepcdhavims repkcation: genome repair aflr infectious e n m into hepatocytes does not depend on viral polymerase actiwMty. J Viol, 1993.67(8): p. 4867-74. Enders, G.H., D. Ganem, and H.E. Varmus, 5'-teminal sequences influene the segregation of grand squirrel hepatitis virus M A S into polynbosomes and viral cure parfiiZes. J Viol, l98?.6l(l): p. 3 5-4 1. Nasal, M., M. Junker-Niepmann, and H- Schaller, Translational inactivation of M A jknc fion: discrimination agm-nst a subset of genomic trunscrip ts during HB V

mcieucapsid arsembly. Ceil, 1990.63(6): p. 1357-63- Birnbaum, F. and M. Nassal, Hepafiafitis B Bms rmcleocqsid assemb1y.- prim.y structure repirements in the core protein J Viol, 1990.64(7): p. 3 3 19-3 O. Gallina, A, et al., A recombinant hepatïtis B core d g e n polypeptide with the protamine- like domain deleted selfarsemhles into capsidpn?zèIes but f&Zs tu bind d e i c aci& J Viol, 1989.63(11): p. 4645-52. Miyanohara., A, et al., Erpression of hepatitis B vinrs core mtigen gene in Saccharomyces cerevisae: synthesis of two polypeptidés hanslatedfrom dzgerent initiation codons. J Viral., 1986.59(1): p. 176-80. Hitsch, RC., et al., PuZymerare gene prducts of hepatitis B wvinrses are required for genomic RNA packagzng ar wel as for reverse transmi)tiort. Nature, 1990.344(6266): p. 552-5 - Bartenschlager, R, C . Kuhn, and H. Schaller, mression of the P-protein of the human hepottis B Mnrs in a vaccinia virus system ddetec t ion of the mcZeoc~s id~socc ied P- gene prodicct by radiolabellzng ut newly intr~cedphosphorylution sites. Nucleic Acids Res, 1992.20(2): p. 195-202. Tavis, J.E., S. Peni, and D. Ganem, Hepaakvitinrs reverse trmmption initiates within the stem-loop of the RNA packagikg signal and employs a novel sfrand t r e e r . J Virol 1994.68(6): p. 3536-43. Tavis, J.E. and D. Ganem, Expression o f ~ c t i o n a l h e p - f i s B vinrs poljmerase in yeasl reveals it tu be the sole viral protein required for correct initiation of reverse transcn'ptiun- Proc Natl Acad Sci U S A, 1993.90(9): p- 4 107-1 1. Wang, G.H. and C. Seeger, Novel mechanim for reverse frmcription in Izepatitis B vlruses. J Viral, 1993.67(11): p. 6507-1 2. Wang, G.H. and C. Seeger, m e reverse trmmptase of hepatr-tis B virus acts as a protein primer for viral DNA syn thesis. Cell, 1992. 71(4): p. 663-70. Miller, RH. , P.L. Marion, and W. S. Robinson, Hepdtis B viral DNA-RNA hybrid molecules in parfiarficles from infected lNer m e converted to wkal DNA molecules during an endogemus DNA polynrerase reuctiun. Viology, 1 984. 139(1): p. 64-72. Summers, J. and W.S. Masoq Replication of the genome of a hepattis B-like vinrs by reverse transcription of an RNA intermediate- Ce& 2 982.29(2): p- 403- 1 5. Staprans, S., D.D. Loeb, and D. Ganem, Mutations qfjecting hepadhavirus plus-strand DNA synthesis dissociate primer cleavage from tramlocation and reveal the origh of rinear viral DNA. J Viol, l991.65(3): p. 1255-62. G f i a , A., E. Gazina, and G. Milanesi, A C-terminal PreSI sequence is su-cient to retain hepatitis B vins L protein in 293 cells- Virology, 1 995. 2 l3(l): p. 57-69. Ganem, D., Hepacli.urvin'&e and andeir Replication, in Fields Vïrology, B.N. Fields, Knipe, D.M., Howley, PM., et al., Editor. 1996, Raven Publishers: Philadelphia. p. 2703- 2735, Cheng, K.C., G.L. Smith, and B. Moss, Hepattis B vims lmge mgace protein is not secreted btrf is immogenic when selectiveZy expressed by recombinunt vaccinïa virus. J Viol, 1986. 60(2): p. 337-44. Chisari, F.V., et al., Expression of hepattis B v i n s large ewelope polypeptide inhibits

hepatitis B sm$ace mtigen secretion in frmsgenic mice. J Viol, 1986.60(3): p. 880-7. Persing, DH-, KE. Vamus, and D. Ganem, Inhibition of secretion of hepatitis B sMface mtigen by a relatedpresmjbce polypeptide Science, l986.234(4782): p. 1 3 8 8-9 1. Standring, D.N., J.H. Ou, and W.J. Rutter, Assernbly of walparticles Rt Xenopus oocytes: pre-sm$ace-antigens regulate secretion of the hepottis B viral surface eenvlope particle. Proc Natl Acad Sci U S 4 1986. 83(24): p. 933 842. Poisson, F., et al., 230th pre-SI and S domaim of hepatitis B wvinrs envelope proteins interact wirh the core particlee Vîology, 1997. ZUI(1): p. 1 15-20. Ganem, D ., AssernbZy of hepa&avi'ral vinons and subviral parfi-cles. Curr Top Microbiol Imm~noI, 1991. 168: p. 61-83. Wynne, S .A, RA Crowther, and AG. Leslie, n e crystal structure of the human hepatitisB vims capsid Mol Cell, 1999.3(6): p. 771-80. Gamble, T.R, et al , SLwcture of the wboxyl-teminal dimerization domain of the HN-1 cq~idpo te in . Science, 1 997.278(53 3 9): p. 849-53. Momany, C., et al., Crysral structure of dimen-c H N ; I cqsidprotein. Nat Stnict Biol 1996.3(9): p. 763-70. Zheng, J., F. Schodel, and D.L. Peterson, B e structure of hepadmral core antigens. Ià?ènit@ation offree thiols and detemination of the disuIfide honding pa ffem. I Bi01 Ch- 1992.267(13): p. 9422-9. N a s e M., A Rieger, and 0. Steinau, Topolog-~~caI anaZysis of the heptitis B vins core particle by cysteine- cysteine cross-linking. J Mol Biol, 1992. 225(4): p. 10 1 3 -25. Zlotnick, A, et al., Dirn01phi.m of hepatirs B vinrs cqsids is ~frongly influenced by the C- temzzmrs of the capsidprotein BiocheMstry, 1996.35(23): p. 74 12-2 1. Hatton, T., S. Zhou, and D.N. S tanciring, RNA- and DNA-binding acfivities N> hepatitis B virus capidprotein: a rnodel for their roles in viral replicatibon. J V i o l 1992.66(9): p. 523241. Lan, Y.T., et al., Roles of the three majorphosphorylation sites of heparits B virus core protein in viral repliudzCQfionn Virology, 1 999.259(2): p. 3 42-8. Roossinclg M I and A. Siddiqui, In vivo phoqhorylation d p r o t e i n analysis of hepatitis B virus core antigen. J Viol, 1987.61(4): p. 955-61. Machida, A., et al., Phoqhorylation in the carboxyl-tennmal domain of the cupsïd protein of hepatïtis B virus: evaluaton with a monoclonal antib*. J Viol, 199 1. 65(11): p. 6024-30. Kratz, P.A, B. Bottcher, and M. Nassal, Native di~piày of complete foreignprotein domains on the mrjiace of hep&-ris B vins capsidS. Proc Natl Acad Sci U S 4 1999. 96(5): p. 1915-20. Bmss, V. and W.H. Gerlich, Formation of trmsmembrmeous hepat-tis B e-untigen by cotrans~ationaI in vitro processng of the viral precore protein. Virology, 198 8. 163(2): p. 268-75. Wasenauer, G., J. Kock, and H.J. Schlichî, A cysteine and a hydrphoobic sepence in the noncleavedportron of the preC leocier peptidk detennine the biophysicaI properties of the secretory core protein (HBe pro fein) of human hepatitis 23 virus. J Viol, 1992.66(9): p. 5338-46.

Standring, D.N., et al., A signalpeptide encocied within the precore regon of hepattis B virus directs the secretion of a heterogeneouspopuIution of e antigens in Xenopus oocytes- Proc Natl Acad Sci U S 4 1988- 85(22): p. 8405-9. Le Bouvier, G.L., et al-, Subtpes of Austraia d g e n and hepatitis-B virus Jama, 1972. 222(8): p. 928-30. Stirk, H. J., J.M. Thornton, and C.R Howard, A topological mmodel for hepafi-tis B su?$ac;e antigen. Intervirology, l992.33(3): p. 148-58. Bmss, V. and D. Ganem, The role of envelope proteins in hepafiafitis B w?us msemS[y. Proc NatI Acad Sci U S A, 199 1.88(3): p. 1059-63- Mehta, A, et al., Hem-f is B virus (tlBv emelope glycoproteim v q rbasfiaSficallly in thezr sem-tivity to g l y m processing: evideme that alteration of a single N-linked gIycosy2.-on site c m regulate HBVsecretion. Proc Natl Acad Sci U S 4 1997.94(5): p. 1 822-7. Peterson, D.L., Isolation and characterization of the major protein mdglycoprotein of hepatitis B m a c e antigen. J Bi01 Chem, 198 1.256(13): p. 6975-83. Norder, K, et al-, Cornparison of the amino acid sequences of nine dzflerent serotpes of hepatitis B surface antigen and genomic c lm~ca t ion of the correqonding hepm-tis B virus strains. J Gen Viol., 1992.73(Pî 5): p. 120 1-8. Bancroft, W.H., F.K. Muidon, and P.K. Russell, Deteciion of d i t ional antigenic determinants of hepatratrtis B antigen. J Immun04 1972. 109(4): p. 842-8. Okamoto, K, et al., Tping hepaiïtis B virus by homology in mrcleoti& sequence: compmson of M a c e antigen subtypes. J Gen Vlrol, 1988.69(Pt 10): p. 2575-83. Norder, H, AM Courouce, and L.O. Magnius, Mdecular basis of hepatitis B virus serotype vmàtiom within the four major mhtypes. J Gen Viol , 1992.73(Pt 12): p. 3 14 1- 5. Melegari, M-, PP. ScaglionÏ, and JR Wands, rite small emeIope protein is requiredfor secretion of a naturally o c c u ~ g hepatitis B virus mutant with pre-SI deleted J ViioI, 1997.71(7): p. 5449-54- Stibbe, W . and W.H. Gerlich, Structural rel~~onshzps between minor and major proteins of hepafiafitis B sug2ace antigen. J ViroI, 1983.46(2): p. 626-8. PoUicino, T., et al., Pre-S2 defective hepottis l3 virus Nfection in patr-ents with fulmnant hepatitis. Hepatology, 1997. 26(2): p. 495-9. Heemanq K.H., et al., Large surfce proteins of hepatitis B virus containing the pre-s sequence. J Viol, 1984.52(2): p. 396-402. Persing, D.B, BE. Varmus, and D. Ganem, n e preSl protein of hepat-tis B Brus is acyZated at its mino tennimrs with myristic acid J Virol, 1987.61(5): p. 1672-7. Swameye, 1. and H- Schalier, Dual ropology of the large emelope protein of h c k hepatitis B vins: deteminont.. preventntg pre-S tramdocation and glycosylation. J V i o l , 1997.71(12): p. 9434-41. Guo, J.T. and J-C. Pugh, Topotogy of the large envelope protein of duck he@-tis B vins suggests a mechanism for membrane trunslocation during partice morphogeneesis. J Viol., 1997. 71(2): p. 1107-14. Bmss, V., A short Zinear sequence in the pre-S domain of the. large hepatitis B virus

envelope protein required for Mnon fornation. J V o l , 1997- 7 l(12): p- 93 5 0-7. Xu, Z., G, Jensen, and T.S. Yen, Activation of hepatitis B virus Spromoter by the wal large szi$ace protein via induction of stress in the eruioplasmic reticuIum- J Viol, 1997. 71(10): p. 7387-92. Nemath, AR, et al., Antibodies to a synthetic peptide fi.om the preS 120-145 region of the hepatitis B virus envelope are virus neutralizing. Vaccine, l986.4(1): p- 3 5-7. Nemath, A-R, et a l , C.actennzatrzatron of monocIonul anfibodies speczJic for rhe pre-S2 region of fhe hepatitis B vim envelope protein. Mol Immunol, 1986.23(9): p. 991-7- Pontisso, P-, et a/., 1denfitcafrafron of an atfachent sire for Innnan lNer p/amra membranes on hepatitis B Mnrs partr-cles. Virology, 1989. 173(2): p. 522-30. Gong, 2. J., et al., Transfection of a rat hepatoma cell line with a colzsfruct expressing human Ziver annexih V confers susceptibiZity tu hepatitis B virus infection. Hepatology, 1999,29(2): p, 576-84. Toh, E, H. Hayashida, and T. Miyata, Sepence homology between reiroviraZ reverse trmcn;Ptase andputafivepo&merases ofheptitis B virus and cauZz$?uwer rnosuic virusS Nature, l983.305(5937): p. 827-9. Mack D.H., et al,, Hepafipafitis B virus parfiarficIes conlain a polypeptide encoded by the Zargest open reading#mne: a pu t e e reverse b-mciptase. J Viral, l988.62(12): p. 4786-90. Lanford, RE., et al., Mqping of the hepatr-tis B vins reverse transcriptase P and Ri? dommhs by transcomplementûlion for d e o t i d e priming mrd by protein- protein interaction. J Virol, 1999. 73(3): p. 1885-93. Tavis, J.E., B. Massey, and Y. Gong B e chrck hepatitis B virus polymerase is activafed by its RNA packagrizg signa4 eps~-Zon. J V i 1998. 72(7): p. 5789-96. Bartenschlager, R and H. Schaller, Hepadnmaylral assernbly is znitiated by pobymerase binding tu the encapsiahtion signal ni the viiral RNA gemme. Embo J, 1 992. 1 l(9): p. 3413-20. Urban, M., et al., In vitro uctivity of hepat;ratis B Mruspolymerase: repzrement for dislnct metal ions and the viral epsilon stem-loop. J Gen Viol, 1998.79(Pt 5): p. 1 12 1 - 3 1. Luber, B., et al., 13re hepatitis B virus trmcfnlator HBx causes elevation of diacyZgZycerol and activation of protein kinase C. Res Virol, 1 993. 144(4): p. 3 1 1-2 1. Renner, M., et al., Transactivating@nction and expression of the x gene of heptitis B virus. J Hepatol, 1995.23(1): p. 53-65. Su, F. and RJ, Schneider, Hepatitis B virus HBx prutein activates transcription factor W-@paB by acting on multiple cytoplasmzc inhibitors of rel-relatedproteins. J Virol, 1996. 70(7): p. 4558-66. Klein, N.P. and RJ. Schneider, Activafr-on of Src fmily kinases by hepafrafrtis B virus HBx protein and coupled signahg to Ras. Mol Cell Biol, 1997. 17(11): p. 6427-36. Lee, Y.I., et al., n e h a n hepktis B virus transactivator Xgene producf regulates Spl mediated fray~scription of an insulin-Iike growth factor IIpromoter 4. Oncogene, 1998. 16(18): p. 2367-80. Henkler, F., et al., Erk-independent partial activation of fi-l sites by the hepatitis B

MrusHBxprotem J Gen Virol, 1998+79@ 11): p- 273742. Benn, J- and RJ. Schneider, Hepatitis B vinrs HBxprotein activates Ras-GP complex formafiafion und esiablishes a Ras, Rat: MAP kinme sSZgnaling cascade- Proc Nat1 Acad Sci U S A, 1994.91(22): p, 10350-4. Kekule, A S . , et al., Hem-fis B Bms bansacfivator IiBx uses a tumour promoter signulling puthway [see commen fs]. Nature, 1993.361(64 14): p. 742-5. Lee, Y.H- and Y . Yun, B x protein of hepafrafrtis B virus activuîes Jukl-STAT signaling. J Bi01 Chem, 1998- 273(39): p. 255 10-5. Feitelson, M.A, et al., He@-ils B x antigen andp.53 are associated in vitro and in lNer tissues frum patients with primary hepatocelluIar carcinoma. Oncogene, 1993. S(5): p. 1109-17. Mosley, J. W., Editonal: B e HBV carrier-a new kind of leper ? N Engl J Med, 1 975. 292(9): p. 477-8. Alter, H.J., et al., Transmission of hepaflafltis B to chimpanzees by hepatitis B suflace antigen-positive &a and semen. Infect Immug 1977. 16(3): p. 928-33. Davison, F., et al,, Detection of hepatittis B virus DNA in spemratozoa, urine, saliva and leucocytes, of chronc HBsAg carriers. A hck ofrelafrafromhip wifh serum markers of replication. J Hepatol, 1987. 4(1): p. 3 7-44 Grabow, W.O., et al., Absence of hepdtis B antigensfrom feces d s e w a g e ar a r e d t of enzymaflaflc aksfruction. J Infect Dis, 1975. 131(6): p. 658-64. McAleer, W.J., et al., Human hepatitis B vaccine fiom recombinant yeast. Nature, 1984. 307(5947): p. 178-80. Hollinger, F.B., Hepatitis B vaccines-to swirch or not to swirch, Jarna, 2987. 257(19): p. 2634-6. Hilleman, M.R, Recombinuntyemt hepatitis B vaccine. Dev Bi01 Stand, 1986.63: p. 57- 62. Acs, G., et al., Hepatitis B virus prduced by transfected Hep G2 ceZZs causes hepatitis in chimpanzees. Proc Natl Acad Sci U S 4 1987.84(13): p. 4641-4. Sureau, C., et al., Production of hem-tis B virus by a dzzerentiated h m a n hepatoma ceIl line afier tra71sfection with cloned circular HBVDNA. Cell, 1986.47(1): p. 3 747 . Chang, C.M., et al., Production of hepatitis B virus in vitro by trunsienf expression of clonedHBVDNA in a hepatoma cell line. Embo J, 1987.6(3): p. 675-80. P fleiderer, M., F.G. Falkner, and F. Domer, Deletion of the myri@htion signal a b s high-levelproductim of the hepatitis B virus large slnface gZycoproteinpreSI with vaccinia virus recombinants. Gene, 1 996. 176(1-2): p- 1 3 1-7. Deml, L., EL WoE and R Wagner, High level eqression of hepatitis B vins sur/ce antigen in stabty transfected Drosophila Schneider-2 cells- J V i o l Methods, 1999. 79(2): p. 191-203. Deml, L., et al., Pmication and characterization of hepatitis B virus sur$ace antigen pcrticIesproduced in Drosophila Schneidèr-2 ce& J Viol Methods, 1999. 79(2): p. 205- 17. Hohann, C., et al., Hepatocyte-qeczific bbining of US--HBVpmticles eqressed in insect cells. Bi01 Chem Hoppe Seyler, l995.376(3): p. 173-8.

Seifer, M,, et al., GeneratÏon of replication-competent heptitis B virus mrcleocapsi. in insecf cells. J Viol, 1998.72(4): p. 2765-76. Hanahsa, T., et al., Replicatin of hepattis B vims which carries foreign DNA in vitro. Biochern Biophys Res Commun, 1999.262(2): p. 53 0-3. Protzer, U., et al., Interferon gene fransfer by a hepat-tis B vinrs vector effientZy suppresses wild-type viws infection. h o c Nat1 Acad Sci U S 4 1999.96(19): p. 1 O8 18- 23. Shoji, I., et al., Efficient gene tmm#er into various mmmaIiian ce& including non- hep& ce&, by bacuZovirus vectors. J Gen V i o l 1997. 78w 10): p. 2657-64. Delaney, W.E.t. and K C . Isom, Hep- t i s B vinrs replicatin in h a n He* cells mediated by hepmifis 23 wvinrs recombinant banrlovirur. He patology, 1998.28(4): p. 1134-46. Whitt, M-A, L. Chong., and JK. Rose, Glycoprotein c y t o p Z ~ c domain sequences required for rescue of a vesinrm stomaiitis Mnrs glycoprotezn mutant. J Viol, 1989. 63(9): p. 3 569-78. SchBtzer, T.I., C. Dickson, and RA Weiss, MorphoIogïcal and biochemical chmacferization of viral particles proaSrced by the tsU4.5 mutant of vesicuIar stomatits virus at resfnctive temperature. J Viol, 1979.29(1): p. 185-95. Gallione, C.J. and JK. Rose, A single mino acid substitution in a hy&ophobic domain causes temperature-semltSJfive celZ-smface tt-ansport of a mutrmt wraI gl'ymprotein. J V io l , 1985.54(2): p. 374-82. Honigwachs, J., et al., Liver-speczj5c eqwession of hepatitis B vims is detennined by the combineci action of the core gene promoter d the enhcer . J V i o l 1 989.63(2): p. 9 1 9-24, Lopez-Cabrera, M., et al-, Trmsmi,tional factor CEBP binds to and transactivates the enhmxer element II of the hepatitis B virus. Viology, 199 1. 183(2): p. 825 -9. Su, H. and J.K. Yee, Regulation of hepatïtis B Mrus gene eqression by its two enhancers. Proc Nat1 Acad Sci U S 4 1992. 89(7): p. 2708-12. Zhang, P. and A. McLachlan, Dzflerentiation-speczjic tramcnptionaZ regulation of the hepatitfs B vinrs rtucIeocapsid gene in human hepatorna cell lines. Viology, 1994. 202(1): p. 430-40. Yu4 C.H. and L.P. Ting, DzTerentiated Iïver tell speczpcity of the second enhancer of h e w t i s B virus. J Viioi, 1993.67(1): p. 142-9. Raney, A.K. and A. McLachlan, Characteniution of the hepatitis B virus major suMace amïgen prornoter hepafocyte mcZear factor 3 binding site. J Gen Viol, 1997.78(Pt 1 1): p. 3029-38. Yu, X and J.E. Mer& Promoters for synthesis of the pre-C andpregenomic mRNAs of h m m hepatitis B virus m e geneticalry distinct and dzrerentially regulated J Viol, 1996.70(12): p. 8719-26. Yu, X and J.E. Mertz, DzflerentiaI regirlation of the pre-C andpregenomic promoters of huma71 hepatitis B virus by members of the mcZear receptor super--fmi&. J Viol, 1997. 71(12): p. 9366-74. Loser, P., et al., Evaluation of HBVpromoters for use in hepatic gene therapy. Bi01

Chem Hoppe Seyler, l996.377(3): p. 1 87-93. Kosovsky, M-J-, et al., Induction of hepatifis B virus gene expression af Zow temperature. Biochim Biophys Acta, 2000- 1490(1-2): p. 63-73. Gazha, E.V., et al., Intracellulm retention of h c k hepatitis B virus large surface protein is independent of preS fopology- V.Üology, l998.242(2): p. 266-78 - Nemeckova, S., et al., A carboxy-terminal portion of thepreSI domain of hepatitis B virus (EBV occasioned retention in endoplmic retimlm of HBVenvelope proteins expressed by recombinant vaccinza viruses. Virology, 1994- 202(2): p. 1 024-7. Xh 2. and T. S. Yen, IiztraceZZulizr retention of surface proteîn by a hepaîitis B virus mutant that releases virion pmirpmircZes. J Viol , 1996. 70(1): p- 13 3-40. Zhou, D.X. and T.S- Yen, Dzrerential reguIatratron of the hepatitis B vinrs surface gene promoters by a second viral enhancer. J Bi01 Chem, 1990.265(34): p. 2073 1 4 . Antonucci, T-K- and W.J. Rutter, Hepatitis B virus (HBv promoters are regulafed by the HBV enhancer in a tissue-qeczjk rnarmer- J Viro f , 1 989.63(2): p. 5 79-83. Sells, MA, M.L. Chen, and G. Acs, Production of hepat-tis B Mri~sprticies in Hep G2 cells transfected wirh cloned hepatitis B virus DNA. Proc Natl Acad Sci U S 4 1987- 84(4): p. 1005-9. Klein, R, CH. Schroder, and EL Zentgrd Ekpression of the Xprotein of hepar-tis B virus in imect cells using recombinant bacubviruses. V i s Genes, 199 1.5(2): p. 157-74. S panday D .F., et al., A functional hew-t is B virus Xpro fein produced in insect ce lk Virology, 1991. 185(2): p. 93841. Sommer, G., F. van Bommel and H- W a Genotype-speczpc synfhesis and semetion of spliced hepatitis B Mrus gemmes in hepatoma cells. Virology, 2000. 271(2): p- 3 7 1-8 1. Weiss, L-, et al., 17te KBV-producing ceZZ Zine HepG2-4A5: a new in vitro systern for studying the regulation of HBY replication and for screening unri- heptitis B virus h g s . Virology, 1996. 216(1): p, 214-8. Boyce, F.M. and N.L. Bucher, BamIoMrus-mediafedgene t r w e r into mammalian celk Proc Nad Acad Sci U S A, 1996. 93(6): p. 2348-52.

Acknowledgements Many thanks should go to Dr. Chris Richardson for his editing and input during the Wnting of the textbook chapter on the Hepatitis B V i s . Thanks should also go to Dr. Nicholas Acheson for his added comments, additional figure designs, and general editing.

Jïngyu Diao should be credited for writuig the buk of the review paper on the Hepatitis B X Protein. Many thaks again to Dr. Chris Richardson for editing and critiquhg of the paper and figures which 1 designed and generated with the assistance of fi~lgyu Diao.

(TEXTBOOK CHAPTER) Garces RG and Richardson CD. (In press) The Hepatitis B Virus in Nicholas Acheson (Ed), Molecuiar Biology of Viruses.

The discovery of hepatitis B virus Liver infections, known as hepatitis, consitute a major worldwide public health problem.

Among the numerous agents that cause hepatitis are a number of unrelated +ses, denoted by letters f?om A through G. Before the vimses causing hepatitis were identifiecl, these pathogens were class5ed by modes of transmission and epidemiology. The terms hepatitis "A" and hepatitis c73" were first htroduced by MacCallum in 1947 in order to differentiate between infectious (enteric) and semm hepatitis. Type A hepatitis was predominantly transmitted via the fécal-oral route while type B hepatitis was transmitted primarily through blood contact. EventuaQ these terms were adopted by the World Health Organization Cornmittee on Viral Hepatitis.

In 1963 Blumberg discovered a previously unknown prote* which he denoted the Australia antigen, in the blood of an Australian aborigine. It soon became apparent that this protein was related to type B hepatitis. Over the next several years, investigators established that the Australia antigen (now known as the hepatitis B surface antigen) is associated with type B hepatitis. In 1973 Dane found virus-like particles in the senun of patients with type B hepatitis; these particles subsequently became known as Dane Particles and were shown to be Wions of hepatitis B virus (HBV see Box). A unique property of these particles was revealed by Kaplan, who detected endogenous RNALDNA-dependent DNA polymerase (reverse transcriptase) withh their core. These diswveries led to the study and characterizaion of the HBV DNA genome, which was eventually cloned and sequenced by TioUais, Charny, Valenniela, and Rutter in 1979. HBV is unique in the world of vinises with its small circdar DNA genome, extensive use of overlapping reading fiames, production of a pregenome RNA @gRNA), and dependence on a reverse transcription step for replication. Human HBV became the archetype of the hepadnavirus family, H e e v i n d a e . A plant virus, caulinower mosaic virus, also uses overlapping reading fiames and a reverse transcriptase during its replication. It is believed to be a distant cousin of HBV.

Aithough the hepatitis B surface antigen has been found in other primates, humans remai. the prirnary reservoir for this Mnis. In recent years, related vinises have been found in other

animal species (see Box), but each pathogen is species-speciflc. The WHO estimates that over two billion people worldwide have been exposed to HBV, and around 500 million of these individuals are chronic carriers. Transmission of HBV is primarily through blood and semai contact. This large reservoir of infected individuals has facilitated the evolution of a satellite Wus known as hepatitis delta vhs (see chapter 3 1)- Hepatitis delta virus can only replicate in cells previously infected with HBV, since it borrows the hepatitis B surface proteins to package and form an envelope around its own capsid proteins and genornic RNk However, hepatitis delta virus resembles Woids and is quite different fi-om HBV.

There are several types of hepatitis B vims particles, but only Dane particles are infectious The infectious hepatitis B virion, or Dane particle (see Box) has a diameter of 42 m. Its

envelope contains hepatitis B surface proteins (HBs) and lipids; however, electron microscopy does not reveal a typical unit membrane structure, and the envelope contauis a lower proportion of lipids than rnost membranes and viral envelopes. The envelope surrounds the nucleocapsid or core, which is-composed of 180 molecules of hepatitis B core protein (HBc) arranged with icosahedral qmmetry. The nucleocapsid contains at least one molecde of hepatitis B DNA polymerase @p), as well as the HBV genome.

High concentrations of non-infectious, subviral particles can be found in the senun together with Dane particles during the acute phase of infection These particles are composed primady of lipids and hepatitis B surface protek. Both filamentous and sphericd non-infectious particles, each having a diameter of 22 nm, are found in the s e m . The spheres are composed of small and middle hepatitis B surface proteins (SHBs and MHBs), whereas the filaments also contain large hepatitis B surFace proteins (LHBs). These particles do not contain core or polymerase proteins, or viral genome DNA Since non-infious particles wntain the HBV surface antigens, they cm induce a significant immune response in the infëcted host. Production of massive amounts of noninfectious particles may provide a "stealth" mechanism for evading the immune response; they c m divert the Unmune attack by binding to antibodies and complement, allowing the less abundant virions to traverse the bloodstream undetected.

Four major serotypes and six major genotypes of HBV are found worldwide. The genotypes are denoted Group A through Group F. Group A is found in northem Europe and sub- Saharan Afnca, Group B in eastern Asia (China), Group C in the Far East (Japan), Group D around the Mediterranean, the middie East and southern Asia, Group E in west sub-Saharan Atnca extenduig south to Angola, and Group F in North and South America- Serotypes of HBV are defined by antibody recognition sites on the small surface protein. Originally, an antigenic epitope that was present on all known hepatitis B surface proteins was classified as determinant a. The four other major subtypes are d ory and w or r. These two sets of antigenic subtypes fd into 2 separate groups and the mernbers of each pair are mutua& exclusive. Determinant d has a lysine at position 122 on the smd surface protein, while y has an arginine at that position. Similady, deteminant w has a lysine at position 160 while r has an arginine at that position. Thus, a common main of hepatitis B virus might be classified as adw or a&.

The hepatitis B virus genome is a compact, circular DNA of unique structure Electron microscopy provided the fïrst view of the hepatitis B genome. It is present as a

circular 3 -2 kb DNA molecule that is partly double-stranded, with a single-stranded region of variable length (Figs. 1 & 2). The minus DNA strand is joined at i ts 5' end to a tyrosine residue in the P protein, an RNA/DNA-dependent DNA polymerase. The cornplementary plus DNA strand has a short, capped RNA at its 5' end; this DNA strand is shorter than the minus strand, giving nse to the partly single-sîranded region Neither strand is covalently linked to DNA at its 5' or 3' ends; the circle is held together by a short overlap near the 5' ends of both strands. These peculiar features refiect the unique mode of HBV genorne replication, which proceeds by reverse transcription of an RNA intemediate (see be1ow)- Addition of deoxyn'bonucIeoside triphosphates to disrupted vinons allows the virion-associated DNA polymerase t o extend the plus DNA strand, filling in the single-stranded gap and generating a U y double-stranded DNA molecule.

Coding regions in the HBV genome are organized in a highly efficient fashion (Fig. 1). Four overlapping open reading fiames, designated C (for capsid protein), S (for surface protein), P (for polymerase) and X (for a regdatory protein), are translated to yield seven different HBV proteins. Every base pair in the HBV genome is involved in coding for at least one HBV protein! The genome also contains two enhamer-elements @nh 1 and 2) that regulate levels of transcription, a polyadenylation signal, a packaging signal (E), and direct repeats (DR1 and DR2) that are involved in reverse transcription. These cis-acting sequence elements necessarily overlap with one or more coding regions. There may be no other virus that has so many overlapping functions within such a compact genome.

After uptake, the HBV genome is converted to a fully double-stranded, covalently-closed circular DNA in the nucleus

To begin its Me cycle, HBV must first bind to a cell capable of supporting its growtk Replication is most efficient within the liver, although other celi types, including monocytes, epithelial and endothelid celis, have been found to support minimal growth of the virus. Hepatocytes &eshly explanted fiom duck liver support duck hepatitis B vims infection, but there are currently no in vitro cdtivated ceIl lines that can be productively infected with HBV. Consequently, initial steps of HBV entry are poorly understood. H~wever, several cell h e s are capable of supporting HBV DNA synthesis upon transfection with cloned HBV DNA These cell systems have helped to elucidate much of the HBV Life cycle. Attempts to define a receptor for HE3V have yielded various candidates, including apolipoprotein-H, Ebronectin, interleulan-6, annexh V, and an unlcnown 80 k D protein. Which of these proteins are fiuictional cellular receptors remains to be established.

The immediate steps following binding of HBV to the host cell are not well understood. It is currently believed that proteolytic cleavage occurs within the large hepatitis B surface protein as it interacts with the cellular membrane, to expose a fusion peptide. This results in the fiision of the virion envelope and the host cell membrane, followed by the release of the nucleocapsid into the cytoplasm Once uncoated, the nucleocapsid is transported to the nuclear membrane. Studies with duck hepatitis B virus have suggested that retease of the HBV genome fkom the core occurs at the nucleus, possibly through interaction with the nuclear pore cornplex.

The HBV genome is transported into the nucleus where it is repaired to a covalently closed, circular form (Fig 2). This repair process involves extension of the plus-strand DNA across the single-stranded gap region to form a fùlly double-stranded DNA (step 1), removal of

the temiinal primers (the P protein on the minus strand, and the short, capped RNA primer on the plus strand) (step 2), and covalent ligation of the resrilting 3'-OH and 5'-P ends of each DNA strand (step 3). The P protein may take part in the extension of the minus strand, but inhibitor studies have shown that alI of these steps (strand extension, primer removal, and Iigation) can be camied out by host cell enzymes in the nucleus.

Transcription of HBV DNA gives rise to several rnRNAs and a pregeaomic RNA. UnWre the retrovimses, integration of HBV DNA into the host cell genome is not required

for HBV replication The circuIar HE3V DNA directs the synthesis of a pregenornic RNA and the messenger RNA transcripts required for virai protein synthesis. Cellular RNA polymerase II recognizes four different promoter elements (preS 1, preS2, core, and X) on HBV DNA, and transcription is influenced by two enhancer elements (Enh I and Enh II), which are binding sites for several cellular transcription factors @gs. I & 3)- A single polyadenylation signal, located in the region spanning nucleotides 19 16 to 192 1, specifies the 3 ends of all viral RNAs. This gives rise to four classes of RNA tmscripts, ranghg in size fkom 900 to 3500 nucleotides. The smallest mRNA encodes the X protein. Transcripts initiated at the preS2 promoter encode both the smali and medium surface proteins, whiIe those initiated at the preS 1 promoter encode the large surface protein. Finally, transcnpts initiated at the core promoter have a dual role. They can be mRN& for the e, c, and p proteins, and c m also serve as pregenornic RNAs @gRNA), an intermediate in the synthesis of progeny HE3V genomic DNA (Fig. 3). This 3 5 kb f d y of transcripts is exceptional in that they extend more than once around the circuIar DNA genome. The core promoter is upstrearn of the polyadenylation signal, but RN& initiated at that promoter are not cleaved on first passage of the polyadenylation signal, which lies very close to the promoter. This may be due in part to the sequence of the polyadenylation signal, TATAAA, different fiom the consensus AATAAA found in rnost genes in vertebrate cells.

The roles of the HBV proteins X protein. The smallest open reading h e encodes the 1 %-amino acid x protein.

Although the fùnction of HBx has remained elusive, it has been implicated in the development of hepatocellular carinorna (liver cancer). HBx is not found in mature vinons or nucleocapsids, but it stimulates viral gene transcription during the early phases of infection, It was origindy called the ccpromiscuous transactivator" since it increases the synthesis of many Wal and cellular gene products. However, the bdk of HBx has recently been shown to reside in the cytoplasm, and its major fiuiction may be to regulate signal transduction pathways. HBx has been reported to upregulate c-src kinase, ras/ra£/MAP kinase, stress kinase (SAPK), protein kinase C, the JAKISTAT pathway (see chapter 33), and the transcription factor NF-KB, and to interact with and sequester the tumor suppressor protein p53. It has recently been shown to inhibit apoptosis mediated by either fas or p53. Several laboratories have generated transgenic rnice that synthesize HBx under control of its viral promoter. These researchers observeci that the transgenic rnice were predisposed to developing liver tumors within a year of their birth.

Surface proteins. Three dserent in-fiame start codons are utilized within the S open reading fiame. As a result, d three d a c e proteins contah a common S domain in their C- terminal portion (Fig. l). These proteins are involved in HBV envelope formation, as well as the

formation of non-infectious particles found in serum. The small hepatitis B surface protein (SHBs) is the smallest, most abundant d a c e protein produced- Histoncally, it is also known as the Australia antigen. SHBs comprises four a-helical hydrophobic regions. It contains 14 cross- rinked cysteine residues, providing for high stability, and it can be glycosylated at Asn-146. Both glycosylated and non-glycosylated foxms of SHBs can be resolved by gel electrophoresis of p d e d virus particles. SHBs has at least two transmembrane regions. Pnor to DNA sequence anaiysis, daerent strains of HBV were classified based upon the antigenic epitopes contained within SHBs,

The second most abundant membrane protein produced is the middle hepatitis B surface protein (MHBs). The Ml3Bs protein contains an additional 55 N-terminal amino acids encoded by the preS2 domain (Fig. 1). These additional amino acids are primarily hydrophilic and are believed to reside on the extraceMar face of HBV particles. The preS2 domain also contains a glycosylation site at Asn-4 that is always glycosylated in the MHBs protein. However, vimses that lack the ability to express ME-IBs still retain their ~ ~ v i ~

The largest and least abundant envelope protein is the large hepatitis B surface protein (LHBs). It contains, besides the preS2 and S domains, an additional 119 N-terminal amino acids in the preS 1 domain. The sequence of preS 1 varies arnong dzerent strains and it is likely involved in host cell attachment. The preS 1 domain does not contah any additional glyw sylation sites, but it is myristylated at its N-terminus, a modification that serves to anchor the N-terminus in the membrane. Myristylation may also help LHBs fold properly at the membrane surface. Monoclonal antibodies directed against the preS 1 region block attachment of HBV to HepG2 liver cells, substantiating the idea that LHBs plays an important role in attachment. In addition, a variety of proteins, including interleukin-6 and amexin V, have been reported to interact with the preS 1 region of LHBs. However, the attachment and en- steps of HBV remain poorly characterized and the devance of these viral-host protein interactions is sti l l under scrutiny.

Core and e proteins. The C open reading fiame encodes two sequence-related, yet fùnctionally distinct proteins: the hepatitis B core protein (HBc) and the hepatitis B e protein e ) The 185-amino acid core protein is the major component of the nucleocapsid, which packages the HBV genome in the mature virion. It contains five a-heiices and a C-terminal region that consists of four arginine clusters involved in nucleotide and pgRNA binding. Core proteins readily form dimers, and interactions between dimer pairs produce the icosahedral structure of the nucleocapsid. The HBe protein has a very dflerent fate and tùnction. The e antigen was named for its ccearly'7 appearance in s e m during an acute HBV infection The preC region (Fig, 1) encodes a hydrophobic transmembrane domain that directs the HBe protein to the endoplasmic reticulum, where a signal sequence is removed by proteolytic cleavage. The distinct location for HBe alters its folding and antigenicity when compared to the nearly identical HBc protein. Among other ciifferences, the basic C-terminal region is removed by cleavage £kom HBe. A function for HBe has not been established. One theory is that high levels of HBe may suppress the host immune system and prevent it fiom eliminating cells that contain HBV. In support of this hypothesis, woodchuck hepatitis virus variants that lack HBe are incapable of establishing persistent viral infections.

Polymerase protein. The largest open reading fiame in the genome encodes the hepatitis B DNA polymerase protein @p)- This 90 kD protein fiinctions as an RNA/DNA-dependent

DNA polymerase (reverse transcriptase). The polymerase plays a critical role in HBV genome replication and pgRNA encapsidation. HBp has four characteristic domains: an N-teminal domain for priming minus strand DNA synthesis; a spacer dom* an RNADNA dependent DNA polymerase domain, which occupies roughly 40% of the protein; and an RNase H domain. The RNAse H domain degrades the RNA pregenome during the process of genome replication.

HBV genome replication occurs via reverse transcription of a pregenome RNA intermediate

The pregenome RNA (pgRNA), in addition to serving as mRNA for several proteins, is used as a template to produce the DNA genorne of HBV, This occurs in a ccpackaged" RNA- protein complex including both the HBp and Ht3c proteuis. The viral replication machinery targets the pgRNA for packaging by recognition of a region known as the epsilon (E) stem-loop (Figs. I and 2). Only pgRNAs have a copy of the E stem-loop near their 5' ends; it appears that only the 5' E stem-loop is finctiond, because ali HBV transcripts have a copy at their 3' ends, just upstream of the polyadenylation site. Secondary sequence analysis of the E region predicts a series of inverted repeats that fold into a three-dimensional stem-loop structure. This secondary structure is conserved arnong all hepadnaWuses despite many Werences in the primary sequence. The polymerase protein is believed to recognize and interact directly with the E stem- bop, initiahg both encapsidation and reverse transcription of the pgRNA The C-tenninus of HBp interacts with the core protein to begin encapsidation only when HBp is bound to the E

stem-loop. Initiation of the reverse transcription process also begins when HBp binds to the &-stem

loop. Retrovirus reverse transcriptases use a cellular tRNA bound to their genomic RNA as a primer to initiate synthesis of a DNA copy (chapter 27). HBV, in contrast, initiates DNA synthesis on the pgRNA tempIate by covalently linking the first nucleotide of the DNA chain to the hydroxyl group of a tyrosine residue in HBp. This has sirnilarities to the mechanism by which adenoviruses initiate replication of their hear, double-stranded DNA genomes (see chapter xx), except in this case the DNA polymerase also plays the role of the tenninal protein. The HBp protein remains linked to DNA throughout the process so presumably the active site exiends the 3' end of the growing DNA molecule, while the 5' end remauis attached to another part of the same molecule of HBp, forming a circular complex @ig. 4). Reverse transcription progresses for only a few base pairs beyond the 5' E stem-loop, after which the enzyme and the newly synthesized DNA are translocated onto an identicai sequence in the direct repeat region 1 @RI) near the 3' end of the pgRNA (Fig. 4). This step is reminiscent of the tramfer of the retrovirus "cmhus strong mop" DNA to the repeat region at the 3' end of the retrovirus genomic RNA.

The p protein then makes a complete copy of the remainder of the p@NA by extending the DNA chah to its capped 5' end. As reverse transcription proceeds, the pgRNA template is degraded by the RNAse H activity of HBp. An RNAse H-resistant RNA fragment consisting of the capped 5' end of the pgRNA, including the DR1 region, serves as a primer for subsequent HBp-directed synthesis of plus-strand DNA This fragment is translocated to the DR2 region near the 5' end of the newly synthesized minus strand DNA, where it is used as an RNA primer to make a short DNA copy of that end of the minus strand. This nascent DNA chah then jumps to the 3'end of the minus strand DNA, and the polymerase proceeds to make a copy of the minus

strand. The newly synthesized plus-strand DNA remains hydrogen-bonded to the minus strand, fonning a doublasaandecl DNA. However, plus-strand DNA synthesis is usually not completed by the t h e the virion is released from the host cell, and stalls when the dNTP pools within the virion are exhausted. This explains the regions of single stranded DNA that are found within the genomes of purifieci virions.

HBV Particles are formed by budding in the endoplasmic reticulum and are transported via the Golgi membranes to the ce11 surface

Larger quantities of the small and medium surfàce proteins are produced than the Iarge surface protein, a reflection of the reIative abundance of the two surface protein mRNAs, These proteins are inserted into the endoplasmic reticulum as they are translated (Fig. 5). Through the interaction of their transmembrane regions, HBs proteins aggregate in specific regions of Golgi membranes by a process that excludes host membrane proteins. Regions rich in surface proteins bud into the lumen of the endoplasmic reticulum to produce the secreted 22 nrn spheres and flaments (Fig. 5). LHBs protein is not present in Iarge amounts within these non-infectious particies since its colocaIization with SHBs and MHBs favors the retention of surface proteins within the endoplasmic reticulum. The assembled nucleocapsid is thought to associate with areas of the Golgi rich in these surface proteins. LHBs is believed to interact with the core protein at the cytoplasrnic face of the Golgi, pulling the nucleocapsid into a vesicle that forms a 42 nm enveloped particle within the lumen of the Golgi membrane (Fig 5). This mature virion is then secret ed by the cell, through a process of exocytosis, into the extraceilular environment.

Epidemiology and Pathogenesis

Hepatitis B infections are spread globally throughout the human population. Transxnission is primarily through blood or sexuai contact. In countries where the hepatitis B vaccine is available, HBV still remains a problem for certain occupational groups such as morticians, doctors, dentists, dialysis workers, hemophiliacs, mental care facility workers, tattoo-parlor workers, firefighters, police officers, daycare workers and barbers. Other risky activities inciude intravenous drug use and unprotected intercourse with multiple partners. HBV c m dso be passed on to babies through the neonatal route. In spite of the availability of a vaccine, millions of individuals dl are chronically înfected with the virus.

HBV does not immediately kill idected ceils but instead leads to chronic persistent Sections. It appears that the majority of tissue damage in the host is the result of a host immune response directed against the Section. D d g the early stages, HBV infection usudy r e d t s in the development of jaundice, flu-WIe symptoms, and s e m sickness. Fortunately, about 90% of infecteci adults resolve their uifection within six months. About one percent of those infected suffer fiom a severe disease known as fûlminant hepatitis, which results in massive levels of hepatocytotoxicity and death. The remaining 9% of infected individuals become chronic carriers, almost half of whom may eventually develop iiver cancer. Other chronicalty infected individuals progress to cirrhosis, which is characterized by fibrin deposition in the liver, the production of ascites fluid, infiltration of lymphocytes, flu-like symptoms, hepatoencephalopathy, and hemorrhaging. Infected children have different disease outcornes; only about 50% manage to

clear the vims and 40% become chronic carriers, perhaps due to the underdeveloped state of a child's immune system

Treatment and Prevention There are presently no dmgs or treatments that ensure clearance of HBV fkom idiected

individuals However, there are several ways to rninirnize the likelihood of contracting the virus- Care when handling potentially contarninated surfaces, nuids, and sharp objects will rninimize accidental exposure. In 1986, Vdenzuela and Rutter of Chiron Corporation produced the first recombinant hepatitis £3 vaccine in yeast, and this is the basis of the vaccines still used today. The three yeast-derived vaccines licensed in most countries are Engerix-B (SmithKlineBeecham, Philadelphia, PA), Recombivax Hl3 (Merck & Co-, West Point, PA), and Comvax (Merck & Co., Westpoint, PA). In a new approach, Amtzen of the Boyce Thompson Institute at ComeU University is currently testing edible HJ3V vaccines engineered into bananas! Another method of HBV prevention is through post-exposure immunoprophylaxis, used prirnarily on newboms of mothers who are carriers of HBV- Anti-hepatitïs B immunoglobulins are injected into the exposed individual to neutralize circulating virus and prevent it fiom entering the target cell.

Currently, only two antiviral drugs are effectively used to treat chronic carriers- The fkst is interferon alpha, which is an immune system modulator that works by stimulating cytokine synthesis and viral RNA degradation enhance host antiviral response (see chapter 33). The second is lamivudine ( 3 T Q a nucleoside analogue that was originaliy developed by BiochemPhanna/Glaxo-Wellcome for the treatment of HIV (see chapter 34). BiochemPharma and Tyrrell recently showed that 3TC interferes with the polyrnerase activity of the HBp protein. Both of these treatments can reduce the Wal load. However, this reduction is often only temporary and virus titers can begin to increase f i e r prolonged therapy. The dmgs also have some secondary effects, such as nausea and fever, which make treatment uncornfortable. Clearly there is a need for the further development of antiviral therapies.

As promising as the above treatments are for HBV infected individuals, there still is no cure. HBV remains a worldwide problem- However, Our understanding of the virus, its replication mechanisms, and how it affects ceilular machinery will guide us in our quest to control and eventually elimùiate the problems arising f?om HBV infection. More effective vaccines and antiviral agents are being developed by a number of phannaceutical companies.

Gee Whiz box

Did you know:

- you shouid never use someone else's toothbnish? It might transmit HBV to you!

- the fhst HBV vaccine (Heptavax) was prepared fiom the blood of paid carriers?

- HBV c m linger on dryhg surfaces Like door handles for over a week and still remain infectious?

- most people who are acutely infected with HBV do not even realize they have it?

- the HBV vaccine is only effective in about 80-90% of those who are vaccinateci with the three

injection regimen?

- two billion people worldwide have been exposed to HBV?

- some laboratories have been working on generating an edible HBV vaccine by expressing HBs

proteins in potatoes, carrots, and bananas?

References

Ganem, D. (1996). Hepadnaviridae and their replication. In B.N. Fields, D.M. Knipe, P.M.

Howley (eds.) Field YiroZogygy Lippincott-Raven, Philadelphia, Vo1.2, pp. 68 8 1 -68 86.

Gerlich, W.H. (1 995). Hepatitis B V i s . Intervirology. Volume 3 8 (1-4). Pp. 1 - 1 54. Karger

Press, Zurich (collection of reviews)-

Koshy, R and Caselmann, W.H. (1998). Hepatitis B virus: molecular mechanisms in disease

and novel strategies for therapy. Impencal College Press, River, Edge, New Jersey.

Nassal, M. (1999). Hepatitis B virus Replication: Novel roles for Wus-host interactions-

Intervirology 42:2-3 : 1 17- 2 26 (special section).

Tiollais, P. and Buendia, M.-A (1991). Hepatitis B Virus. ScientSc American 264: 116-123.

2 o u . h ~ F. and Trepo, C. (1999). New antiviral agents for the therapy of chronic hepatitis B

virus i n f i o n . Intervblogy 42:2-3: 125-144 (special section).

Figure legends

Fig.1. Coding and signalhg regions on the hepatitis B gemme. The four open readuig

fiames (C, P, S and X) are shown as arrowed circular lines. See text for detds.

Fig. 2. Repair of EIBV genomic DNA to a covalently-closed, circular DNA. The 5' ends of

genomic DNA are joined by short cornplernentary regions, and are attached tu P protein (minus

strand) and a short, capped RNA (plus strand). The plus strand is incomplete. Step I: DNA

polymerase extends the plus strand. Step 2: nucleases remove the 5' ends of both strands. Step 3:

DNA ligase jouis the 3' and 5' ends of each strand.

Fig. 3. Transcription of HBV DNA. Circular DNA is transcribed by host RNA polymerase II,

which recognizes four promoters (C, S 1, S2 and X) to generate four classes of capped,

polyadenylated mRNAs. Translation products are noted above each RNA The largest RNA also

serves as a pregenome RNA,

Fig. 4. Reverse transcription of pgRNA to form HBV genome DNA. Boxes labeled 1 and 2

represent DR1 and DR2 sequence elements. Colored cïrcle represents reverse transcriptase (HBp

protein). 3' ends of growing DNA chahs are shown as arrows; at tachent of the 5' end of minus

strand DNA to HBp is shown by a dot.- RNA degraded by RNAse H is shown as dashed he.

See text for other detaiIs.

Fig. 5. The life cycle of hepatitis B virus. See text for details.

1) DNA

m . . .

: 2) nuclease

3) DNA ligase

4. . . . m m .

Fig. 2. Repair of HBV genom ic DNA to a covalentiy-closed, circular DNA. The 5' ends of genomic DNA are joined by shoa complementary regions, and are attached to P protein (minus strand) and a short, capped RNA @lus strand). The plus strand is incomplete. Step 1 : DNA polymerase extends the plus strand. Step 2: nucleases remove the 5' ends of both strands. Step 3: DNA ligase joins the 3' and 5' ends of each strand.

1 RNA pol

Poly A Tai1

Fig. 3. Transcription of HBV DNA. Circular DNA is transcribed by host RNA polyrnerase II, which recognizes four promoters (C, S 1, S2 and X) to generate four classes of capped, polyadenylated mRNAs. Translation products are noted above each RNA. The largest RNA also serves as a pregenome RNA.

Polymerase attachment ont0 Epsilon-Stem Loop

s'Cap+ DIU

Initiation of FU' actMtty

-ID= 1

Elongation of minus-sense DNA and RNA template degradation

Note: 5' end of newiy synthesked DNA is covaiently attached to the poiymerase protein

RNA oligomer left at 5' end of template Base pairs added to 3' end

5' [DE 1 Note: RNA oligomer ends up

translocated onto DRZ and r acts as primer for plus

DNA strand synthesis

Note: Plus DNA stmnd synthesis continues to 5' end of minus strand temphte

Fig. 4. Reverse transcription of pgRNA to form EBV genome DNA. Boxes labeled 1 and 2 represent DR1 and DR2 sequence elements. Colored circle represents reverse transcriptase @ B p protein). 3' ends of growing DNA chains are shown as arrows; attachment of the 5' end of minus strand DNA to HBp is shown by a dot.. RNA degraded by RNAse H is shown as dashed line. See text for other details.