degree - university of toronto t-space · macrolides are the most commonly used antibiotics for...
TRANSCRIPT
![Page 1: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/1.jpg)
PREVALENCE AND CHARACTERIZATION OF THE MECHANISMS OF MACROLIDE, LINCOSAMIDE, AND STREPTOGRAMIN RESISTANCE
AMONG ISOLATES OF STREPTOCOCCUS PNEUMONIAE AND VlRlDANS STREPTOCOCCI
Nicole 3. Johnston
A thesis submitted in conformity with the requirements for the degree of Master of Science
Graduate Department of Medical Genetics and Microbiology University of Toronto
1999
@Copyright by Nicole J. Johnston 1999
![Page 2: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/2.jpg)
National Library of Canada
Bibliothèque nationale du Canada
Acquisitions and Acquisitions et Bibliographie Services services bibliographiques 395 Wellington Street 395, rue Wellington ûîtawaON K I A O W Ottawa ON K1 A ON4 Canada Canada
The author has granted a non- exclusive licence allowing the National Library of Canada to reproduce, loan, distribute or sel1 copies of this thesis in microform, paper or electronic formats.
L'auteur a accordé une licence non exclusive permettant à la Bibliothèque nationale du Canada de reproduire, prêter, distribuer ou vendre des copies de cette thèse sous la fome de microfiche/film, de reproduction sur papier ou sur format électronique.
The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protege cette thèse. thesis nor substantial extracts fiorn it Ni la thèse ni des extraits substantiels may be p ~ t e d or othewise de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son permission. autorisation.
![Page 3: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/3.jpg)
ABST RACT
Background: With the emergence of peniciltin resistence in Strepfococcus
pneumoniae, there has been an associated increase in resistance to the
macrolide (M), lincosamide (L), and streptogramin B (SB) antimicrobials.
Previously, ribosomal modification due to an emB-encoded methylase was the
only known mechanism of MLS, resistance in pneumococci, resulting in cross-
resistance to al1 three classes. Recently. however, a macrolide-specific active
efflux mechanism, encoded by the mef gene, has been reported.
Objectives: Using a large collection of S. pneumoniae isolates from across
Canada, we determined the prevalence of these mechanisms, and how they may
be best detected in the clinical laboratory.
Methods: Of 5029 isolates tested, 147 (2.9%) were found to be erythromycin
resistant and 64 (1.3%) clindamycin resistant by broth microdilution. Alf
erythromycin resistant isolates were screened for MLS resistance mechanisms
by disk susceptibility testing and by PCR, using primers specific for the
ennA-,B-,C-, and mef genes.
Results: Our results demonstrated that 81 (55.1 %) strains possessed the efflux
mechanism based on the presence of the mef gene. Of these, 76 possessed an
M phenotype by disk diffusion, whereas fve demonstrated an MS, phenotype.
Target modification accounted for 57 (38.8%) strains based on the presence of
an e m gene. Fifty-six of these isolates demonstrated an MLS, phenotype and
one isolate an ML phenotype by disk diffusion. Nine isolates (6.1 %) possessed
unusual patterns of resistance to MLS, antibiotics, in addition to lacking both
![Page 4: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/4.jpg)
mef and e n genes. suggesting the presence of novel mechanisrns of resistance
which have not yet been identified.
Nine viridans streptococci were also selected on the basis of MLS,
resistance and negative PCR results for ennA, 8, C, and met Susceptibility
testing demonstrated that al1 possessed an MLS, phenotype. Five of these were
found to be resistant to synercid . One isolate was found to possess the recently
described emTR gene from Group A streptococci. which is the Cnt time this
gene has been identified in any other species.
Conclusions: In this study of erythromycin resistant pneurococci, the
prevalence of known MLS resistance mechanisms was detemined. In S.
pneumoniae, active effiux is the predominant mechanism of MLS resistance,
characterized by resistance to macrolides and susceptibility to lincosamides and
type B streptogramins. Previously, target modification, characterized by cross-
resistance to macrolides, lincosamides, and type 6 streptograrnins, was believed
to be the only mechanism of MLS resistance in S. pneumoniae. Additionally, the
finding of unusual resistance phenotypes in both pneumowcci and viridans
streptococci suggests the presence of potentially novel mechanisms of
resistance.
![Page 5: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/5.jpg)
TABLE OF CONTENTS
1 .O) Introduction ......................................................................................... 1 1 . 1 ) Macroiide. Lincosamide. and Streptogramin (MLS) Antimicrobials ....... 2 1.1 . 1) Spectnirn of Activity ........................................................................... 2 1.1.2) Structure and Mode of Action of the MLS Antimicrobials ................... 3 1.2) Acquired Mechanisrns of Resistance .................................................... 4 1.2.1 ) Ribosomal Target Modification - The MLS, Resistance Phenotype ... 4 1.2.2) Active Efflux of MLS Antimicrobials .................................................... 11
........................................................................... 1.2.3) Enzyme Inactivation 19 2.0) Objectives ............................................................................................ 25 3.0) Y aterials and Methods ........................................................................ 26 3.1 ) Isolates .................................................................................................. 26 3.1 . 1) Group Identification of Viridans Streptococcal lsolates ...................... 27 3.2) Susceptibility Testing ............................................................................ 27 3.2.1) Broth Microdilution ............................................................................. 27 3.2.2) Disk Susceptibility Testing ................................................................. -28 3.3) DNA Isolation ........................................................................................ 29 3.3.1 ) Genomic DNA Isolation ...................................................................... 29 3.3.2) Plasmid DNA Isolation ........................................................................ 30 3.4) PCR ....................................................................................................... 31 3.4.1) e m A Y -B. 4. and mef PCR ................................................................ 31
....................................................................................... 3.4.2) ermTR PCR 31 3.4.3) vet&atWvatC/satA PCR .................................................................... -33 3.4.4) vgb ?CR ............................................................................................. 33 3.5) Pulsed Field Gel Electrophoresis .......................................................... 34
.................................................................................. 3.6) Southern Blotting -34 3.6.1 ) Sandwich Method .................................... .... ....................................... 34 3.6.2) Dot Blot Method ................................................................................ -35 3.7) Probing for ermA. -B. -C. and mef genes .............................................. 35 4.0) Results ................................................................................................ -35 4.1) Group Identification of Viridans Streptococcal lsolates ......................... 35 4.2) Susceptibility Data - Broth Microdilution and Disk Susceptibility
Testing .................................................................................................. -36 4.3) PCR ....................................................................................................... 43 4.3.1 ) emA. -8. -C. and mef PCR ................................................................ 43 4.3.2) emTR PCR ........................................................................................ 47 4.3.3) vatlvatWvatC/satA PC R ..................................................................... 49
............................................................................................ 4.3.4) vgb PCR -49 4.4) Pulsed Field Gel Electrophoresis .......................................................... 50 4.5) Hybridization Resuits Using emA. -B. -C. and mef probes ................... 50 5.0) Discussion .......................................................................................... -58 6.0) Future Studies ..................................................................................... 63 7.0) References .......................................................................................... 67
iii
![Page 6: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/6.jpg)
LIST OF TABLES
Table 1 . Type of MLS resistance and phenotypic patterns of resistance ..... 13
Table 2 . MLS resistance mechanisms among various genera ..................... 14
Table 3 . Primer sequences used in this study for the detection of known MLS resistance mechanisms and sequencing .................... 32
Table 4 . Characterization of 147 erythromycin-resistant S . pneumoniae ............ by broth microdilution. disk susceptibility testing. and PCR 44
![Page 7: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/7.jpg)
LIST OF FIGURES
Figure 1. Structure of the emC mRNA of S. aumus ................................... 8
Figure 2. Susceptibility testing of S. bovis BSV 421 by disk diffusion using erythromycin and clindamycin disks ................................. .38
Figure 3. Susceptibility testing of S. mutans BSV 134 by disk diffusion using erythromycin and clindamycin disks ................................... 39
Figure 4. Susceptibility testing of S. millen BSV 377, harbouring ermTR. by disk diffusion using erythromycin and clindamycin disks ........ .41
Figure 5. Susceptibility testing of S. pyogenes 02C1110, harbouring emTR, by disk diffusion using eiythromycin and clindamycin disks ............................................................................................. 42
Figure 6. Distribution of mef and em genes acwrding to the MIC ............................................................................. of erythromycin 45
Figure 7. PCR analysis demonstrating the presence of emTR in one MLS, resistant isolate of S. milleri ................................................ 48
Figure 8. Pulsed field gel electrophoresis of selected empositive and mef-positive S. pneumoniee ........................................................ .52
Figure 9. Pulsed field gel electrophoresis of novel MLS resistant isolates and selected erythromycin susceptible isolates of
........................................................................... S. pneumoniae -53
Figure 10. Analysis by southem blot of the PFGE gel from figure 8, containing selected ermBpositive and mef-positive pneumococcal isolates. and probed with enn8 amplicon ............ 54
Figure 11. Analysis by southem blot of the PFGE gel from figure 8, containing selected em5gositive and mef-positive pneumococcal isolates, and probed with mef amplicon ............. .55
Figure 12. Analysis by southern blot of the PFGE gel from figure 9, wntaining selected em54mef-negative novel isolates and selected erythromycin susceptible isolates. and probed with mef amplicon. ....................................................................... 56
![Page 8: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/8.jpg)
Figure 1 3. Analysis by southem blot of the PFGE gel from figure 8, containing selected em8Jmef-negative novel isolates and selected erythromycin susceptible isolates. and probed with enn8 amplicon ....... .... . . . . . ....... ..... . . ... . . . . .. . .... .. . . . .. . . . . . ... .. .. . ... . -57
![Page 9: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/9.jpg)
1 .O) INTRODUCTION
The macrolide. lincosamide, and streptogramin (MLS) antimicrobials are
chernically distinct, yet functionally related antibiotics which inhibit pmtein
synthesis by binding to 23s rRNA in the 50s subunit of the ribosome
(Femandez-Munoz et al.. 1971). The modifications which result in acquired
resistance to these three classes of antimicrobials include (i) target site
modification, (ii) altered antirnicrobial transport, and (iii) enzymatic inactivation
(Weisblum 1995).
Macrolides are the most commonly used antibiotics for community
acquired pneumonia, and are an important alternative for the treatment of Gram-
positive infections in patients allergic to penicillin. The lincosamide class,
principally clindamycin, has a spectrum of activity similar to the macrolides, but is
particulariy valuable for the treatment of otitis media and osteomyelitis (Mims et
al., 1993). The streptogramins, which have been available in Europe for the past
few decades, are used as mainly as antistaphyiococcal agents (Allignet et al.,
1 998). Synercid (dalfapristin-quinuprisün) is a new injectable streptogramin that
has just recently been approved in North America for the treatment of multi-drug
resistant infections caused by such organisms as methicillin resistant
Staphyiococcus aureus (MRSA), vancomycin resistant Entemcoccus (VRE), and
penicillin resistant Streptococcus pneumoniae (PRSP).
The development of resistance to the macrolides in S. pneumoniae,
Group A streptococci, and the viridans streptococci is problematic. as the
development of therapeutic alternatives has not kept up with the development of
![Page 10: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/10.jpg)
resistance in these organisms. Detemination of the prevalence of MLS
resistance, and the identification of both known and potentially novel resistance
mechanisms, is necessary to study the epiderniology of MLS resistance in
Canada. Presently, the antibiotics used in routine testing by clinical laboratories,
as recommended by the National Cornmittee for Clinical Laboratory Standards
(NCCLS, 1997). does not include lincosamides, as macrolide resistance has
been shown to result in cross-resistance to the lincosamides (Quintilliani, Jr. and
Courvalin, 1 995). However, the discovery of a macrolide-specific efflux
mechanism in streptococci may affect these recommendations, as these isolates
are susceptible to lincosamides. Thus, clindamycin therapy may prove valuable
for the treatment of infections caused by a subset of macrolide resistant
organisms.
1 .l) MACROLIDE, LINCOSAMIDE, AND STREPTOGRAMIN (MLS)
ANTIMICROBIALS
1 .l .l) Spectrum of Activity
The MLS classes of antibiotics have a relatively broad spectrum of activity
which includes Gram-positive cocci (staphylococci, streptococci, and
enterococci), Gram-negative cocci, anaerobes, and bacilli. Additionally, these
antibiotics have favourable activity against Haemophilus, Legionella, Chlamydia,
and Campylobacfer. Gram-negative bacilli are generally inherently resistant as a
result of imperrneability of the cell wall to these antibiotics (Leclercq and
Courvalin, 1991 ).
![Page 11: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/11.jpg)
1.1.2) Structure and Mode of Action of the MLS Antimicrobials
A) Macrolides
Macrolides are comprised of a 14-, 15-, or 16-membered lactone ring
structure with a minimum of two amino andlor neutral sugars (Leclercq and
Couwalin, 1991). After binding to 23s rRNA, macrolides inhibit protein synthesis
by blocking the translocation step, thereby preventing the release of tRNA
following peptide bond formation (Mims et al.. 1993). This class consists of the
1Cmembered macrolides eryairomycin, oleandornycin, and clarithromycin; the
1 Smembered macrolides azithromycin or 4"-epiazithromycin; and the 1 6-
membered macrolides spiramycin, josamycin, tylosin, and rosaramicin
(Andremont et al.. 1986). The three respective classes differ in their
pharrnacokinetic properties as well as in their responses to bacterial resistance
(Leclercq and Courvalin, 1 991 ).
B) Lincosamides
The lincosamides are compounds which do not possess a lactone ring
and are alkyl derivatives of proline (Leclercq and Courvalin, 1991). After binding
to the 50s ribosomal subunit, the lincosamides inhibit protein synthesis by
inhibiting peptide bond formation, though the precise mechanism is not well
understood (Mims et al., 1993; Weisblum 1 995). The most commonly known
lincosamides include celesticetin, lincomycin, and clindamycin, although the
latter is what is most widely used clinically.
C) Streptogramins
![Page 12: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/12.jpg)
The streptogramins are a unique class of antibiotics in that they consist of
two components, type A and type 6, which when combined exert a synergistic
inhibitory effect on sensitive cells. The type A compounds are polyunsaturated
cyclic peptolides, whereas type B cornpounds are cyclic hexadepsipeptides.
Type A and B streptogramins inhibit protein synthesis by blocking peptide bond
formation through the inhibition of substrate attachment to the A and P sites,
thereby inhibiting peptide chain elongation. Synergistic inhibition arises from
conformational changes on the peptidyltransferase center by type A
components, which in tum increases ribosomal affinity for type 6 streptogramins.
The synergistic effect inhibits both the early and late stages of protein synthesis
(Cocito, 1979). Type A compounds indude dalfopristin (RP54476) (streptogramin
A), virginiamycin M 1 , pristinamycins II (1 IA, l l B), ostreogrycins (A, G), vemamycin
A, and mikamycin A. Compounds of the type B class include: quinupristin
(RP57669) (streptogramin B), virginiamycins S (SI, S2, S3, S4), pristinarnycins I
(IA, IB, IC), ostreogrycins B (81, 82, B3), vemamycins (Ba, BP, By, Ba), and
mikamycin IA (Cocito ,1979, Cocito et al., 1997).
1.2) ACQUIRED Y ECHANISMS OF RESISTANCE
A summary of the various MLS resistance phenotypes is shown in
Table 1. The known MLS resistance genes and corresponding mechanisms are
summarized in Table 2.
1.2.1) Ribosomal Target Modification - The MLS, Resistance Phenotype
Cross-resistance to al1 three classes occurs as a result of a
methyltransferase (rnethylase) which is encoded for by a class of genes,
![Page 13: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/13.jpg)
designated em for erythromycin resistance methylase. S-adenosylmethionine is
used as the methyl donor to modify an adenine residue in 23s rRNA to form
either N ornono- or dimethyladenine (Weisblum 1995). The MLS antibiotics
interact competitively when binding to the 505 subunit. with only one molecule
being able to bind per 50s subunit, suggesting that the binding sites either
overiap or functionally interact (Fernandez-Munoz et al., 1 971 ). It is believed
that rRNA methylation effects a conformational change within the ribosome
which results in cross-resistance to macrolides, lincosamides. and type B
streptogramins. The type A streptogramins are unaffected and, as a result.
synergy between the A and B components against MLS,-resistant organisms is
maintained (Leclercq and Courvalin, 1991).
Footprinting experiments, which utilize antibiotic probes to localize dnig
binding sites, have enabled identification of the precise site of rnethylation at
position A2058 of 23s RNA domain V in Eschenchia coli containing emC. The
nucteotides within this highly conserved peptidyltransferase region are protected
by bound MLS antibiotics when treated with dimethyl sulfate (DMS) and
kethoxal, agents which derivatize purines and pyrimidines in single-stranded
DNA or RNA. Methylation of this region has also been identified in S. aureus
strains possessing emA, em6, and emC genes. as well as in Bacillus
stearothemophilus strains possessing the meth ylase of the erythromycin-
producer Streptomyces erythreus (Skinner et al., 1983; Thakker-Varia et al.,
1985).
A) Constitutive or Inducible Expression of MLS, Resistance
![Page 14: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/14.jpg)
Expression of MLS, resistance may be either constitutive or inducible
(Weisblum 1995). In staphylococci, constitutive and inducible resistance can be
distinguished by disk susceptibility testing. When expression is constitutive,
resistance is obsewed for al1 macrolides, lincosamides. and type 6
streptogramins. Type A streptogramins and the synergistic compounds are
unaffected. With inducible expression, however, resistance is observed for 14-
and 15-membered macrolides only. The 16-membered macrolides, the
lincosamides. and the type B streptogramins remain active, but resistance to
these antibiotics can be induced when in the presence of a 14- or 15-mernbered
macrolide. Phenotypically. inducible expression can be detected by the
presence of a D-shaped zone of inhibition around 16-membered macrolides,
lincosamides, and type B streptogramins when placed in the proximity of a disk
impregnated with a 14- or 1 5-membered macrolide. In streptococci, however,
constitutive and inducible expression are not always discemible by disk
susceptibility testing because al1 macrolides, lincosamides, and type B
streptogramins can act as inducers to varying degrees. This explains the variety
of resistance phenotypes observed by disk susceptibility testing. In some
streptococcal isolates, inducible resistance can be characterized by cross-
resistance to al1 three classes (Quintilliani Jr., and Courvalin, 1995).
A) Regulation of MLS, Resistance: Translational Attenuation
The regulation of MLS, resistance can be explained by a mechanism
termed translational attenuation (Horinouchi and Weisblum, 1980). In the
presence of erythromycin, conformational transitions in a region of the mRNA
![Page 15: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/15.jpg)
upstream of the ermC methylase gene activate previously inactive mRNA,
resulting in translation of the methylase gene. Inducible expression is not
dependent upon the class of e m gene but is instead determined by the
sequence of a regulatory region, referred to as a control peptide, leader peptide,
or leader sequence, located upstream of the methylase gene (Figure 1). The
regulatory region adjacent to the ennC gene in staphylococci has been
characterized and found to enwde a 1Camino acid control peptide. Both genes
are CO-transcribed in a single mRNA characterized by four inverted repeats that
form two stem-loop structures in the absence of erythromycin. In this inactive
conformation, both the ribosomal binding site and initiation codon for the
methylase gene are sequestered, preventing translation of the methylase. Thus,
only the region corresponding to the control peptide is able to be translated.
When present, erythromycin binds to the ribosomes involved in the synthesis of
the control peptide. causing them to stall. Ribosomal stalling is believed to
induce conformational rearrangement of the mRNA, resulting in the dissociation
of segments 1 + 2 and 3 + 4. and the consequent association of segments 2 + 3,
thereby freeing the flbosomal binding site (Shine-Dalgamo-2; SD2) for the
methylase. Once free, SD2 can then be recognized by the ribosomes, enabling
translation of the methylase and the subsequent modification of other ribosomes,
rendering them resistant to MLS, antibiotics. A similar model has been proposed
for emA from the staphylococcal transposon Tn554 and ermG of Bacillus
sphaericus (Dubnau, 1984; Leclercq and Couwalin, 1991; Mayford and
Weisblum, 1985). Constitutive expression anses from any point mutations or
![Page 16: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/16.jpg)
deletions within the stemloop regions that result in the association of segments
2 + 3, and subsequently enable translation of the methylase (Mayford and
Weisblum 1985).
Figure 1: Structure of the ennC mRNA of S. aumus.
Control Peptide
5' Inactive Conformation
Active Conformation
Figure 1: In the inactive conformation, the mRNA is characterized by two stem-
loop structures which sequester the ribosomal binding site and initiation codon
for the methylase. The active conformation is characterized by unsequestering
of the stem-loop structures, either due to mutations or the presence of
erythromycin, such that the methylase can be translated (modified frorn Leclercq
and Courvalin, 1991 ).
![Page 17: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/17.jpg)
C) Origin and Distribution of enn Genes
Approximately 30 enn genes have been described in both Gram-positive
and Gram-negative genera, as well as in actinomycetes that produce antibiotics
(Weisblum 1995). The MLS, phenotype, characterized by cross-resistance to
macrolides, lincosamides, and type 6 streptogramins. has subsequently been
detected in Staphylococcus spp. (Thakker-Varia et al., 1985; Lampson and
Parisi, 1 986), Enterococcus spp. (Leclercq and Courvalin, 1 991 ), Streptococcus
spp. (Courvalin et al.. 1972; Dixon and Lipinski, 1974; Gilmore et al., 1982;
Horinouchi et al., 1983) , Bacillus spp. (Monod et al., 1986; Monod et al., 1987),
Bactemides spp. (Salaki et al., 1976, Shoemaker et al., l985), Lactobacillus spp.
(Rinckel and Savage, 1 990; Axelsson et al., 1 988), Corynebacterium diptheriae
(Coyle et al.. 1 979), Clostridium spp. (Wilkens and Thiel, 1973),
Pmpionibactetium spp. (Eady et al., 1989), and in various Entembacteriaceae
(Arthur et al., 1987).
Hybridization studies and sequence cornparisons of the various e m
genes have lead to the distinction of eight e m gene classes which include ermA
and emC (from S. aureus), ennAM (from Streptococcus sanguis), ennF (from
Bacteroides fragilis), ennD (from Bacillus lichenifonnis), emG (from Bacillus
sphaetfcus, as well as emE and ennA'from the erythromycin producers
Streptomyces ewhreus and Adhmbacter spp. respectively (Arthur et al., 1987,
Leclercq and Courvalin, 1991 ). Varying degrees of similarity have been
obsewed among the different e m genes, however, the distribution of e n genes
![Page 18: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/18.jpg)
is generally species specific and approximately 30 variant etm genes have been
identified to date (Leclercq and Courvalin, 1991, Seppala 1998).
D) MLS, Resistance and Streptococci
MLS, resistance is generally associated with self-transferable plasrnids of
various sites harbouring the emAM (ennB) gene. Some e m genes have been
located in the chromosomes of strains not harbouring plasmids and are
transferred on conjugative transposons (Leclercq and Courvalin, 1991 ;
Shoemaker et al., 1985). In streptococci, MLS, resistance plasmids have been
found in al1 species with the exception of S. pneumoniae. However, transfer of
MLS, resistance in the absence of plasmids has been observed in S.
pneumoniae, Streptococcus bovis, as well as in groups A, B, F, and G
streptococci. In S. pneumoniae BM4200, however, the emAM gene was
identified on a 25.3 kb conjugative transposon, Tn1545 (Courvalin and Carlier,
1986). Unlike other transposons, Tn7545 is not flanked by terminal inverted
repeats, it lacks variable base pairs at each end, and it does not duplicate the
target DNA upon insertion. It is self-transferable into other Gram-positive
bacteria and is able to transpose into numerous sites. Recently, a second e m
gene, designated ermTR, has been iden Wied in Streptococcus pyogenes
(Seppala et al., 1998).
Previously, target modification was long believed to be the only
mechanism of MLS, resistance in streptococci. Since then, an active efflux
mechanism has been identified and characterized. Target modification and
![Page 19: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/19.jpg)
eflux have been the only mechanisms identified in streptococci to date (Cooksey
et al., 1989; Leclercq and Couivalin, 1991 ; Poyart-Salmeron et al.. 1991 ).
1.2.2 ) Active Efflux of MLS Antimicrobials
A) Efflux in Staphylococci: The MS Resistance Phenotype
Efflux of both macrolides and streptogramins was first described in
staphylococci and was found to be due to an ATP-binding transport pump with
specficity for 14- and 15-membered macrolides and type B streptogramins, but
not for 16-membered macrolides or the lincosamides. This energydependent
pump maintains intracellular antibiotic concentrations below those required for
binding to ribosomes (Goldman et al., 1990). The resultant MS resistance
phenotype, which conferred inducible resistance to erythromycin and the
streptogramin. pnstinamycin 1, but not to lincamycin. was first reported several
yean ago in multiply-resistant strains of S. aumus isolated in Hungary (Janosi
and Ban, 1982). A similar MS phenotype, charaderized by resistance to
erythromycin and virginiamycin S and susceptibility to clindamycin, was
subsequently reported six years later among clinical isolates of coagulase-
negative staphylococci in the USA (Jenssen et al., 1987). In 1989, this
phenotype was reported in 1 10 human skin isolates of coagulase-negative
staphylococci, obtained in the UK from 1987 to 1988 (Ross et al., 1989).
Susceptibility testing of 16 other antibiotics failed to reveal any other resistance
markers associated with the MS phenotype, although an association with
penicillin resistance was noted but did not occur in al1 cases. Subsequently, Ross
et al. demonstrated the active efflux of erythromycin from cells of S. aureus
![Page 20: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/20.jpg)
RN4220 and deduced the sequence of a 488-amino acid protein (MsrA) which
contained two ATP-binding motifs bearing homolog y to the ATP-binding
transport proteins from Gram-negative bacteria and eukaryotic cells (Ross et al.,
1990). Macrolide-producing organisms such as Streptomyces ambofaciens (a
spiramycin producer). Streptomyces themotoIemns (a carbomycin producer)
and Streptomyces fmdiee (a tylosin producer) have been found to possess emux
deteminants bearing sequence homology to MsrA and other ATP-binding
transport proteins, suggesting that resenroirs for these resistance deterrninants
were present and that horizontal transmission of these genes may occur in
nature (Schoner et al., 1992).
In a distribution study characterizing the incidence of erythromycin efflux
and erythromycin ribosomal methylases in staphylococci, Eady et al. reported
that of 221 strains of clinically significant coagulase-negative staphylococci, 73
(33%) isolates harboured the msrA gene (Eady et al., 1993). The common
isolation of these organisrns from human skin led the authors to propose skin as
the likely reservoir of MS-resistant strains. Previously, msrA had hitherto been
unrecognized in the UK as a significant cause of erythromycin resistance in
medically-important staphylococci. However, the relative prevalence of these
mechanisms was not determined in this study which was biased in favour of the
selection of strains possessing an MS phenotype (Eady et al., 1993).
![Page 21: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/21.jpg)
Table 1. Type of MLS Resistance and phenotypic patterns of resistance.
Mechanism of Phenotype Susœptibility Resistance
1 4- 1 5- 16- Lin SB SA SA+R - . . .. - Mac Mac Mac
Target modification MLS, . ,- R R S R R S S
MLS- R R S S S S S
Efflux MS R R S S R S S
M R R S S S S S
Inactivation hl (~-1 R R S S S S S
hl (G-I R S R S S S S
L S S S R S S S
SA S S S S S R R
SB S S S S R S S
ICMac, 14-mernbered macrolide; 1 5-Mac, 1 Smembered rnacrolide; 1 6-Mac, 16- membered macrolide; Lin, lincosamides; SB, type B streptogramins. SA, type A streptogramins; S,,, synergistic combinations of type A and type B streptogramins. R, resistant; S, susceptible.
![Page 22: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/22.jpg)
Table 2. MLS resistance mechanisms among various genera.
Mechanism Gene Gene proâuct Host
Target enn Modification AB,C
AM (8) AM (B)
TR o, G, J,K
G GT
A, CD, CX ennBP
A
Efflux
ribosornal methylase Staphylococcus Enterococcus Streptococcus
S.pyogenes, S. milleri Bacill us
Ba ctemides Lactobacillus
Covnebacteflum djphthetiae Clostriciium perfnngens
Propionibactetiurn various Enterobacteriaciae
msrA ATP-dependent pump Staphylococcus
meWA ATPdependent pump Streptococcus, Enterococcus
W ATP-dependent pump Staphylococcus vgaB
Enzyme emA erythromycin esterase Inactivation ere B
E. coli E. coli
mphA macrolide phosphotransferase Streptomyces lividans mphB E. coli
mgt rnacrolide glycosyltransferase Streptomyces vendargensis
IinA IinA '
vat satA vatB vatC
lincosamide
streptogramin A
S. haemolyücus S. aureus
Staphylococcus E. faecium
Stap hylococcus Staphy/ococcus
W b streptogramin B hydrolase Staphylococcus vgb6 Staphylococcus
vgb-l i ke E. faecium
![Page 23: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/23.jpg)
Subsequently, Wondrack et al. confirmed the presence of an msrA-like
gene in one strain of S. eureus possessing both an active emux mechanism in
addition to a rnacrolide-specific inactivating enzyme (Wondrack et al., 1996).
Additionally, one strain of Staphylococcus xylosus possessing an erythromycin
resistance deteminant (msrB) 100% homologous to the carboxy-terminal ATP-
binding cassette of MsrA has been described (Milton et al., 1992).
8) Effiux in Staphylococcl: The S Resistance Phenotype
In recent years. two genes have been identified encoding putative ATP-
transporter genes which confer resistance to type A streptogramins (SgA) and
related compounds (pristinamycin IIA, virginiamycin M, mikamycin A, synergistin
A, and dalfopristin) (Allignet and El Solh, 1992. Allignet et al., 1997). The first
gene identified, vga, encodes a 522-amino acid protein, VgA, of 60 kDa which
demonstrates significant homology with the ATP-binding domains of several
proteins.
Two ATP-binding domains are present in VgA which combine the A and B
motifs, and like the MsrA protein, lack the long hydrophobic stretches believed to
represent potential membrane-spanning domains (Allignet and El Solh, 1992). In
contrast with the MsrA protein, however, the two ATP-binding domains of VgA
are not separated by a typical O-linker sequence which are believed to function
in tethering the interacting domains of the proteins (Wootton and Dnimmond,
1989). Efflux studies have not been carried out on the staphylococcal isolates
harbouring this gene. Rather, the determination of effiux as the mechanism of
![Page 24: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/24.jpg)
streptograrnin A resistance in these isolates was based on significant sequence
identity with other known effiux proteins.
Another sta ph ylococcal gene has been recentl y iden tified , vgaB, which
encodes a 552-amino acid protein of approximately 61 kDa and bears the most
homology with the 1572 bp vga gene (58.8% nucleotide identity, 48.3% identical
amino acids, 70.4% similar amino acids). Like VgA, Vga8 also contains two
ATP-bindings domains sharing 38.8% identical and 39.1 % similar amino acids
respectively with the former (Allignet et al., 1997).
C) Efflux in Streptococci: The M Resistance Phenotype
Until recently, the MsrA efflux pump in staphylococci was believed to be
the only known efflux mechanism with specificity for any of the MLS
antimicrobials. Although an energy-dependent mtr effîux system has been
reported in gonococci, similar to the mexABoprK efflux system in Pseudomonas
aemginosa and the acrAB and -EF pumps of E. coli, it is not specific for
macrolides (Hagman et al.. 1 995).
Until recently, active effîux had not been described in streptococci.
However, clinical isolates of Streptococcus pyogenes bearing a novel M
phenotype, characterized by resistance to macrolides with susceptibility to
lincosamides and type B streptogramins, were being reported in Finland
(Seppala et al., 1 993), Australia (Stingemore et al., l989), the United Kingdom,
and North America (Coonan and Kaplan, 1994; Phillips et al., 1990; Sutdiffe et
al., 1996-A). Similady, a study of pneumococcal isolates recovered from the
middle ear and sinuses of children in the United States reported the same M
![Page 25: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/25.jpg)
phenotype (Nelson, 1994). Sutcliffe et al. likewise found this same phenotype in
pneumococcal and Group A streptococcal isolates obtained from France,
Ireland, Sweden. and various part of the United States (Sutcliffe et al., 1996-A).
Evaluation of these isolates revealed the presence of a novel mechanism, not
mediated by target modification and distinct from any known e m genes. Instead,
they reported the finding of an efflux system with specificity for macrolides only
which appeared distinct from the MsrA efflux system responsible for
erythromycin and type B streptogramin resistance in staphylococci (Sutcliffe et
al., 1996-A).
The gene responsible for macrolide effiux in streptococci has
subsequently been cloned and sequenced. The determinant in S. pyogenes
strains with an M phenotype. mefA for macrolide emux, encodes a novel
hydrophobic 44.2-kDa protein with homology at the amino acid level to other
efflux proteins (Clancy et al., 1996; Sutcliffe et al., 1996-6). Since both S.
pyogenes and S. pneumoniae strains with the M phenotype were shown to efflux
erythromycin, it was dernonstrated that S. pneumoniae possessed a mefA-like
gene, designated mefE, which bears 90% homology with mefA. The presence of
mefA in S. pyogenes and mefE in S. pneumoniae confers resistance to 14- and
1 à-membered macrol ides, with susceptibility to 1 6-mem bered macrolides,
lincosamides, and type 6 streptogramins (Tait-Kamradt et al., 1997).
The presence of the mef gene has also been reported in erythromycin-
resistant group B and viridans streptococci bearing an M phenotype and has
been shown to possess the meE gene (Tait-Kamradt et al., 1997). Likewise,
![Page 26: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/26.jpg)
meE has also been reported in a Philadelphia hospital in clinically-signifiant
strains of Enterococcus faecium that are moderately resistant to erythromycin
and susceptible to clindamycin. The mef gene found in E. faecium was found to
be identical to meb (Fraimow and Knob, 1997).
lsolates demonstrating an M phenotype are easily distinguishable from
MLS, resistant isolates by susceptibility testing in the routine laboratory using
erythromycin and clindamycin disks, both alone, and in close proximity to each
other. Inducible MLSB resistance is discemible by the presence of a D-shaped,
or blunted, zone of inhibition surrounding the cfindamycin disk in the presence of
erythromycin. In some streptococci. inducible resistance is characterized by
cross-resistance to al1 three classes. In contrast, erythromycin-resistant isolates
with an M phenotype demonstrate a fully susceptible zone of inhibition
surrounding a clindamycin disk, despite the proximity of an erythromycin disk
(Shortridge et al., 1996).
Like the MS phenotype, the M phenotype is not restricted to a single
geographical location and has also been reported in South Africa (Klugman and
Koornhof, l988), Finland (Kataja et al., 1998) and Canada (Johnston et al.,
1998). Reports of the prevalence of the M phenotype are varied, with rates of
85% (Sutcliffe et al., 1996-A), 42% (Shortridge et al., 1996), and 56% (Johnston
et al., 1998) in three studies involving macrolide-resistant pneumococci, and as
high as 95% in one study looking at the prevalence of mef among group C
streptococci (Seppala et al., 1998). The differences among these prevalence
![Page 27: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/27.jpg)
rates may be influenced by different antibiotic prescribing patterns among
different parts of the wodd.
1.2.3) Enzyme lnactivation
Enzymes which modify antibiotics and thereby render them inactive have
been described for macrolides, lincosamides. as well as both type A and B
streptogramins. Several enzymes and their respective genes have been
identified in both Gram-positive and Gram-negative organisms with specificity
against one particular antimicrobial or class of antimicrobials. In streptomcci,
however, inactivation of any MLS antimicrobials has not been described.
A) Macmlide lnactivation
Evidence of macrolide inactivation was first detected in Streptomyces, and
subsequently, in Pseudomonas aeruginosa and Lactobacillus spp.. however, the
respective enzymes and genes were not investigated (Feldman et al., 1964;
Flickinger et al.. 1 975).
The first report to identify a macrolide-specific enzyme described the
finding of a plasmid-mediated esterase confemng high-level resistance in E. coli
(Barthelemy et al., 1984; Ouinissi et al.. 1985; Andremont et al., 1986). The
macrolide resistance phenotype observed, with susceptibility to lincosamides
and streptogramins, was found to be due to an erythromycin esterase,
designated emA, which hydrolyzes the lactone ring of the antibiotic (Barthelemy
et al., 1984). Strains possessing this gene were found to inactivate the 14-
membered macrolides erythromycin and oleandomycin but none of the other
commercially available macrolide, lincosamide, or streptogramin antibiotics
![Page 28: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/28.jpg)
(Andremont et al., 1986). The emA gene was detected in strains of E. coli,
Klebsiel!a pneumoniae, Entembcter agglomerans, and in one coliforni isola te
(Andremont et al., 1986). indicating its dissemination in nature. Similady,
another erythromycin esterase, designated ereB, was also reported arnong
various Enterobacteriaceae (Arthur et al., 1986; Arthur et al., 1987).
Recently, Wondrack et al. reported a strain of S. eumus with a macrolide-
specific inactivating enzyme which results in an inactivation product identical to
that observed in E. coli strains containing the EreA or EreB esterase (Wondrack
et al., 1996). However, the Gram-positive esterase predominantly hydrolyzes 14-
and 16-membered macrolides, in wntrast with the Gram-negative esterases
which have substrate specificity for 14- and 1 Sniembered macrolides only.
Although inactivation by esterases has been described for various memben of
the family Enterobacteriaceae, this report was the first to describe a macrolide-
specific inactivation deteminant, and more specifically, an esterase in a Gram
positive organism (Wondrack et al., 1996).
In addition to macrolide-specific esterases, both a glycosyltransferase and
phosphotransferase have also been described. Resistance to macrolides was
identified in Sfmpfomyces lividans and Streptomyces vendargensis a result of a
glycosyltransferase, encoded by the mgt gene, that specifically inactivates
macrolides. (Jenkins and Cundliffe, 1991 ; Kuo et al., 1989).
Additionally, both a type I and a type II macrolide 2'-phosphotransferase
have been demonstrated in E. coli with specificity for 14- and 16-membered
macrolides. High-level resistance is demonstrated with 14-membered
![Page 29: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/29.jpg)
macrolides, whereas low-level resistance is observed with the 16-membered
macrolides. High-level expression has been shown to be dependent on h o
genes, mphA and mm which encode the macrolide 2'-phosphotransferase 1 and
an unidentified hydrophobic protein respectively (Noguchi et al., 1995).
Macrolide resistance due to the type II macrolide 2'-phosphotransferase in E. coli
is conferred by the mphB gene (Kono et al.. 1992; Noguchi et al., 1996; O'Hara
et a1.,1 989).
B) Lincosamide Inactivation
In 1969, Argoudelis et al. first reported the finding of the lincosamide-
specific inactivating enzyme, 3linwsamide û-phosphotransferase, and
subsequently, a 3-lincosamide O-nucleotidyltransferase in Streptomyces
(Argoudelis and Coats, 1 969; Argoudelis and Coats, 1971 ). The genes encoding
these enzymes were not investigated.
A sirnilar enzyme was discovered by Dutta et al. who reported the finding
of a 4-lincosamide O-nucleotidyltransferase in Streptococcus ubens, encoded by
the linA gene. However, the location of this determinant was not known (Dutta
and Devriese. 1982). Brisson-Noel et al. similarly reported the finding of this
same enzyme in S. haemolyticus (Brisson-Noel et al., 1987). A similar enzyme
was described by Brisson-Noel et al. from S. aureus which modified the dnig in
the same manner but was localized to a different plasmid and the gene
designated IinA' (Dutta and Devriese, 1982; Brisson-Noel et al., 1988).
Recently, a new resistance gene, &B. conferring resistance to lincomycin
by inactivation was identified in one isolate of E. faecium demonstrating high
![Page 30: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/30.jpg)
levels of resistance to clindamycin and lincomycin (MICs > 128 pglml). The
resistance gene. linB. was distinct from linA and linAt, responsible for the
inactivation of clindamycin and lincomycin in staphylowcci (Bozdogan et al.,
1997-A).
C) Streptogramin Inactivation
Two enzymes with specificity for streptogramins have been detected in S.
aumus. Evidence of streptogramin inactivation has also been detected in
Lactobacillus spp., Clostridum perfnngens, and in the streptogramin-producers
Streptomyces diastaticus, Streptomyces loidensis, and Streptomyces olivaceus,
however, the enzymes present in these organisms were not investigated further
(Courvalin et al.. 1985; Fierro et al., 1989). Since then, four acetyltransferases
and two hydrolases have been detected and characterized that modify type A
and type B streptogramins respectively. thereby rendering them inactive.
D) Streptogramin A Inactivation
De Meester et al. Srst identified a streptogramin A û-acetyltransferase
responsible for the modification of the M cornponent of virginiamycin by the
acetylation of a hydroxyl group, followed by the rapid degradation of the 0-
acetylated product (De Meester and Rondelet. 1976).
Subsequently. a streptogramin A-specific acetyltransferase fmm S.
eureus, designated vat for virginiamycin A acetyltransferase, was described and
found to encode resistance to A-type compounds of streptogramin antibiotics
(Allignet et al., 1993). The vat gene is iocated on the same plasmids as the
![Page 31: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/31.jpg)
previously described vge gene, believed to encode an ATP-binding protein
involved in active transport (Allignet and El Solh. 1992).
A sirnilar acetyltransferase with specificity for type A streptogramins was
also identified around the same time in E. faecium. Hybridization studies of satA
and the vat acetyltransferase observed in S. aumus did not demonstrate
sequence hornology, indicating that satA was distinct (RendeFournier et al.,
1993).
Su bsequently, another staphylococcal streptogramin A acetyltransferase
has been identified, designated vatB. Amino acid analysis of VatB with Vat and
SatA, encoded by the staphylococcal and enterococcal plasmids respectively,
demonstrates 47.4 and 58.4% identity. Analysis of the nucleotide sequence of
vatB exhibited 53.3% nucleotide identity with vat and 52.6% identity with saM.
Recently, a fourth acetyltransferase with specificity for type A
streptogramins, designated vatC, was isolated from S. cohnii subsp. cohnii and
found to be similar to the other three streptogramin A acetyltransferases: Vat
(24.3 kDa; 69.8% identical amino acids and 83.5% similar amino acids), VatB
(23.3 kDa; 58.2% identical amino acids and 77.4% similar amino acids), and
SatA (23.3 kDa; 66.0% identical amino acids and 77.4% similar amino acids). All
four acetyltransferases possess 48 identical amino acids as well as a repeated
sequence comprising an isoleucine patch (Allignet et al., 1998).
E) Streptogramin 8 Inactivation
Le Goffic et al. subsequently identified the presence of a pristinamycin 1A
hydrolase in S. aureus which was found to split the lactone ring of pristinamycin
![Page 32: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/32.jpg)
I A into a linear molecule which has lost its antibiotic acüvity (Le Goffic et al.,
1977). Similar enzymes have also been reported in lysates of Actinoplenes
missouriensis and Streptomyces mifakaensis which likewise inactivate the B
components of virginiamycin antibiotics by cleavage of the lactone ring (Hou et
al., 1970; Kim et al., 1974).
The first gene encoding resistance to virginiamycin antibiotics to be
cloned and sequenced was from an S. aureus plasmid. encoding a virginiamycin
6 hydrolase (AIIignet et al., 1988). The S. aumus vgb gene is similar to the 35
kDa streptogramin B hydrolase previously detected in A. missouriensis (Allignet
et a1.J 988).
Until recently, satA was the only streptogramin resistance deteninant to
be identified in enterococci. Bozdogan and Leclercq identified the presence of a
vgb-like gene in one isolate of E. faecium found to be resistant to quinupristin-
dalfopristin (MIC = 16 pglmL). The fragment obtained was nearly identical to vgb
with the exception of 50 nucleotides. This has been the only enterococcal
isolate described to date possessing a streptograrnin resistance determinant
other than satA (Bozdogan et al., 1997-8).
Recently, a second virginiamycin B hydrolase, designated vgb8, has
been identified which encodes a 295amino acid lactonase (Allignet et al., 1998).
No signifiant similarities were detected between the two SgB hydrolases. Vgb
and VgbB, and other peptide sequences in the data banks.
The genes vat, vga, and vgb have been found to occur on the same
plasmid, with vat wntiguous to vgb. Of 48 staphylococcal isolates examined by
![Page 33: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/33.jpg)
Allignet et al., each camed either vga or a combination of two or three genes:
vga8-vat8, vga-vat, or vga-vat-vgb (Allignet et al.. 1998). The reason why these
genes are seemingly cotranscribed is not known. However, while the plasmids
harbouring vat, vga, and vgb are not transferable by conjugation, the plasmid
carrying vatB is conjugative. None of the 7 staphylococcal isolates in which vat8
was identified possessed a vgb gene (Allignet et al., 1998).
To date, streptogramin resistance determinants have only been identified
and characterized in staphylococd and enterococci. However, with the
multiplicity of plasmids and genes encoding resistance to both type A and B
streptograrnin components and the synergistic mixtures of the two, care rnust be
exercised when ernploying these antibiotics in animal feed, as well as in the
administration of these antibiotics for the treatment of infections caused by
staphylococci and multidrug-resistant Gram-positive organisms (Allignet et al.,
1998).
2.0 OBJECTIVES
Our laboratory obtained 5029 isolates of S. pneumoniae as part of an
ongoing crossCanada surveillance study looking at levels of antimicrobial
resistance among clinically significant organisms. Given that the incidence of
penicillin resistance has been increasing in pneumococci, and that erythromycin
resistance is frequently associated with resistance to the former, our objectives
were threefold: firstly, to deterrnine the prevalence of resistance to MLS
antimicrobials among erythromycin-resistant pneumococci; secondly. to
characterize the mechanisms of resistance to MLS antimicrobials in
![Page 34: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/34.jpg)
erythromycin-resistant pneumococci; and thirdly, to identify potential new
mechanisms of MLS resistance. Additionally. a subset of erythromycin-resistant
viridans streptococci possessing unusual resistance patterns to MLS antibiotics
were selected and characterized for potential new rnechanisms of MLS
resistance.
3.0) MATERIALS AND METHODS
3.1) lsolates
A total of 5029 clinical isolates of S. pneumoniae was obtained from 1993
to 1996 from a cross-canada suiveillance study involving 1 13 hospital and
private laboratories in al1 ten provinces. Of these, 147 were found to be
erythromycin-resistant by broth microdilution and were selected for further
investigation. Additionally, 422 viridans streptococci. isolated from sterile sites,
were obtained between 1995 and 1997 as part of the same study. Of these, 121
were found to erythromycin-resistant by broth microdilution. Frorn this su bset,
nine viridans streptococci were selected for fumer study based on unusual
resistance patterns to MLS antibiotics. In total, 147 pneumococci and nine
viridans streptococci were characterized further to determine the prevalence of
known MLS resistance mechanisms. as well as the identification of potential new
resistance mechanisms.
The following organisms were used as wntrols for the following genes: E.
coli RN7951 (ennA), S. pneurnoniae 3585 (ennAIWB), S. aureus (ennC). S.
pneumoniae 02J1175 (mefE), S. pneumoniae ATCC 49619 (negative control), S.
![Page 35: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/35.jpg)
pneumoniae 6303 (negative control), S. pyogenes 02C1110 (ennTR), S. aumus
BM3002 (vga, vgb, vat), E. coli DBI O (satA).
3.1 .l ) Group Identification of Viridans Streptococcus lsolates
The nine viridans streptococci with unusual MLS resistance patterns were
identified to the group level by standard biochemical tests as recommended in
the Manual of Clinical Microbiofogy (Ruoff, 1395). The following tests were
performed to confimi laboratory identification of these isolates: viridans
streptococci were distinguished from S. pneumoniae by optochin resistance and
the bile solubility test, from S. pyogenes by the pyrrolidonyl arylamidase (PYR)
test, and from enterococci by the PYR and bile esculin tests. The following tests
were utilized to identify the isolates to the group level: esculin hydrolysis,
mannitol fermentation, sorbitol fermentation, urea hydrolysis, and the Voges-
Proskauer test.
3.2) Susceptibility Testing
3.2.1) Broth microdilution
Susceptibility testing was carried out by broth microdilution and disk
diffusion according to the National Cornmittee for Clinical Laboratory Standards
guidelines (NCCLS, 1997). Broth microdilution was performed to determine
minimum inhibitory concentrations (MICs) to the following MLS antimicrobials:
erythromycin, clindarnycin (Sigma, Oakville, Ont.), quinupristin (S,), dalfopristin
(SA), synercid (dalfopristin-quinupnsün) (SA+ SB), and pristinamycin (pristinarnycin
IA +UA) (Rhone-Poulenc-Roter, Collegeville, Pa). Micmdilution panels were
incubated at 37OC in air for 24 hours. lsolates which failed to grow in ambient air
![Page 36: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/36.jpg)
were subsequently retested and grown in 5% CQ for 24 hours. Pristinamycin
was induded to compare MlCs with the values obtained for synercid, as MlCs
for pristjnamycin are within a two-fold dilution lower than those for synercid .
Susceptibility to erythromycin and clindamycin was based on the following
breakpoints according to the NCCLS guidelines: susceptible MIC i; 0.25 pg/mL;
intermediate MIC = 0.5 pg/mL; and a resistant MIC r 1 pglmL. As breakpoints for
quinupristin, dalfoprisün. and synercid were not available by NCCLS, the
following tentative breakpoints for synercid were supplied by the manufacturer:
susceptible MIC s 1 pglmL; intemediate MIC = 2 WmL; and a resistant MIC r 4
pglmL. MlCs to dalfopristin are almost exclusively resistant in streptococci as a
result of their in herent resistance to streptogramin A compounds. Quinu pristin
breakpoints were not available from the manufacturer, however, MlCs of 8 pg/mL
or greater were considered resistant based on personal communication with the
manufacturer.
3.2.2) Disk Susceptibility Testing
MLS resistance phenotypes were detemined by disk diffusion using
erythromycin (1 5 pg), clindamycin (2 pg) (Oxoid, Nepean, Ont.), quinupristin (7.5
pg), dalfopristin (7.5 pg), and synercid (1 5 pg) (Rhone-Poulenc-Rorer). Cultures
were grown for 18 to 21 houn on Columbia agar plates (Medprep. Que.)
supplemented with 5% sheep blood. After this time, suspensions were made to
a turbidity equivalent to a No. 0.5 McFarland standard in sterile saline solution.
Plates were inoculated with this suspension, pemitted to dry, inoculated with
antibiotic disks, and incubated within 15 minutes of placement of the disks. Zone
![Page 37: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/37.jpg)
sizes were detemined following 24 hours incubation in 5% CO2 according to
NCCLS guidelines (NCCLS. 1997). Evidenœ of inducible MLSB resistance was
tested for by placing clindamycin and quinupristin disks 10-1 5 mm respectively
from an erythrornycin disk. The following breakpoints were used to detenine
susceptibility: 1) for erythromycin, susceptible 2 21 mm, intemediate = 16 - 20
mm, and resistant 5 15 mm; 2) for clindamycin, susceptible 2 19 mm.
intermediate = 16 -1 8 mm, and resistant < 15 mm; 3) for quinupristin, breakpoints
are not available, although preliminary data from Rhone-Poulenc-Rorer
examined 10 isolates of S. pneumoniae and found that the average zone size for
these isolates was 13.84 mm (penonal communication), resistance was defined
by zone diameters s 1 1 mm; 4) for dalfopristin, breakpoints do not exist owing to
intrinsic resistance; 5) for synercid, the following tentative breakpoints have been
provided by the manufacturer: susceptible 2 19mrn, intermediate 16-1 8 mm, and
resistant 5 15 mm.
3.3) DNA Isolation
3.3.1) Genomic DNA Isolation
Genomic DNA was isolated from pneumococcal isolates by the method
of Smith et al. (Smith et al., 1993). To isolate genomic DNA from virîdans
streptococci, the same procedure was used with the following modifications: the
pellet obtained from centrifugation of a 1.5 mL ovemight culture was
resuspended in a lysis mixture consisting of RNase, mutanolysin, and lysozyme
added to a lysis buffer composed of 50 mM glucose, 25 mM Tris, pH 8.0, 10 mM
EDTA, pH 8.0, and 150 mM NaCI) and incubated at 37OC for 1 hour. At this time.
![Page 38: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/38.jpg)
10% SDS was added to each tube, mixed by inversion, and kept at room
temperature for 10 minutes. To this. 50 PL of 10 mg/mL proteinase K was added
and the tubes incubated at 45OC for at least one hour.
Alternatively, genomic and plasrnid DNA were also obtained by a rapid
lysis method for use as template DNA for PCR. A loopful of organism was
inoculated into a 1.5 mL microcentrifuge tube containing 1 mL of lysis buffer
made from the following: 100 mM NaCI, 10 mM Tris-HCI (pH 8.3), 1 mM EDTA
(pH 8.0). and 1 % Triton X 100. The suspension was boiled for 10 minutes, snap-
cooled on ice for 5 minutes, and subsequently spun down to remove cell debris.
For a 25 pl PCR reaction, 5 pL of the supernatant was used as template.
3.3.2) Plasmid DNA Isolation
Plasmid isolation from E. coli was perfomed as previously described
(Bimboim and Doly, 1979). Plasmid isolation was also performed by the
Quantum Prepm plasmid miniprep kit (Bio-Rad, Mississauga, Ont.) and by the
QlAfilter plasmid midi kit (Qiagen, Mississauga, Ont.) according to the
manufacture& instructions. For staphylococcal plasmid isolation, 10 PL of 1
mglmL lysostaphin pet 100 pL of lysis mixture was added to lyse the
staphylococcal cell well using either kit.
3.4) ?CR
The following concentrations were used for al1 PCR reactions in a final
volume of 25pL: 0.5 pL of a 20 pmol primer stock, 2.5 pL of a 1 mM dNTP
solution, 2.5 PL of 10X PCR buffer, and 0.1 pL of Taq polymerase (20 UlpL).
![Page 39: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/39.jpg)
PCR was carried out in a Perkin-Elmer 9600 Themocyder. The primen used in
this study are found in Table 3.
3.4.1) emA, -8, 4, and mef PCR
Multiplex PCR was pe~ormed using primers specific for ermA, emB
(ennAM), emC. and mef (Sutcliffe et al., 1996). The following parameters were
used: 1) initial denaturation for 3 min. at 93OC; 35 cycles of annealing for 1 min.
at 5g°C, elongation for 1 min. at 72OC. denaturation for 1 min. at 93OC; and a final
elongation for 5 min. at 72OC. A magnesium concentration of 4 mM was
employed for the multiplex reaction, although a magnesium concentration of 2
mM was used for the rnef primer set alone (Sutcliffe et al., 1996).
3.4.2) enn TR PCR
Primers ermTRA and ermTRB, designed to amplify an approxirnately 400
bp region of the gene, were employed to enable detection of ermTR in those
pneumocaccal isolates and viridans streptococcal isolates with an MLS,
phenotype, but that were negative by PCR for emA, em8, and ermC (primer
sequence kindl y provided by Joyce Sutcliffe, Pfizer Central Resea rch Centre,
Groton, Connecticut). The following PCR conditions were employed: 1 ) initial
denaturation for 3 min. at 94OC; 2) 35 cycles of denaturation for 30 s at 94OC,
![Page 40: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/40.jpg)
Table 3. Primer sequences used in this study for PCR detection of known MLS
resistance genes and for sequencing.
Primer name
emA1
ennA2
em81
emB2
Sequence (5'3') TCTAAAAAGCATGTAAAAGAA
4
ClT CGA TAG T lT A T AAT ATT AGT
GAA AAG GTA CTC AAC CAA ATA
AGT AAC GGT ACT TAA ATT GTT TAC L
ermC1
emC2
ermTRU
errnTRA
emTW
1
1 mef 7 1 AGT ATC ATT AAT CAC TAG TGC 1
TCA AAA CAT AAT ATA GAT AAA
GCT AAT ATT GTT TAA ATC GTC AAT
GCA TAA GGA GGA GTT AA GAA GiT TAG ClT TCC TAA
GCC TTC AGC ACC TGT CTT AAT TGA T
em7TRD TCA GTA ACA TTC GCA TG
-
mef2
sat&at&atWvatCl
sat/i/aVitatB/vatC2
vgb 7
vgb2
-
lTC l T C TGG TAC T H A A G ~ ~
AT(A/TIC) ATG AA(T/C) GGI GCI AA(CT) CA(TC) (AC)GI ATG
iCC (GIAIT)AT CCA IAC (A/G)TC (AIG)TT ICC
AAA ACG GAG GGG ATA GAA TG
TAA TTG CAT GAG GTC GAG CG
![Page 41: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/41.jpg)
annealing for 30 s at 94OC, elongation for 1 min. at 72OC; and a final elongation
for 5 min. at 72OC. A magnesium concentration of 1.5 mM was used in al1
reactions.
For sequencing of the ermTR gene found in S. milleri, primers were
designed to amplify as much of the emTR structural gene, in addition to the two
upstream leader peptide regions, as possible. The primers ermTRC and
ennTRD amplified an 835 bp fragment comprising rnost of leader peptide 1, al1 of
leader peptide 2. and the majority of the emTR structural gene, with the
exception of the predominantly AT-rich terminus. The same parameters used for
PCR with primers ennTRA and ennTRB were employed.
3.4.3) vaWati3hatC/satA PCR
Degenerate primen, M and N, were used (Allignet et al., 1996) which
were designed to amplify a 147 bp product representing conserved regions of
motifs III and IV from the streptogramin A acetyltransferases vat, vatB, and vatC
from S. aureus and satA from E. faecium. Low stringency PCR was canied out
under the following conditions: 1) initial denaturation at 95OC for 5 min.; 2) 35
cycles of denaturation at 95OC for 30 s, annealing at 40°C for 2 min., elongation
at 72OC for 1 min. 30 s; 3) final annealing at 4OoC for 4 min.; and 4) final
extension at 72OC for 12 min. A magnesium concentration of 1.5 mM was used
in al1 reactions.
3.4.4) vgb PCR
Primers were designed in our laboratory to amplify an approximately 700
bp region within the virginiamycin B hydrolase gene, vgb. from S. aureus. The
![Page 42: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/42.jpg)
conditions used were as follows: 1) initial denaturation at 94OC for 3 min.; 2) 35
cycles of denaturation at 94OC for 30 s, annealing at 52OC for 30 s, elongation at
7Z°C for 1 min.; and 3) a final elongation at 72OC for 5 min. A final magnesium
concentration of 1.5 mM was used.
3.5) Pulsed Field Gel Electrophoresis
Pulsed field gel electrophoresis (PFGE) (Murray et al., 1990) with the
CHEF DRll apparatus (Bio-Rad) and Smel digestion were performed on 8-12
representative isolates of each: MLS, phenotype (em positive), M phenotype
(mef positive). susceptible strains (em negative. mef negative), and resistant
strains (em negative, mef negative). The following S. pneumoniae strains 3585
(ermAM), 0251 175 (mefE), and ATCC 4961 9 were used as controls.
Modifications included a lysis time of 2 h and the following electrophoretic
parameters: pulse times 0.2 - 35 s, temperature 14OC, 200 volts for 21 h.
3.6) Southern Blotting
3.6.1) Sandwich Method
Southem blotting of the PFGE gels was perfomed as previously
described (Southem, 1975). The transfer was left to proceed ovemight and the
DNA fixed to the membranes by 1 min. exposure in a UV crosslinker
(Stratagene). The gels were subsequently restained in ethidium bromide to
confimi the transfer of the DNA bands to the membranes. The blots were then
rinsed in dH,O to rernove any traces of agame and excess salt and were stored
in sealed plastic bags at 4OC until ready for use in hybridization studies.
![Page 43: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/43.jpg)
3.6.1) Dot Blot Method
Dot blot hybridization was performed on the 8-12 representative isolates
with the addition of plasmid DNA from strains E. coli RN7951 (emA) and S.
aumus RN4220 (emC) for ptobing with ennA and ermC amplicons. The DNA
was prepared for blotting as previously described (Southem, 1975) and
transferred to nitrocellulose membranes (3M) by vacuum suction using a 96-well
apparatus (San brook et al., 1 989).
3.7) Probing for ermA. - B. -C, and mef genes
All probes were purified using the QlAquick PCR purification kit (Qiagen).
Hybridization and detection was performed by enhanced chemiluminescence
using the €CL direct nucleic acid labelling system (Amersharn Life Science,
Oakville, Ont.). The Mots prepared from the PFGE gels were screened for
emB(AM) and mef using probes generated by PCR. The dot blots. which
contained the same representative isolates with the addition of plasmids
harbouring emA and ennC were screened with probes generated by PCR for
emA and emC. Additionally, a 16s PCR proâuct, representing a conserved
region of pneumococcal16S rRNA, was used as a probe to confimi the
presence of pneumococcal DNA on the blot.
4.0) RESULTS
4.1) Group Identification of Viridans Streptococcal lsolates
Of the nine viridans streptococci found to lack an e m or mef gene, eight
were presumptively identified to the group level based on standard biochemical
testing. Based on positive reactions with the various substrates used. one of
![Page 44: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/44.jpg)
these isolates was found to be S. bovis, two belonged to the S. milleri group, one
to the S. mutans group, and four to the S. M i s group.
4.1) Susceptibility Data: Broth Microdilution and Disk Susceptibility Testing
Of 5029 isolates S. pneumoniae tested, 147 (2.9%) were found to be
erythromycin-resistant by broth microdilution. Of these, 64 (1.3%) were found to
be clindamycin-resistant. No erythromycin susceptible, clindamycin resistant
streptococci have been identified to date. All erythromycin resistant isolates were
subsequently screened by disk diffusion to detect already known and potentially
novel MLS phenotypes among randomly selected, unbiased S. pneumoniae
isolates, as well as selected isolates of viridans streptococci. Both methods were
found to be very reliable at detecting the various MLS phenotypes.
The predominant phenotype detected among these isolates was the M
phenotype, with 77 isolates detected by disk diffusion and 78 detected by broth
microdilution. The MLS, phenotype was the second most commonly identified
phenotype with 61 isolates detected by disk diffusion, but only 51 detected by
broth microdilution. An ML phenotype was identified among three isolates by
disk diffusion and nine by broth microdilution based on quinupristin levels c; 4
pglmL by broth microdilution. An MS phenotype was identified among six
isolates screened by disk diffusion and nine isolates screened by broth
microdilution. The following isolates were identified as MS resistant by both
methods: 442, 1914, 2669, 2859, 2867, and 6131. The following three isolates
were identified as possessing an MS phenotype by broth microdilution only:
2189,2636 (quinupristin MlCs = 8 pgImL), and 7488 (quinupristin MlCs 16
![Page 45: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/45.jpg)
pg/mL). Of these, isolates 21 89 and 2636 demonstrated M phenotypes and
7488 an MLS, phenotype by disk diffusion. Of twelve eiythromycin susceptible
pneumococci, two were foond to be resistant to quinupristin alone with MlCs of 8
pg/mL and 16 pg/mL respectively.
Of the nine viridans streptococci tested, six demonstrated a definite MLS,
phenotype based on resistant zone sizes to erythromycin, clindamycin, and
quinupristin. In total. six isolates demonstrated a definite MLS, phenotype based
on resistance to erythromycin, clindamycin, and quinupristin by both methods.
Of the rernaining three isolates, S. bovis 421, demonstrated resistance to
erythromycin, susceptibility to clindamycin, and slightly reduced susceptibility to
quinupristin, suggesting the presence of an M or possibly an MS phenotype
(Figure 2). By broth microdilution. this isolate possessed a distinct MS
phenotype. However, when a clindamycin and a quinupristin disk were placed
within 20 mm of the erythromycin disk, D-shaped zones of inhibition were
observed around clindamycin and quinupristin, indicating inducible resistance in
the presence of eryüiromycin, which was undetectable by both methods.
Another isolate, S. mutans BSV 134, demonstrated resistant zone sizes to
erythrornycin and clindamycin, but susceptibility to quinupristin, suggesting an
ML phenotype (Figure 3). This isolate likewise possessed an ML phenotype by
broth microdilution. However, when both the clindamycin and quinupristin disks
were placed in close proximity to the erythromycin disk, a D-shaped zone of
![Page 46: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/46.jpg)
Flgun 2. Susceptibility testing of S. bovis BSV 421 by disk diffusion using
eiythromycin and dindamycin disks.
Flgun 2: Oemonstration of inducible clindamycin resistance (top left disk) nihm
placed in close pmximity to an erythromycin disk (top right). Zone of inhibition
around clindamycin disk aione (bottom left) mis susceptible when not in
ciose proximity to an erythromydn disk (bottom right).
![Page 47: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/47.jpg)
Flgun 3. Susceptiôiîity testing d S. mulMs 8SV 134 by disk difbion using
erlyIhromycin and clindam ycin disks.
Flgun 3: Demonstratbn of dindamycin resistance (top left disk and top right
disk) end e w r m ycin eryütromycin resistance (bottom left disk and bottom dght
disk). InduciMe resistence to quinupristin (streptogramin 6) not shown.
![Page 48: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/48.jpg)
inhibition was observeci around both the clindamycin and quinupristin disks,
indicating inducible resistance in the presence of erythromycin.
In the third isolate, S. millen' BSV 377, this organisrn demonstrated
intermediate resistance to erythromycin. but complete resistance to clindamycin
based on the absence of any zone of inhibition, as well as resistance to
quinupristin (Figure 4). Similarly, by broth microdilution, this isolate was only
intemediately resistant to erythromycin but expressed high level resistance (264
pg/mL) to clindamycin. Interestingly, when both clindamycin and quinupristin
disks were placed within close proximity to an erythromycin disk, no evidence of
any induction was observed. The erythromycin zone size did not blunt and
continued to dernonstrate intemediate resistance to ewhrornycin and high-level
resistance to clindamycin based on the absence of a zone of inhibition
surrounding the clindamycin disk. This phenotype is in stark contrast with the
emTR phenotype observed in S. pyogenes, whereby erythromycin resistance is
characterized by a small resistant zone size and clindamycin appears active in
vitro, characterized by a susceptible zone size, but is inducibly resistant in the
presence of erythrornycin (Figure 5). The phenotype displayed by the latter is
the same as that observed in staphylococci possessing ermA, which is not
surprising owing to the 80% homology between ermTR and emA, which are two
rnost highly related e m genes.
Resistance to synercid was also screened for. despite only recently
having been approved in North America for therapeutic use for multidrug-
![Page 49: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/49.jpg)
Flgun 4. Susceptibility t d n g of S. m1W BSV 377, harbouring ennTR, by disk
diffusion using erythromydn and clindamydn disks.
Flgw 4: Demonstraton of the wiusual resîstence pattern by S. milleri BSV 377
harbouring enTl?. The zone size sumwndlng the eiythromycin disk (Mt)
exhibits intemediate level resistance, whereas high-levd clindamycin resistance
c m be detected by the lack of any zone of inhibition around the clindamycin disk
(right). No evidence of induction can be detected even when the two disks are
Maiin close proximity to each other.
![Page 50: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/50.jpg)
Flgun 5. Suscepbibility testing of S. p- OX1110, haburing m T R , by
disk diffosim using eryairomycin and dindamycin disks.
Flgun 5: Demanstretbn of the typicai resistance pattern by S. pyogenes
haibouring ennTR. Etythromycin resistence is chamcterized by a srnail zone of
inhibition (top and bottom left), whereas clindamycin appears to be susceptible in
aie absence of erythromycin (top right) but is induciMy resistant, characteriteci
by a Munted tom of inhibition (bottom right), when an erythrompin disk is
pîaced within close pfoxîmity.
![Page 51: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/51.jpg)
resistant infections. as streptogramins have been routinely used in animal feed
here for years. All pneumococci tested, with the exception of one. were found to
be susceptible to synercid, whereas five of the nine viridans streptococci were
found to be resistant by both disk diffusion and broth microdilution.
4.3) PCR
4.3.1) emA, -8, -C, and mef PCR
Multiplex PCR. using primen specific for emA, emB (ermAM), emC,
and mef, yielded results generally predicthre of the observed MLS, and M
phenotypes. Characterization of the erythmmycin resistant S. pneumoniae
isolates by broth microdilution, disk diffusion, and PCR is summarized in Table 4.
By broth microdilution, ewhromycin resistance was consistently found to be
greater among those isolates possessing an e m gene (MIC, r 64 pglmL, MIC,
r 64 pg/mL) compared to those with mef (ME, = 4.0 pglmL, MIC, = 32 pglmL),
thus, also proving to be generally predictive of whether resistance is due to
target modification or active efflux (Figure 6).
In cornparison with the resistance genes detected. there was excellent
correlation between disk diffusion and broth microdilution at predicting those
isolates possessing an M phenotype due to mef. Of the 82 rnef genes detected
in total, 76 were identified among the 77 isolates with an M phenotype by disk
diffusion and 78 by broth microdilution. One isolate. SPN 2636, possessing an
M phenotype by disk diffusion but lacking a mef gene, was found to possess an
MS phenotype by broth microdilution and may represent a novel mechanism of
![Page 52: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/52.jpg)
Table 4. Characterization of 147 erythromycin-resistant S. pneumoniae by broth
microdilution. disk susceptibility testing, and PCR.
Resistance Suscepti bility test
phenotype method
Resistance genes
detected
Broth Disk ennA,-8,-C rnef none microdilution diffusion
-
Total 147 147 57 82 9
a MLS,: macrolide/linwsamide/streptogramin,-resistant. ML: macrolidellincosamide-resistant; lincosamidelstreptogramin,- susceptible. M: macrolide-resistant; lincosarnidelstreptogramin,-susceptible. MS: ma~f~lide/~tfept~gramin~-resi~tant; lincosamide susceptible
%ne constitutive MLS, isolate possessed both e m and mef genes
![Page 53: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/53.jpg)
Figure 6. Distribution of mef and e m genes according to the MIC of
erythromycin.
Oenn - 1 mef + Oerm - 1 mef -
0.5 1 2 4 8 16 32 6 4 '
Erythromycin MIC (pglml)
![Page 54: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/54.jpg)
broth microdilution was found to be MLS, resistant by disk diffusion and
possessed an e m gene.
60th mechanisms were found to occur in one isolate, SPN 779. which
was found to possess both rnef and enn, despite possessing an MLS,
phenotype by both methods. The rnef gene was also identified in five isolates
(1914,2669,2859,2867, and 6131) demonstrating an MS phenotype which
accounted for the observed macrolide resistance, but failed to account for the
streptogramin resistance found in these isolates. An additional MS isolate, SPN
442, demonstrated intermediate level resistance to erythromycin and resistance
to quinupristin by both methods, and lacked both mef and em. These findings
suggest the presence of an independent streptogramin resistance mechanism.
Of the 57 e m genes detected, 56 were identified among isolates with an
MLS, phenotype, whereas one e m gene was detected in one isolate, SPN
7638, demonstrating an ML phenotype by both susceptibility methods. This
suggested that SPN 7638 was in fact MLS, cross-resistant and that resistance to
quinupristin was not induced. Two isolates with an ML phenotype detected by
both methods, SPN 2960 and SPN 8265, were found to lack both mef and em.
By broth microdilution, six additional isolates were identified as ML resistant
(633,2048,2831,6459,6515, and 7218); however, by disk diffusion they
possessed an MLS, phenotype and by PCR were found to harbour an e m gene.
In total, nine isolates were identified which did not possess either mef or
an e m gene. Five isolates (1 178,3843,6549,6990,6996) found to possess an
MLS, phenotype, characterized by complete cross-resistance to al1 three classes
![Page 55: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/55.jpg)
by disk diffusion. demonstrated either apparent clindamycin susceptibility in
some strains. or a lower level of resistance (< 32 pglmL) in others than found in
isolates harbouring etmB (MICM 2 64 CcglmL) when tested by broth microdilution.
Two isolates (SPN 2960 and SPN 8265) were found to possess an ML
phenotype. and one isolate (SPN 442) an MS phenotype, by both susceptibility
test methods. whereas one isolate (SPN 2636) demonstrated an MS phenotype
by broth microdilution but an M phenotype by disk diffusion.
4.3.1) ermTR PCR
Of the nine pneumococci and nine viridans streptococci found to lack
emA, 4, -C, and mef, only one isolate of S. millen gp. was found to possess
the wmTR gene which has, until now, only ever been identified in Group A
streptococci to date (Figure 7).
A) Sequence Analysis of an 835 bp ermTR Fragment from S. milleri group.
Interestingly, while the one S. milledgp. isolate was found to contain the
same e n gene as is commonly found in S. pyogenes, it's phenotypic resistance
pattern was rnarkedly different from that observed in the latter. The phenotype in
S. pyogenes can be characterized by resistance to erythromycin based on a
small zone site, although larger than observed with ennB(AM), and apparent
susceptibility to clindamycin (personal observations and personal communication
with Joyce Sutcliffe. Pfizer Central Research. Groton, Connecticut.). However,
when both disks are within close proximity to each other. clindamycin is induced
by erythromycin to become resistant. l ndividual colonies which are inducibly
![Page 56: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/56.jpg)
Figure 7. PCR analysis dernonstrating the presence of ennTR in one MLS,-
resistant isolate of S. millefi
Lane: 1 - 1 kb ladder 2 - plP524 (negative control) 3 - pAT15 (negative control) 4 - S. pyogenes 02C1110 (positive control) 5 - S. pyogenes 8595 (positive control) 6 - ATCC6303 (negative control) 7 - ATCC 4961 9 (negative control) 8 - S. mitis BSV 1 00 9 - S. mutans BSV 134
10 - S. millen BSV 150 1 1 - S. bovis BSV 188 12 - S. mi!is BSV 205 13 - S. mitis BSV 223 14 - S. mitis BSV 247 15 - S. milleri BSV 377, ermTR+ 1 6 - S. ~ O V ~ S BSV 42 1 17 - nongroupable BSV 442 18 - negative reagent control
![Page 57: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/57.jpg)
resistant can be seen extending up to and beyond the clindamycin disk. In this
particular isolate of S. milleri gp., however, the resistance pattern was markedly
different. In contrast with S. pyogenes, the organism exhibited only intenediate
level resistance to erythromycin, yet full resistance to clindamycin based on the
absence of any zone of inhibition. When the disks were placed within close
proximity to each other, however, no change in phenotypic expression was
observed. Sequence analysis of the 835 bp amplicon generated from the
genomic DNA of this isolate demonstrated the finding of two mutations: one in a
noncoding region between the ribosomal binding site and the start codon for the
methylase structural gene, and the other within leader peptide 2, located
upstream from the methylase gene, resulting in an amino acid switch from
isoleucine to asparagine.
4.3.3) vaükat#vatC/satA PCR
PCR was perfonned using degenerate primers specific for the four known
streptogramin A acetyltransferases described to date. None of the erm negativel
mef negative pneumococci or viridans streptococci were found to possess any of
these genes. Consequently, the synercid resistance observed in one
pneumococcus and five viridans streptococci is not due to any of these
streptogramin acetyltransferases.
4.3.4) vgb ?CR
The eighteen etm negativelmef negative pneumococci and viridans
streptococci, as well as the two erythromycin susceptible pneumowcci resistant
to quinupristin, were screened by PCR for the presence of the virginiamycin B
![Page 58: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/58.jpg)
hydrolase to sccount for the observed streptogramin 6 resistance levels
observed in al1 isolates. None of these were found to possess the vgb gene.
4.4) Pulsed Field Gel Electrophoresis
PFGE dernonstrated that, of 42 strains tested, 40 were clonally distinct
(Figures 8 and 9). Lanes 5 and 27 appear to be the sarne as are lanes 19 and
20. Thus, the isolates selected from each group tmly represented a random,
unbiased representation of pneumococci from across Canada for determination
of the true prevalenœ of MLS resistance mechanisms.
4.5) Hybridization Results Using emA, -8, -C, and rnef Probes
Hybridization studies on selected isolates supported the ?CR findings in
that only those positive for enn8 by PCR hybridized with the emB probe (Figure
IO), but not with emA, emC, and mef probes, whereas only those positive for
mef by PCR hybridized with a mef probe (Figure 1 1 ). Erythromycin susceptible
strains and resistant strains which were ennwmef negative did not hybridize with
any of the probes, and erythromycin resistant emi8 negativelmef negative
isolates were negative by probing for both genes (Figures 12 and 13). Thus,
PCR was reliable in characterizing the two major mechanisms of resistance. The
presence of nine isolates which did not yield amplicons by PCR and did not
hybridize with em and mef suggests the presence of novel genes or
mechanisms of resistance.
Dot blot hybridization studies of the two viridans isolates possessing an
![Page 59: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/59.jpg)
inducible MLS, phenotype demonstrated that the cross-resistance to al1 three
antimicrobials was not due to emA, -0, 4, or -TRp suggesting the presence of a
novel e m gene, or as yet unidentifid mechanism (data not shown).
![Page 60: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/60.jpg)
Figure 8. Pulsed-field gel electrophoresis of selected erm-positive, mef-positive
S. pneumoniae.
1 - lambda ladder 2 - 3585 (ermB positive control) 3 - 0251 175 (mef positive control) 4 - ATCC 49619 (negative control) ennB positive S. pneumonlae 5 - 633 6 - 800 7 - 1242 8 - 1346 9 - 1503 10 - 2707 Il - 2831 12- 6139 13 - 6515 14 - 6823 15 - 7218 16 - 7638
mef positive S. pneumoniae 17 - 719 18 - 836 19 - 958 20 - 1219 21 - 1781 22 - 191 23 - 2183 24 - 2471 25 - 3108 26 - 6673 27 - 7701 28 - 7732
![Page 61: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/61.jpg)
Figure 9. Pulsed-field gel electrophoresis of novel MLS-resistant isolates and
selected erythromycin susceptible isolates of S. pneumoniae.
1 - lambda ladder 2 - 3585 (erm8 positive control) 3 - 025 1 1 75 (mef positive control) 4 - ATCC 4961 9 (negative control) em8-/mef- novel S. pneumoniae 5 - 442 6 - 1178 7 - 2960 8 - 3843 9 - 6549 I O - 6990 1 1 - 6996 12 - 8265
erythrornycin susceptible S. pneumoniae 13 - 1060 14 - 1753 15 - 1967 16 - 2199 17 - 2330 18 - 2468 19 -2697 20 - 3248 21 - RB (susceptible control) 22 - ATCC 6303 (susceptible control)
![Page 62: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/62.jpg)
Figure 10. Analysis by southern blot of the PFGE gel from Figure 8 containing
selected emSpositive and mef-positive pneumococcal isolates, and probed with
ermS amplicon.
1 2 3 4 5 6 7 8 9 10 11 121314 15161718t920 2122232425 26 2728
1 - lambda ladder 2 - 3585 (erm8 positive control) 3 - 02J1175 (met€ positive control) 4 - ATCC 49619 (negative control) ermB positive S. pneumoniae 5 - 633 6 - 800 7 - 1242 8 - 1346 9 - 1503 10 - 2707 11 - 2831 12- 6139 13 - 6515 74 - 6823 15 - 7218 16 - 7638
mef positive S. pneumoniae 17 - 719
![Page 63: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/63.jpg)
Figure II. Analysis by southern blot of the PFGE gel from Figure 8 containing
selected emB-positive and mefipositive pneumococcal isolates, and probed with
mef amplicon.
1 2 3 4 5 6 7 8 9 10 11 12 13 1415 16 17181920 2122232425 26 2728
W . * œ- m
1 - lambda ladder 2 - 3585 (emB positive control) 3 - 02J 1 175 (mefE positive control) 4 - ATCC 496 19 (negative control) e r . 6 positive S. pneumoniae 5 - 633 6 - 800 7 - 1242 8 - 1346 9 - 1503 10 - 2707 Il - 2831 12- 6î39 13 - 6515 14 - 6823 15 - 7218 16 - 7638
mef positive S. pneumoniae 17 - 719 18 - 836 19 - 958 20 - 1219 21 - 1781 22 - 191 23 - 2183 24 - 2471 25 - 3108 26 - 6673 27 - 7701 28 - 7732
![Page 64: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/64.jpg)
Figure 12. Analysis by southern blot of the PFGE gel from Figure 9 containing
selected emB-lmef-negative novel pneumococcal isolates and selected
erythromycin susceptible isolates, probed with mef amplicon.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22
1 - lambda ladder 2 - 3585 (emB positive control) 3 - 025 1 175 (met€ positive control) 4 - ATCC 4961 9 (negative control) errnB/mef- novel S. pneumoniae 5 - 442 6 - 1178 7 - 2960 8 - 3843 9 - 6549 I O - 6990 1 1 - 6996 12 - 8265
erythromycin susceptible S. pneumoniae 13 - 1060 14 - 1753 15 - 1967 16 - 2199 17 - 2330 18 - 2468 19 - 2697 20 - 3248 21 - R6 (susceptible control) 22 - ATCC 6303 (susceptible control)
![Page 65: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/65.jpg)
Figure 13. Analysis by southern blot of the PFGE gel from Figure 9 containing
selected emS-lmef-negative novel pneumococcal isolates and selected
erythromycin susceptible isolates, probed with emB amplicon.
1 2 3 4 5 6 7 8 9 10 11 1213 741516 1718 19202122
1 - lambda ladder 2 - 3585 (em8 positive control) 3 - 02J 1 175 (mefE positive control) 4 - ATCC 4961 9 (negative control) em8-/mef- novel S. pneumoniae 5 - 442 6-1178 7 - 2960 8 - 3843 9 - 6549 10 - 6990 11 - 6996 12 - 8265
erythromycin susceptible S. pneumoniae 13 - 1060 14 - 1753 15 - 1967 16 - 2199 17 - 2330 18 - 2468 19 - 2697 20 - 3248 21 - R6 (susceptible control) 22 - ATCC 6303 (susceptible control)
![Page 66: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/66.jpg)
5.0) DISCUSSION
This study is the first report to characterize the MLS resistance
mechanisms present among an unbiased collection of 147 erythromycin resistant
pneumococcal isolates obtained from across Canada. Antibiotic susceptibility
studies. combined with PCR and hybridization studies, enabled effective
characterization of both known as well as potentially novel MLS resistance
mechanisms. The macrolide-specific active efflux rnechanism, characterized by
the presence of the mef gene, was easily identified among 76 isolates with an M
phenotype (out of 77 detected by disk diffusion and 78 detected by broth
microdilution), and was found to be the predominant mechanism of erythromycin
tesistance among S. pneumoniae. Ribosomal modification due to e n was
identified arnong 57 isolates, 56 of which possessed an MLS, phenotype (out of
61 detected by disk diffusion and 51 by broth microdilution) and one with an ML
phenotype (out of 3 detected by disk diffusion and 9 by broth microdilution). One
strain was found to harbour both genes, yet possessed an MLS, phenotype by
both susceptibility methods, indicating that this phenotype is the dominant
phenotype when both rnechanisms are present within the same isolate. This is
the first report of both genes being detected in S. pneumoniae. A potential
reason for the discrepancy observed in detecting the various MLSB phenotypes
by both susceptibility methods compared with the results obtained by PCR,
notably regarding clindamycin and quinupfistin MICs, can be attributed to the
difference in incubation conditions as defined by NCCLS. For streptococci, disk
susceptibility plates are incubated in CO,, whereas broth microdilution panels are
![Page 67: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/67.jpg)
incubated in 4. Broth microdilution panels are only incubated in C0,when the
organism fails to grow in the presence of O,. Consequently, the effect of CO2 on
either clindamycin or quinupristin induction, whether due to pH changes or
enhanced growth of the organism in the presence of 5% CO,, often results in a
more resistant phenotype (personal observation). Based on the PCR findings,
however, disk diffusion appean to be the more reliable indicator of the
underiying resistance mechanism.
Five isolates, also found to possess met demonstrated resistance to
streptogramin B. A sixth isolate. also demonstrating an MS resistance
phenotype, only demonstrated intermediate-level resistance to erythromycin and
lacked the mef gene, but was resistant to streptogramin B. This particular
finding, in addition to the identification of two ewhromycin susceptible
pneumococcal isolates with resistance to streptogramin 6, suggests that there is
possibly a novel mechanisrn of streptogramin B resistance in S. pneumoniae. It
is detectable by both broth microdilution and disk diffision among isolates which
are resistant to emhromycin only, but may be undetected in those isolates
possessing ennB and the resultant MLS, phenotype. The observed macrolide
resistance in five of these isolates is clearly due to the mef gene present, as it is
unlikely that two mechanisms of macrolide resistance wuld result in MlCs as low
as 1 pgImL. Bordedine intemediate resistance in one isolate, possessing an
MS phenotype but lacking the mef and ennB gene, was observed by both broth
microdilution and disk diffusion. It is possible that this isolate is inherently less
susceptible erythromycin and is not due to a novel macrolide resistance
![Page 68: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/68.jpg)
mechanism. The finding of streptogramin B resistance among two erythromycin
susceptible pneumococci. however, suggests that the observed streptogramin
resistance is a streptogramin-specific mechanism. and is not part of a macrolide-
streptogramin specific efflux pump. as is found in staphylococci.
It would seem unlikely that the mechanism responsible for the observed
streptogramin B resistance is due to ribosomal modification, owing to the fact
that the shared binding sites of the three classes would involve the macrolides
and lincosamides to soma degree (Leclercq and Courvalin, 1991 ). Disk
approximation tests did not reveal induction of resistance to either macrolides or
lincosamides in the presence of a streptogramin B disk.
The detection of nine pneumococcal isolates in total demonstrating
varying degrees of resistance to al1 three classes of MLS antibiotics. but lacking
any the known streptococcal MLS resistance genes (emB, emTR, and mef),
suggests the presence of additional resistance mechanisms. Hybridization
studies confinned that the negative results obtained by PCR are not simply ?CR
artifacts, but that these strains are in fact resistant on the basis of an unknown
resistance gene(s). In addition to the MS isolate which demonstrated bordedine
erythromycin resistance, one isolate was found to possess an M phenotype,
suggesting an unknown macrolide resistance mechanism, whereas five isolates
demonstrated an MLS, phenotype, characterized by high level cross-resistance
to al1 three classes, and two isolates demonstrated an ML phenotype. However,
since the rernaining ML isolates were found to be MLS, resistant by disk
diffusion and contained an e m gene. both of these phenotypes can be attributed
![Page 69: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/69.jpg)
to ribosomal target modification sinœ quinupristin resistance is observed in the
presence of an erythromycin disk. The apparent streptogramin B susceptibility in
these isolates indicates that quinupristin is not an effective inducer of methylase
synthesis in these particular isolates. Thus, the finding of these same
phenotypes among isolates lacking any of the known e m genes, suggests the
presence of a novel em gene. Similarly. two of the nine viridans streptococci.
found to lack any known stieptococcal MLS resistance genes, possessed
unusual phenotypes by disk diffusion characterized as being MS and ML
resistant, respectively. However, the disk approximation method gave evidence
of erythromycin induction resulting in zones of inhibition around both clindamycin
and streptogramin disks characterized by a blunted edge nearest the
erythromycin disk, providing some support for the idea of a variant enn gene
among pneumowcci and viridans streptococci. It is also possible that this enn
gene is inherent in streptococci and is now upregulated in these particular
isolates, resulting in expression. It seems unlikely that the mechanism of
resistance in these seven isolates is either efflux or enzymatic inactivation, owing
to the fact that the three classes are structurally and functionally dissimilar.
Overlapping binding sites on the ribosome is the only feature shared in comrnon
among the three classes. Whife active efflux remains a remote possibility,
enzyme inactivation is unlikely, as al1 known MLS modifying enzymes are
specific to a particular antibiotic class and structure.
Of the nine viridans streptococci screened further due to unusual
resistance patterns, five isolates demonstrated resistance to synercid . Each of
![Page 70: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/70.jpg)
these isolates was also found to possess an e m gene. However, the presence
of streptogramin B resistance does not confer resistance to the synergistic
combination, thereby suggesting that the obsewed synercid resistance is
instead due a putative streptograrnin A resistance rnechanism. The MlCs
obtained for dalfopristin were not useful in detecting a putative rnechanism due
to the inherent resistance to type A streptogramins found in streptococci. Further
biochemical studies are warranted. The finding of synercid resistance among
Canadian streptococci is particularly disturôing in light of the fact that this drug
has only recently been approved for use in North America. Unfortunately,
streptogramins have been used in Canadian animal feed for decades and may
have provided the selective pressure for the emergence of a novel streptogramin
resistance genelmechanism.
Finally, one additional isolate, S. milleri 377, was found to possess the
recently described emTR gene, which has only ever before been found in S.
pyogenes until now. Interestingly, the phenotypic appearance of the S. millefi
isolate was found to be markedly different fmm Group A streptococci harbouring
ermTR, which can be characterized as moderately erythromycin resistant and
clindamycin sensitive in vitro, but inducibly resistant to clindamycin in the
presence of etythromycin. In S. mikn, however, resistance to erythromycin falls
on the breakpoint for intemediate resistance, whereas high level clindamycin
resistance is observed. Disk approximation testing fails to demonstrate any level
of induction of erythromycin by clindamycin. This phenotype may be due to
three possible reasons. Firstly, it is possible that the expression of emTR in S.
![Page 71: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/71.jpg)
miïen is different owing to a different host background. Secondly, it is possible
that a lincosamidsspecific resistance mechanism may account for the high level
clindamycin resistance observed. Finally, it is also possible that either of the two
mutations found upstream of the emTR methylase may result in changes in
induction specificity.
In this population-based study of clinical S. pneumoniae isolates from
across Canada, we found that 55.1 % of al1 macrolide resistant isolates were
resistant due the macrolide efffux pump, characterized by the M phenotype by
antibiotic susceptibility methods. This proportion was lower than that reported by
Sutcliffe (85% M phenotype) and higher than that reported by Shortridge (42% M
phenotype). However, both of these previous studies evaluated selected, non-
population based collections of isolates. Resistance due to target modification,
characterized by both the MLS, and ML phenotypes, accounted for 38.8% of
isolates. Nine isolates (6.1 %) demonstrated unusual resistance patterns and did
not possess either mef or e m genes, suggesting putative novel mechanisms.
These findings more closely reflect the true proportion of each mechanism in S.
pneumoniae, as well as the potential finding of other novel MLS resistance
genes.
6.0) Future Studies
As most streptogramin resistance is due to modifying enyzmes,
elucidating this mechanism may best be approached by various biochemical
assays in which quinupristin is used as substrate to screen for inactivation of the
drug. Detedion of enzymatic activity can by screened for by scanning
![Page 72: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/72.jpg)
spectrophotometry. Modified dnig can be screened for either by thin-layer
chromatography. or by high pressure liquid chromatography, depending upon
the sensitivity required to enable detection. Altematively, the organism can be
grown ovemight and the wncentrated cell suspension added in a predetermined
aliquot to a microtiter plate and grown ovemight in various concentrations of the
drug. Following centrifugation. a portion of the supematant can be spotted ont0
sterile disks which are subsequently applied to plates swabbed with a
susceptible control strain to obtain confluent growth. Zone sires are then
compared with zone sizes produced from disks containing medium plus drug
alone versus disks containing medium plus drug inoculated with the isolate
containing the putative modifying enzyme. If the mechanism proves not to be a
modifying enzyme, active efflux can be screened for by radiolabeling quinupristin
and monitoring the uptake of drug into cells growing exponentially. Active efflux
can be determined following the addition of a metabolic inhibitor of proton motive
force, such as sodium arsenate or carbonyl cyanide m-chlomphenylhydrazone
(CCCP), and a measure of the radioactivity found in the supernatant, determined
by liquid scintillation counting . A decrease in the amount of radioactivity in the
culture supematant following the addition of the metabolic inhibitor, indicating
accumulation of the drug within the cell, is indicative of the dissipation of an
active efflux pump.
To determine whether or not the mechanism of resistance is in fact
ribosomal target modification, a methyltransferase assay can be perfonned to
detect the methylation of an adenine residue in the conserved peptidyl
![Page 73: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/73.jpg)
transferase region using radiolabeled methionine as substrate. Alternatively,
target modification may also be detecteâ in a reconstituted translation assay in
which ribosomes isolated from MLS, resistant strains are screened for resistance
to inhibition when challenged with erythromycin, compared with those results
obtained using ribosomes from an erythromycin sensitive control. While this
method has been demonstrated successfully using staphylococcal ribosomes, a
previous atternpt at extrading functional ribosomes from MLS, resistant
pneumococci proved unsuccessful (Sutcliffe 1996). Failing these methods.
isolation of the putative e m gene can be screened for by shotgun cloning of 5 kb
pieces of genomic ONA into an MLS,-susceptible mutant E. coli (DB1 O), followed
by selection on plates containing erythromycin and a selectable resistance
marker wntained on the shuttle vector. The putative resistance determinant
must be located on the chromosome in both the pneumococci and viridans
streptococci, as plasmids wuld not be detected in any of these pneumococcal
isolates or the MU,-inducible S. mufans 134 and S. bovis 421, despite several
attempts at plasmid isolation. Theoreticaliy, only those transformants expressing
the cloned methylase will grow on plates containing erythromycin. A second
resistance marker, contained on the shuttle vector, must be selected for in
addition to erythromycin resistance due to the likelihood of spontaneous
erythromycin resistant revertants, frequently observed with this particular host
strain, which possesses an unknown cell wall mutation that results in
susceptibility to MLS antibiotics. Successful expression of Gram-positive MLS
resistance deteminants has been achieved in this particular host strain.
![Page 74: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/74.jpg)
however, in light of the fact that expression of a methylase obtained from a
Gram-positive organism may be unsuccessful in a Gram-negative host. Bacillus
subtilis has been successfully shown to express methylase genes cloned frorn
Gram-positive organisms (Katz et al., 1987).
![Page 75: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/75.jpg)
7.0) REFERENCES
Allignet, J., Loncle, V., Mazodier, P., and N. El Solh. (1988). Nucleotide
sequence of a staphylococcal plasmid, vgb, encoding a hydrolase inactivating
the 6 components of virginiamycin-like antibiotics. Plasmid, 20:271-275.
Allignet, J., and Na El Solh. (1992). Sequence of a staphylococcal plasmid
gene, vga. encoding a putative ATP-binding protein involved in resistance to
virginiamycin A-like antibiotics. Gene. 1 17:45-51.
Allignet, J., V. Loncle, C. Simenel, M. Delepierre, and N. El Solh. (7993).
Sequence of a staphylococcal gene, vat, encoding an acetyltransferase
inactivating the A-type compounds of virginiamycin-like antibiotics.
Gene 1 3O:W -98.
Allignet, J., and Na El Solh. (1995). Diversity among the Gram-positive
acetyltransferases inactivating streptogramin A and stnicturally relûted
compounds and characterization of a new staphylococcal determinant, vatB.
Antimicrobial Agents and Chemotherapy, 39:2027-2036.
Allignet, J. S. Aubert, A. Morvan, and N. El Solh. (1996). Distribution of genes
encoding resistance to streptograrnin A and related compounds among
staphylocacci resistant to these antibiotics. Antimicrobial Agents and
Chemotherapy. 40:2523-2528.
Allignet, J., Loncle, V., and N. El Solh. (1997). Characterization of a new
staphylococcal gene, vba0, encoding a putative ABC transporter conferring
resistance to streptogramin A and related compounds. Gene, 202: 133-1 38.
![Page 76: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/76.jpg)
Allignet, J., N. Liassine, and N. El Solh. (1998). Characteriration of a
staphylococcal plasmid related to pu61 10 and canying two novel genes, vatC
and vgb6, encoding resistance to streptogramins A and 6 and similar antibiotics.
Antimicrobial Agents and Chemotherapy, 42: l794-Iï98.
Andremont, A., O. Gerbaud, and P. Courvalin. (1 986). Plasmid-mediated high-
level resistance to erythromycin in Escherichia coli. Antimicrobial Agents and
Chemotherapy, 29:515-5 18.
Argoudelis, A.D., and J.H. Coats. (1 969). Microbial transformation of
antibiotics. II. Phosphorylation of linwsamycin by Streptomyces species. Journal
of Antibiotics. 22(7):341-343.
Argoudelis, A.D., and J.H. Coats. (1 971 ). Microbial transformation of
antibiotics. V. Clindamycin ribonudeotides. 93(2):534-535.
Arthur, M., D. Autissier, and P. Courvalin. (1986). Analysis of the nucleotide
sequenœ of the ereB gene encoding the erythromycin esterase type II. Nucfeic
Acids Research, 14: 4987-4999.
Arthur, M., A. Andremont, and P. Courvalin. (1987). Distribution of
erythromycin esterase and rRNA methylase genes in members of the family
Enterobacteriaceae highly resistant to erythromycin. Antimicrobial Agents and
Chemotherapy, 31 404409.
Axelsson, L X , S.I. Ahme, M.C. Andersson, and S.R. Stahl. (1988).
Identification and cloning of a plasmid-encoded erythromycin resistance
determinant from Lactobacillus reuted. Plasmid, 20: 1 71 -1 74.
![Page 77: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/77.jpg)
Barthelemy, P., Dm Autissier, Ga Gerbaud, and P. Courvalin. (1984). Enzymic
hydrolysis of erythromycin by a strain of Eschenchia cdi: a new mechanism of
resistance. Journal of Antibiotics, 37: 1692-1 696.
Birnboim, HaCm and J. Doly. (1979). A rapid alkaline extraction procedure for
screening recombinant plasmid DNA. Nucleic Acids Research 7: 151 3-1 523.
Bozdogan, B., L. Berrezouga, and R Leclercq. (1997). A new resistance
gene, linB. confemng resistance to lincomycin by inactivation in Entemcoccus
feecium HM1 025, abstract C-66, p. 57. In Abstracts of the 37n lnterscience
Conference on Antimicrobial Agents and Chemotherapy 1997. American Society
for Microbiology, Washington, D.C.
Bozdogan, B., and R. Leclercq. (1 997-8). lntrinsic and acquired resistance to
dalfopristin (streptogramin A) in Entemcoccus spp., abstract C-79, p. 59. In
Abstracts of the 37" lnterscience Conference on Antimicrobial Agents and
Chemotherapy 1997. Amencan Society for Microbiology, Washington. D.C.
Brisson-Noel, A. and P. Courvalin. (1 987). Nucleotide sequence of the gene
IinA encoding resistance to lincosamides in Staphylococcus haemolyticus. Gene
30: 1 57-3 66.
Brisson-Noel, A., P. Delrieu, D. Samain, and P. Courvalin. (1988). Inactivation
of lincosamide antibiotics in Staphylococcus. Journal of Biological Chemistry
263:15880-15887.
Burridge, Ra, C. Warren, and 1. Phillips. (1986). Macrolide, lincosamide and
streptogramin resistance in Campylobacter jejunüco/i. Journal of Antimicrobial
Chemotherapy, 17:315-321.
![Page 78: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/78.jpg)
Clancy, J. J. Petitpas, Fm Dib-Hajj, W. Yuan, M o Cronan, A.V. Kamath, Je
Bergeron, and J.A. Retsema. (1 996). Molecular cloning and funciional analysis
of a novel macrolide-resistance deteminant, mefA, from Streptococcus
pyogenes. Molecular Microbiology, 22(5):867-879.
Cocito, Cm (1979). Antibiotics of the virginiamycin family, inhibitors which contain
synergistic components. Microbiological Reviews, 43: 145-1 98.
Cocito, Cm, M o Di Giambattista, Em Nyssen, and P. Vannuffel. (1997). Inhibition
of protein synthesis by streptogramins and related antibiotics. Journal of
Antimicrobial Chemotherapy, 39, Suppl. A, 7-13.
Cooksey, R e C o , Swenson, J.M., Clark, N.C., and Cm Thomsberry. (1989). DNA
hybridization studies of a nucleotide sequence horologous to transposon
Tn 1545 in the 'Minnesotan strain of multiresistant S?mptococcus pneumoniae
isolated in 1977. Diagnostic Microbiology and lnfectious Diseases 1 2: 1 3-1 6.
Coonan, KoM, and E.L. Kaplan. (1 994). In vitro susceptibility of recent North
American Group A streptococcal isolates to eleven oral antibiotics. Pediatric
lnfectious Oiseases Journal, 1 3:630-635.
Courvalin, P., C. Carlier, and YAm Chabbert. (1972). Plasmid-linked
tetracycline and ewhromycin resistance in group D Streptococcus. Annales
Institut Pasteur (Paris). 1 23:755-759.
Courvalin, P., H. Ounissi, and M. Arthur. (1 985). Multiplicity of macrolide-
lincosamide-streptogramin antibiotic resistance determinants. Journal of
Antimicrobial Chemotherapy, l6:gl -1 00.
![Page 79: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/79.jpg)
Courvalin, P. and C. Cariier. (1986). Transposable multiple antibiotic resistance
in Streptococcus pneumoniae. Molecular and General Genetics 205:291.
Coyle, M.B., B.H. Minshen, J.A. Land, and P.C. Hsu. (1979), Erythromycin
and clindamycin resistance in Corynebacterium diphthenae from skin lesions.
Antimicrobial Agents and Chemotherapy, 1 6:525-527.
De Meester, C., and J. Rondelet. (1976). Microbial acetylation of M factor of
virginiamycin. Joumal of Antibiotics, 29(l2): 1297-1305.
Dixon, J.M.S., and A.E. Lipinski. (1 974). Infections with &hemolytic
Streptococcus resistant to lincomycin and erythrornycin and observations on
zonal-pattern resistance to lincomycin. Joumal of lnfectious Diseases, I30:35l-
356.
Dutta, G.N., and L.A. Devriese. (1982). Resistance to macrolides, lincosamide,
and streptograrnin antibiotics and degradation of lincosamide antibiotics in
streptococci from bovine mastitis. Joumal of Antimicrobial Chemotherapy,
1 0:403-408.
Eady, E.A., J.I. Ross, J.H. Cove, K.T. Holland, and W.J. Cundliffe. (1989).
Macrolide-lincosamide-streptogramin B (MLS) resistance in cutaneous
propionibacteria: definition of phenotypes. Joumal of Antimicrobial
Chemotherapy. 23:493-502.
Eady, E.A., J.I. Ross, J.L. Tipper, C.E. Walters, J.H. Cove, and W.C. Noble.
(1 993). Distribution of genes encoding eqtthromycin ribosomal methylases and
an erythrornycin efflux pump in epidemiologically distinct groups of
staphylococci. Joumal of Antirnicrobial Chemotherapy, 3 1 :211-217.
![Page 80: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/80.jpg)
Feldman, LI., I.K. DiIl, C.E. Holmlund, H.A. Whaley, E.L. Patterson, and N.
Bohonos. (1964). Microbial transformations of macrolide antibiotics.
Antimicrobial Agents and Chemotherapy, 54-57.
Fernandez-Munoz, R., R.E. Monron, R. Torres-Pinedo, and D. Vasquez.
(1 971 ). Substrate- and antibiotic-binding sites at the peptidyl-transferase centre
of Escherichia col/ ribosomes. Studies on the chloramphenicol. lincomycin and
erythromycin sites. European Journal of Biochemistry, 23: 185-1 93.
Fierro, J.F., C. Vilches, Cm Hardisson, and JA. Salas. (1 989). Streptogramin-
inacüvating activity in three producer streptomycetes. FEMS Microbiology
Letters, 58:243-246.
Flickinger, M. and D. Perlman. (1 975). Microbial degradation of erythmmycin A
and B. Journal of Antibiotics, 28:307-311.
Fraimow, H., and Cm Knob. (1997). Amplification of macrolide efflux pumps msr
and meffrorn Enterococcus faecium by polymerase chah reaction, abstr. A-125,
p.22. In Prugram and Abstracts of the 97n General Meeting of the American
Society for Microbiology . American Society for Microbidogy , Washington, D.C.
Gilmore, M.S., O. Behnke, and J.J. Ferretti. (1982). Evolutionary relatedness
of MLS resistance and replication function sequences on streptococcal antibiotic
resistance plasmids, p. 174-1 76. In O. Schlessinger (ad.) , Microbiology - 1982.
American Society for M icrobiolog y. Washington. D.C.
Goldman, R.C., and J.O. Capobianco. (1 990). Role of an energy-dependent
efflux pump in plasmid pNE24-mediated resistance to 14- and 15-rnembered
![Page 81: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/81.jpg)
macrolides in Staphylococcus epidemidis. Antimicrobial Agents and
Chemotherapy. 34: 1973-1 980.
Hagman, K.E., W.P. Pan, B.G. Spratt, J.T. Balthazar, R.C. Judd, and W.M.
Shafer. (1 995) Resistance of Neissena gonorrhoeae to antimicrobial agents is
modulated by the mtrRCDE efflux system. Microbiology, 141 :611-622.
Horinouchi, S., W.H. Byeon, and B. Weisblum. (1983). A complex attenuator
regulates inducible resistance to macrolides, lincosamides, and streptogramin
type B antibiotics in Streptococcus sanguis. Journal of Bacteriology, 154: 1252-
1262.
Horinouchi, S., and B. Weisblum. (1980). Posttranscriptional modification of
mRNA conformation: mechanism that regulates eryüiromycin-induced
resistance. Proceedings of the National Academy of Science. USA. 77(12):7079-
7083.
Hou, C.T., Perlman, Dm, and Schallock, M.R. (1 970). Microbial transformation
and properties of peptide antibiotics. VI. Purification and properties of a peptide
lactonase hydrolyzing dihydrostaphylomycin S. Journal of Antibiotics. 70:35-42.
Janosi, 1.. and E. Ban. (1 982). Localization of the gene(s) determining inducible-
type macrolide and streptogramin B resistance on the penicillinase plasrnid of
isolates of an epidemic of Staphylococcus eureus strain. In Curent
Chemotherapy and Immunotherapy, Vol. II. Proceedings of the 1 2" ln ternational
Congress of Chemotherapy, Florence, Italy, 1 981 (Periti, P. and Grassi, G.G.,
Eds.), 91 8-91 9. American Society for Microbiology, Washington, DC.
![Page 82: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/82.jpg)
Janosi, Lm, Y. Nakajima, and Ha Hashimoto. (1 990). Characterization of
plasmids that confer inducible resistance to 1Cmembered macrolides and
streptogramin type B antibiotics in Staphylococcus aureus. Microbiology and
Immunology. 34:723-735.
Jenkins, G., Zalacain M., and E. Cundliffe. (1989). Inducible ribosomal RNA
methylation in Streptomyces lividans, conferring resistance to lincomycin.
Journal of General Microbiology 1 35:3281-3288.
Jenkins, G., and E. Cundliffe. (1991). Cloning and characterization of two
genes from Streptomyces lividens that confer inducible resistance to lincomycin
and macrolide antibiotics. Gene, 1 08:55-62.
Jenssen, W.D., S. Thakker-Varia, D.T. Dubin and M.P. Weinstein. (1987).
Prevalence of macrolides-lincosamides-streptograrnin B resistance and erm
gene classes among clinical strains of staphylococci and streptococci.
Antimicrobial Agents and Chemotherapy 31 : 883-888.
Johnston, N.J., J.C. de Azavedo, J.O. Kellner, and D.E. Law. (7998).
Prevalence and charactenzation of the mechanisms of macrolide, lincosamide,
and streptogramin resistance in isolates of Streptococcus pneumoniae.
Antimicrobial Agents and Chemotherapy, 42: 2425-2426.
Kataja, J., H. Seppala, M. Skumik, Hm Sarkkinen, and P. Huovinen. (1998).
Different erythromycin resistance mechanisms in group C and group G
streptococci. Antimicrobial Agents and Chemothera py, 42: 1493-1 494.
Katz, L., D. Brown, K. Boris, and J. Tuan. (1987). Expression of the macrolide-
lincosamide-streptogramin-B-resistance methylase gene, emE, from
![Page 83: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/83.jpg)
Streptomyces egdhraeus in Eschenchia coli results in N 6-monomethylation and
N ', N 64imethylation of ribosomal RNA. Gene 55:319-325.
Kim, C.H., N. Otake, and H. Yonehara. (1974). Studies on mikarnycin B
lactonase. 1. Degradation of mikamycin B Streptomyces mitakaensis. Joumal of
Antibiotics, 27:903-908.
Klugman, K.P., and H.J. Koornhof. (1988). Dnig resistance patterns and
serogroups or serotypes of pneumococcal isolates from cerebrospinat fluid or
blood, 1979-1986. Journal of Infectious Diseases, 1 58:956-964.
Kono, M, K. O'Hara, and T. Ebisu. (1992). Purification and characterization of
macrolide P'phosphotransferase type II from a strain of Eschenchia coli highly
resistant to macrolide antibioücs. FEMS Microbiology Letters, 76:89-94.
Kuo, M.S., D.G. Chirby, A.D. Argoudelis, J.I. Cialdella, J.H. Coats, V.P.
Marshall. 1989. Microbial glycosylation of erythromycin A. Antirnicrobial Agents
and Chemotherapy, 33:2089-2091.
Lampson, B.C., and J.T. Parisi. (1986). Naturally occurring Sfaphylococcus
epidermidis plasmid expressing constitutive macrolide-linwsamide-streptogramin
B resistance contains a deleted attenuator. Joumal of Bacteriology, 166:479-
483.
Le Goffic, Fm, M.L. Capmau, J. Abbe, C. Cerceau, A. Dublanchet, and J.
Duval. (1 977). Plasmid-mediated pristinamycin resistance: PH1 A, a
pristinamycin 1 A hydrolase. Annales Microbiologie (Paris). Nov.-Dec.
128 6~471-474,
![Page 84: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/84.jpg)
Leclerçq, R., and P. Courvalin. (1991). Bacterial resistance to macrolide,
lincosamide. and streptogramin antibiotics by target modification. Antimicrobial
Agents and Chemotherapy, 35: 1267-1 272.
Levy, SB. (1 992). Active efflux mechanisms for antimicrobial resistance.
Antimicrobial Agents and Chemotherapy, 36:695-703.
Mayford, M., and B. Weisblum. (1 985). Messenger RNA from Staphylococcus
aureus that specifies macrolide-lincosamide-streptogramin resistance:
demonstration of its conformations and of the leader peptide it encodes. Journal
of Molecular Biology 1 85:769-780.
McMuny, LM., A.M. George and S.& Levy. (1 994). Active efflux of
chloramphenicol in susceptible Eschenchia coli strains and in multiple-antibiotic
resistant (Mar) mutants. Antimicrobial Agents and Chemotherapy, 38: 542-546.
Milton, E.D., C.L. Hewitt, and C.R. Hamood. (1992). Cloning and sequencing
of a plasmid-mediated erythrornycin resistance determinant from Staphylococcus
xyîosus. FEMS Microbiology Letten. 97: 141 -1 47.
Mims, C.A., J.H.L. Playfair, I.M. Roitt, Dm Wakelin, R. Williams, R.M.
Anderson. (1993). Medical Microbology. Mosby Europe Limited, London.
Monod, M., C. Denoya, and D. Dubnau. (1986). Sequence and properties of
plM 13, a macrolide-lincosamide-streptogramin B resistance plasmid from
Bacillus sphaericus. Journal of Bacteriology, 167: 1 38-1 47.
Monod, M., S. Mohan, and Dm Dubnau. (1987). Cloning and analysis of emG,
a new macrolide-lincosamide-streptogramin B resistance plasmid from Bacillus
sphaericus. Journal of Bacteriology, 169340-350.
![Page 85: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/85.jpg)
Murray, B.E., K.V. Singh, J.D. Heath, B.R. Shanna, and G.M. Weinstock.
(1 990). Cornparison of genomic DNAs of different enterococcal isolates using
restriction endonucleases with infrequent recognition sites. Journal of Clinical
Microbiolog y 28:2059-2063.
National Committee for Clinical Laboratory Standards (NCCLS). 1997.
Methods for dilution antimicrobial susceptibility tests for bacteria that grow
aerobically, 4th ed. Approved standard M2-A6 and M7-A4. National Committee
for Clinical Laboratory Standards, Villanova, Pa.
Nelson, C.T., €.O. Mason, Jr., and S.L. Kaplan. (1994). Activity of oral
antibiotics in middle ear and sinus infections caused by penicillin-resistant
Streptococcus pneumoniae: implications for treatment. Pediatric lnfectious
Diseases Journal, 1 3: 585-589.
Nikaido, H. (1994). Prevention of dnig access to bactenal targets: pemeability
barriers and active efflux. Science, 264:382-388.
Noguchi, N., A. Emura, H. Matsuyama, K. O'Hara, M. Sasatsu, and M. Kono.
(1 995). Nucleotide sequence and characterization of erythromycin resistance
deteminant that encodes rnacrolide 2'-phosphotransfene I in Eschenchia coli.
Antimicrobial Agents and Chemotherapy, 39:2359-2363.
Noguchi, N., J. Katayama, and K. O'Hara. (1996). Cloning and nucleotide
sequence of the mphB gene for macrolide 2'ghosphotransferase II in
Escherichia coli. FEMS Microbiology Letters. 144: 1 97-202.
O'Hara, K. T. Kanda, K. Ohmiya, T. Ebisu, and M. Kono. (1989). Purification
and characterization of a macrolide 2'-phosphotransferase frorn a strain of
![Page 86: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/86.jpg)
Eschenchia coli that is highly resistant to erythromycin. Antimicrobial Agents and
Chemtherapy, 33: 1 354-1 357.
Ouinissi, H., and P. Courvalin. (1985). Nucleotide sequence of the gene ereA
encoding the ery&hromycin esterase in Escherichia coli. Gene, 35271-278.
Phillips, O., O. Parratt, G.V. Orange, 1. Harper, H. McEwan, and N. Young.
(1 990). Erythromycin-resistant Streptococcus pyogenes. Journal of Antimicrobial
Chemotherapy, 25:723-724.
PoyartSalmeron, C., P. TrieuCuot, C. Carlier, and P. Courvalin. (1991).
Nucleotide sequences specific for Tn I 5 6 l i ke conjugative transposons in
pneumococci and staphylowcci resistant to tetracycline. Antimicrobial Agents
and Chemotherapy, 35: 1657-1 660.
Quintilliani, Jr., R. and P. Countalin. (1996). Mechanisms of resistance to
antimicrobial agents. In Manual of Clinical Microbiology, ed. Murray et al. ASM
Press, Washington, D.C. 1 308-1 326.
Rende-Fournier, R., R Leclercq, M. Galimand, J. Duval, and P. Courvalin.
(1993). Identification of the satA gene enooding a streptogramin A
acetyltransferase in Entemcoccus faecium BM4145. Antimicrobial Agents and
Chemotherapy, 37:2 1 1 9-21 25.
Rinckel, L.A., and D.C. Savage. (1 990). Characterization of plasmids and
plasmid-borne macrolide resistance from Lactobacillus sp. Strain 100-33.
Plasmid 23: 1 1 9-1 25.
Ross, J.E., A.M. Farrell, E.A. Eady, J.H. Cove, and W.J. Cundliffe. (1989).
Characterisation and molecular cloning of the novel macrolide-streptogramin 6
![Page 87: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/87.jpg)
resistance determinant from Stephy/ococcus epidennidis. Journal of
Antimicrobial Chemotherapy ,24: 851 -862.
Ross, J.I., E.A. Eady, J.H. Cove, W.J. Cundliffe, S. Baumberg, and J.C.
Wootton. (1 990). lnducible erythromycin resistance in staphylococci is encoded
by a member of the ATP-binding transport supergene family. Molecular
Microbiology. 4: 1207-1 2 14.
Ross, J.E., €.Am Eady, J.H. Cove, and S. Baumberg. (1995). Identification of a
chrornosomally encoded ABC-transport system with which the staphylococcal
MsrA may interact. Gene, 153:93-98.
Ruoff, K. (1995). Streptococcus. p. 299-307. In "Manual of Clinical
Microbiology". ed. Murray et al. ASM Press, Washington. D.C.
Salaki, J.R., Ra Balck, F.P. Tally, and J.W. Kislak. (1976). Bacteroides fragilis
resistant to the administration of clindamycin. American Journal of Medicine
60~426428.
Sanbrook, J., E.F. Fritsch, and T. Maniatis. (1 989). Molecular cloning: a
laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
N.Y.
Schoner, B. M. Geistlich, P. Rosteck, Jr., R.N. Rao, E. Seno, K. Cox,
S. Burgett, and C. Hershberger. (1 992). Sequence similarity between
macrolide-resistance determinants and ATP-binding transport proteins. Gene,
1 1 5:93-96.
![Page 88: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/88.jpg)
Seppala, H. , A. Nissinen, Q. Yu, and P. Huovinen. (1993). Resistance to
erythromycin in Group A streptococcus. New England Journal of Medicine,
3262929297.
Seppala, H., M. Skurnik, H. Soini, M. Roberts, and P. Huovinen. (1998). A
novel erythromycin resistance methylase gene (ennTR) in Streptococcus
pyogenes. Antimicrobial Agents and Chemotherapy 42:257-262.
Shoemaker, N.B., E.P. Guthrie, A.A. Salyers, and J.F. Gardner. (1985).
Evidence that the clindamycin-erythromycin resistance gene of the Bacteroides
plasmid pBG4 is on a transposable element. Journal of Bacteriology 162:626-
632.
Shorbidge, V.D., R.K. Flamm, N. Ramer, J. Beyer, and S.K. Tanaka. (1996).
Novel mechanism of macrolide resistance in Streptococcus pneumoniae.
Diagnostic Microbiolog y and lnfectious Diseases, 26:73-78.
Skinner, R., E. Cundliffe, and F.J. Schmidt. (1983). Site of action of a
ribosomal RNA methylase responsible for resistance to ewhromycin and other
antibiotics. Journal of Biological Chemistry 258: 1 2702-1 2706.
Smith, A.M., K.P. Klugman, T.J.Coffey, and B.G. Spratt. (1993). Genetic
diversity of penicillin-binding protein 20 and 2X genes from Streptococcus
pneumoniae in South Africa. Antimicrobial Agents and Chemotherapy 37:1938-
1 944.
Southern, E.M. (1975). Detection of specific sequences among DNA fragments
separated by gel electrophoresis. Journal of Molecular Biology 98:503-17.
![Page 89: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/89.jpg)
Stingemore, Na, G.R.J. Francis, M. Toohey, and D.B. McGechie. (1989). The
emergence of elyairomycin resistance in Streptococcus pyogenes in Fremantle,
Western Australia, Medical Journal of Australia, 150:626-631.
Sutcliffe, J., A. Tait-Kamradt, and L. Wondrsck. (1 996-A). Streptococcus
pneumoniae and Streptococcus pyogenes resistant to macrolides but sensitive
to clindamycin: a common resistance pattern mediated by an afflux system.
Antimicrobial Agents and Chemotherapy, 40: 181 7-1 824.
Sutcliffe, J., Tm Grebe, A. Tait-Kamradt, and Lm Wondrack. (1996-8). Detection
of erythromycin-resistance determinants by PCR. Antimicrobial Agents and
Chemotherapy, 40:2562-2566.
TaitXamradt, A., J. Clancy, M. Cronan, Fm Dib-Hajj, Lm Wondrack, W. Yuan,
and J. Sutcliffe. (1 997). mefE is necessary for the erythromycin-resistant M
phenotype in Streptococcus pneumoniae. Antimicrobial Agents and
Chemotherapy, 41 :2251-2255.
'Thakker-Varia, S., A.C. Ranzini, and D.T. Dubin. (1985). Ribosomal RNA
methylation in Staphylococcus aumus and Escherichia colk effect of the "MLSn
(erythromycin resistance) methylase. Plasmid 14: 1 52-1 61 .
Weisblum, B. (1 995). Erythromycin resistance by ribosome modification.
Antirnicrobial Agents and Chemotherapy 39:577-585.
Wilkins, T.D., and Tm Thiel. (1 973). Resistance of some species of Clostndium
tu clindamycin. Antimicrobial Agents and Chernotherapy 13:884-887.
![Page 90: degree - University of Toronto T-Space · Macrolides are the most commonly used antibiotics for community acquired pneumonia, and are an important alternative for the treatment of](https://reader034.vdocuments.mx/reader034/viewer/2022042220/5ec6216d8d12144b8d424c58/html5/thumbnails/90.jpg)
Wondmck, Lm, M. Massa, B.V. Yang, and J. Sutcliffe. (1996). Clinical strain of
Staphylococcus aureus inactivates and causes efflux of macrolides.
Antimicrobial Agents and Chernotherapy, 40:992-998.
Wootton, J-C. and M.H. Drummond. (1989). The Q-linker: a class of
interdomain sequences found in bacterial rnultidomain regulatory proteins.
Protein Engineering, 2535-543.