MOLECULAR AND CELLULAR BIOLOGY, Aug. 2003, p. 5446–5459 Vol. 23, No. 150270-7306/03/$08.00�0 DOI: 10.1128/MCB.23.15.5446–5459.2003Copyright © 2003, American Society for Microbiology. All Rights Reserved.

Defective T-Cell Activation Is Associated with AugmentedTransforming Growth Factor � Sensitivity in Mice with

Mutations in the Sno GeneS. Pearson-White1,2* and M. McDuffie1

Departments of Microbiology1 and Biochemistry and Molecular Genetics,2 University of Virginia MedicalCenter, Charlottesville, Virginia 22908

Received 31 January 2003/Returned for modification 4 March 2003/Accepted 8 May 2003

The proto-oncogene Sno has been shown to be a negative regulator of transforming growth factor beta(TGF-�) signaling in vitro, using overexpression and artificial reporter systems. To examine Sno function invivo, we made two targeted deletions at the Sno locus: a 5� deletion, with reduced Sno protein (hypomorph), andan exon 1 deletion removing half the protein coding sequence, in which Sno protein is undetectable inhomozygotes (null). Homozygous Sno hypomorph and null mutant mice are viable without gross developmentaldefects. We found that Sno mRNA is constitutively expressed in normal thymocytes and splenic T cells, withincreased expression 1 h following T-cell receptor ligation. Although thymocyte and splenic T-cell populationsappeared normal in mutant mice, T-cell proliferation in response to activating stimuli was defective in bothmutant strains. This defect could be reversed by incubation with either anti-TGF-� antibodies or exogenousinterleukin-2 (IL-2). Together, these findings suggest that Sno-dependent suppression of TGF-� signaling isrequired for upregulation of growth factor production and normal T-cell proliferation following receptorligation. Indeed, both IL-2 and IL-4 levels are reduced in response to anti-CD3� stimulation of mutant T cells,and transfected Sno activated an IL-2 reporter system in non-T cells. Mutant mouse embryo fibroblasts alsoexhibited a reduced cell proliferation rate that could be reversed by administration of anti-TGF-�. Our dataprovide strong evidence that Sno is a significant negative regulator of antiproliferative TGF-� signaling in bothT cells and other cell types in vivo.

Sno and Ski are the two most closely related members of theSki/Sno proto-oncogene family. A third family member, Dach,is very distantly related and plays a role in central nervoussystem, eye, and skeletal-muscle formation (9, 24, 26). The Snoand Ski proteins localize to the nucleus (59) and appear tofunction as transcriptional activators or repressors (18, 43, 62).Loss of either Sno or Ski enhances tumor development in mice(52, 53), a phenotype also seen in the absence of E2F-1, adownstream mediator of transforming growth factor �(TGF-�) activity, and with other defects in TGF-� activity orsignaling (20, 67, 72). Both Sno and Ski appear to functionthrough interaction with other proteins that bind GTCTAGAC(11, 43), a consensus binding element for Smads, which areeffector molecules for TGF-� signaling (29, 65). Indeed, bothSno and Ski can pair with Smad2, Smad3, and Smad4, repress-ing Smad trans-activation of target genes in vitro (1, 36, 56–58,71). The complex regulatory interaction between Sno and theTGF-� pathway appears to involve both positive and negativefeedback. Initially, TGF-� signaling induces degradation ofSno via Smad-dependent recruitment of the ubiquitin-depen-dent proteosome and the anaphase-promoting complex (4, 55).TGF-� later induces Sno expression, which then is thought torepress expression of TGF-�-responsive genes in a negativefeedback loop (56). Sno- and Ski-mediated inhibition of TGF-�-induced gene expression appears to be effected by histone

deacetylase recruitment (44, 52). However, Sno and Ski canalso be shown to interact with other transcription factors, in-cluding TafII110 (11), N-CoR/SMRT (nuclear hormone recep-tor corepressor), Sin3A, and Rb (44, 52, 63).

Human Sno and Ski share a 106-amino-acid amino-terminaldomain with 82% identity at the amino acid level. They appearto interact with each other through a 55% identical carboxyl-terminal region that includes two predicted �-helical coiledcoils (25, 41). Sno and Ski are differentially expressed in somemature tissues and respond differently to several signals, sug-gesting that they produce nonredundant effects in vivo. It hasbeen shown that Sno (but not Ski) is induced with immediate-early kinetics upon serum stimulation of quiescent mouse10T1/2 fibroblasts (46). Sno is also selectively induced upon theonset of muscle cell differentiation, peaking prior to MyoD andmyogenin induction (40). Although Sno and Ski are both cellcycle regulated in cycling myeloid cells in culture, with mRNAlevels peaking in the early to mid-G1 phase of the cell cycle(45), these genes are differentially expressed in the cells oflymphoid lineages (45). It has been shown that Sno is selec-tively expressed in T lymphocytes but not in B lymphocytes,whereas Ski is expressed in both cell types (45). In this report,we show that Sno is expressed in the earliest stages of thymo-cyte development and in the spleen as soon as it is formed. Snois also present in unstimulated primary mouse splenocytes inthe adult and is upregulated within 1 h of T-cell receptorstimulation. Because of its restriction to cells of the T-lympho-cyte lineage and its suspected relationship to TGF-� signaling,we hypothesized that Sno might be important in preventingsuppressive TGF-�-mediated antiproliferative activity in the

* Corresponding author. Mailing address: University of VirginiaHealth Sciences Center, Jordan Hall, Box 800734, Room 7034, Char-lottesville, VA 22908-0734. Phone: (434) 982-0756. Fax: (434) 982-1071. E-mail: sp3i@virginia.edu.

5446

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 27

Dec

embe

r 20

21 b

y 12

6.76

.67.

16.

initial steps of T-cell activation during a productive immuneresponse.

To characterize Sno function in lymphoid cells and othercells in vivo, we used homologous recombination gene target-ing in mice to make two deletion mutations. A 5� deletion,removing 1.7 kb of regulatory sequences at the 5� end of theSno gene, leaves coding sequences intact. This mutation de-creased Sno mRNA and protein expression to low basal levelsbut appeared to leave activation-induced increases intact. Asecond construct deleted exon 1, removing the coding se-quences for the first half of the protein and effectively elimi-nating Sno expression in homozygous mice. Mice homozygousfor either deletion are viable and show no deviant phenotypeon gross inspection in either a C57BL/6, 129/Sv, or mixed129/Sv-C57BL/6 genetic background. However, both muta-tions caused a reproducible defect in T-cell activation, accom-panied by signs of increased sensitivity to TGF-�. The mutantdefect is rescued by the addition of exogenous interleukin-2(IL-2) to the cultures. This suggests a direct relationship be-tween Sno activity and the production of proproliferative cy-tokines. Indeed, we found that Sno-null splenocytes expressreduced levels of IL-2 as well as IL-4 and that Sno overexpres-sion can trans-activate the IL-2 promoter in transfection assays.These results suggest that Sno functions early in the T-cellactivation pathway(s) to inhibit tonic TGF-� modulation of thepathway in response to strong activating signals and that earlyresponse of the Sno gene to T-cell receptor triggering is re-quired for optimal IL-2 production and subsequent T-cell pro-liferation.

MATERIALS AND METHODS

RNA isolation and RT-PCR. RNA was isolated as described previously (10)and reverse transcribed using random hexamer primers. Reverse transcription(RT)-PCR is performed with specific primers and [32P]dCTP in the reaction.Pilot studies were used to determine the conditions for linear incorporation of32P with the amount of input RNA (27 cycles with 0.7 �g of total RNA for Snoand 0.05 �g for GAPDH [glyceraldehyde-3-phosphate dehydrogenase] [Table1]) (17, 49). One-fifth of the [32P]dCTP-labeled reaction mixture was loaded ona 5% acrylamide gel, electrophoresed, exposed to a phosphor screen, andscanned for image analysis. The band identities were confirmed by the band sizes

and by Southern blot hybridization of cold RT-PCR products to radiolabeled Snoprobes (not shown). Real-time PCR was performed, using SYBR Green dye andprimer concentration conditions that we optimized in pilot experiments, in aPrism 7700 sequence detector (Applied Biosystems, Inc., Foster City, Calif.).Oligonucleotide primer sequences and template amounts are presented in Table1. Real-time PCR for IL-2 and IL-4 was performed using predeveloped TaqManprimers (Applied Biosystems, Inc.).

Splenocyte stimulation. Splenocytes were isolated from unprimed C57BL/6mice (Fig. 1) or B6;129/Sv mice of the different genotypes and plated on 10-cm-diameter dishes precoated with 100 �g of anti-CD3ε (�CD3) antibody/ml (cat-alog no. 145-2C11; BD Biosciences Pharmingen, San Diego, Calif.). Adherentcells were harvested after 1 to 48 h for RNA isolation. Both adherent andnonadherent cells were collected for immunophenotyping; some splenocyteswere harvested prior to plating (zero hour).

Targeting vector and gene targeting. A 20-kb 129/Sv strain mouse Sno genomicDNA clone in lambda FIX II (Stratagene) phage was used to generate thetargeting vectors. A pGK-neo gene expression cassette (50) was substituted for1.7 kb of Sno promoter immediately upstream of the NcoI site at the ATGtranslation initiation codon (Fig. 2A). The similarity of the sequence of thisregion in the mouse Sno gene to the chicken genomic Sno sequence (21) led usto expect that this deletion would remove promoter elements controlling Snoexpression. The Sno5� construct also deleted the 500-nucleotide (nt) 5� untrans-lated region and the context for the initiation of translation. Fill-in of the NcoI5� overhang to make a blunt end disrupted the NcoI recognition site but regen-erated the ATG codon (boldface); the Kozak consensus context was altered fromGTGGCCATGG to GAATTCATGG. Since the coding region remained intact inthe 5� mutant, we generated another allele deleting all of exon 1 (designatedex1), thus deleting all of the biological activities so far described for Sno (Fig.2A). A lacZ gene with a nuclear localization signal was substituted for the exon1 coding sequences that were deleted. The targeting constructs (Fig. 2A and 3A)were electroporated into R1 ES cells (42) and selected in 200 �g of G418/ml onirradiated G418-resistant mouse embryo fibroblast (MEF) feeders isolated fromour TgN(pGKneo)066Spw transgenic mice. ES clones exhibiting homologousintegration of the targeting vector (n � 2 for 5� and n � 4 out of the 12 clonesisolated for ex1) were thawed, expanded briefly, injected into C57BL/6 blasto-cysts, and implanted into pseudopregnant recipient mice, which were allowed todeliver litters (7). We obtained one or more germ line-transmitting male chime-ras for each line. One line of Sno5� was chosen for further analysis. Two lines ofSnoex1 were studied and behaved identically; the results reported here were fromone of these lines. Animal use complied fully with federal guidelines, with priorapproval of the animal protocol by the Institutional Animal Care and UseCommittee.

Immunoprecipitation of Sno protein. To examine Sno protein, 13.5-day post-coitum (dpc) embryos were eviscerated and homogenized in 10 ml of RIPAbuffer per g of tissue (56) with fresh protease inhibitor cocktail (Complete;Roche Applied Science, Indianapolis, Ind.). Eviscerated embryos were usedbecause LacZ staining of embryos (not shown) revealed them to have the highest

TABLE 1. Oligonucleotide primer sequences and conditions

GeneOligonucleotide Annealing

temp (°C) Size (nt) Amt of template(�g in 50 �l) 5�- to-3� sequence

5� 3�

SnoN, SnoN2 oM094 62 427, 289 0.7 CTGCTGCGTCCCAGTCTAoM065 TGAACTGCTCAGCATCTCCACCTCCAT

Ski oM099 62 283 0.7 GTTTTGGGTCTTATGGAAGCTGGGGGCTCoM100 GCTGCCTGCATCCAGTGCCTCGACTGCCGCCTCATGT

IL-2a oM245 60 413 0.0125 TTCAAGCTCCACTTCAAGCTCTACAGCGGAAGoM246 GACAGAAGGCTATCCATCTCCTCAGAAAGTCC

IL-2R�a oM257 60 700 0.0125 ATGGAGCCACGCTTGCTGATGTTGoM258 CCATTGTGAGCACAAATGTCTCCG

IL-4a oM247 60 357 0.025 CCAGCTAGTTGTCATCCTGCTCTTCTTTCTCGoM248 CAGTGATGTGGACTTGGACTCATTCATGGTGC

GAPDHa oM205 62 983 0.05 TGAAGGTCGGTGTGAACGGATTTGGCoM206 CATGTAGGCCATGAGGTCCACCAC

L7 oM092 62 210 0.7 GGAGCTCATCTATGAGAAGGCoM093 AAGACGAAGGAGCTGCAGAAC

JunB oM277 60 134 0.6 GTTCCTGGCTCTTAGTTTGCCGoM278 CTGGAGTCCGTGAATTGGATTG

a Sequences originally from Clontech.

VOL. 23, 2003 DEFECTIVE T-CELL PROLIFERATION IN Sno MUTANT MICE 5447

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 27

Dec

embe

r 20

21 b

y 12

6.76

.67.

16.

expression of Sno protein. Precleared lysates were immunoprecipitated over-night with anti-Sno polyclonal antibody (H317; Santa Cruz Biotechnology, SantaCruz, Calif.) or preimmune serum, electrophoresed, Western blotted using amixed anti-Sno monoclonal antibody probe generously provided by ShunsukeIshii (52) and goat anti-mouse horseradish peroxidase-coupled secondary anti-

body (Sigma, St. Louis, Mo.), and developed by Western Lightning chemilumi-nescent detection (New England Nuclear, Boston, Mass.).

T-cell proliferation assay for function of unprimed T cells. Spleen cells fromlittermates of each genotype were seeded into microwells. The following stimu-lation conditions were employed: 10 ng of 145-2C11 (�CD3)/well plate-bound in96-well plates, 50 ng of phorbol myristate acetate (PMA)/ml with 1 �g of iono-mycin/ml, and 20 U of recombinant human IL-2/ml. Recombinant humanTGF-�1 (catalog no. 240-B; R& D Systems, Minneapolis, Minn.) was used at 100pM. Anti-TGF-� antibody (MAB1835, clone 1D11 anti-TGF-�1, -�2, -�3; R&DSystems) was used at 2 �g/ml. Cells were incubated for 66 h at 37°C with astimulator in the medium or plate bound and then for an additional 6 h with[3H]thymidine and were then harvested onto glass fiber filters (Tomtec harvesterand Wallac 1450 MicroBeta scintillation counter; Perkin-Elmer, Boston, Mass.)and counted in scintillation fluid to determine the [3H]thymidine incorporation.

Transient transfections and luciferase assays. 10T1/2 cells (3 � 105 per 60-mm-diameter plate) were transfected with 1 �g of reporter with or without 2 �gof Sno expression construct in a total DNA mass of 3 �g using lipofectAMINE(Gibco-Invitrogen, Grand Island, N.Y.). Transfections and assays were done intriplicate. Cells were harvested 48 h after transfection in groups of six or fewerto minimize variations in activity (8). The washed cell monolayers were scrapedinto reporter lysis buffer (Promega, Madison, Wis.) for harvest. The lysates wereassayed for protein concentration (6) (Bio-Rad [Hercules, Calif.] protein assay),and 50 �g of protein from each sample was measured into tubes in duplicate forluciferase assays in a Pharmingen luminometer with Promega dual-injectionreagents. An internal transfection control, such as pSV�gal, was not includedwith each experimental sample, since it had been demonstrated that Sno acti-vates the simian virus 40 and several other enhancers and distorts the control (K.Jessen and S. Pearson-White, unpublished data), as does Ski (32). pSV�galtransfection controls were done in parallel and stained for LacZ activity (RocheApplied Science) to compare the transfection efficiencies of MEFs of differentgenotypes.

Cell proliferation assay. MEFs were isolated by trypsinizing and mechanicallydissociating 13.5-dpc embryo carcasses as described previously (2). Multipleseparate cell preparations were tested for each genotype. MEFs were plated atequal densities in quadruplicate in 96-well plates at the appropriate concentra-tions of TGF-�; cultured for 24 h, with the final 3 h in [3H]thymidine; and thenharvested onto glass fiber filters and counted as described above to determine the[3H]thymidine incorporation. Anti-TGF-� antibody (MAB1835; R&D Systems)was used at 2 �g/ml.

Statistics. Statistical significance was calculated using the paired one-tailedStudent’s t test. The probabilities given are the calculated likelihood that the twosets of values are from the same population. All experiments were performedcompletely at least three times; representative data from one typical experimentare shown.

RESULTS

Sno mRNA expression in the immune system. Two isoformsof Sno mRNA have been described (46, 47). SnoN is theproduct of the full-length mRNA. The SnoN2 isoform (alsocalled sno-dE3) is generated by use of an internal alternativesplice donor site within exon 3 (46, 47). The SnoN2 transcriptis 138 nt shorter than SnoN, predicting the translation of aprotein product missing a 46-amino-acid segment (46, 47).Mouse Sno expression contrasts with that of the human gene,which produces SNON2 as a minor percentage of total SNOmRNA in the tissues examined (46). Mouse SnoN and SnoN2mRNAs are expressed throughout thymocyte and splenocytedevelopment, appearing first in thymic progenitor cells at 13.5dpc (Fig. 1A and B), as determined by semiquantitative 32PRT-PCR. The ratio between SnoN and SnoN2 is 1:4 in spleenand in thymus tissue at most ages tested (Fig. 1A and B) but iscloser to 1:1 in embryonic 13.5-dpc thymic cells. These expres-sion levels and ratios were confirmed using isoform-specificprimers in real-time PCRs (data not shown). It has been shownthat the SnoN/SnoN2 ratio is also 1:4 in many nonhematopoi-etic tissues (e.g., in liver, kidney, and skeletal muscle) but isconsistently 1:1 in the brain (46). The functional significance of

FIG. 1. Sno is expressed in embryonic thymus and spleen from theearliest stages. (A and B) Thymus tissue (A) or whole spleens (B) wereisolated from outbred Swiss-Webster embryos or mice at the timesindicated (d, dpc), and then total RNA was purified and RT-PCR wasperformed with specific primers as described in Materials and Meth-ods. RT-PCR with GAPDH or L7 primers showed that reverse-tran-scribed-RNA was present in all samples in comparable amounts. Theimages shown are composites of phosphorimager files; the relationshipbetween the signal and image intensity is linear. Sno and Ski mRNAsare upregulated within 1 h after in vitro stimulation of primary spleno-cytes. (C) Splenocytes freshly isolated from wild-type mice were platedon plate-bound �CD3 antibody. Total RNA was isolated after 0, 1, or3 h of culture and subjected to RT-PCR using primers as described inMaterials and Methods. The calculated levels of SnoN and SnoN2mRNAs relative to zero time (set at 1), and independently verifiedusing real-time RT-PCR, are shown above the figure.

5448 PEARSON-WHITE AND MCDUFFIE MOL. CELL. BIOL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 27

Dec

embe

r 20

21 b

y 12

6.76

.67.

16.

the two isoforms is unknown, but tissue-specific differences intheir relative expression levels suggest important functionaldifferences between them.

Sno mRNA is induced upon T-cell receptor stimulation ofwild-type splenocytes. We had previously shown that serumstimulation of fibroblasts upregulates SnoN2 expression by 1 h,resulting in peak expression at 3 h (46). To examine whetherSno was inducible by antigen receptor triggering in T cells,splenocytes from unprimed mice were isolated and culturedfor 0, 1, or 3 h with plate-bound antibody specific for thereceptor-associated signaling molecule CD3ε, a strong prolif-erative stimulus for normal T cells. Increased expression ofboth SnoN and SnoN2 was detectable by 1 h after T-cell re-ceptor stimulation (Fig. 1C). The level of increase in Snoexpression was modest but was independently confirmed usingisoform-specific primers in real-time PCR experiments (datanot shown). SnoN2 mRNA remained the dominant isoform instimulated T cells, increasing by twofold in splenocytes within

3 h. As expected, autocrine growth factor signaling pathways,represented by IL-2, IL-2 receptor �-chain (IL-2R�), and IL-4mRNAs, were induced with slightly delayed kinetics relative toSno but were also detected by 3 h (Fig. 1C). Ski was alsoupregulated 2.5-fold upon T-cell receptor stimulation (Fig.1C).

Gene targeting produces altered expression of Sno in vivo.To examine Sno function in vivo, we performed gene targetingin mice. A pGK-neo gene expression cassette (50) was substi-tuted for 1.7 kb of Sno promoter immediately upstream of theNcoI site at the ATG translation initiation codon (Fig. 2A) tomake the 5� mutation. The coding region remains intact in thismutant, allowing a low basal level of expression of the entireSno gene product. A second mutant allele (ex1), generated bydeleting all of exon 1, removes that portion of the codingsequence responsible for all of the biological activities de-scribed to date for Sno (Fig. 3A). After electroporation into EScells, selection, and screening, 2 out of 160 clones (5�) and 12

FIG. 2. (A) Sno5� gene targeting construct [B6;129-TgH(Skir5�)1Spw]. The 6.1-kb EcoRI (RI) fragment that contained exon 1 from the Snogene was used to generate the targeting vector. An internal fragment extending from the NcoI site at the ATG translation start site to a BstEIIsite 1.7 kb upstream was replaced with the pGKneo cassette. This mutation is called 5� due to the removal of sequence 5� of the coding region.The deletion removes a HindIII site, and the resulting larger HindIII fragment (6.5 kb) hybridizes with a probe outside the targeting construct.With the wild-type gene, the probe hybridizes with a 3.5-kb HindIII band. The symbols for the pGKneo cassette, Bgl2 site, and HindIII site aredefined to the right of the figure. (B) Autoradiogram of Southern blot of 10 �g of DNA from ES cells and two targeted clones digested withHindIII, electrophoresed on a 1.2% agarose gel, alkaline blotted to Hybond N� (Amersham Biosciences, Piscataway, N.J.), and probed with theradiolabeled 3� probe shown in panel A. Clone 13 appears in duplicate at two concentrations. wt, wild type. (C) The NcoI site at the ATG codonis destroyed, but another is introduced in pGKneo that is closer to the probe, making a 7.4-kb band with the 5� probe; the wild-type band is 8.1kb. The autoradiogram shows a Southern blot of an NcoI digest from a wild type (�/�) and an Sno5��/ (�/) heterozygote probed with the 5�probe shown in panel A. (D) The pGKneo insert introduces a BglII site so that an exon 1 probe hybridizes with a 3.5- instead of a 5.3-kb bandwhen digested with BglII. The autoradiogram shows a Southern blot of a Bgl2 digest from a weanling Sno5��/ heterozygote intercross litter probedwith exon 1; three mice are homozygous mutant at the Sno locus.

VOL. 23, 2003 DEFECTIVE T-CELL PROLIFERATION IN Sno MUTANT MICE 5449

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 27

Dec

embe

r 20

21 b

y 12

6.76

.67.

16.

out of 200 clones (ex1) had undergone homologous recombi-nation at one allele of the Sno locus (Fig. 2B and C and 3B)and were successfully passed through the mouse germ line.

When bred from heterozygotes, mice homozygous for eithermutant Sno allele are viable at weaning (Fig. 2D and 3C) in theexpected 1:2:1 ratio in mice carrying a mixed 129/Sv-C57BL/6genetic background, as well as in mice backcrossed throughseveral generations onto either 129/Sv or C57BL/6. No grossmorphological defects have been noted in homozygotes carry-ing either mutation, and the mice are not subject to earlymortality on a mixed genetic background or after backcrossing.Maintenance of the lines on a 129/Sv background was difficult,probably because of reduced fertility of this strain. However,both mutant alleles were successfully propagated by backcross-ing them to C57BL/6. Heterozygote intercrosses were used togenerate animals for testing but not to propagate the line. Miceused in these studies resulted from intercrosses using the 11th

generation of backcrossing for Sno5� and the 3rd and 4thgenerations for Snoex1. Two independent lines initially estab-lished for the Snoex1 mutant gave identical results in pheno-typic screening.

Expression of Sno is highest in embryonic mouse skin; afterbirth, Sno expression is highest in brain tissue. In the Snoex1/

tissues, Sno poly(A)� mRNA was reduced below the limit ofdetection with a probe specific for the exon 1 sequence thatwas deleted (Fig. 4A, top, exon 1 probe). Using this exon 1probe, a minor amount of Sno mRNA with retarded mobilitywas detectable in the brains of mice homozygous for the Sno5�

mutation, which retains this sequence (Fig. 4A, exon 1 probe).Rehybridization with a separate probe for exons 2 to 5 showedthat although exon 1 was deleted from Snoex1/ mice, down-stream initiation produced a 6.4-kb 3�-end RNA species in thebrain, but there was much less produced in embryos (Fig. 4A,panels with the probe from exons 2 to 5, lanes 1 and 4). This

FIG. 3. (A) Snoex1 targeting construct [B6;129-TgH(Skirex1)2Spw]. The 6.1-kb EcoRI fragment described in the legend to Fig. 2 was used forthe 5� end, subcloning the first 4.4 kb up to the NcoI site into ApaI-NcoI-digested pSKTNLSLacZ (60, 61), generously provided by ShahragimTajbakhsh and Margaret Buckingham. pMMneoflox8 (23), generously provided by Tim Bender and Klaus Rajewsky, was cut with XbaI and ligatedto BamHI adaptor linkers (catalog no. 1108 and 1133; New England Biolabs) and then cut with HindIII and ligated into the BamHI-digested lacZconstruct (described above), together with a 4.1-kb BamHI/HindIII fragment purified from a downstream SphI genomic subclone. The symbol usedfor the loxP-flanked pMCIneo cassette is shown at the right. The targeting vector introduces two nearby BstXI sites that cleave a 14- to 16-kb bandthat hybridizes with both 5� and 3� flanking probes to give an apparent 12- or 7-kb band, respectively. This mutation is called ex1 to indicate thedeletion of exon 1 coding sequences. The PCR primers (asterisks) are oM263 (AATGTGAGCGAGTAACAACCCG) in the lacZ segment of thetargeting vector, oM264 (CCAACCAAACTCAACCATTACACC) in the Sno promoter, and oM265 (TTCACAGGAGGACTGCCATCATCC)in wild-type Sno. (B) Autoradiogram of Southern blot of 10 �g of DNA from eight ES clones digested with BstXI and probed sequentially withthe 5� and 3� probes (Fig. 2A). Four of the eight clones shown are targeted; the overall targeting frequency was 12 of 200. (C) PCR assay ofweanling heterozygote (�/) intercross mice; five homozygous mutant (/) animals are in this group. wt, wild type.

5450 PEARSON-WHITE AND MCDUFFIE MOL. CELL. BIOL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 27

Dec

embe

r 20

21 b

y 12

6.76

.67.

16.

species is not detected in the Sno5�/ tissue on Northernblots (Fig. 4A, panels with the probe from exons 2 to 5, lane 3)but is detectable using RT-PCR and primers spanning exons 3to 5 (data not shown). The probes used do not cross-react withSki. A faint background band (or doublet) at 4.8 kb is seenwith these probes and comigrates with mouse 28S RNA intotal-RNA Northern blots. Thus, we suspect that this faintband is due to the residual 28S RNA remaining after polyA�

purification and is not related to Sno or Ski. Rehybridization ofthe blot with a GAPDH probe showed that the lanes werecomparably loaded with RNA (Fig. 4A). Similar results wereobserved with RNAs from other tissues in both lines (data notshown), although lower expression levels in tissues other thanthese make definitive demonstration of decreased or absentmRNA levels less convincing.

Despite the presence of RNA derived from downstreamcoding sequence in Snoex1/ mice, no mature full-length pro-tein is detectable in these mice on immunoblots (Fig. 4B). Tocontrol for the possibility that truncated mutant proteins areproduced, we made Sno exon 1 deletion mutant cDNA con-structs containing only cDNA from exons 2 to 6 for SnoN andSnoN2 and used them to transfect 293T cells (Fig. 4B, lane tf’dtrunc N/N2). Transfected protein lysates were then electropho-resed in parallel with the lysates from embryo fibroblasts. Al-though a minor band of the appropriate size for truncatedSnoN2 (Fig. 4B, tf’d N2�ex1; 34 kDa) was observed in theSnoex1/-immunoprecipitated lane, no truncated SnoN bandis detected. The truncated SnoN2 band is also present in thewild-type lane at a similar level. It is therefore unlikely to beresponsible for the phenotypes observed in Snoex1/ cells.Since the Sno5� deletion leaves exon 1 coding sequence intact,we expected to see Sno protein in embryo lysates fromSno5�/ mice but at decreased levels based on the smallamounts of Sno mRNA detected by Northern blot analysis. Aspredicted, Sno protein was detected in mice homozygous forSno5� at reduced levels. We measured 40% as much Sno5�

protein as seen in wild-type mice, using densitometric mea-surement of the laser-scanned autoradiogram (Fig. 4B). Thepolyclonal antibodies used for the immunoprecipitation andthe monoclonal antibody mixture used for the blot hybridiza-tion are both capable of binding to any remaining carboxyl-terminal peptide that the 6.4-kb Snoex1/ mRNA might en-code. Thus, the homozygous Snoex1 mutation appears toeliminate Sno expression, as expected, while the Sno5� muta-tion significantly decreases Sno expression. An anti-Smad4probe detected comparable levels of Smad4 in mice of eachgenotype, suggesting no feedback alteration of Smad4 expres-sion in either line (Fig. 4B).

Sno mutations produce no gross phenotypic changes in ho-mozygous mice. At 3 months of age, littermates of all threegenotypes (Sno5�/, Snoex1/, and their Sno�/� siblings)displayed no differences in the gross morphology of any organsystem. Tissue sections from testis, salivary gland, skeletal mus-cles, heart, lung, and liver, as well as smears taken from bonemarrow and blood, were also unremarkable. No significantlyincreased incidence of somatic tumors has been observed up to2 years of age. Splenomegaly (enlarged spleen) was notedamong a few Sno5�/ and Sno5��/ mice �6 months old in amixed 129/Sv-C57BL/6 genetic background. However, weightsand cell counts of spleens harvested from mice at younger ages

FIG. 4. Sno mRNA and protein are expressed in wild-type but notmutant tissue. (A) Five micrograms of poly(A)� RNA from brain oreviscerated 13.5-dpc embryo tissue of mice of the indicated genotypeswas electrophoresed and subjected to Northern blotting. The blot washybridized with a probe for exon 1 and then stripped and rehybridizedwith a probe for exons 2 to 5 and then with a GAPDH probe to showthat the lanes were equally loaded with RNA. The probe used for eachautoradiogram is shown to the right of each blot. (B) To examine Snoprotein expression, lysates from wild-type or mutant eviscerated 13.5-dpc embryos were subjected to immunoprecipitation (IP) and Westernblotting (WB). Total protein lysates (140 mg of tissue per lane) wereimmunoprecipitated with anti-Sno polyclonal antiserum (�Sno) orpreimmune serum (pre). The immunoprecipitated products were elec-trophoresed on a 7.5% polyacrylamide Tris-glycine gel, blotted topolyvinylidene difluoride membranes, and probed with a mixture offour anti-Sno monoclonal antibodies (�Sno MAb) (52). X-Ray filmexposed by the enhanced chemiluminescence signal was laser scannedto make the image. 293T cells were transfected separately with Snoexpression vectors, immunoprecipitated with anti-FLAG-agarosebeads, and pooled to provide positive controls (tf’d SnoN/N2 at 80 and76 kDa; tf’d trunc N/N2 at 40 and 34 kDa). Aliquots of each mouseembryo lysate were electrophoresed, blotted, and probed with anti-Smad4 antibody (Santa Cruz) to show that equal amounts were loaded.Molecular mass markers (not shown) were used to measure the ap-proximate molecular masses of the bands.

VOL. 23, 2003 DEFECTIVE T-CELL PROLIFERATION IN Sno MUTANT MICE 5451

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 27

Dec

embe

r 20

21 b

y 12

6.76

.67.

16.

(2 to 6 months) or mice with a higher percentage of C57BL/6background have yielded no significant difference in the num-bers of splenocytes from wild-type and mutant Snoex1/ orSno5�/ spleens. Similarly, age- and sex-matched mutantmice and their sibling controls maintain similar numbers ofthymocytes.

T-cell subpopulations from thymus and spleen were ana-lyzed by flow cytometry. There were no significant differencesbetween homozygous mutants of either line and their siblingcontrols in thymocyte or splenocyte expression of the CD4,CD8, CD25, or CD62L differentiation antigens (data notshown). Sno is not expressed in B cells, and as expected, nodifferences in the percentages of B220� splenocytes were ob-served (data not shown). These results have remained consis-tent through 11 generations of backcrossing to C57BL/6 for theSno5� mutation.

Sno5��/� and Snoex1�/� splenocytes exhibit reduced T-cellactivation in response to T-cell receptor stimulation. The T-cell receptor complex consists of an antigen-specific het-erodimer, structurally related to immunoglobulin molecules,and an associated multimeric signaling complex designatedCD3. Plate-bound �CD3 antibody is a potent T-cell receptorstimulatory signal. Sno5�/ and Snoex1/ splenocytes have aT-cell proliferation response to �CD3 stimulation that is 15 to60% of wild type (Fig. 5A; 26 and 36% in the example shown).Heterozygote values were somewhat variable, ranging fromfully wild type to intermediate between wild type and homozy-gous mutant in many experimental replicates (data not shown).

Analysis on days 2 to 5 of culture showed that the peak pro-liferative response was on day 3 for both wild-type and mutantcultures; day 3 data are shown. Mutant splenocytes alsoshowed similar decreases in proliferative response after stim-ulation by the bacterial superantigen staphylococcal entero-toxin B and by mitomycin C-treated allogeneic spleen cells(data not shown), demonstrating that the proliferative defectseen in these mice is not restricted by the type of externalstimulus applied through the T-cell receptor or its signalingpartners.

Despite the defective proliferation seen in response to trig-gering through the T-cell receptor, T cells from Snoex1/ micecould proliferate well in culture after stimulation with thecombination of PMA and ionomycin. PMA and calcium iono-phores together bypass the early steps in T-cell activation thatrequire the T-cell receptor complex by direct activation ofdownstream intracellular signaling cascades (48). Interestingly,differences were noted in the ability of PMA-ionomycin toinduce proliferation of cells carrying the two Sno mutations:Sno5�/ cells proliferated only 75% as well as wild-type cellsin response to PMA-ionomycin, whereas Snoex1/ cells pro-liferated as well as the wild type under these conditions (Fig.5B). This may reflect differences in compensation by othergenes regulating cell growth that are invoked in Sno-null cellsbut not in the hypomorph.

Exogenous IL-2 also reverses the Sno mutant defect. T cellsrequire the support of growth factors in order to proliferateafter stimulation through the T-cell receptor complex. IL-2 is

FIG. 5. T-cell proliferation assays examining functions of unprimed T cells show that Sno5�/ and Snoex1/ mutant T cells have a T-cellactivation defect that is largely compensated for by addition of excess IL-2 or incubation with anti-TGF-� antibody. (A) Spleen cells fromlittermates of each genotype were seeded at a density of 500 � 103 responder cells per microwell in 96-well plates. The cells were incubated for66 h at 37°C and then for a final 6 h with 1 �Ci of [3H]thymidine and then harvested onto glass fiber filters to determine the [3H]thymidineincorporation. The numbers presented are kilocounts of [3H]thymidine per minute (background samples without stimulator were subtracted) inthe average of triplicate wells from a representative experiment. The error bars indicate the calculated standard deviations. For T-cell receptorstimulation of splenocytes, 10 ng of 145-2C11 �CD3 allogeneic major histocompatibility complex anti-T-cell receptor (T-cell receptor) monoclonalantibody was preincubated in each well as indicated (aCD3). Additional antibody or cytokines were added as indicated (TGFb, TGF-�). Controlwells had no �CD3 stimulator or other additions to the media and had very low proliferation. The genotypes were wild type (Sno�/�), Sno5�/,and Snoex1/. The asterisks indicate results that were statistically significantly (P � 0.05) different from the wild type. (B) Splenocytes werestimulated with PMA-ionomycin (PMA/io), with added cytokines as indicated. [3H]thymidine incorporation was measured on day 4 after plating.The genotypes were as in panel A. Representative experiments of 5 to 12 repetitions are shown in both panels.

5452 PEARSON-WHITE AND MCDUFFIE MOL. CELL. BIOL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 27

Dec

embe

r 20

21 b

y 12

6.76

.67.

16.

the major proproliferative cytokine produced to support clonalexpansion of antigen-activated T cells. It is primarily, if notexclusively, produced by T cells in vivo and functions in anautocrine, as well as a paracrine, fashion. Addition of IL-2 tocultures of Snoex1/ cells effectively reversed the proliferationdefect in response to �CD3 stimulation (Fig. 5A). AlthoughIL-2 completely restored the deficit in proliferative response inT cells from Snoex1/ mice, it only partially restored prolif-eration of Sno5�/ cells (66% of wild type). This differencewas observed consistently in all the repetitions of this experi-ment and mirrors the incomplete recovery of proliferative ca-pacity seen with PMA-ionomycin stimulation.

The Sno mutant defect may be due to reduced antagonism ofTGF-� signaling. TGF-� is known to inhibit T-cell activationthrough suppression of IL-2 production (5, 22, 31). Since Snohas been shown to suppress the response to signaling throughTGF-� receptors in other cell types (55, 56, 58), we testedwhether the Sno mutant defect in T-cell proliferation could bereversed by addition of panspecific anti-TGF-� antibody.Blocking endogenous TGF-� signaling with anti-TGF-� anti-body completely rescued the proliferation of the Snoex1/

mutant T cells in response to �CD3 stimulation. Althoughrescue of Sno5�/ T cells by anti-TGF-� antibody consistentlyappeared to be incomplete (averaging 75% of Snoex1 recov-ery), it was not statistically significantly different from the wildtype (P � 0.092) (Fig. 5A). Both wild-type and mutant cellswere sensitive to the addition of 100 pM exogenous recombi-nant TGF-�, showing severely reduced levels of proliferationunder these conditions (Fig. 5A). The addition of TGF-� re-duced cell proliferation of Sno mutant cells to the level ofunstimulated control cultures, whereas wild-type cells were notas completely inhibited from proliferating (Fig. 5A), consistentwith increased TGF-� sensitivity in mutant cells. High doses ofexogenous IL-2 could not completely reverse the suppressiveeffect of added TGF-� in either wild-type or mutant cells (Fig.5A), suggesting that inhibition of IL-2 production alone doesnot completely account for the inhibitory capacity of TGF-� atthis concentration.

IL-2 and IL-4 mRNAs are reduced in Sno-null splenocytesand are induced to lower levels after T-cell receptor stimula-tion. IL-2 and IL-4 mRNA levels were found to be lower inunstimulated Sno-null than in wild type splenic T-cell popula-tions (Fig. 6A), suggesting that steady-state levels of T-cellactivation in vivo are decreased in mutant mice. Although IL-2mRNA levels were higher 1 h after �CD3 stimulation in mu-tant cells than in wild-type controls, by 3 h (and at all subse-quent time points) mutant cells expressed significantly less IL-2mRNA than control cells (Fig. 6B). Upregulation of a secondcytokine, IL-4, after CD3 ligation was less in Snoex1/ splenicT cells than in the wild type at all time points tested (Fig. 6Aand B).

Sno trans-activates the IL-2 promoter in non-T cells. SinceSno deletion reduces the amount of IL-2 mRNA produced inresponse to �CD3 stimulation, we tested whether Sno couldregulate IL-2 gene expression. 10T1/2 fibroblasts were tran-siently cotransfected with an IL-2 promoter element (632 bp[28, 54]) driving a luciferase reporter (IL-2-lux) and expressionconstructs driving FLAG-tagged SnoN or SnoN2. Controltransfections were performed with IL-2-lux alone. IL-2-lux ac-tivity, in the absence of Sno constructs, was very low, as ex-

pected. Cotransfection with either SnoN or SnoN2 increasedluciferase activity �60-fold (Fig. 6C). Anti-FLAG immunopre-cipitates were used to confirm expression of the transfectedSno constructs (Fig. 6D). 32P RT-PCR demonstrated low-levelexpression of endogenous SnoN and SnoN2 in untransfected10T1/2 cells, while the levels were �50-fold higher in trans-fected cells (Fig. 6D). No additional T-cell-specific factorswere cotransfected, suggesting that Sno expression is sufficientto induce activation of IL-2 expression even in a non-T cell.

Sno-deficient embryo-derived fibroblasts also exhibit re-duced antagonism of TGF-� signaling. MEFs derived fromembryonic skin express Sno at high levels. Snoex1/ MEFsgrow more slowly than wild-type MEFs in the absence of addedTGF-� (P � 0.002) (Fig. 7). Furthermore, Sno5�/ andSnoex1/ cells show reduced proliferation rates at lowerTGF-� concentrations than wild-type cells (0.5 and 1.0 pMTGF-�) (Fig. 7B). Both results indicate increased sensitivity toTGF-�. Sno5�/ proliferation rates were reproducibly inter-mediate between the wild type and Snoex1/ at 0.5 pM TGF-�and below, possibly indicating a protein dosage effect (Fig. 7).Culture in the presence of anti-TGF-� boosted the levels ofproliferation of both mutant and wild-type MEFs almost two-fold over untreated cells (Fig. 7A). The observation that nei-ther Sno5�/ nor Snoex1/ proliferation was equal to that ofthe wild type in the presence of anti-TGF-� suggests thatadditional factors may be suppressing growth in Sno mutantMEFs independently of TGF-� signaling pathways.

Both Sno5� and Snoex1 mutations modulate the response ofthe TGF-�-responsive reporters 3TP-lux and A3-lux. To con-firm that Sno levels modulate TGF-� sensitivity, we tested theactivity of a TGF-�-responsive promoter in MEFs with thethree different genotypes. 3TP-lux is a composite reporter usedby other investigators to measure cellular TGF-� responses(70); it contains an element from the human PAI-1 promoter(30) together with a 3� multimerized tetradecanoyl phorbolacetate response element from the human collagenase gene(15) coupled with a luciferase coding sequence. 3TP-lux ex-pression is increased relative to the wild type in Sno5�/ andSnoex1/ cells in the absence of added TGF-� (P � 0.001)(Fig. 8A, control). Exogenous TGF-� increases 3TP-lux ex-pression in cells of all three genotypes, demonstrating thatTGF-� signaling is intact in each case (Fig. 8A). Compilationof data from five separate experiments showed a small butstatistically significantly higher activation of 3TP-lux by TGF-�in Snoex1/ cells than in wild-type cells (Fig. 8B). Luciferaseactivity in Sno5�/ cells was indistinguishable from that in thewild type in this compilation and is not shown. Cotransfectionof the reporter construct with SnoN reduced the level of 3TP-lux expression to below pretransfection levels (Fig. 8A), al-though the luciferase activity in Snoex1/ cells remainedhigher than in wild-type cells. Transfection of FLAG-taggedSnoN reversed the TGF-�-induced increase in activity of thereporter construct (Fig. 8A). In order to confirm that thetransfection efficiencies were comparable for all genotypes andpreparations of MEFs, we transfected a pSV�gal construct inparallel and stained for beta-galactosidase activity (Fig. 8C).Snoex1/ cells express LacZ in their nuclei because of theknock-in design. However, cytoplasmic staining is seen only incells exposed to the pSV�gal construct during the transfectionprocedure and appears with comparable frequencies for all

VOL. 23, 2003 DEFECTIVE T-CELL PROLIFERATION IN Sno MUTANT MICE 5453

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 27

Dec

embe

r 20

21 b

y 12

6.76

.67.

16.

three cell types (Fig. 8C). Similar results were obtained withthe A3-lux reporter construct, in which the activin responseelements are activated by Smad2/Smad4/FAST-1 or FAST-2(for forkhead activin signal transducer) (73) (Fig. 8D). Each ofthese transfections included a FAST-2 expression plasmid.Snoex1/ cells once again exhibited significantly increased lu-ciferase activity in the presence of TGF-�. In this instance,neither the control levels without added TGF-� nor the 8- to10-fold increase after addition of TGF-� was significantly dif-ferent from the wild type, suggesting that although Sno canrepress TGF-� signaling through Smad2/Smad4, it also worksthrough Smad3.

The TGF-� response of an endogenous gene, JunB, confirmsdifferential effects of the Sno5� and Snoex1 mutations onTGF-� signaling. We used quantitative real-time RT-PCR toexamine expression of JunB, a major target for induction byTGF-� (35, 38), in MEFs. The elevation of JunB levels inSnoex1/ MEFs was significantly (P � 0.019) above that seenin wild-type MEFs 2 h after TGF-� administration (Fig. 9A).

L7 ribosomal protein mRNA levels were similar in all samples,showing that equivalent amounts of template were used in allexamples (Fig. 9B). In some repetitions of this experiment,JunB was elevated in Snoex1/ cells in the absence of addedTGF-�, with an additional increase as shown in the presence ofTGF-�, but we consistently observed no effect in Sno5�/

mutant cells. This suggests that JunB expression in MEFs isrelatively insensitive to TGF-� signaling, since it appears thatthe low residual Sno protein levels in Sno5�/ mutant cellsmay provide enough TGF-� opposition to keep JunB at “wild-type” levels. The observation that a TGF-�-responsive endog-enous gene is expressed at elevated levels in response toTGF-� in Snoex1/ cells provides additional evidence thatSno is a significant modulator of TGF-� signals.

DISCUSSION

In this report, we show that Sno plays an important role inopposing TGF-� signaling in both lymphocytes and fibroblasts.

FIG. 6. (A and B) Sno mutant T cells express reduced IL-2 and IL-4 mRNAs prior to and after T-cell receptor (TCR) stimulation. Spleen cellsfrom littermates of each genotype were seeded in �CD3-coated 10-cm-diameter plates or harvested without plating (zero time point). The cellswere incubated for the indicated times at 37°C and harvested, and RNA was purified, reverse transcribed, and subjected to real-time TaqMan PCRin quadruplicate, using commercially available primer sets (Applied Biosystems, Inc.) and making a template dilution curve for quantification ofthe results. The asterisks indicate results that were statistically significantly (P � 0.05) different from the wild type. Amplifications of the 18S rRNAinternal control were similar in all samples (data not shown). Rescaled data from 0 and 1 h in panel B are presented in panel A. (C) Sno inducesIL-2 promoter activity. 10T1/2 fibroblasts were transiently transfected with 1 �g of IL-2-luciferase reporter, plus or minus 2 �g of expressionconstruct driving either SnoN or SnoN2 expression. An amount of each cell lysate corresponding to 50 �g of protein was used for each luciferaseassay. The results are expressed as n-fold activation above the level of the IL-2 luciferase reporter alone, which was set to onefold. The error barscorrespond to the calculated standard deviations for the triplicate dishes and duplicate measurements. The asterisks indicate results that werestatistically significantly (P � 0.02) different from the IL-2 luciferase reporter transfected alone. (D) 32P RT-PCR shows that SnoN and SnoN2 arepresent at endogenous levels in untransfected 10T1/2 cells and that the corresponding Sno isoform is expressed at high levels in transfected cells.Immunoprecipitation (IP) followed by Western blotting (WB) using the FLAG epitope tag on the Sno expression constructs confirmed that Snoproteins were overexpressed in transfected cell lysates.

5454 PEARSON-WHITE AND MCDUFFIE MOL. CELL. BIOL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 27

Dec

embe

r 20

21 b

y 12

6.76

.67.

16.

Sno mRNA is expressed in the thymus as early as embryonicday 13.5 postcoitum, and Sno expression continues throughadulthood. Sno mRNA is also expressed in the spleen at alldevelopmental stages from fetal to adult, with upregulation inprimary mouse splenocytes within 1 h of T-cell receptor stim-ulation in vitro. We examined the role of Sno in T-lymphocytefunction using two targeted deletions in mice: a hypomorphicmutation with a 1.7-kb deletion upstream of the ATG codon(Sno5�) and a null mutation with deletion of exon 1 (Snoex1)that removes the coding sequence for the entire domain re-sponsible for most known biological activities of Sno. BothSno5�/ and Snoex1/ mice have a defect in T-cell activationas measured by splenocyte proliferation in response to T-cellreceptor stimulation. The defect is partially reversed by sup-plementation with exogenous IL-2, supporting the idea thatSno functions early in the pathway that activates IL-2 expres-sion. This idea is further supported by the observation of re-duced IL-2 and IL-4 levels in unstimulated and �CD3-stimu-lated T cells and the demonstration that Sno trans-activates theIL-2 promoter in transient-transfection assays. SnoN andSnoN2 isoforms, which differ in the presence of a 46-amino-acid internal sequence, can both stimulate IL-2 upregulation.The T-cell proliferative defect is also reversed by incubationwith panspecific anti-TGF-� antibody during stimulation.Along with evidence for enhanced TGF-� signaling in MEFsfrom Sno mutants using both luciferase reporter constructs andan endogenous TGF-� target gene, JunB, our results confirmthat Sno is an important negative regulator of the known ef-fects of TGF-� signaling during T-cell activation, as suggestedby previous investigators (reviewed in reference 22). In addi-

tion to this “reactive” role for Sno, our data further suggestthat Sno functions constitutively to prevent tonic TGF-�-me-diated suppression of T-cell activation during the early steps inan antigen-specific immune response. We saw no evidence thatSno activity plays a role in opposing the postulated role forTGF-� in maintaining homeostatic control of the T-cell pop-ulation size in vivo (22), since splenic-T-cell numbers frommutant mice were not different from those of wild-type con-trols on an inbred (C57BL/6) genetic background.

Analysis of any mutant allele must exclude the possibilitythat the mutant phenotype is due to the influence of the de-letion on a gene closely linked to the primary target, as wasnoted for Arf/Ink4a (51), or to an unintended second mutationsite. The similarity of the phenotypes in T cells for our twoindependent mutations is good evidence not only that it is atarget-specific effect but also that it does not result from asecond mutation at an unknown site.

Mice with another null mutation in the Sno gene were re-ported to die in early embryogenesis (52), whereas our nullmice are viable. It is puzzling that our two mutations differ sodramatically from a third mutation at the same locus (52). Theresults with our mutants are strongly substantiated; two out oftwo ES clone-derived lines of Snoex1/ mice and the singleline of Sno5�/ mice have similar phenotypes. We have alsoexcluded possible second-site mutations, unless they are tightlylinked to Sno, through our backcrossing regimen. The report ofan earlier attempt to create Sno-null mice described intercross-ing two different ES clone-derived germ line Sno lines to ex-clude the possibility of second-site mutations (52). However,this does not exclude the possibility that a lethal second-site

FIG. 7. (A and B) Wild-type and mutant MEFs show different DNA synthetic rates (A) and Sno mutant cells are more sensitive to TGF-� (B).MEFs were isolated from litters of embryos derived from intercrossed mice that were either both wild type or both homozygous mutant. Thegenotype of each MEF preparation was verified by PCR; multiple preparations gave the same results in these experiments. Equal numbers of cellswere plated in quadruplicate sets of microwells and untreated or treated with increasing concentrations of TGF-� or panspecific anti-TGF-�antibody at 2 �g/ml for 24 h. The cells were metabolically labeled for the final 3 h with 1 �Ci of [3H]thymidine per well and harvested onto glassfiber filters to determine the [3H]thymidine incorporation. The asterisks above the control bars (panel A, control; panel B, 0.0 pM) indicate resultsthat were statistically significantly (P � 0.05) different from the wild-type control. In panel A, the asterisks above the other bars indicate resultsthat were statistically significantly (P � 0.05) different from the corresponding untreated control cells. In panel B, the asterisks at 100 pM TGF-�indicate significant (P � 0.02) difference from the wild type; the other asterisks indicate significant difference (P � 0.009) from the wild type.Incorporation into mutant cells was statistically significantly different from the wild type in the presence of anti-TGF-� antibody (Sno5�/, P �0.013; Snoex1/, P � 0.001), whereas incorporation in mutants and the wild type was not significantly different in the presence of 5 pM TGF-�.The genotypes were wild type (Sno�/�), Sno5�/, and Snoex1/. Two independent experiments are shown with different absolute [3H]thymidineincorporation levels in the controls.

VOL. 23, 2003 DEFECTIVE T-CELL PROLIFERATION IN Sno MUTANT MICE 5455

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 27

Dec

embe

r 20

21 b

y 12

6.76

.67.

16.

mutation had arisen in their ES cell population prior to or atthe time of targeting. Other potential sources for changes inthe outcome of Sno mutation can be postulated, includingdifferences in the deletion boundaries, the genetic back-grounds used, the location and direction of neomycin resis-tance cassettes, or effects on nearby gene expression. However,such unintended secondary consequences of homologous re-combination, including deletion or deregulation of nearbygenes, are more likely to play a role in the more dramaticphenotype reported earlier. Alternatively, we must considerthe possibility that our Snoex1 mutation allows expression of apartial gene product with partial function.

The design of our null mutation, in which we excised exon 1but not exons 2 to 6, raises the possibility that a truncatedcarboxyl-terminal protein species could be expressed. We de-tected transcripts including these downstream exons usingNorthern blots (Fig. 4A) and RT-PCR (not shown). We care-fully examined protein products of the predicted size andfound such a truncated protein (SnoN2 isoform but not SnoN),

FIG. 8. MEFs from Snoex1/ embryos show increased activity ofthe 3TP-lux and A3-lux TGF-�-responsive promoters, either with orwithout TGF-� supplementation of the cultures. (A) The activity of aTGF-�-responsive promoter element, 3TP-lux, was tested in trans-fected MEFs. The genotypes were wild type (Sno�/�), Sno5�/, andSnoex1/. “Control” indicates the level of luciferase activity of trans-fected 3TP-lux reporter alone. �TGF-b, TGF-� (100 pM) was added;�Sno, pCMV-SnoN expression construct was cotransfected. Sixty-mil-limeter-diameter dishes were transfected in triplicate, and the relativelight units (RLU) emitted by the luciferase reporter were measured induplicate in a luminometer. The error bars indicate the calculatedstandard deviations from each group of six values measured. Theasterisks above the control bars indicate results that were statisticallysignificantly (P � 0.05) different from the wild type. The asterisksabove the other bars indicate results that were statistically significantly(P � 0.05) different from the corresponding untreated control cells.The results for the mutants were significantly different from the cor-responding wild-type results under each condition (Snoex1/, P �0.0007; Sno5�/, P � 0.034). (B) The increase with added TGF-� wasplotted for Sno�/� and Snoex1/ cells from combined data from fiveexperiments. Sno5�/ cells had the same 2.7-fold increase as Sno�/�

cells and were not plotted. The asterisk indicates that the 3.2-foldincrease in luciferase in the presence of TGF-� was statistically signif-icantly (P � 0.016) higher in Snoex1/ cells than the 2.7-fold increasein the wild type. (C) The activity of a different TGF-�-responsivepromoter element, A3-lux, was tested in wild-type and Snoex1/

MEFs cotransfected with a FAST-2 expression vector. The asteriskindicates that the activity in the presence of TGF-� was statisticallysignificantly higher in Snoex1/ than in Sno�/� MEFs (P � 0.005).(D) To confirm that MEFs of the three genotypes were transfectedwith similar efficiencies, a pSV�gal construct was transfected in par-allel in the same experiment, and the dishes were stained and photo-graphed. The transfection efficiencies were similar among the three

FIG. 9. Snoex1/ MEFs show enhanced activation of endogenousJunB in response to TGF-�. (A) Real-time PCR measured levels ofJunB endogenous mRNAs in wild-type and Sno mutant MEFs with(�TGFb) or without (TGFb) incubation with 100 pM TGF-� for 2 h.The quantified levels calculated for each sample are presented in thehistograms. Each sample was measured in quadruplicate and standard-ized against a dilution curve generated in the same experiment, usingthe same JunB primers and twofold serial dilutions of template (notshown). The genotypes are indicated below panel B. The asterisksindicate results that were statistically significantly (P � 0.015) differentfrom the corresponding untreated cells. The difference in the presenceof added TGF-� between Snoex1/ and the wild type was significant(P � 0.018). (B) L7 ribosomal protein loading control real-time PCRresults are presented as a histogram, showing that the samples con-tained comparable levels of RT-RNA; the profiles were not normal-ized. The error bars indicate the calculated standard deviations.

genotypes. The Snoex1/ cells expressed lacZ from the knock-in con-struct, seen in the nuclear staining in the figure. The transfectedpSV�gal gave cytoplasmic staining and was thus distinguishable fromthe nuclear-staining Snoex1/ background.

5456 PEARSON-WHITE AND MCDUFFIE MOL. CELL. BIOL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 27

Dec

embe

r 20

21 b

y 12

6.76

.67.

16.

but it is expressed at low levels in wild-type as well as mutantcells (Fig. 4B). This carboxyl-terminal fragment of Sno carriesthe lysine residues that are responsible for ubiquitination anddegradation of Sno (55) and thus might turn over rapidly. Thisdomain, including only the carboxyl-terminal half of Sno,would lack SKIP binding (13); N-CoR binding (44); TAFII110binding (11); Smad 2, 3, or 4 binding (56, 58); transcriptionalactivation or repression (11); oncogenic transformation; andmuscle differentiation-promoting activities (12). However,such a 34-kDa carboxyl-terminal Sno species would be pre-dicted to retain the ability to heterodimerize with Ski (12, 25,41) and thus could have dominant-negative activity. If trun-cated Sno protein in these cells has dominant-negative activity,we would expect even heterozygous cells to have phenotypesapproaching that of the homozygous mutant. However, wehave not observed heterozygote phenotypes that are compara-ble to homozygous mutant phenotypes, strongly suggesting theabsence of such dominant-negative activity. Also, when theSno5� mutation is combined with the Ski-null mutation, dou-ble-homozygous mutant mice die early in embryogenesis, a full12 days earlier than Ski/ mice in the absence of the Sno5�

mutation (3; S. Pearson-White and C. Colmenares, unpub-lished data). This shows that Sno and Ski compensate for someof each other’s functions. The Sno5� mutation alone confers amild phenotype, but this is altered dramatically when Ski isdeleted, showing that there is no dominant-negative effect ofthe Sno5� mutation or, by analogy, of the Snoex1 mutation witha similar mild phenotype. The Sno-null mouse described else-where also had only exon 1 deleted, and experiments thatwould have detected a downstream mRNA species or trun-cated protein were not reported (52). Because of its lethality inthe homozygous state, all of the experiments with this mutationwere obligatorily performed in heterozygous mice (52). Onepossible explanation for the effects reported with this mutationmight be a dominant-negative effect on Ski function.

Sno is one of many proteins with a negative regulatory in-fluence on TGF-� signaling and is likely, therefore, to have amodulatory rather than a binary controlling influence. Evi-1(34), oncogenic Ras (33), Ski (1, 36, 57, 71), c-Jun (16), lefty(64), TGIF1 (68, 69), and TGIF2 (39) also participate in theinhibition of TGF-� signaling. In the face of so many alterna-tive modulators of TGF-�, it is significant that phenotypicchanges in TGF-� effects in lymphocytes are measurable in theabsence of Sno. This suggests that Sno is a very importantmodulator of TGF-� signaling in certain cell types and thatSno may be the critical factor regulating TGF-� activity in Tcells.

In primary T cells, TGF-� does more than just inhibit IL-2production to suppress T-cell activation, since the addition ofIL-2 does not rescue T-cell proliferation in the presence ofhigh doses of TGF-� (Fig. 5A). TGF-� also enhances IL-2Rexpression by IL-2 (19) and plays a significant role in T-celldevelopment and terminal differentiation (22, 31, 66). Snodeletion appears not to affect T-cell-developmental aspects ofTGF-� signaling, since immunophenotyping revealed no dif-ferences among T-cell subpopulations in Sno mutant mice(data not shown). Furthermore, it appears to play no role inhomeostatic regulation of the peripheral T-cell pool.

Sno5�/ and Snoex1/ mice show some differences in phe-notype. It is only in MEFs, in the regulation of the JunB

response to TGF-�, that the two mutants show completelydistinct responses: Snoex1/ cells hyperactivate JunB in re-sponse to TGF-�, whereas Sno5�/ cells do not (Fig. 9).Subtle differences were also seen in other assay systems. Boththe activation of the TGF-�-responsive promoter 3TP-lux andthe [3H]thymidine incorporation rate are intermediate inSno5�/ cells between wild-type and Snoex1/ cells (Fig. 7and 8), and reversal of proliferative defects in splenocytes byboth IL-2 and anti-TGF-� antibodies was less complete inSno5�/ than in Snoex1/ cells. In these cases, the Sno5�

mutation appears to be more resistant to complete reversalthan Snoex1. While these differences may result from a subtledose effect for Sno, it is also possible that compensatory de-velopmental changes in interacting pathways not seen in theSno5�/ hypomorph alter expression in the Snoex1/ nullmutant.

There is also evidence in data from both mutants that Snoregulates functions other than those induced by TGF-�. Anti-TGF-� antibody was not able to completely rescue prolifera-tion of Sno5�/ or Snoex1/ fibroblasts to the level attainedby the wild type with added anti-TGF-� antibody (Fig. 7A). Itis not known which additional pathway requires Sno function.Sno and Ski are linked to several other signaling pathwaysthrough the Smad proteins, which are also targets of the Ras/MAPK, Wnt/�-catenin, and nuclear hormone signaling path-ways (27, 37). Ski and Sno can also interact with Gli3, whichresponds to Sonic hedgehog signaling (14). Our results showthat Sno is important in the negative regulation of TGF-�signals in vivo in T-cell activation but also suggest that Sno maymodulate signaling through another pathway still to be identi-fied.

ACKNOWLEDGMENTS

We thank Rowena Crittenden for outstanding technical support andMargaret Ober of the University of Virginia Transgenic Mouse CoreFacility for construction of the 5� targeting construct and all blastocystinjections to make germ line-transmitting male chimeras. We thankKerrington Ramsey for the IL-2 transfection experiments when sherotated in the laboratory. We thank Tim Bender, Bill Pearson, andDavid Wotton for comments on the manuscript. We thank the Uni-versity of Virginia Child Health Research Center Molecular GeneticsCore for plasmid purifications, the Biomolecular Core Facility forDNA sequencing, and the FACS core facility for flow cytometry. Wethank Shunsuke Ishii for the anti-Sno monoclonal antibody mixture.We thank Mike Rudnicki, Shahragim Tajbakhsh, Margaret Bucking-ham, Tim Bender, and Klaus Rajewsky for plasmids.

This work was supported by the Muscular Dystrophy Associationand Public Health Service grant HD-35130 from the National Instituteof Child Health and Human Development to S.P.W.

REFERENCES

1. Akiyoshi, S., H. Inoue, J. Hanai, K. Kusanagi, N. Nemoto, K. Miyazono, andM. Kawabata. 1999. c-Ski acts as a transcriptional co-repressor in transform-ing growth factor-beta signaling through interaction with smads. J. Biol.Chem. 274:35269–35277.

2. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A.Smith, and K. Struhl. 1992. Current protocols in molecular biology. JohnWiley & Sons, New York, N.Y.

3. Berk, M., S. Y. Desai, H. C. Heyman, and C. Colmenares. 1997. Mice lackingthe ski proto-oncogene have defects in neurulation, craniofacial patterning,and skeletal muscle development. Genes Dev. 11:2029–2039.

4. Bonni, S., H. R. Wang, C. G. Causing, P. Kavsak, S. L. Stroschein, K. Luo,and J. L. Wrana. 2001. TGF-beta induces assembly of a Smad2-Smurf2ubiquitin ligase complex that targets SnoN for degradation. Nat. Cell Biol.3:587–595.

5. Brabletz, T., I. Pfeuffer, E. Schorr, F. Siebelt, T. Wirth, and E. Serfling. 1993.Transforming growth factor beta and cyclosporin A inhibit the inducible

VOL. 23, 2003 DEFECTIVE T-CELL PROLIFERATION IN Sno MUTANT MICE 5457

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 27

Dec

embe

r 20

21 b

y 12

6.76

.67.

16.

activity of the interleukin-2 gene in T cells through a noncanonical octamer-binding site. Mol. Cell. Biol. 13:1155–1162.

6. Bradford, M. M. 1976. A rapid and sensitive method for the quantitation ofmicrogram quantities of protein utilizing the principle of protein-dye bind-ing. Anal. Biochem. 72:248–254.

7. Bradley, A. 1987. Production and analysis of chimaeric mice, p. 113–151. InE. J. Robertson (ed.), Teratocarcinomas and embryonic stem cells, a prac-tical approach. IRL Press, Oxford, United Kingdom.

8. Buskin, J. N., D. L. Gregory, W. A. La-Framboise, and S. D. Hauschka. 1996.Harvest protocol to reduce variability of soluble enzyme yield from culturedcells. BioTechniques 20:92–94.

9. Caubit, X., R. Thangarajah, T. Theil, J. Wirth, H. G. Nothwang, U. Ruther,and S. Krauss. 1999. Mouse Dac, a novel nuclear factor with homology toDrosophila dachshund shows a dynamic expression in the neural crest, theeye, the neocortex, and the limb bud. Dev. Dyn. 214:66–80.

10. Chomczynski, P., and N. Sacchi. 1987. Single-step method of RNA isolationby acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Bio-chem. 162:156–159.

11. Cohen, S. B., R. Nicol, and E. Stavnezer. 1998. A domain necessary for thetransforming activity of SnoN is required for specific DNA binding, tran-scriptional repression and interaction with TAF(II)110. Oncogene 17:2505–2513.

12. Cohen, S. B., G. Zheng, H. C. Heyman, and E. Stavnezer. 1999. Het-erodimers of the SnoN and Ski oncoproteins form preferentially over ho-modimers and are more potent transforming agents. Nucleic Acids Res.27:1006–1014.

13. Dahl, R., B. Wani, and M. J. Hayman. 1998. The Ski oncoprotein interactswith Skip, the human homolog of Drosophila Bx42. Oncogene 16:1579–1586.

14. Dai, P., T. Shinagawa, T. Nomura, J. Harada, S. C. Kaul, R. Wadhwa, M. M.Khan, H. Akimaru, H. Sasaki, C. Colmenares, and S. Ishii. 2002. Ski isinvolved in transcriptional regulation by the repressor and full-length formsof Gli3. Genes Dev. 16:2843–2848.

15. de Groot, R. P., and W. Kruijer. 1990. Transcriptional activation by TGFbeta 1 mediated by the dyad symmetry element (DSE) and the TPA respon-sive element (TRE). Biochem. Biophys. Res. Commun. 168:1074–1081.

16. Dennler, S., C. Prunier, N. Ferrand, J. M. Gauthier, and A. Atfi. 2000. c-Juninhibits transforming growth factor beta-mediated transcription by repress-ing smad3 transcriptional activity. J. Biol. Chem. 275:28858–28865.

17. Diaco, R. 1995. Practical considerations for the design of quantitative PCRassays, p. 84–108. In M. A. Innis, D. H. Gelfand, and J. J. Sninsky (ed.), PCRstrategies. Academic Press, Inc., San Diego, Calif.

18. Engert, J. C., S. Servaes, P. Sutrave, S. H. Hughes, and N. Rosenthal. 1995.Activation of a muscle-specific enhancer by the Ski proto-oncogene. NucleicAcids Res. 23:2988–2994.

19. Espevik, T., A. Waage, A. Faxvaag, and M. R. Shalaby. 1990. Regulation ofinterleukin-2 and interleukin-6 production from T-cells: involvement of in-terleukin-1 beta and transforming growth factor-beta. Cell. Immunol. 126:47–56.

20. Field, S. J., F. Y. Tsai, F. Kuo, A. M. Zubiaga, W. G. Kaelin, Jr., D. M.Livingston, S. H. Orkin, and M. E. Greenberg. 1996. E2F-1 functions in miceto promote apoptosis and suppress proliferation. Cell 85:549–561.

21. Givol, I., P. L. Boyer, and S. H. Hughes. 1995. Isolation and characterizationof the chicken c-sno gene. Gene 1565:271–276.

22. Gorelik, L., and R. A. Flavell. 2002. Transforming growth factor-beta inT-cell biology. Nat. Rev. Immunol. 2:46–53.

23. Gu, H., Y.-R. Zou, and K. Rajewsky. 1993. Independent control of immu-noglobulin switch recombination at individual switch regions evidencedthrough Cre-loxP-mediated gene targeting. Cell 73:1155–1164.

24. Heanue, T. A., R. Reshef, R. J. Davis, G. Mardon, G. Oliver, S. Tomarev,A. B. Lassar, and C. J. Tabin. 1999. Synergistic regulation of vertebratemuscle development by dach2, eya2, and six1, homologs of genes required forDrosophila eye formation. Genes Dev. 13:3231–3243.

25. Heyman, H. C., and E. Stavnezer. 1994. A carboxyl-terminal region of the skioncoprotein mediates homodimerization as well as heterodimerization withthe related protein SnoN. J. Biol. Chem. 269:26996–27003.

26. Ikeda, K., Y. Watanabe, H. Ohto, and K. Kawakami. 2002. Molecular inter-action and synergistic activation of a promoter by Six, Eya, and Dach pro-teins mediated through CREB binding protein. Mol. Cell. Biol. 22:6759–6766.

27. Itoh, S., F. Itoh, M. J. Goumans, and P. Ten Dijke. 2000. Signaling oftransforming growth factor-beta family members through Smad proteins.Eur. J. Biochem. 267:6954–6967.

28. Jain, J., C. Loh, and A. Rao. 1995. Transcriptional regulation of the IL-2gene. Curr. Opin. Immunol. 7:333–342.

29. Jonk, L. J., S. Itoh, C. H. Heldin, P. ten Dijke, and W. Kruijer. 1998.Identification and functional characterization of a Smad binding element(SBE) in the JunB promoter that acts as a transforming growth factor-beta,activin, and bone morphogenetic protein-inducible enhancer. J. Biol. Chem.273:21145–21152.

30. Keeton, M. R., S. A. Curriden, A. J. van Zonneveld, and D. J. Loskutoff.1991. Identification of regulatory sequences in the type 1 plasminogen acti-

vator inhibitor gene responsive to transforming growth factor beta. J. Biol.Chem. 266:23048–23052.

31. Kehrl, J. H., L. M. Wakefield, A. B. Roberts, S. Jakowlew, M. Alvarez-Mon,R. Derynck, M. B. Sporn, and A. S. Fauci. 1986. Production of transforminggrowth factor beta by human T lymphocytes and its potential role in theregulation of T cell growth. J. Exp. Med. 163:1037–1050.

32. Kelder, B., C. Richmond, E. Stavnezer, E. O. List, and J. J. Kopchick. 1997.Production, characterization and functional activities of v-Ski in culturedcells. Gene 202:15–21.

33. Kretzschmar, M., J. Doody, I. Timokhina, and J. Massague. 1999. A mech-anism of repression of TGF�/Smad signaling by oncogenic Ras. Genes Dev.13:804–816.

34. Kurokawa, M., K. Mitani, K. Irie, T. Matsuyama, T. Takahashi, S. Chiba, Y.Yazaki, K. Matsumoto, and H. Hirai. 1998. The oncoprotein Evi-1 repressesTGF-� signalling by inhibiting Smad3. Nature 394:92–96.

35. Li, L., J. S. Hu, and E. N. Olson. 1990. Different members of the junproto-oncogene family exhibit distinct patterns of expression in response totype beta transforming growth factor. J. Biol. Chem. 265:1556–1562.

36. Luo, K., S. L. Stroschein, W. Wang, D. Chen, E. Martens, S. Zhou, and Q.Zhou. 1999. The Ski oncoprotein interacts with the Smad proteins to repressTGF� signaling. Genes Dev. 13:2196–2206.

37. Massague, J. 2000. How cells read TGF-� signals. Nat. Rev. Mol. Cell Biol.1:169–178.

38. Mauviel, A., K. Y. Chung, A. Agarwal, K. Tamai, and J. Uitto. 1996. Cell-specific induction of distinct oncogenes of the Jun family is responsible fordifferential regulation of collagenase gene expression by transforminggrowth factor-beta in fibroblasts and keratinocytes. J. Biol. Chem.271:10917–10923.

39. Melhuish, T. A., C. M. Gallo, and D. Wotton. 2001. TGIF2 interacts withhistone deacetylase 1 and represses transcription. J. Biol. Chem. 276:32109–32114.

40. Mimura, N., K. Ichikawa, A. Asano, T. Nagase, and S. Ishii. 1996. A tran-sient increase of snoN transcript by growth arrest upon serum deprivationand cell-to-cell contact. FEBS Lett. 397:253–259.

41. Nagase, T., N. Nomura, and S. Ishii. 1993. Complex formation betweenproteins encoded by the ski gene family. J. Biol. Chem. 268:13710–13716.

42. Nagy, A., J. Rossant, R. Nagy, W. Abramow-Newerly, and J. C. Roder. 1993.Derivation of completely cell culture-derived mice from early-passage em-bryonic stem cells. Proc. Natl. Acad. Sci. USA 90:8424–8428.

43. Nicol, R., and E. Stavnezer. 1998. Transcriptional repression by v-Ski andc-Ski mediated by a specific DNA binding site. J. Biol. Chem. 273:3588–3597.

44. Nomura, T., M. M. Khan, S. C. Kaul, H. D. Dong, R. Wadhwa, C. Colmen-ares, I. Kohno, and S. Ishii. 1999. Ski is a component of the histone deacety-lase complex required for transcriptional repression by Mad and thyroidhormone receptor. Genes Dev. 13:412–423.

45. Pearson-White, S., D. Deacon, R. Crittenden, G. Brady, N. Iscove, and P. J.Quesenberry. 1995. The ski/sno protooncogene family in hematopoietic de-velopment. Blood 86:2146–2155.

46. Pearson-White, S. H., and R. Crittenden. 1997. Proto-oncogene Sno expres-sion, alternative isoforms, and immediate early serum response. NucleicAcids Res. 25:2930–2937.

47. Pelzer, T., G. E. Lyons, S. Kim, and R. W. Moreadith. 1996. Cloning andcharacterization of the murine homolog of the sno proto-oncogene reveals anovel splice variant. Dev. Dyn. 205:114–125.

48. Rao, A., C. Luo, and P. G. Hogan. 1997. Transcription factors of the NFATfamily: regulation and function. Annu. Rev. Immunol. 15:707–747.

49. Rawls, A., J. H. Morris, M. Rudnicki, T. Braun, H. H. Arnold, W. H. Klein,and E. N. Olson. 1995. Myogenin’s functions do not overlap with those ofMyoD or Myf-5 during mouse embryogenesis. Dev. Biol. 172:37–50.

50. Rudnicki, M. A., T. Braun, S. Hinuma, and R. Jaenisch. 1992. Inactivationof MyoD in mice leads to up-regulation of the myogenic HLH gene myf-5 andresults in apparently normal muscle development. Cell 71:383–390.

51. Sherr, C. J. 2001. Parsing Ink4a/Arf: “pure” p16-null mice. Cell 106:531–534.52. Shinagawa, T., H. D. Dong, M. Xu, T. Maekawa, and S. Ishii. 2000. The sno

gene, which encodes a component of the histone deacetylase complex, acts asa tumor suppressor in mice. EMBO J. 19:2280–2291.

53. Shinagawa, T., T. Nomura, C. Colmenares, M. Ohira, A. Nakagawara, andS. Ishii. 2001. Increased susceptibility to tumorigenesis of ski-deficient het-erozygous mice. Oncogene 20:8100–8108.

54. Siebenlist, U., D. B. Durand, P. Bressler, N. J. Holbrook, C. A. Norris, M.Kamoun, J. A. Kant, and G. R. Crabtree. 1986. Promoter region of inter-leukin-2 gene undergoes chromatin structure changes and confers inducibil-ity on chloramphenicol acetyltransferase gene during activation of T cells.Mol. Cell. Biol. 6:3042–3049.

55. Stroschein, S. L., S. Bonni, J. L. Wrana, and K. Luo. 2001. Smad3 recruitsthe anaphase-promoting complex for ubiquitination and degradation ofSnoN. Genes Dev. 15:2822–2836.

56. Stroschein, S. L., W. Wang, S. Zhou, Q. Zhou, and K. Luo. 1999. Negativefeedback regulation of TGF-� signaling by the SnoN oncoprotein. Science286:771–774.

57. Sun, Y., X. Liu, E. N. Eaton, W. S. Lane, H. F. Lodish, and R. A. Weinberg.

5458 PEARSON-WHITE AND MCDUFFIE MOL. CELL. BIOL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 27

Dec

embe

r 20

21 b

y 12

6.76

.67.

16.

1999. Interaction of the Ski oncoprotein with Smad3 regulates TGF-� sig-naling. Mol. Cell 4:1–20.

58. Sun, Y., X. Liu, E. Ng-Eaton, H. F. Lodish, and R. A. Weinberg. 1999. SnoNand Ski protooncoproteins are rapidly degraded in response to transforminggrowth factor beta signaling. Proc. Natl. Acad. Sci. USA 96:12442–12447.

59. Sutrave, P., T. D. Copeland, S. D. Showalter, and S. H. Hughes. 1990.Characterization of chicken c-ski oncogene products expressed by retrovirusvectors. Mol. Cell. Biol. 10:3137–3144.

60. Tajbakhsh, S., E. Bober, C. Babinet, S. Pournin, H. Arnold, and M. Buck-ingham. 1996. Gene targeting the myf-5 locus with nlacZ reveals expressionof this myogenic factor in mature skeletal muscle fibres as well as earlyembryonic muscle. Dev. Dyn. 206:291–300.

61. Tajbakhsh, S., and M. E. Buckingham. 1994. Mouse limb muscle is deter-mined in the absence of the earliest myogenic factor myf-5. Proc. Natl. Acad.Sci. USA 91:747–751.

62. Tarapore, P., C. Richmond, G. Zheng, S. B. Cohen, B. Kelder, J. Kopchick,J. Kruse, A. E. Sippel, C. Colmenares, and E. Stavnezer. 1997. DNA bindingand transcriptional activation by the Ski oncoprotein mediated by interactionwith NFI. Nucleic Acids Res. 25:3895–3903.

63. Tokitou, F., T. Nomura, M. M. Khan, S. C. Kaul, R. Wadhwa, T. Yasukawa,I. Kohno, and S. Ishii. 1999. Viral ski inhibits retinoblastoma protein (Rb)-mediated transcriptional repression in a dominant negative fashion. J. Biol.Chem. 274:4485–4488.

64. Ulloa, L., and S. Tabibzadeh. 2001. Lefty inhibits receptor-regulated Smadphosphorylation induced by the activated transforming growth factor-betareceptor. J. Biol. Chem. 276:21397–21404.

65. Verrecchia, F., C. Tacheau, M. Schorpp-Kistner, P. Angel, and A. Mauviel.2001. Induction of the AP-1 members c-Jun and JunB by TGF-beta/Smadsuppresses early Smad-driven gene activation. Oncogene 20:2205–2211.

66. Wahl, S. M., J. M. Orenstein, and W. Chen. 2000. TGF-beta influences thelife and death decisions of T lymphocytes. Cytokine Growth Factor Rev.11:71–79.

67. Wakefield, L. M., and A. B. Roberts. 2002. TGF-� signaling: positive andnegative effects on tumorigenesis. Curr. Opin. Genet. Dev. 12:22–29.

68. Wotton, D., R. S. Lo, S. Lee, and J. Massague. 1999. A Smad transcriptionalcorepressor. Cell 97:29–39.

69. Wotton, D., R. S. Lo, L. A. Swaby, and J. Massague. 1999. Multiple modesof repression by the smad transcriptional corepressor TGIF. J. Biol. Chem.274:37105–37110.

70. Wrana, J. L., L. Attisano, J. Carcamo, A. Zentella, J. Doody, M. Laiho, X. F.Wang, and J. Massague. 1992. TGF beta signals through a heteromericprotein kinase receptor complex. Cell 71:1003–1014.

71. Xu, W., K. Angelis, D. Danielpour, M. M. Haddad, O. Bischof, J. Campisi,E. Stavnezer, and E. E. Medrano. 2000. Ski acts as a co-repressor with Smad2and Smad3 to regulate the response to type beta transforming growth factor.Proc. Natl. Acad. Sci. USA 97:5924–5929.

72. Yamasaki, L., T. Jacks, R. Bronson, E. Goillot, E. Harlow, and N. J. Dyson.1996. Tumor induction and tissue atrophy in mice lacking E2F-1. Cell 85:537–548.

73. Zhou, S., L. Zawel, C. Lengauer, K. W. Kinzler, and B. Vogelstein. 1998.Characterization of human FAST-1, a TGF beta and activin signal trans-ducer. Mol. Cell 2:121–127.

VOL. 23, 2003 DEFECTIVE T-CELL PROLIFERATION IN Sno MUTANT MICE 5459

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 27

Dec

embe

r 20

21 b

y 12

6.76

.67.

16.