ORIGINAL PAPER

Deciphering the Roles of Trehalose and Hsp104 in the Inhibitionof Aggregation of Mutant Huntingtin in a Yeast Modelof Huntington’s Disease

Rajeev Kumar Chaudhary • Jay Kardani •

Kuljit Singh • Ruchira Banerjee • Ipsita Roy

Received: 23 April 2013 / Accepted: 6 November 2013

� Springer Science+Business Media New York 2013

Abstract Despite the significant amount of experimental

data available on trehalose, the molecular mechanism

responsible for its intracellular stabilising properties has

not emerged yet. The repair of cellular homeostasis in

many protein-misfolding diseases by trehalose is credited

to the disaccharide being an inducer of autophagy, a

mechanism by which aggregates of misfolded proteins are

cleared by the cell. In this work, we expressed the patho-

genic N-terminal fragment of huntingtin in Dnth1 mutant

(unable to degrade trehalose) of Saccharomyces cerevisiae

BY4742 strain. We show that the presence of trehalose

resulted in the partitioning of the mutant huntingtin in the

soluble fraction of the cell. This led to reduced oxidative

stress and improved cell survival. The beneficial effect was

independent of the expression of the major cellular anti-

oxidant enzyme, superoxide dismutase. Additionally, tre-

halose led to the overexpression of the heat shock protein,

Hsp104p, in mutant huntingtin-expressing cells, and

resulted in rescue of the endocytotic defect in the yeast cell.

We propose that at least in the initial stages of aggregation,

trehalose functions as a stabiliser, increasing the level of

monomeric mutant huntingtin protein, with its concomitant

beneficial effects, in addition to its role as an inducer of

autophagy.

Keywords Huntington’s disease � Oxidative stress �Endocytosis � Trehalose � Protein folding

Introduction

Huntington’s disease (HD) belongs to the class of pro-

tein-misfolding diseases, specifically the polyglutamine

(polyQ) disorders, in which the N-terminal Q-rich region

of the protein huntingtin is elongated. This homopoly-

meric stretch causes misfolding of the protein, followed

by oligomerization and finally amyloid fibrillation (The

Huntington’s Disease Collaborative Research Group

1993; Ross and Tabrizi 2011; Appl et al. 2012). Indi-

viduals with 6–35 glutamine residues are asymptomatic,

those with 36–39 residues exhibit incomplete penetrance

and [39 residues result in complete penetrance. The

disease exhibits anticipation (Nestor and Monckton

2011), individuals with higher number of glutamine

residues in the protein develop the disease earlier and

with increasing degree of severity. Both cytoplasmic and

nuclear inclusions have been reported in post-mortem

brains of HD (Davies et al. 1997; Maat-Schieman et al.

2007; Weiss et al. 2012). Various cell-based and animal

models have been used in studies with yeast (Duennwald

2011), Drosophila melanogaster (Weiss et al. 2012), C.

elegans (Faber et al. 2002) and mice (Davies et al. 1997;

Landles et al. 2010), where the presence of the N-ter-

minal domain in the inclusions resulted in cytotoxicity

and decreased lifespan.

The disease progression has been positively correlated

with the rate of aggregation and as such, inhibition of

protein aggregation has long been accepted as a promising

therapeutic strategy for HD. Increasing evidence indicates

that inhibition of formation of oligomeric protofibrillar

structures leads to reduction in cell death (Sanchez et al.

2003; Ross and Tabrizi 2011). On the other hand, for-

mation of amyloid fibril-containing inclusions has been

linked to cytotoxicity (Arrasate et al. 2004). Thus,

Jay Kardani and Kuljit Singh have contributed equally to this work.

R. K. Chaudhary � J. Kardani � K. Singh � R. Banerjee �I. Roy (&)

Department of Biotechnology, National Institute of

Pharmaceutical Education and Research, Sector 67,

S.A.S. Nagar 160062, Punjab, India

e-mail: ipsita@niper.ac.in

123

Neuromol Med

DOI 10.1007/s12017-013-8275-5

stabilization of monomeric huntingtin in the native con-

formation is likely to slow down the progress of the

disease.

Some recent reports have suggested that the cellular

clearance of huntingtin aggregates occurs by autophagy

(Sarkar et al. 2007; Renna et al. 2010). The formation of

autolysosomes, upon fusion of autophagosomes with

lysosomes, is thought to clear oligomeric and protofibrillar

structures in lower HD models. Since autophagy is nega-

tively regulated by the mammalian target of rapamycin

(mTOR), induction of autophagy using the conventional

mTOR inhibitor, rapamycin, has shown favourable results

in cell models of HD (Ravikumar et al. 2002). Oral

administration of trehalose in transgenic R6/2 mice

decreased polyglutamine aggregation in the cerebrum and

liver, improved motor dysfunction and extended lifespan of

the diseased animal (Tanaka et al. 2004). This could be due

to the ability of the disaccharide to bind and stabilise

polyglutamine-containing proteins in the native confor-

mation. Exposure of non-neuronal and neuronal precursor

cells expressing 74Q-htt to trehalose in the culture medium

led to uptake of the disaccharide by the cells and resulted in

reduction in aggregation of huntingtin and cell death in a

similar way as cells overexpressing trehalose synthetic

genes (Sarkar et al. 2007).

Trehalose has been used to stabilise proteins and lipids

under a variety of stress conditions (Jain and Roy 2009). Its

GRAS (Generally Regarded As Safe) status as well as the

absence of any effect on the wild-type protein has made it

an important molecule in the development of a therapy

regimen for HD. The route through which trehalose exerts

its mTOR-independent effect on autophagy and clearance

of huntingtin aggregates has been worked out in a series of

well-designed experiments (Sarkar et al. 2007, 2009; Sar-

kar and Rubinsztein 2008). Stimulation of autophagy and

the neuroprotective effect of this disaccharide have been

shown in a mouse model of human tauopathy (Schaeffer

and Goedert 2012; Schaeffer et al. 2012). However, the

consequence of the activation of this pathway and the

effect of trehalose on cellular cascades and viability have

received very little attention. The well-established role of

trehalose as a stabiliser of proteins, and whether that

function is important in case of HD, has also not been

explored. The purpose of the current study was to under-

stand the role of trehalose inside the cell, which helps it to

exert its beneficial effect. Using a yeast model of HD, we

show that upregulation of the chaperone Hsp104 occurs in

the presence of intracellular trehalose only in case of cells

expressing mutant huntingtin, leading to reduced aggre-

gation and increased partitioning of the monomeric protein

in the soluble cytosolic fraction. This results in reduced

oxidative stress in the cell and increased cell viability. We

also show that the presence of trehalose rescues endocytosis

in the affected cells, restoring the protein-trafficking

machinery.

Materials and Methods

Saccharomyces cerevisiae BY4742 [MATa his3D1 leu2D0

lys2D0 ura3D0, (RNQ1?)] Dnth1 strain was purchased

from Saf Labs Pvt. Ltd., Mumbai, India. Oligo dT18 primer

was purchased from Fermentas, Inc., USA. SYBR� Premix

Ex TaqTM (Perfect Real Time) kit was purchased from

Takara Bio, Inc., Japan. Dichlorodihydrofluorescein diac-

etate (DCFH-DA) was purchased from Cayman Chemical

Company, USA. FM4-64 was a product of Invitrogen,

USA. Mouse antipolyglutamine (polyglutamine expansion

disease marker monoclonal antibody) was a product of

Chemicon International, and was purchased from Millipore

(India) Pvt. Ltd., New Delhi, India. All other reagents and

chemicals used were of analytical grade or higher.

Methods

Expression of Huntingtin Protein Fragments

in Saccharomyces cerevisiae

Saccharomyces cerevisiae BY4742 Dnth1 strain, a neutral

trehalase-deficient strain, was transformed with pYES2-

25Q-htt-EGFP and pYES2-103Q-htt-EGFP by lithium

acetate-PEG (polyethylene glycol) method (Gietz et al.

1992). Flasks containing 50 ml each of SC-URA med-

ium ? 2 % (wv-1) dextrose were inoculated with the

respective starter cultures of transformed yeast cells and

grown at 30 �C, 200 rpm till OD600 nm 0.4–0.6. Protein

expression was induced with 2 % (wv-1) galactose, with or

without 4 % (wv-1) trehalose for 10 h and monitored using

a fluorescence microscope (E600 Eclipse microscope,

Nikon, Japan), with an objective lens of 1009.

Yeast Cell Lysis

Yeast cells were lysed with acid-treated glass beads (Ein-

hauer et al. 2002) as described earlier (Meriin et al. 2002).

Protein estimation was carried out in the resulting super-

natants by dye-binding method (Bradford 1976), using

bovine serum albumin as the standard protein. Analysis of

protein expression pattern was done using native PAGE

(Hames 1998). After denaturing polyacrylamide gel elec-

trophoresis, protein bands were transferred electrophoreti-

cally to nitrocellulose membrane (0.45 lm) and visualised

using Hsp104 (1:1,00,000), FLAG (1:1,000) or polygluta-

mine antibodies (1:5,000). FITC-conjugated antimouse

antibody (1:1,000) was used as the secondary antibody.

Neuromol Med

123

Measurement of Intracellular Oxidative Stress

Saccharomyces cerevisiae BY4742 Dnth1 cells were grown as

described above and counted using a Neubauer’s chamber.

Cells (1 9 107 each) were incubated with 20 lM dichlor-

odihydrofluorescein diacetate (DCFH-DA) (10 mM stock

solution in dimethyl sulphoxide) and 1 mM H2O2 for 1 h at

30 �C, 200 rpm (Wong et al. 2002). The emission intensities of

dichlorofluorescein (de-esterified and oxidised metabolite of

DCFH-DA) were recorded using a spectrofluorometer (Shi-

madzu, Japan), using an excitation wavelength of 504 nm and

an emission wavelength of 519 nm.

Cell Viability Assay

Cells were routinely grown on SC-URA [2 % (wv-1) dex-

trose] liquid medium and then transferred to SC-URA [2 %

galactose (wv-1), with and without 4 % (wv-1) trehalose]

medium for the expression of 25Q-htt and 103Q-htt at 30 �C

for 10 h. Cells (9 9 103) were serially diluted (threefold) and

spotted on solid media SC-URA [2 % (wv-1) dextrose or

2 % (wv-1) galactose, with and without 4 % (wv-1) treha-

lose]. Growth of colonies was monitored at 30 �C for 3 days.

Gene Expression Analysis

Total RNA was isolated from yeast cells using the hot phenol

method (Collart and Oliviero 2001). RNA was treated with

DNase I to remove genomic DNA contamination and sub-

jected to reverse transcription using oligo dT18 primer and

M-MLV reverse transcriptase according to the manufac-

turer’s protocol. cDNA thus obtained was used for real-time

PCR. Primers were designed for the desired genes (Table 1)

using Primer3 (v.0.4.0) software (Rozen and Skaletsky

2000). cDNA (1:10 dilution) was used with SYBR� Premix

Ex TaqTM (Perfect Real Time) kit according to the manu-

facturer’s protocol. Cyclings were performed on an Eppen-

dorf Mastercycler� ep realplex Thermal Cycler using SYBR

Green detection. Data were analysed using realplex 2.2

software (Eppendorf) to calculate cycle threshold (Ct) val-

ues. Actin1 (Act1) gene was taken as housekeeping gene

(internal control). Relative fold change in gene expression

was calculated by the comparative Ct method (also known as

the 2-DDCt method) (Schmittgen and Livak 2008).

Uptake of Trehalose by Yeast Cells

The amount of trehalose taken up by the cells was deter-

mined by HPLC (Lillie and Pringle 1980) after extracting

the disaccharide with 0.5 M trichloroacetic acid (Ferreira

et al. 1997).

Endocytosis in Yeast Cells

After induction, yeast cells (10 ml each) were centrifuged

as described earlier. The pellets were resuspended in 1 ml

each of phosphate buffered saline, pH 7.4 and incubated

with FM 4–64 dye (8 lM final concentration) for different

time periods (Meriin et al. 2003). Endocytosis of the dye

was monitored by visualising the cells under a fluorescence

microscope (Model E600, Nikon Corporation, Japan;

excitation at BP 510–560 nm, emission BA 590 nm), with

an objective lens of 1009.

Results

Trehalose Reduces Aggregation of Mutant Huntingtin

in Yeast

Exon 1 sequences of huntingtin gene containing the

sequence for first 17 amino acid followed by 25 or 103

Table 1 Details of primers designed for gene expression profiling in

yeast model of Huntington’s disease

Gene Orientation Oligo sequence (50–30)

Btn2 Forward TCTCCAGTGAGCTATTATCC

Reverse ATAACCATTTGGTGTTTCAG

Hsp104 Forward TTTACAGAAAGGGCTCTAAC

Reverse TTCTGTAGGTAAGGGACTGA

Ssa1 Forward GAGTCTCATTTTTCTCAAGG

Reverse TTGTCCATGACGTATCCT

Ssa2 Forward ACCTTACCTTTGTCGAGAGT

Reverse AGCGTCGTTTAGTGATATTG

Ssa3 Forward GTCTCTGGTGTTGTCAAGTT

Reverse AGCAGAGACACAACCATT

Sis1 Forward CAAGAAGGCTGAAGAGACTA

Reverse CTTGGTACAACTTAGACATGA

Ydj1 Forward TGTGTTGCTCACTTCTCTAA

Reverse AGTGTTAGCTGGGTTCATAG

Rnq1 Forward GTTGGTATTGATTTGGGAAC

Reverse TAATCTTTCGGTGTCTGTGA

Ure2 Forward ACGATATTCTAGGTGTTCCA

Reverse CTGAAGCTTCTTTGAACTTT

Sup35 Forward TAAGTCAAAGAAACCACCTG

Reverse ATTGCTATTGTGGTACCTTG

Sod1 Forward ACGGATGAGGTTAGAAGAGT

Reverse TATCCACGACATTATTCCAT

Atg5 Forward TCATACTGAATGGTTCCTCA

Reverse GATGTCCTTGAGGTTTGAAT

Tor2 Forward AGGTGTTATGGCTGAAGAGT

Reverse AATGACTTTCCCAGTGATTC

Act1 Forward TGCCGGTATTGACCAAACTA

Reverse TGACCTTCATGGAAGATGGA

Neuromol Med

123

glutamines were fused in frame with a FLAG tag at NH2

terminus and an EGFP tag at COOH terminus. These

constructs were cloned into the pYES2 vector (Meriin et al.

2002) and were used to transform S. cerevisiae BY4742

Dnth1 strain. This strain carries the RNQ1 protein in the

prion form, which has been shown to be responsible for the

formation of aggregates by huntingtin fragments carrying

longer stretches of polyQ tracts (Meriin et al. 2002, 2003).

Since neutral trehalase (nth1) is the major trehalose-

degrading enzyme in yeast, the neutral trehalase mutant

(Dnth1) accumulates the disaccharide and the effect of

trehalose on protein aggregation can be monitored. No

difference in either expression/aggregation of 103Q-htt or

cell viability was observed in parental or Dnth1 cells (Saleh

et al., manuscript submitted). Cells expressing 25Q-htt-

EGFP showed diffused/homogeneous distribution of green

fluorescence due to the expression of the soluble protein

(Fig. 1a). Yeast cells expressing 103Q-htt showed the

presence of fluorescent puncta (Fig. 1a), which indicated

the formation of aggregates by the protein containing the

longer polyglutamine stretch. These aggregates are thought

to be cytotoxic (Meriin et al. 2002). Yeast cells grown in

the presence of 4 % (wv-1) trehalose still showed the

presence of some aggregates. However, these were more

diffused in nature (Fig. 1a) rather than being pin-pointed.

This confirmed the stabilizing role of trehalose, which

resulted in partial solubilisation of the aggregates of mutant

huntingtin protein. Since trehalose is an inhibitor of protein

Fig. 1 Effect of trehalose on the expression of 103Q-htt. Yeast cells

were grown as described. a After induction, cells were pelleted down,

washed, mounted on glass slides and viewed under a fluorescence

microscope (Nikon E600 Eclipse, Nikon Corporation, Japan).

Bar = 10 lm. b Native PAGE analysis of lysed yeast cells. Cells

were lysed as described and loaded on a 12 % cross-linked

polyacrylamide gel. After the electrophoretic run, the gel was

scanned on an image scanner (Typhoon Trio, GE Healthcare,

Sweden), operated in the fluorescence mode to visualise GFP-tagged

proteins. Left panel: Coomassie blue-stained gel; right panel: gel

scanned in fluorescence mode. Lanes 1, 3: 103Q-htt expressed in the

absence of trehalose; lanes 2, 4: 103Q-htt expressed in the presence of

trehalose. Arrow denotes the position of monomeric 103Q-htt-EGFP

while arrowhead denotes the position of aggregated 103Q-htt-EGFP.

c Densitometric analysis of bands for monomeric 103Q-htt bands seen

on native PAGE (lanes 3 and 4). Values shown are mean ± SEM of

three independent experiments, ***p \ 0.001 against 103Q-htt grown

in the absence of trehalose. d Western blot analysis of cells expressing

25Q-htt grown in the absence and presence of 4 % (wv-1) trehalose

using FLAG antibody. e Western blot analysis of cells expressing

103Q-htt grown in the absence and presence of 4 % (wv-1) trehalose

using polyglutamine antibody

Neuromol Med

123

folding and cannot solubilise preformed aggregates (Singer

and Lindquist 1998), it is likely that the disaccharide sta-

bilises the monomeric conformation of mutant huntingtin

and does not allow it to aggregate.

Analysis of cell lysate by native PAGE (Fig. 1b) showed

about 3.6-fold increase in the fluorescence intensity of the

band for the monomer mutant huntingtin protein in the pre-

sence of trehalose (Fig. 1c). This was accompanied with

reduction in the fluorescence intensity of aggregates trapped

in the wells of the gel in case of cells grown in the presence of

trehalose as compared to the cells, which were not exposed to

the disaccharide (Fig. 1b). The presence of trehalose alone

did not lead to increase in the expression of the induced

protein. As the fusion proteins contain an N-terminal FLAG

tag, cells expressing 25Q-htt were immunoblotted with

FLAG antibody. No difference in the band intensities of the

protein expressed in the absence and presence of trehalose

could be detected (Fig. 1d). Immunoblotting with polyglu-

tamine antibody as the primary antibody, which specifically

recognises elongated polyQ stretches, confirmed that the

bands observed were for the mutant huntingtin (Fig. 1e). An

increase in the intensity of the band for the monomer

established that 103Q-htt was expressed in the soluble form

in cells grown in the presence of trehalose.

Solubilisation Leads to Reduction in Intracellular

Oxidative Stress

Increase in the level of reactive oxygen species (ROS) has

been one of the major mechanisms underlying the patho-

genesis of Huntington’s disease (Borlongan et al. 1996).

Since oxidative stress leads to protein modification mainly

via carbonylation, decreasing the level of free radicals is

likely to have a beneficial effect for proteomic longevity.

Significant increase (approximately twofold) in the fluores-

cence intensity of dichlorofluorescein (DCF) was observed

in the cells expressing 103Q-htt as compared to those

expressing the normal counterpart (25Q-htt) (Fig. 2a). Sim-

ilar increase in the level of ROS has been observed in HeLa

cells expressing 97Q-htt as compared to cells expressing

25Q-htt (Hands et al. 2011). In the presence of trehalose, a

significant decrease in fluorescence intensity could be seen

(Fig. 2a). The addition of trehalose per se did not lead to any

change in the level of oxidative stress in the cell, as seen in

the case of 25Q-htt grown in the presence of the disaccharide.

Thus, solubilisation of 103Q-htt in the presence of trehalose

led to reduction in oxidative stress in the cell.

Solubilisation of 103Q-htt Increases Cell Viability

Induced yeast cells were spotted on selection plates and

their growth pattern was monitored. No effect of trehalose

was seen in cells expressing 25Q-htt when plated on

dextrose or galactose (Fig. 2b), confirming that the disac-

charide has no effect on the growth of yeast cells. All the

transformants grew to the same extent in dextrose-con-

taining plates (Fig. 2c). For cells expressing 25Q-htt,

growth was maximal in all media, which matches with the

soluble nature of the protein (Fig. 1a) as well as low ROS

level in these cells (Fig. 2a). In case of cells expressing

103Q-htt, however, the viability of cells was significantly

lower when plated on induction plates as compared to cells

expressing 25Q-htt (Fig. 2c). The aggregation of 103Q-htt

is toxic to cell survival to such an extent that a majority of

cells expel the plasmid even on a selection plate (Meriin

et al. 2002). This toxicity was rescued when cells previ-

ously grown in the presence of galactose/trehalose were

plated on the same medium (Fig. 2c). In the latter case,

103Q-htt was expressed in mostly soluble form (Fig. 1b)

with reduced oxidative stress (Fig. 2a). This led to reduced

toxicity and increased cell survival in the presence of tre-

halose. In the absence of the disaccharide, the protein

(103Q-htt) formed aggregates (Fig. 1a) and exhibited

higher oxidative stress in the cell (Fig. 2a), which corrob-

orated with increased cytotoxicity observed in this case.

Fig. 2 a Measurement of oxidative stress in yeast cells by 2,7-

dichlorodihydrofluorescein diacetate (DCFH-DA) assay. Values

shown are mean ± SEM of three independent experiments,

**p \ 0.01 against 25Q-htt, ##p \ 0.01 against 103Q-htt grown in

the absence of trehalose, N.S.: Non-significant. b Effect of trehalose

on viability of cells expressing 25Q-htt. Cells (9 9 103) were serially

diluted threefold and plated as indicated. c Effect of trehalose on

viability of cells expressing 103Q-htt. Experimental details are

described in ‘Methods’ section. Each experiment was carried out in

triplicate. Representative plates are shown

Neuromol Med

123

Gene Expression Analysis

Levels of gene expression in yeast cells expressing 103Q-

htt were compared with cells expressing 25Q-htt (Table 2).

Expression of Btn2, encoding a protein involved in intra-

cellular trafficking of late endosomal proteins to the Golgi

apparatus (Kanneganti et al. 2011), was upregulated in

yeast cells expressing aggregated 103Q-htt. Under stress

conditions, Btn2 accumulates in yeast cells due to

increased gene expression and reduced proteasomal turn-

over (Malinovska et al. 2012). The expression level of this

protein is upregulated in a yeast model (S. cerevisiae

Dbtn1) of Batten disease (Chattopadhyay et al. 2003).

Upregulation of Btn2 protein acts as an indicator of altered

trafficking within the cell (Chattopadhyay et al. 2003).

Huntingtin has been proposed to participate in protein

trafficking in cells (Ross and Tabrizi 2011). Upregulation

of Btn2 in the cells expressing 103Q-htt inclusions reflects

the cell’s attempt to overcome the defect in protein traf-

ficking due to the accumulation of protein aggregates. In

the presence of trehalose, expression of Btn2 was signifi-

cantly downregulated as compared to cells expressing

103Q-htt in the aggregated form (Table 2). Since formation

of 103Q-htt aggregates was reduced in the presence of

trehalose, the protein-trafficking machinery was repaired

and the expression of Btn2 was restored to the normal

level.

Expression of genes coding for chaperones, viz.

Hsp104, Ssa1, Ssa2, Ssa3, Sis1 and Ydj1, was upregulated

in the cells expressing aggregated 103Q-htt as compared

to those expressing 25Q-htt (Table 2), revealing an

amplified effort of the cell to refold the misfolded and

aggregated 103Q-htt. As these chaperones are also

essential for prion propagation, seed formation and

expansion of preformed seeds, their overexpression

resulted in increased aggregation and toxicity of mutant

huntingtin in the yeast cell. In the presence of trehalose,

expression of Hsp104 was found to be marginally

downregulated in cells expressing partially solubilised

103Q-htt (Table 2). This may reflect the diminished need

of the cell to synthesise Hsp104p when solubilisation of

103Q-htt is promoted by the presence of trehalose.

Expression of other chaperones, viz. Ssa1, Ssa3 and Sis1,

in the cells expressing 103Q-htt in the presence of tre-

halose was also downregulated (Table 2). Expression of

Ssa2 and Ydj1 remained unchanged.

Prion forms of endogenous yeast proteins Rnq1p,

Ure2p and Sup35p ‘seed’ aggregation of polyglutamine-

containing protein (Meriin et al. 2002; Derkatch et al.

2004). Glutathione-dependent peroxidase activity of

Ure2p has been seen towards oxidants like H2O2 in vitro

(Bai et al. 2004). When 103Q-htt was expressed in the

aggregated form, upregulation of Ure2 was observed

(Table 2). This probably reflects the cellular response to

increased oxidative stress. Trehalose has been shown to

positively affect the glutathione homeostasis system in

case of mice model of tauopathies and parkinsonism

(Rodrıguez-Navarro et al. 2010). However, in the present

case, the expression of Ure2 did not change significantly

when the cells were treated with trehalose (Table 2).

Expression of the gene coding for the antioxidant enzyme,

superoxide dismutase, Sod1, was found to remain

unchanged in cells expressing 103Q-htt, either in the

absence or presence of trehalose (Table 2). Thus, the

reduction in ROS level in case of trehalose-treated cells is

by a mechanism independent of antioxidant enzymes.

Expression of another yeast prion protein gene, Rnq1,

coding for Rnq1p, whose prion form ‘seeds’ aggregation

of the polyQ protein, remained unaltered in the cells

expressing 103Q-htt either in the aggregated or partially

soluble form, as compared to those expressing 25Q-htt

(Table 2). This is expected since it is the polymerisation

of Rnq1p, rather than its expression, which decides if

103Q-htt is seeded or not (Meriin et al. 2002). Expression

of Sup35 in the cells expressing partially solubilised

103Q-htt was downregulated as compared to those

expressing the aggregated protein (Table 2). This may be

linked to the higher viability of yeast cells expressing

mutant huntingtin in the presence of trehalose. Since

overproduction of Sup35p results in inhibition of growth

of weak or strong [PSI?] yeast strains (Derkatch et al.

1998), decreased expression of Sup35 may be correlated

Table 2 Gene expression analysis in yeast cells

Target

gene

103Q-htt v/s 25Q-htt 103Q-htt (trehalose) v/s

103Q-htt

Fold change

(2-DDCt)

p value Fold change

(2-DDCt)

p value

Btn2 7.83 ± 1.64 0.01407 -1.46 ± 0.05 0.00354

Hsp104 3.55 ± 0.73 0.02457 -1.55 ± 0.06 0.00327

Ssa1 1.69 ± 0.32 0.09787 -1.23 ± 0.09 0.09654

Ssa2 2.17 ± 0.64 0.13988 -1.15 ± 0.10 0.27393

Ssa3 1.86 ± 0.04 0.00002 -1.33 ± 0.11 0.07976

Sis1 3.11 ± 0.25 0.00113 -1.21 ± 0.04 0.00829

Ydj1 2.43 ± 0.81 0.15013 1.08 ± 0.11 0.49132

Rnq1 -1.11 ± 0.05 0.10369 1.02 ± 0.18 0.91487

Ure2 2.06 ± 0.07 0.00010 -1.01 ± 0.08 0.86483

Sup35 1.06 ± 0.03 0.06357 -1.25 ± 0.02 0.00086

Sod1 -1.10 ± 0.06 0.18183 -1.17 ± 0.11 0.25845

Atg5 1.06 ± 0.14 0.68670 -1.15 ± 0.06 0.07365

Tor2 1.37 ± 0.05 0.00137 -1.12 ± 0.10 0.29745

PCR reactions were carried out in triplicate from three different

cDNA samples (n = 3). Values shown are mean ± SEM (standard

error of mean)

Neuromol Med

123

with the increased viability of yeast cells (Fig. 2c)

expressing mutant huntingtin in the presence of trehalose.

Induction of autophagy has been proposed to be a major

route by which trehalose exerts its ameliorative effect in

HD models (Sarkar et al. 2007, 2009; Sarkar and Ru-

binsztein 2008). The level of Atg5 remained unaltered in

the absence or presence of trehalose (Table 2). The

expression of Atg5p in mammalian cells remains unchan-

ged on exposure to trehalose (Sarkar et al. 2007). Trehalose

has been proposed to induce autophagy not by upregulating

Atg5 but probably by increasing the number of auto-

phagosomes and activating the clearance of polyQ aggre-

gates (Sarkar et al. 2007). This occurs by a mechanism

independent of the mammalian target of rapamycin

(mTOR) (Sarkar et al. 2007). In our case too, we found that

the level of Tor2 remained unaltered under both conditions

(Table 2), confirming its non-participation in trehalose-

induced autophagic pathway.

Trehalose-Induced Solubilisation of 103Q-htt Leads

to Overexpression of Hsp104

The beneficial effect observed earlier in the presence of

trehalose could be due to increased uptake of trehalose by

yeast cells. The basal level of trehalose is *7 times less in

Dnth1 cells than in parental cells (Saleh et al., manuscript

submitted). When grown in the presence of 4 % (wv-1)

trehalose, yeast cells were found to have accumulated

significantly higher amount of trehalose (30.29 ± 0.22 lg/

mg dry cell weight) as compared to cells grown in the

presence of galactose alone (22.95 ± 1.58 lg/mg dry cell

weight) (Fig. 3a). Trehalose has been shown to have a

beneficial effect not only in case of huntingtin (Tanaka

et al. 2004; Sarkar et al. 2007), but also for other amyloid

fibril-forming proteins (Davies et al. 2006; Lan et al. 2012).

The higher amount of trehalose accumulated in yeast cells

corresponded with reduction in the aggregation of 103Q-

Fig. 3 Interaction between trehalose and Hsp104 in solubilisation of

103Q-htt. a Measurement of intracellular trehalose. Values shown are

mean ± SEM of three independent experiments, **p \ 0.01 against

103Q-htt grown in the absence of trehalose. b Western blot analysis to

monitor expression of Hsp104p. Protein load was equal in all lanes as

confirmed by Coomassie staining of the protein gel (data not shown).

The nitrocellulose membrane was stained with anti-Hsp104 antibody

(1:1,00,000). c Quantification of band intensities of Hsp104 using

ImageQuantTM software (GE Healthcare), by running western blots

from three independent sets of samples. In each case, the band

intensity of Hsp104 in cells expressing 25Q-htt was arbitrarily

assigned a value of 1. The intensities of other bands were calculated

with respect to this value. The quantification shown is mean ± SEM

of these three independent measurements. The image shown is that of

a representative blot. **p \ 0.01 against 25Q-htt grown in the

absence of trehalose, ##p \ 0.01 against 103Q-htt grown in the

absence of trehalose, N.S.: Non-significant

Neuromol Med

123

htt, decreased production of ROS and increased cell

survival.

The chaperone, heat shock protein, Hsp104, in cooper-

ation with Hsp40-70 chaperone system, is involved in the

solubilisation and refolding of misfolded and aggregated

proteins (Glover and Lindquist 1998; Winkler et al. 2012).

Immunoblotting with Hsp104 antibody showed approxi-

mately twofold decrease in Hsp104 expression in case of

cells expressing aggregated 103Q-htt (in the absence of

trehalose) as compared to those cells expressing 25Q-htt

(Fig. 3b). The reduced level of Hsp104 is due to the

impairment of heat shock response in these cells (Duenn-

wald and Lindquist 2008; Chafekar and Duennwald 2012)

and correlates with their inability to solubilise huntingtin

aggregates. In case of cells grown in the presence of tre-

halose, fivefold increase in the expression of Hsp104p was

seen as compared to cells expressing 103Q-htt in the

absence of trehalose and more than twofold increase when

compared with cells expressing 25Q-htt (Fig. 3c). This

corresponded with reduction in the aggregation of 103Q-

htt. No difference in the expression of Hsp104p was

observed in case of cells expressing 25Q-htt in the absence

or presence of trehalose (Fig. 3b). Thus, the level of the

chaperone did not increase simply due to the presence of

trehalose but rather as a cellular response to the toxic insult

of aggregated 103Q-htt. Since 103Q-htt exists in the sol-

uble form in an Hsp104-deleted background due to prion

loss (Krobitsch and Lindquist 2000), the effect of trehalose

on the solubilisation of 103Q-htt in a DHsp104 strain could

not be monitored.

Trehalose-Induced Solubilisation of 103Q-htt Rescues

Endocytosis in Yeast Cells

FM 4-64 is a lipophilic styryl dye, which fluoresces only in

living cells. The dye intercalates into the plasma membrane

and is internalised by cells by endocytosis (Meriin et al.

2003). We used the fluorescent probe FM 4-64 to investi-

gate the effect of the expression of mutant huntingtin

protein on endocytosis in a yeast model of Huntington’s

disease. Cells expressing 25Q-htt showed internalisation of

the dye within 5 min of exposure (Fig. 4). A delay in

endocytosis of the dye was observed in the cells expressing

aggregated 103Q-htt, as indicated by the absence of a

fluorescence signal after 5 min (Fig. 4). The fluorescence

probe could be visualised inside the cell only after 15 min

of incubation. This indicates a defect in endocytosis pro-

cess due to the aggregation of 103Q-htt and matches results

described by others (Meriin et al. 2003). 72Q-htt had ear-

lier been shown to inhibit clathrin-mediated endocytosis in

primary striatal neurons (Trushina et al. 2006). Interest-

ingly, the trehalose-treated cells, expressing partially sol-

ubilised 103Q-htt, showed an earlier internalisation of the

dye as compared to the cells grown in the absence of tre-

halose (Fig. 4). Thus, trehalose rescued the cells from the

deleterious effect of the aggregation of mutant huntingtin

protein, and hence, the endocytosis process.

Discussion

The cell has developed mechanisms to defend itself against

misfolded and aggregated proteins. Among them are

molecular chaperones that aid in normal folding and also in

refolding of abnormal conformations back to the native

state (Stefani and Dobson 2003). Hsp104p acts as a

molecular chaperone, solubilising aggregates and restoring

the composition of the cellular proteome (Glover and

Lindquist 1998). Along with helper chaperones, it is also

required for prion propagation in yeast cells. Seeding

activity of Hsp104p leads to the disaggregation of the prion

protein Rnq1, which induces the formation of polyQ

aggregates (Meriin et al. 2002). Hsp104p cooperates with

Ydj1p and Ssa1p to refold and reactivate denatured and

aggregated proteins (Meriin et al. 2002). Although not

clearly understood, the activities of trehalose and Hsp104

are closely related as far as stabilization of proteins is

concerned (Iwahashi et al. 1998). Hsp104 functions as a

solubiliser of aggregated proteins (Winkler et al. 2012). It

also has the ability to correct the folding of misfolded

proteins in vitro. The downregulation of Hsp104 expres-

sion leads to reduced ‘seed’ formation and increase in

solubilisation of 103Q-htt aggregates. It has been suggested

that in the cell, trehalose and Hsp104 play complementary

roles in protein folding when exposed to stress. Trehalose

‘holds’ the stress-induced unfolded protein in a ‘folding-

ready’ form and does not allow it to misfold any further

(Singer and Lindquist 1998). This trehalose-stabilised

polypeptide chain is refolded back to the correct confor-

mation by Hsp104. Degradation of trehalose occurs before

refolding can take place. Based on in vitro experiments, it

has been suggested that trehalose is an inhibitor of protein

folding (Singer and Lindquist 1998). Thus, it is likely that

in this case too, trehalose leads to the stabilization of 103Q-

htt in the monomeric form till it is refolded back to the

native conformation by Hsp104.

Inducers of mitochondrial biogenesis have shown

promise in slowing down the progression of HD (Gopinath

and Sudhandiran 2012; Johri and Beal 2012). Trehalose has

been reported to restore mitochondrial function by reduc-

ing the level of mitochondrial cytochrome c and restore

equilibrium in response to oxidative stress (Noubhani et al.

2009). Increased ROS has been shown to induce autophagy

as a mechanism to degrade damaged mitochondria (Chen

and Gibson 2008). Since trehalose also acts as an inducer

of autophagy (Sarkar et al. 2007), it is likely that it helps in

Neuromol Med

123

the clearance of damaged mitochondria, restoring the redox

balance of the cell. Increased ROS level has been reported

to negatively regulate the global translation machinery of

the cells by inhibiting phosphorylation of eukaryotic initi-

ation factor-2 via Gcn2 protein kinase (Shenton et al.

2006). We and others have observed a mismatch between

the gene expression data and proteomic milieu with respect

to scavenger enzymes when the yeast cell is exposed to

oxidative stress (Vogel et al. 2011; Singh et al. 2013).

Thus, the cells upregulated the expression of Hsp104 at

mRNA level but this message could not be translated at the

protein level, which resulted in the expression of 103Q-htt

in the aggregated form.

Another possible reason for the discrepancy could be the

sequestration of Hsp104p by 103Q-htt aggregates.

Recruitment of molecular chaperones by aggregates of

mutant huntingtin has been reported to accompany reduc-

tion in their levels in the cellular proteome pool (Sorolla

et al. 2012). Although no mammalian orthologue of

Hsp104 is known, carbonylation of other chaperones, e.g.

Hsp90 in human striatum, has been reported in case of HD

patients (Sorolla et al. 2008). The partial solubilisation of

103Q-htt in the presence of trehalose resulted from the

increased expression of Hsp104p. Since the oxidative stress

generated in these cells was low, translation of Hsp104p

remained unaffected, and hence, the marginal increase in

the expression of Hsp104 was sufficient to cause solubili-

sation of the elongated polyglutamine stretch. Our results

match with earlier reports which show that the aggregation

of mutant huntingtin activates the unfolded protein

response (UPR) selectively but not the heat shock response

in yeast cells (Duennwald and Lindquist 2008; Chafekar

and Duennwald 2012), as seen by the low level of the

expression of Hsp104 and Hsp26. Expression of an

expanded polyQ stretch has, in fact, been shown to

adversely affect the heat shock response elements of the

Fig. 4 Monitoring endocytosis by FM 4-64 internalisation in yeast

cells expressing normal (25Q-htt) and mutant (103Q-htt) huntingtin in

the absence and presence of trehalose. White arrows indicate 25Q-htt/

103Q-htt expressing cells showing internalisation of FM4-64. Bar at

the bottom of the figure = 50 lm

Neuromol Med

123

yeast cell (Chafekar and Duennwald 2012). Progression of

HD in both transgenic and knockin mouse models has been

associated with impaired heat shock response whose

induction regulates proteostasis under stress conditions

(Labbadia et al., 2011). The ability of the master regulator

Hsf1 to bind to the promoter regions of different chaper-

ones, especially Hsp70, is compromised in transgenic mice,

leading to impaired heat shock response (Labbadia et al.

2011). Our findings correlate with the earlier report of

reduction in polyglutamine aggregation with the overex-

pression of yeast Hsp104 (Cashikar et al. 2005), leading to

prolonged survival of transgenic mice model of Hunting-

ton’s disease (De Souza et al. 2009).

The cell attempts to restore the balance between protein

folding aids and increased ROS by increasing the tran-

scription process. In the absence of trehalose, the delete-

rious effect of ROS impairs the translation process, leading

to reduced cell viability. The ameliorative effect of treha-

lose is able to partially restore this process, leading to

reduced ROS and increased cell viability. Whether the

reduction in oxidative stress is a direct effect of the pre-

sence of trehalose or a result of solubilisation is open to

speculation. The presence of trehalose does not relieve the

oxidative stress in cells expressing 25Q-htt (Fig. 2a). Thus,

we favour the second possibility that in this case, trehalose

exerts its beneficial effect by stabilising the soluble

(monomeric) form of mutant huntingtin, and restoring the

cellular redox homeostasis.

Formation of polyQ aggregates has been shown to result

in a defect in endocytosis, in an event independent of

cytotoxicity (Meriin et al. 2003). Wild-type huntingtin

protein has been found to participate in protein trafficking

between Golgi complex and extracellular space (Trushina

et al. 2004). Data from invertebrates and mammals have

suggested an essential role of huntingtin protein in fast

axonal trafficking. Moreover, expression of mutant hun-

tingtin protein in mammalian neurons in vitro and in vivo

impairs vesicular and mitochondrial trafficking (Trushina

et al. 2004). Earlier experiments had shown reversal of

endocytic defects in cells ‘cured’ of the prion phenotype,

where 103Q-htt was expressed in the soluble form (Meriin

et al. 2003). Gene expression analysis had shown the

reversal of upregulation of Btn2, a gene which codes for a

protein involved in the trafficking of sorting late endosomal

proteins, in the presence of trehalose (Table 2). Btn2p is an

orthologue of the mammalian Hook1 protein and is

involved in late endosome to Golgi transport. Our results

here indicate that one of the routes by which the formation

of polyQ aggregates leads to cytotoxicity is by blocking not

only the early, but also the late stages of endocytosis. This

process is rescued by trehalose, which solubilises the

aggregated polyQ protein, reduces the oxidative stress,

restores the endocytic process and improves cell survival.

Given the complex nature of interaction between trehalose

and heat shock proteins, our results do not preclude the

possibility that the disaccharide restores the heat shock

machinery into its functional form, which is impaired due

to the aggregation of mutant huntingtin protein (Chafekar

and Duennwald 2012; Labbadia et al. 2011). This may be

responsible for the beneficial effect seen following

administration of trehalose.

Conclusion

The protective property of trehalose (as a chemical chap-

erone) leading to reduced cytotoxicity may be relevant to

the development of any therapy regimen for the treatment

of Huntington’s disease. The beneficial effect of adminis-

tration of trehalose observed in HD mice model (Tanaka

et al. 2004) may be due to the increased solubilisation of

mutant huntingtin in the presence of trehalose. Since the

formation of aggregates has been linked to disease pro-

gression in case of Huntington’s disease and other protein-

misfolding diseases, it can be anticipated that reduction in

the aggregation of the protein would lead to amelioration of

symptoms. We show here that even prior to autophagy and

its induction by trehalose, the cell attempts to restore the

equilibrium by solubilising the mutant huntingtin protein

and improving cell viability by increasing the expression of

Hsp104p. The evidence for the ameliorative effect lies in

the fact that trehalose-treated cells show repair of the

endocytosis network, a common pathological feature of

HD.

Acknowledgments The authors are thankful to Prof. Michael Y.

Sherman, Boston University School of Medicine, Boston, Massa-

chusetts, USA for the gifts of pYES2-25Q-htt and pYES2-103Q-htt

and to Prof. John R. Glover, Department of Biochemistry, University

of Toronto, Toronto, Canada for the gift of Hsp104 antibody. The

work was partially supported by a research grant from Department of

Science and Technology (Govt. of India). RKC acknowledges the

award of senior research fellowship by Indian Council of Medical

Research (Govt. of India).

Conflict of interest The authors declare that they have no conflict

of interest.

References

Appl, T., Kaltenbach, L., Lo, D. C., & Terstappen, G. C. (2012).

Targeting mutant huntingtin for the development of disease-

modifying therapy. Drug Discovery Today, 17(21–22),

1217–1223.

Arrasate, M., Mitra, S., Schweitzer, E. S., Segal, M. R., & Finkbeiner,

S. (2004). Inclusion body formation reduces levels of mutant

huntingtin and the risk of neuronal death. Nature, 431(7010),

805–810.

Neuromol Med

123

Bai, M., Zhou, J. M., & Perret, S. (2004). The yeast prion protein

Ure2 shows glutathione S-transferase activity in both native and

fibrillar forms. Journal of Biological Chemistry, 279(48),

50025–50030.

Borlongan, C. V., Kanning, K., Poulos, S. G., Freeman, T. B., Cahill,

D. W., & Sanberg, P. R. (1996). Free radical damage and

oxidative stress in Huntington’s disease. Journal of Florida

Medical Association, 83(5), 335–341.

Bradford, M. M. (1976). A rapid and sensitive method for the

quantitation of microgram quantities of protein utilizing the

principle of protein-dye binding. Analytical Biochemistry,

72(1–2), 248–254.

Cashikar, A. G., Duennwald, M., & Lindquist, S. L. (2005). A

chaperone pathway in protein disaggregation. Hsp26 alters the

nature of protein aggregates to facilitate reactivation by Hsp104.

Journal of Biological Chemistry, 280(25), 23869–23875.

Chafekar, S. M., & Duennwald, M. L. (2012). Impaired heat shock

response in cells expressing full-length polyglutamine-expanded

huntingtin. PLoS One, 7(5), e37929.

Chattopadhyay, S., Roberts, P. M., & Pearce, D. A. (2003). The yeast

model for Batten disease: A role for Btn2p in the trafficking of

the Golgi-associated vesicular targeting protein, Yif1p. Bio-

chemical and Biophysical Research Communications, 302(3),

534–538.

Chen, Y., & Gibson, S. B. (2008). Is mitochondrial generation of

reactive oxygen species a trigger for autophagy? Autophagy,

4(2), 246–248.

Collart, M. A., & Oliviero, S. (2001). Preparation of yeast RNA.

Current Protocols in Molecular Biology, 23, 13.12.1–13.12.5.

doi:10.1002/0471142727.mb1312s23.

Davies, J. E., Sarkar, S., & Rubinsztein, D. C. (2006). Trehalose

reduces aggregate formation and delays pathology in a trans-

genic mouse model of oculopharyngeal muscular dystrophy.

Human Molecular Genetics, 15(1), 23–31.

Davies, S. W., Turmaine, M., Cozens, B. A., DiFiglia, M., Sharp, A.

H., Ross, C. A., et al. (1997). Formation of neuronal intranuclear

inclusions underlies the neurological dysfunction in mice

transgenic for the HD mutation. Cell, 90(3), 537–548.

De Souza, E. B., Cload, S. T., Pendergrast, P. S., & Sah, D. W.

(2009). Novel therapeutic modalities to address nondrugable

protein interaction targets. Neuropsychopharmacology, 34(1),

142–158.

Derkatch, I. L., Bradley, M. E., & Liebman, S. W. (1998).

Overexpression of the SUP45 gene encoding a Sup35p-binding

protein inhibits the induction of the de novo appearance of the

[PSI?] prion. Proceedings of National Academy of Sciences of

USA, 95(5), 2400–2405.

Derkatch, I. L., Uptain, S. M., Outeiro, T. F., Krishnan, R., Lindquist,

S. L., & Liebman, S. W. (2004). Effects of Q/N-rich, polyQ, and

non-polyQ amyloids on the de novo formation of the [PSI?]

prion in yeast and aggregation of Sup35 in vitro. Proceedings of

National Academy of Sciences of USA, 101(35), 12934–12939.

Duennwald, M. L. (2011). Polyglutamine misfolding in yeast: Toxic

and protective aggregation. Prion, 5(4), 285–290.

Duennwald, M. L., & Lindquist, S. (2008). Impaired ERAD and ER

stress are early and specific events in polyglutamine toxicity.

Genes & Development, 22(23), 3308–3319.

Einhauer, A., Schuster, M., Wasserbauer, E., & Jungbauer, A. (2002).

Expression and purification of homogenous proteins in Saccha-

romyces cerevisiae based on ubiquitin-FLAG fusion. Protein

Expression and Purification, 24(3), 497–504.

Faber, P. W., Voisine, C., King, D. C., Bates, E. A., & Hart, A. C.

(2002). Glutamine/proline-rich PQE-1 proteins protect Caeno-

rhabditis elegans neurons from huntingtin polyglutamine neuro-

toxicity. Proceedings of National Academy of Sciences of USA,

99(26), 17131–17136.

Ferreira, J. C., Paschoalin, V. M. F., Panek, A. D., & Trugo, L. C.

(1997). Comparison of three different methods for trehalose

determination in yeast extracts. Food Chemistry, 60(2), 251–254.

Gietz, D., St. Jean, A., Woods, R. A., & Schiestl, R. H. (1992).

Improved method for high efficiency transformation of intact

yeast cells. Nucleic Acids Research, 20(6), 1425–1431.

Glover, J. R., & Lindquist, S. (1998). Hsp104, Hsp70, and Hsp40: a

novel chaperone system that rescues previously aggregated

proteins. Cell, 94(1), 73–82.

Gopinath, K., & Sudhandiran, G. (2012). Naringin modulates

oxidative stress and inflammation in 3-nitropropionic acid-

induced neurodegeneration through the activation of Nrf2

signalling pathway. Neuroscience, 227, 134–143.

Hames, B. D. (1998). Gel electrophoresis of proteins: A practical

approach (3rd ed.). Oxford: Oxford University Press.

Hands, S., Sajjad, M. U., Newton, M. J., & Wyttenbach, A. (2011).

In vitro and in vivo aggregation of a fragment of huntingtin

protein directly causes free radical production. Journal of

Biological Chemistry, 286(52), 44512–44520.

Iwahashi, H., Nwaka, S., Obuchi, K., & Komatsu, Y. (1998).

Evidence for the interplay between trehalose metabolism and

Hsp104 in yeast. Applied and Environmental Microbiology,

64(11), 4614–4617.

Jain, N. K., & Roy, I. (2009). Effect of trehalose on protein structure.

Protein Science, 18(1), 24–36.

Johri, A., & Beal, M. F. (2012). Antioxidants in Huntington’s disease.

Biochimica et Biophysica Acta, 1822(5), 664–674.

Kanneganti, V., Kama, R., & Gerst, J. E. (2011). Btn3 is a negative

regulator of Btn2-mediated endosomal protein trafficking and prion

curing in yeast. Molecular Biology of Cell, 22(10), 1648–1663.

Krobitsch, S., & Lindquist, S. (2000). Aggregation of huntingtin in

yeast varies with the length of the polyglutamine expansion and

the expression of chaperone proteins. Proceedings of National

Academy of Sciences of USA, 97(4), 1589–1594.

Labbadia, J., Cunliffe, H., Weiss, A., Katsyuba, E., Sathasivam, K.,

Seredenina, T., et al. (2011). Altered chromatin architecture

underlies progressive impairment of the heat shock response in

mouse models of Huntington disease. Journal of Clinical

Investigation, 121(8), 3306–3319.

Lan, D. M., Liu, F. T., Zhao, J., Chen, Y., Wu, J. J., Ding, Z. T., et al.

(2012). Effect of trehalose on PC12 Cells overexpressing wild-

type or A53T mutant a-synuclein. Neurochemistry Research,

37(9), 2025–2032.

Landles, C., Sathasivam, K., Weiss, A., Woodman, B., Moffitt, H.,

Finkbeiner, S., et al. (2010). Proteolysis of mutant huntingtin

produces an exon 1 fragment that accumulates as an aggregated

protein in neuronal nuclei in Huntington disease. Journal of

Biological Chemistry, 285(12), 8808–8823.

Lillie, S. H., & Pringle, J. R. (1980). Reserve carbohydrate

metabolism in Saccharomyces cerevisiae: Responses to nutrient

limitation. Journal of Bacteriology, 143(3), 1384–1394.

Maat-Schieman, M., Roos, R., Losekoot, M., Dorsman, J., Welling-

Graafland, C., Hegeman-Kleinn, I., et al. (2007). Neuronal

intranuclear and neuropil inclusions for pathological assessment

of Huntington’s disease. Brain Pathology, 17(1), 31–37.

Malinovska, L., Kroschwald, S., Munder, M. C., Richter, D., &

Alberti, S. (2012). Molecular chaperones and stress-inducible

protein-sorting factors coordinate the spatiotemporal distribution

of protein aggregates. Molecular Biology of the Cell, 23(16),

3041–3056.

Meriin, A. B., Zhang, X., He, X., Newnam, G. P., Chernoff, Y. O., &

Sherman, M. Y. (2002). Huntington toxicity in yeast model

depends on polyglutamine aggregation mediated by a prion-like

protein Rnq1. Journal of Cell Biology, 157(6), 997–1004.

Meriin, A. B., Zhang, X., Miliaras, N. B., Kazantsev, A., Chernoff, Y.

O., McCaffery, J. M., et al. (2003). Aggregation of expanded

Neuromol Med

123

polyglutamine domain in yeast leads to defects in endocytosis.

Molecular and Cell Biology, 23(21), 7554–7565.

Nestor, C. E., & Monckton, D. G. (2011). Correlation of inter-locus

polyglutamine toxicity with CAG•CTG triplet repeat expand-

ability and flanking genomic DNA GC content. PLoS ONE,

6(12), e28260.

Noubhani, A., Bunoust, O., Bonini, B. M., Thevelein, J. M., Devin,

A., & Rigoulet, M. (2009). The trehalose pathway regulates

mitochondrial respiratory chain content through hexokinase 2

and cAMP in Saccharomyces cerevisiae. Journal of Biological

Chemistry, 284(40), 27229–27234.

Ravikumar, B., Duden, R., & Rubinsztein, D. C. (2002). Aggregate-

prone proteins with polyglutamine and polyalanine expansions

are degraded by autophagy. Human Molecular Genetics, 11(9),

1107–1117.

Renna, M., Jimenez-Sanchez, M., Sarkar, S., & Rubinsztein, D. C.

(2010). Chemical inducers of autophagy that enhance the

clearance of mutant proteins in neurodegenerative diseases.

Journal of Biological Chemistry, 285(15), 11061–11067.

Rodrıguez-Navarro, J. A., Rodrıguez, L., Casarejos, M. J., Solano, R.

M., Gomez, A., Perucho, J., et al. (2010). Trehalose ameliorates

dopaminergic and tau pathology in parkin deleted/tau over-

expressing mice through autophagy activation. Neurobiology of

Disease, 39(3), 423–438.

Ross, C. A., & Tabrizi, S. J. (2011). Huntington’s disease: from

molecular pathogenesis to clinical treatment. Lancet Neurology,

10(1), 83–98.

Rozen, S., & Skaletsky, H. (2000). Primer3 on the WWW for general

users and for biologist programmers. Methods in Molecular

Biology, 132, 365–386.

Sanchez, I., Mahlke, C., & Yuan, J. (2003). Pivotal role of

oligomerization in expanded polyglutamine neurodegenerative

disorders. Nature, 421(6921), 373–379.

Sarkar, S., Davies, J. E., Huang, Z., Tunnacliffe, A., & Rubinsztein,

D. C. (2007). Trehalose, a novel mTOR-independent autophagy

enhancer, accelerates the clearance of mutant huntingtin and

alpha-synuclein. Journal of Biological Chemistry, 282(8),

5641–5652.

Sarkar, S., Ravikumar, B., Floto, R. A., & Rubinsztein, D. C. (2009).

Rapamycin and mTOR-independent autophagy inducers amelio-

rate toxicity of polyglutamine-expanded huntingtin and related

proteinopathies. Cell Death and Differentiation, 16(1), 46–56.

Sarkar, S., & Rubinsztein, D. C. (2008). Huntington’s disease:

Degradation of mutant huntingtin by autophagy. FEBS Journal,

275(17), 4263–4270.

Schaeffer, V., & Goedert, M. (2012). Stimulation of autophagy is

neuroprotective in a mouse model of human tauopathy. Autoph-

agy, 8(11), 1686–1687.

Schaeffer, V., Lavenir, I., Ozcelik, S., Tolnay, M., Winkler, D. T., &

Goedert, M. (2012). Stimulation of autophagy reduces neurode-

generation in a mouse model of human tauopathy. Brain, 135(Pt

7), 2169–2177.

Schmittgen, T. D., & Livak, K. J. (2008). Analyzing real-time PCR

data by the comparative CT method. Nature Protocols, 3(6),

1101–1108.

Shenton, D., Smirnova, J. B., Selley, J. N., Carroll, K., Hubbard, S. J.,

Pavitt, G. D., et al. (2006). Global translational responses to

oxidative stress impact upon multiple levels of protein synthesis.

Journal of Biological Chemistry, 281(39), 29011–29021.

Singer, M. A., & Lindquist, S. (1998). Multiple effects of trehalose on

protein folding in vitro and in vivo. Molecular Cell, 1(5),

639–648.

Singh, K., Saleh, A. A., Bhadra, A. K., & Roy, I. (2013). Hsp104 as a

key modulator of prion-mediated oxidative stress in Saccharo-

myces cerevisiae. Biochemical Journal, 454(2), 217–225.

Sorolla, M. A., Reverter-Branchat, G., Tamarit, J., Ferrer, I., Ros, J.,

& Cabiscol, E. (2008). Proteomic and oxidative stress analysis in

human brain samples of Huntington disease. Free Radical

Biology & Medicine, 45(5), 667–678.

Sorolla, M. A., Rodrıguez-Colman, M. J., Vall-llaura, N., Tamarit, J.,

Ros, J., & Cabiscol, E. (2012). Protein oxidation in Huntington

disease. BioFactors, 38(3), 173–185.

Stefani, M., & Dobson, C. M. (2003). Protein aggregation and

aggregate toxicity: New insights into protein folding, misfolding

diseases and biological evolution. Journal of Molecular Medi-

cine (Berlin), 81(11), 678–699.

Tanaka, M., Machida, Y., Niu, S., Ikeda, T., Jana, N. R., Doi, H., et al.

(2004). Trehalose alleviates polyglutamine-mediated pathology

in a mouse model of Huntington disease. Nature Medicine,

10(2), 148–154.

The Huntington’s Disease Collaborative Research Group. (1993). A

novel gene containing a trinucleotide repeat that is expanded and

unstable on Huntington’s disease chromosomes. Cell, 72(6),

971–983.

Trushina, E., Dyer, R. B., Badger, J. D., 2nd, Ure, D., Eide, L., Tran,

D. D., et al. (2004). Mutant huntingtin impairs axonal trafficking

in mammalian neurons in vivo and in vitro. Molecular and Cell

Biology, 24(18), 8195–8209.

Trushina, E., Singh, R. D., Dyer, R. B., Cao, S., Shah, V. H., Parton,

R. G., et al. (2006). Mutant huntingtin inhibits clathrin-

independent endocytosis and causes accumulation of cholesterol

in vitro and in vivo. Human Molecular Genetics, 15(24),

3578–3591.

Vogel, C., Silva, G. M., & Marcotte, E. M. (2011). Protein expression

regulation under oxidative stress. Molecular and Cellular

Proteomics, 10(12), 1–12.

Weiss, K. R., Kimura, Y., Lee, W. C., & Littleton, J. T. (2012).

Huntingtin aggregation kinetics and their pathological role in a

Drosophila Huntington’s disease model. Genetics, 190(2),

581–600.

Winkler, J., Tyedmers, J., Bukau, B., & Mogk, A. (2012). Hsp70

targets Hsp100 chaperones to substrates for protein disaggrega-

tion and prion fragmentation. Journal of Cell Biology, 198(3),

387–404.

Wong, C. M., Zhou, Y., Ng, R. W. M., Kung, H., & Jin, D. Y. (2002).

Cooperation of yeast peroxiredoxins Tsa1p and Tsa2p in the

cellular defense against oxidative and nitrosative stress. Journal

of Biological Chemistry, 277(7), 5385–5394.

Neuromol Med

123