dctbp-dependent and -independent repression activities of the

MOLECULAR AND CELLULAR BIOLOGY,0270-7306/00/$04.0010

Oct. 2000, p. 7247–7258 Vol. 20, No. 19

Copyright © 2000, American Society for Microbiology. All Rights Reserved.

dCtBP-Dependent and -Independent Repression Activities ofthe Drosophila Knirps Protein

SCOTT A. KELLER,1 YIFAN MAO,1† PAOLO STRUFFI,1 CARLA MARGULIES,1‡ CATHERINE E. YURK,1

AMELIA R. ANDERSON,1 ROXANE L. AMEY,1 SARAH MOORE,1 JULIE M. EBELS,1

KATHY FOLEY,1 MARIA CORADO,2 AND DAVID N. ARNOSTI1*

Department of Biochemistry and Molecular Biology, Michigan State University, East Lansing, Michigan 48824-1319,1

and Department of Biology, New York University, New York, New York 100032

Received 23 May 2000/Accepted 12 June 2000

Transcriptional repressor proteins play essential roles in controlling the correct temporal and spatialpatterns of gene expression in Drosophila melanogaster embryogenesis. Repressors such as Knirps, Kruppel,and Snail mediate short-range repression and interact with the dCtBP corepressor. The mechanism by whichshort-range repressors block transcription is not well understood; therefore, we have undertaken a detailedstructure-function analysis of the Knirps protein. To provide a physiological setting for measurement ofrepression, the activities of endogenous or chimeric Knirps repressor proteins were assayed on integratedreporter genes in transgenic embryos. Two distinct repression functions were identified in Knirps. Onerepression activity depends on dCtBP binding, and this function maps to a C-terminal region of Knirps thatcontains a dCtBP binding motif. In addition, an N-terminal region was identified that represses in a CtBPmutant background and does not bind to the dCtBP protein in vitro. Although the dCtBP protein is importantfor Knirps activity on some genes, one endogenous target of the Knirps protein, the even-skipped stripe 3enhancer, is not derepressed in a CtBP mutant. These results indicate that Knirps can utilize two differentpathways to mediate transcriptional repression and suggest that the phenomenon of short-range repressionmay be a combination of independent activities.

Transcriptional repression is a critical component of geneticregulation during development, and the Drosophila melano-gaster embryo has served as an important model for elucidationof basic repression mechanisms (7, 19). Differential gene ex-pression in the early embryo is controlled in large part by theactivity of repressor proteins encoded by gap, pair-rule, andother genes (42, 45). Repression of transcription can involvereactions occuring off the DNA, such as the formation ofinactive heteromeric complexes. Another mechanism involvescompetition between activators and repressors for binding siteson DNA. DNA-binding repressors that function by mecha-nisms other than competitive binding have been termed activerepressors (24).

An active repressor can repress basal promoters or enhancerelements over a short range (,100 bp) or, alternatively, overlong ranges (.1,000 bp) (7, 17). One model of repression inthe embryo suggests that the short-range–long-range distinc-tion results from the recruitment of distinct classes of cofactors(36, 55). Short-range repressors may interact with dCtBP,while long-range repressors interact with Groucho.

Long-range repressors are typified by the Hairy protein, atranscription factor that binds the Groucho cofactor (5, 27, 40).Long-range repression complexes regulating the dpp, tld, andzen genes also recruit Groucho (7, 27), as do Engrailed, Runt,and dTCF, Drosophila repressors whose range of action hasnot yet been determined (3, 9, 50).

Short-range repressors present in the early Drosophila em-

bryo include Snail, Kruppel, Giant, and Knirps. These proteinsare capable of repressing the activity of enhancer elementswhen bound within ;100 bp of key activator sites or of a basalpromoter element when cognate sites are introduced close tothe start of transcription (2, 16, 18, 22). Knirps, Snail, andKruppel were recently shown to interact physically and genet-ically with dCtBP, a Drosophila homolog of mammalian CtBP,a factor that binds to and modulates the transcriptional andtransforming activity of the adenovirus E1a protein (37, 40,43). CtBP proteins also function as corepressors in vertebrates(13, 52).

In embryos lacking dCtBP, repression by Knirps, Snail, andKruppel of endogenous target genes such as even-skipped (eve),hairy, rhomboid (rho), runt, and fushi-tarazu is disrupted (36,40). In addition, point mutations affecting residues requiredfor dCtBP binding also compromise repression by Knirps,Snail, and Kruppel (36, 37). The expression patterns of Snail,Kruppel, and Knirps are largely intact in a CtBP mutant, con-sistent with the hypothesis that dCtBP contributes directly tothe transcriptional repression activity of these proteins, ratherthan controlling their expression (36, 40). When fused to het-erologous DNA binding domains, dCtBP can directly represstranscription in embryo and cell culture systems, suggestingthat the cofactor has a direct role in mediating repression (13,36, 37, 52). The mechanism by which CtBP proteins represstranscription is unknown, although there have been sugges-tions of interactions with histone deacetylases (12, 48). Inter-actions with Polycomb proteins have also been noted (44).

knirps is expressed in the early embryo in presumptive ab-dominal and head regions, and mutations in the knirps geneare embryonic lethal, showing a characteristic gap phenotypeof the larval cuticle (38, 54). knirps also plays important rolesin tracheal and wing formation later in development (10, 32).The knirps gene encodes a transcription factor with homologyto nuclear hormone receptors, possessing a conserved N-ter-

* Corresponding author. Mailing address: Department of Biochem-istry and Molecular Biology, Michigan State University, East Lansing,MI 48824-1319. Phone: (517) 432-5504. Fax: (517) 353-9334. E-mail:[email protected].

† Present address: Calydon, Sunnyvale, CA 94089.‡ Present address: Cold Spring Harbor Laboratory, Cold Spring

Harbor, NY 11724.

7247

on February 13, 2018 by guest

http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

minal zinc finger DNA binding domain and a C-terminal ef-fector region (2, 35). The C terminus does not resemble thecanonical hormone receptor ligand binding domain, however,and Knirps is not known to interact with small molecule li-gands. Analysis of knirps mutations revealed that loss of theDNA binding zinc fingers or more C-terminal truncations atcodons 145 or 185 have a strong phenotype, but a frameshiftafter codon 232 creates a weak allele, with less severe cuticu-lar defects (14). Molecular targets of Knirps protein includethe eve and hairy genes (29, 47). In transgenic embryo assays,Knirps represses heterologous enhancers and promoters over ashort range. This repression function is modular and can betransferred to a heterologous DNA binding domain (2). Therepression domain of Knirps includes a motif, PMDLSMK,important for binding of dCtBP. Mutations in this motifsignificantly impair repression activities of a chimeric Gal4-Knirps 255-429 protein or a full-length Knirps protein (36, 37).However, a portion of Knirps not including the dCtBP bindingregion was shown to repress transcription in transiently trans-fected Drosophila cells (14). The hypomorphic mutation kni14F,which retains partial activity, also encodes a protein that lacksa dCtBP binding motif (14).

We have undertaken a molecular analysis of Knirps repres-sion function to identify mechanisms by which this short-rangerepressor acts. To characterize the activity of Knirps and Gal4-Knirps chimeras in a chromosomal context, known to be im-portant for proper functioning of repressors such as Engrailed(50), we have created transgenic embryos containing inte-grated reporter genes. Our studies identify two repression re-gions of the Knirps protein. One portion of Knirps, spanningamino acids 202 to 358, is dependent on the dCtBP bindingmotif for repression. The other, an N-terminal repression re-gion, is apparently independent of dCtBP activity. This repres-sion domain does not bind to dCtBP, and it mediates effectiverepression in embryos lacking dCtBP protein. The dual activ-ities of Knirps may provide the flexibility to regulate differenttarget genes through alternative pathways.

MATERIALS AND METHODS

Plasmids. The following oligonucleotides were used in construction of variousplasmids: 59 CACTCGAGTGACATG39 (a), 59AGATCCTCGAGTACAGCATG39 (b), 59ACGTGGATACGATTAAGTATGCATG39 (c), 59TCCATGATAAACGCGTGCTAGACTATTGCAGGTACTGATCGAATGCCTCTGCATG39(d), 59TCGCTAGACGTGAATCTCGTAGCTTCCGTATCCGTACCAAATGCGTATCAGGCATG39 (e), 59GGCCGACTACAAGGATGACGATGACAAGCACCATCACCACCATCACGC39 (f), 59TTGGCGCGCCAA39 (g), 59CGCGGCGCGCCTGGC39 (h), 59CATGCAGGCGCGC39 (i), 59CGCGATAGTGATAAGTAGAATT39 (transcription termination codons are shown in boldface type)(j), 59CGGGGTACCGCTGCCGCTGCAGCGGCTTCTGCTGCCGATGCCGCT39 (k), 59GGGGAATCTAGACTAACTAATTACTACTTGTCATCGTCATCCTTGTAATCCACCTCCACTTCTTGATCCTCGGA39 (l), 59CGGGGTACCGATGCCGCTTACCGGCAGGAGATGTACAAGCACCGC39 (m), 59GGGGAATCTAGACTAACTAATTACTACTTGTCATCGTCATCCTTGTAATCCACCTCCACTTCTTGATCCTCGGA39 (n), 59GGGTCGGTACCGCAGCCCTGCCCCCACACCTCCTCTTCCCA39 (o), 59GGGAATCTAGACTAAACTAATTACTAGATGGGCGACTGGCGGGCCGAGGA39 (p), 59CGGCAGGAGATGTACGTAGAGTCGCAGAACCGC39 (q), 59AAGCACCGCCAGAGCGTGGATTCCTCGCCCATCGATGTCTGCCTGGAG39 (r), 59ACTCCGACTAGCAGCAGTACTACCAGCGTTGTACCA39 (s), 59GTTTCCGCTCAAGAAGTGCACAGCTTCAACGAC39 (t), 59GGGTCGGTACCGCAGCCTCGGCCCGCCAGTCGCCCATCGAT39 (u), 59CAGAACCGCTTTAGTCCCGCCAGC39 (v), 59GGGGAATCTAGACTAACTAATTACTACTTGTCATCGTCATCCTTGTAATCTCCTTCTTGAGCGGAAACGGTGGG39 (w), 59GGGGAATCTAGACTAACTAATTACTACTTGTCATCGTCATCCTTGTAATCATGCAGGAGGCTTGCGGACGACTG39 (x), 59GGGTCGGTACCCACGAACAGGCCGCCGCAGCGGCGGGCAAG39 (y), 59GGGTCGGTACCGCCGCAGCGGGCTCGCCACACACTCCCGGATTTGGG39 (z), 59GGGTCGGTACCCACCACCATCATCAGCAGCAGCAGCAGCAC39 (aa), 59GGGTCGGTACCGCCGCAGCGTCCGCCGCCCTGCCCTTCTTCAGC39 (bb), 59GGGTCGGTACCCTGCCCCCACACCTCCTCTTCCCAGGCTAC39 (cc), 59GGGGAATCTAGACTAACTAATTACTACTTGTCATCGTCATCCTTGTAATCGAACTTCCGGCGCGGAGCCACCTC39 (dd), 59GGGGAATCTAGACTAAC

TAATTACTACTTGTCATCGTCATCCTTGTAATCGAACTTCCGGCGCGGAGCCACCTC39 (ee), and 59GGGGAATCTAGACTAACTAATTACTACTTGTCATCGTCATCCTTGTAATCGAACTTCCGGCGCGGAGCCACCTC39 (ff).

Promoter spacing constructs. Genes shown in Fig. 1 containing Knirps bindingsites at 270, 275, 2100, 2130, and 2180 were created by modification of a genecontaining dual Knirps binding sites located at 255 bp (2). This reporter con-struct contains divergent white and lacZ genes and enhancer elements derivedfrom the rho and twist genes in the vector C4PLZ (53). The original kni-55construct was modified by insertion of spacing oligonucleotides a (kni-70) or b(kni-75) at the SphI site between the TATA box and the Knirps binding sites. Thekni-75 construct was further modified by insertion of a 25-nucleotide spacer (c)or a 55-nucleotide spacer (d) to create kni-100 and kni-130. The kni-180 con-struct was created by insertion of oligonucleotide e downstream of the spacersequence of kni-130.

Chimeric Gal4-Knirps constructs. A transgene containing the open readingframe for the Gal4 DNA binding domain (residues 1 to 93) fused to codingsequence for amino acids 75 to 429 of Knirps was modified with a Flag-hexahis-tidine tag sequence (f) inserted at a NotI site situated in the linker regionbetween Gal4 and Knirps codons (2). Termination sequences were placed in theknirps coding sequence following codons 189, 254, or 332 by insertion of AscIadapter oligonucleotides g (Kni75-189), h (Kni75-254), or i (Kni75-332) into thePvuII, ClaI, or NcoI restriction sites, respectively, followed by introduction offour stop codons (oligonucleotide j) at the AscI site. Resultant chimeric genesencode proteins truncating with the amino acids (Knirps residues underlined)75 to 189 (PFQLAR), 75 to 254 (SPIAAR), or 75 to 332 (GPMQAR). An N-terminal deletion removing codons 75 to 187 was created by cleaving at the PvuIIsite and inserting an oligonucleotide (f) encoding a Flag epitope tag, resulting inthe junction sequence (Gal4 and Knirps residues underlined) ALLGTAADYKDDDDKQLP. A gene with an internal deletion was constructed by removing theregion between codons 189 and 254, using complementary AscI sites, generatingthe sequence PFQLARLADVC at the junction.

For constructs 8 to 14 shown in Fig. 2, portions of the knirps cDNA containedin the pCarnegie 20 vector pN741 (G. Struhl, unpublished data) were amplifiedusing PfuI DNA polymerase (Promega). The products were placed between theKpnI and XbaI sites of the pTwiggy vector (2) containing a twi enhancer element(2xPEe-Et) and twist basal promoter. The constructs and the correspondingprimers (in parentheses) used were Kni202-358 (k and l) DA (m and n), andKni189-254 (o and p). Additional deletions in this series were generated byoligonucleotide-directed mutagenesis using the Mutagene kit (Bio-Rad) (46).Construction of DB, in which codons 202 to 227 are deleted, used the mutagenicoligonucleotide q. Construction of DC, in which codons 228 to 251 are deleted,used oligonucleotide r. Construction of DD, in which codons 292 to 313 aredeleted, used oligonucleotide s. Construction of DE, in which codons 330 to 343are deleted, used oligonucleotide t. The DD construct described above was usedas a PCR template using oligonucleotides u and l. The product of this amplifi-cation was cloned into pTwiggy as above to generate DF.

A portion of the knirps cDNA was amplified from a pBluescript SK(1) clonewhich includes sequences encoding Knirps residues 75 to 429 using the primersv and either w (Kni75-330) or x (Kni75-276). The amplified fragments weredigested with ClaI and XbaI and used to replace the ClaI-XbaI fragment of theknirps cDNA clone in pBluescript SK(1). The KpnI-XbaI fragments of theseclones were then inserted into pTwiggy (2). The final constructs encode Knirpsamino acids 75 to 330 and 75 to 276 followed by an eight-amino-acid sequenceincluding the Flag epitope, DYKDDDDK.

Portions of the knirps cDNA were amplified as above using the oligonucleo-tides w and y (Kni94-330), z (Kni124-330), aa (Kni139-330), bb (Kni169-330), orcc (Kni189-330). The amplified products were cloned between the KpnI and XbaIsites of pTwiggy.

A plasmid containing a mutated knirps cDNA, Casper-22FDKE, was the kindgift of S. Small (36). Portions of this clone were amplified using the oligonucle-otides u and dd (75-364mut), ee (75-394mut), or ff (75-429mut). A ClaI/XbaIfragment of the amplified products were cloned into a pBluescript vector con-taining the Knirps coding sequence 75 to 429, replacing the endogenous C-terminal sequences with the novel sequences. KpnI/XbaI fragments were thensubcloned into pTwiggy. The products encoded by these constructs have thedCtBP-binding motif of Knirps, PMDLSMK, replaced by AAAASMK.

Constructs created by PCR were verified by complete sequencing of the openreading frames, and junctions of all clones were confirmed by sequencing. Thestructures of integrated transgenes for the deletions of Kni202-358 were furtherconfirmed by PCR analysis of genomic DNA.

T7 expression constructs, protein synthesis, and GST interaction assays. T7RNA polymerase expression constructs were derived from pET3a (Novagen) inwhich the XbaI site 59 of the T7 translational initiation site was destroyed byfilling in the site with Klenow fragment and religating the blunted ends. Se-quences encoding the Gal4 DNA binding domain (amino acids 1 to 93) frompTwiggy (2) were inserted into the NdeI-BamHI sites of the modified pET3avector. An XbaI linker, containing the sequence 59 CTCTAGAG 39, was insertedinto the BamHI site at the 39 end of the Gal4 encoding sequence. KpnI-XbaIfragments containing Knirps coding regions were isolated from P-element trans-formation vectors and inserted between the KpnI-XbaI sites 39 of the Gal4encoding sequences. Kni 75-340 and Kni 75-340M constructs were a kind gift ofY. Nibu and M. Levine (36). [35S]methionine labeled proteins were prepared by

7248 KELLER ET AL. MOL. CELL. BIOL.


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

in vitro translation using a coupled rabbit reticulocyte system (TNT; Promega)according to the manufacturer’s instructions. Glutathione S-transferase (GST)-dCtBP affinity columns were produced as described (36). Translation productswere mixed with GST or GST-dCtBP proteins bound to glutathione agarose(Sigma) in binding buffer (20 mM Tris Cl [pH 7.8], 0.2 mM EDTA, 0.1 M NaCl,1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride) with 0.2% NP-40 andwashed three times in binding buffer with 0.4% NP-40. Proteins retained on theglutathione beads were boiled in Laemmli sample buffer and subjected to sodiumdodecyl sulfate-polyacrylamide gel electrophoresis, followed by PhosphorImageranalysis (Molecular Dynamics).

P-element transformation, whole-mount in situ hybridization of embryos, andcrosses to reporter lines. P-element transformation vectors were introduced intothe Drosophila germ line by injection of y w67 embryos as described (46). Foreach gene construct, at least three separate lines were tested, and similar resultswere obtained with all lines except as noted. In situ hybridizations were per-formed as described (46) using digoxigenin-UTP-labeled antisense RNA probesto lacZ. The Gal4-dCtBP transgenic line used in Fig. 4 expresses the proteinunder the control of Kruppel regulatory elements (37) and was kindly supplied byY. Nibu and M. Levine.

Assays of in vivo repression activity. Transgenic flies carrying chimeric repres-sor constructs were crossed with reporter lines containing one of three reporters:(i) eve stripe 2 enhancer linked to eve-lacZ (2), (ii) eve stripe 2 and stripe 3enhancers linked to eve-lacZ (36), or (iii) eve stripe 3 and rho enhancers linkedto the transposase-lacZ fusion gene (22). To assay repression activity of Gal4-Knirps chimeras, effector lines were crossed to reporter lines, and several hun-dred embryos from each cross were collected, aged to 2 to 4 h at room temper-ature, fixed, and stained as described (46). After mounting on microscope slides,embryos were visually scored in a blinded experiment for evidence of repression.Most functional repressors completely abolished ventral staining in the eve stripe2 region; embryos exhibiting weakened but not complete repression were scoredin a separate category. Typically, a greater number of older (early gastrula)embryos exhibited repression, presumably because of the lag between the acti-vation of the eve or rho enhancer and the production of adequate amounts of theGal4-Knirps protein after its transcription under the control of the twist en-hancer. In general, with heterozygous Gal4-Knirps lines, the maximum percent-age of embryos exhibiting repression would be 50%, because only half of thefertilized embryos receive the Gal4-Knirps effector gene from the heterozygousmale parent. The observed percentages may be lower than this because allembryos showing reporter gene expression were counted, including youngerembryos in which repressors have not yet reached their maximal level of expres-sion.

Analysis of gene expression in embryos lacking maternal dCtBP. CtBP2 germline clones were produced using the autosomal FLP-DFS technique (11). Fe-males carrying an eve stripe 2-upstream activation sequence (UAS)-lacZ reportergene on chromosome 1 (2) were crossed to D/TM3, Sb males. Male progenycarrying the lacZ reporter and D were crossed to females carrying a balanced,P-element insertional mutation of CtBP (CtBP03463/TM3, Sb; Bloomington stockno. P1590).

FRT, ovoD1/TM3, Sb males (Bloomington stock no. 2149) were mated tofemales carrying the Saccharomyces cerevisiae FLP recombinase gene under thecontrol of the hsp70 promoter (hsFLP; D/TM3, Sb; Bloomington stock no. 1970)to generate males with hsFLP on chromosome 1 and ovoD1 over D on chromo-some 3. Females carrying the lacZ reporter and the CtBP mutant allele over Dwere crossed to these hsFLP; ovoD1/D males. Embryos from this cross werecollected for 24 h, aged for 48 h and heat shocked for 2 h in a 37°C water bath.The heat shock was repeated 24 h after the first treatment. Females lacking theD marker (hsFLP; FRT, ovoD1/CtBP03463) were mated to males carrying theappropriate Gal4-Knirps transgene. To assay for expression driven by the evestripe 3 enhancer in a CtBP mutant background, males carrying an eve/lacZfusion gene containing a 500-bp (23.8 to 23.3 kbp) or an 800-bp (23.8 to 23.0kbp) portion of the eve stripe 3 enhancer (47) were crossed to the femalesproducing oocytes deficient in dCtBP. Embryos were collected, fixed, and stainedas described (46). As expected for CtBP mutants, embryos derived from thesecrosses died before hatching.

RESULTS

Distance dependence of Knirps repression activity at abasal promoter element. Previous studies indicated that en-dogenous Knirps, when targeted to a heterologous promoterby introduction of cognate binding sites, was capable of inter-fering with transcription when the binding sites were situatedat 255 bp, but not at 2130 bp, consistent with a short range ofactivity (2). Subsequent analysis of Knirps repression activityon promoters has been limited to reporter genes with bindingsites immediately adjacent to the basal promoter element (36,37). To determine more precisely the distance dependence ofKnirps repression and test whether the loss of activity with

FIG. 1. Distance-dependent repression of integrated lacZ reporter genes by endogenous Knirps protein. The twi and rho elements normally drive expression inuninterrupted swaths from posterior to anterior. Repression by endogenous Knirps is visible where lacZ staining is attenuated in a broad stripe in the posterior region.Moving the 39 edge of repressor binding sites from 255 to 2180 bp by insertion of short spacers (A to F) gradually compromises transcriptional repression activity.Transgene structure is indicated at the bottom of the figure, where the horizontal arrow indicates variable distances from the Knirps binding sites to the transcriptionalstart site in the six genes assayed. Gene activation is directed by enhancer elements derived from the rho and the twist genes. Expression of the transgenes was visualizedby in situ hybridization with antisense probe to the lacZ gene as described in Materials and Methods. Ventrolateral views of representative embryos are shown, withanterior at the left.

VOL. 20, 2000 TRANSCRIPTIONAL REPRESSION BY Knirps 7249


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

FIG. 2. Deletional analysis of the Gal4-Knirps 75-429 repressor. (A) Structure and activities of Gal4-Knirps chimeric proteins. Chimeras numbered 1 to 23 wereexpressed in transgenic embryos as fusions to the Gal4 protein DNA binding domain (residues 1 to 93). A plus sign signifies at least 6% of embryos showed a clearrepression pattern; a minus sign signifies #1%. See Table 1 for quantitation. The dCtBP binding motif PMDLSMK is indicated as a red box; an X indicates proteinsin which the PMDLSMK motif has been mutated to AAAASMK. (B) Structure and expression pattern of the eve stripe (st.) 2-stripe 3 lacZ reporter gene used to testthe activity of Gal4-Knirps repressors shown in panel A. Embryos from left to right: reporter gene in the absence of Gal4-Knirps repressor, repressed pattern generatedby crosses to Gal4-Knirps 75-429 and 75-332 lines, and an unrepressed pattern obtained from a cross to a nonfunctional line (Kni75-254). Embryos are shown withanterior at the left and dorsal being at the top.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

increasing distance represents a step function or a gradualtapering off of activity, we designed reporter transgenes withtandem Knirps binding sites situated at 255, 270, 275, 2100,2130, or 2180 bp. These genes were introduced into Drosoph-ila by P-element-mediated germ line transformation, and theembryonic expression patterns of the transgenes were analyzedby in situ hybridization. With these reporter genes, repressionby Knirps is most readily seen as weakening of lacZ expressionin a broad stripe in the posterior of the embryo where Knirpsis expressed (2).

Strong repression was observed in genes with Knirps bindingsites situated at 255, 270, or 275 bp (Fig. 1A to C). TheKnirps binding sites used in this gene have been shown toconfer repression in a Knirps-dependent manner (2), and asexpected, the repression was observed only in the presumptiveabdomen and ventral anterior regions, where the knirps gene isexpressed (35). Repression was less effective in the 2100- and2130-bp constructs and almost undetectable in the constructwith the sites at 2180 bp (Fig. 1D to F). These results indicatethat there is a gradual tapering off of repression as Knirps sitesare moved away from the promoter region. No differenceswere observed in the pattern for genes with repressor sitessituated at 270 or 275 bp, indicating phasing effects are notimportant on this reporter gene. The effective distance of re-pression on this basal promoter is similar to that seen forKnirps action within enhancer elements (2). A previouslytested gene with the rho enhancer 4 kbp 39 of the transcrip-tional start site showed no repression by a Knirps binding siteat 2130 bp (2), compared with the weak repression seen here.The more proximal position of the enhancers in reporter genesshown in Fig. 1 may influence the relative effectiveness ofKnirps repression.

A repression region identified in cell culture assays does notrepress in the embryo. The experiments with endogenousKnirps protein (Fig. 1) provide information on the generalproperties of the endogenous repressor, without identifyingthe regions of the protein necessary for repression. As a firststep in identifying the mechanism of repression by Knirps, wecarried out a structure-function analysis to define the residuesof Knirps important for mediating repression in vivo. Misex-pression of full-length Knirps leads to embryonic lethality (37),so we performed our structure-function analysis using Gal4-Knirps fusion proteins.

Genes encoding portions of Knirps fused to the Gal4 DNAbinding domain were expressed in ventral regions of transgenicembryos under control of a twist regulatory element (Fig. 2A).To simultaneously measure repression and range of action,these chimeric repressors were tested on a lacZ reporter geneactivated by two enhancers. Gal4-binding UAS sequences wereplaced adjacent to the eve stripe 2 element, which was previ-ously shown to be sensitive to Knirps repression (2). An evestripe 3 enhancer was placed over 300 bp away, beyond therange of short-range repression. Embryos carrying the stripe2-stripe 3 lacZ transgene showed a characteristic pattern of twocircumferential stripes, with an additional anterior stripe de-rived from vector sequences (Fig. 2B).

A series of deletions that focused on a region identified as arepression domain in cell culture assays (14) were initiallytested (constructs 1 to 7). As expected, a Gal4-Knirps chimeracontaining most of the knirps open reading frame (codons 75 to429) showed effective repression of the proximal stripe 2 en-hancer, while, consistent with the short range of Knirps activ-ity, the distal stripe 3 enhancer was not affected (Fig. 2). AC-terminal truncation removing residues 333 to 429 did notcompromise activity (construct 2, Kni75-332 [Fig. 2]), althoughit does remove most of the dCtBP interaction region of Knirps

(see below). More extensive C-terminal truncations terminat-ing at residues 254 or 189 were inactive (constructs 3 and 4[Fig. 2]), suggesting that a region of the protein from residue254 to 332 might be necessary for repression in the absence ofthe dCtBP binding motif. Effective repression by proteins en-coded by constructs 5 and 6 demonstrated that the N-terminalresidues 75 to 187 were dispensable for activity in this context,as was the region of the protein including residues 189 to 254(Fig. 2A). The chimera containing only residues 189 to 254 wasnot active (Fig. 2 [residues 189 to 254]). Therefore, this regionof the protein was neither necessary nor sufficient for repres-sion, in contrast to the result obtained in transient-transfectionassays (14). For these chimeras, active constructs showed atleast 20% of the embryos repressed in blinded scoring assays,while inactive repressor genes and the reporter construct aloneaveraged less than 1% embryos scored as repressed (Table 1)(see Materials and Methods).

A minimal dCtBP-dependent repressor. The activity of thegenes described above suggested that a minimal repressionregion might be localized in the central region of Knirps pro-tein. To further delimit regions important for repression, Gal4fusion proteins containing residues 202 to 358 and derivativeswere tested (constructs 8 to 14 [Fig. 2A]). Deletions of residues202 to 210 (DA), residues 220 to 227 (DB), residues 228 to 251(DC), or residues 292 to 313 (DD) did not impair repressionactivity, while deletion of residues 330 to 343 (DE) abolishedrepression completely (Fig. 2A). The region removed in con-struct DE includes the residues PMDLSMK, shown to mediateKnirps interaction with the dCtBP protein (36, 37). Alanine

TABLE 1. Activity of chimeric Gal4-Knirps repressor proteins intransgenic embryos

Constructno. Chimeraf %

Represseda

No. ofembryosscored

No. of linesanalyzed

1 75-429 32 6 8 777 62 75-332 21 6 9 754 43 75-254 0.9 6 0.8 471 34 75-189 0.4 6 0.5 691 45 188-429 23 6 7 564 2b

6 75-189, 254-429 24 6 5 995 37 189-254 1 6 1 504 78 202-358 13 6 4 1,258 69 202-358 (DA) 7 6 4 526 610 202-358 (DB) 18 6 6 910 611 202-358 (DC) 14 6 8 303 312 202-358 (DD) 12 6 1 856 413 202-358 (DE) 0 529 514 248-291, 314-358 (DF) 1.4–23 240 4c

15 75-330 2–9 307 316 94-330 32 6 12 725 317 139-330 18 6 1 659 318 169-330 1 6 1 1,272 4d

19 189-330 0 1,504 420 75-276 0.9 6 1 1,172 321 75-364mut 6 6 3 594 322 75-394mut 3–9 634 2e

23 75-429mut 32 6 5 1,077 4

a The level of embryos scored as repressed in the even-skipped lacZ reporterlines used for these assays was 0.4% 6 0.9%. Values not given as ranges aremeans 6 standard deviations.

b Only two lines were obtained.c Range shown. This gene showed large variability between lines.d Approximately 3% of embryos from crosses to these lines showed some

weakening of staining in ventral regions.e Range shown. A third line showed no repression activity.f Genes for constructs 1 to 6 contained endogenous kni 39 UTR sequences.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

scanning mutations affecting these residues have also beenshown to compromise repression activity of a chimeric Gal4-Knirps protein containing residues 255 to 429 and by ectopi-cally expressed Knirps (36, 37). Our results indicate that re-pression by residues 202 to 358 depends on dCtBP, because thedCtBP binding motif is required for activity. A minimal con-struct, DF, containing only 89 amino acid residues from Knirps(residues 248 to 291 and 314 to 358) was active, consistent withearlier reports that residues N-terminal to 255 were dispens-able for dCtBP-dependent activity (37). This chimeric geneshowed variation in activity, however, possibly because of line-to-line differences in expression levels.

Characterization of the N-terminal repression region. Al-though the Kni75-332 repressor lacks an intact dCtBP bindingmotif, we considered the possibility that this protein might beable to interact with dCtBP by way of the C-terminal residues(PMQAR) or that some amount of translational readthroughwas occurring to produce full-length protein. (The C-terminaltruncation mutant genes in constructs 1 to 6 still retain Knirpscoding sequence 39 of the introduced triple stop codons).Therefore, we created a transgene encoding residues 75 to 330,eliminating the remainder of the dCtBP interaction motif andall Knirps coding sequences 39 of the stop codon, and testedthis gene in the in vivo repression assay on the eve stripe2-stripe 3 lacZ reporter gene (Fig. 2A, construct 15). TheKni75-330 protein was effective in repressing the eve reportergene, indicating that complete elimination of the dCtBP inter-action motif did not compromise transcriptional repression.The number of embryos showing repression was smaller thanthat seen for other chimeric repressors, perhaps due to lowerprotein expression levels, but the extent of repression of thelacZ gene in individual embryos was the same.

To further define the N-terminal repression region, addi-tional transgenic lines expressing Gal4 chimeras fused toKnirps residues 94 to 330, 139 to 330, 169 to 330, 189 to 330,or 75 to 276 were tested (Fig. 2A, constructs 16 to 20). Theeffectiveness of Kni94-330 and Kni139-330 suggests that theresidues required for N-terminal repression activity are in-cluded within residues 139 to 330. The 169-330 protein hadvery low activity, while the 75-276 and 189-330 proteins werenot active in this assay, suggesting that residues in the regionsfrom residue 139 to 189 and 276 to 330 may be required for theN-terminal repression activity. Difficulties in quantitating lev-els of the chimeric proteins in embryos by either antibodystaining or Western blot analysis precluded a definitive inter-pretation of inactive constructs. We were, however, able todetect one of the inactive Knirps repressors by gel-shift anal-ysis (DE, Fig. 2 [data not shown]), suggesting that at least someof the inactive proteins are expressed.

N-terminal repression activity is not negatively regulated byC-terminal domain of Knirps in Gal4-Knirps chimeras. Ec-topic expression of full-length Knirps protein in an eve stripe 2pattern causes improper repression of endogenous eve andresults in embryonic lethality (36). A mutation in the dCtBPinteraction region of the misexpressed protein eliminates le-thality and greatly weakens, but does not altogether abolish,repression activity of the ectopically expressed protein (36).This weakly active mutant protein contains the N-terminalrepression region that we defined in constructs 15 to 20. Wetherefore tested whether the activity of the N-terminal repres-sion region might be masked by the presence of the C-terminalregions of the protein (residues 330 to 429), resulting in inhi-bition of the N-terminal repressor. Three transgenes contain-ing Gal4 fusions to Knirps residues 75 to 364, 75 to 394, and 75to 429 were generated; each containing the PMDLSMK toAAAASMK mutation that disrupts dCtBP interaction (36). All

three of these proteins were effective in mediating transcrip-tional repression of the stripe 2-stripe 3 lacZ reporter gene(Fig. 2, constructs 21 to 23; Table 1), indicating that the pres-ence of C-terminal residues does not prevent the N-terminalrepression region from acting in this context. In fact, the C-terminal residues may enhance protein stability or function;the 75-429mut transgenic lines gave a higher number of re-pressed embryos than did the 75-394mut and 75-364mut lines(Table 1).

Functional repressors lacking dCtBP binding motifs do notbind dCtBP in vitro. The mutation of DLS to AAA within thePMDLSMK dCtBP binding motif is sufficient to abrogatedCtBP binding to Knirps in vitro (37). The 75-332 chimericprotein contains only the first two residues, PM, of this motif(followed by QAR, introduced during cloning steps). There-fore, it seemed likely that dCtBP would no longer be able tointeract with this protein. To test whether there might be someresidual binding activity to dCtBP, we measured the ability of75-332 protein and other proteins to interact directly withGST-dCtBP protein in vitro (Fig. 3). Proteins produced in invitro transcription-translation reactions were incubated witheither GST or GST-dCtBP bound to glutathione agarose (37).The GST-dCtBP protein interacted specifically with Knirps75-429, 75-340, 202-358, and 248-358DF proteins, all of whichcontain intact PMDLSMK motifs (Fig. 3A, lanes 3, 6, 15, and21). A mutant 75-340 protein containing PMAAAMK (Fig.3A, lane 9), the 202-358DE protein lacking PMDLSMK (Fig.3A, lane 18), and the 75-332 protein (Fig. 3A, lane 12) all failedto interact specifically with the dCtBP affinity matrix. Quanti-tation of the retained proteins (Fig. 3B) indicates the bindingof proteins lacking the dCtBP motif was not significantly abovebackground. Thus, in vitro dCtBP binding does depend on anintact interaction motif, but this interaction is apparently notrequired for activity of the 75-332 protein.

Activity of the dCtBP repressor protein from a distal en-hancer position. Our results suggest that in some contexts,binding of the dCtBP repressor protein to Knirps is not re-quired for repression (Fig. 2 and 3). We considered the pos-sibility that dCtBP may only allosterically alter the Knirpsprotein, allowing the Knirps protein’s own repression domainto contact a target in the transcriptional machinery. In thiscase, dCtBP would not directly mediate transcriptional repres-sion. This picture would contradict earlier studies in whichtethering dCtBP (or a murine homologue, CtBP2) to a pro-moter was sufficient to inhibit gene expression (13, 36, 52).However, due to the design of the reporter genes used in thesestudies, they might be subject to passive repression caused bysteric hindrance of adjacent activators or the basal transcrip-tion machinery. Therefore, we tested the activity of the Gal4-dCtBP protein on a reporter gene where the UAS binding siteswere over 190 bp from the transcriptional start site and over 50bp from the nearest Dorsal activator site (Fig. 4). The Gal4-dCtBP chimeric protein, expressed under the control of aKruppel promoter in the central region of the embryo (36),inhibited the activity of the rho enhancer that contains Gal4-binding UAS sites. Consistent with expected short-range activ-ity of this repressor, the activity of the eve stripe 3 enhancer wasnot affected (Fig. 4B). Gal4-dCtBP thus mediates short-rangerepression on a gene where the likelihood of passive blockingis minimized. Therefore, it is likely that dCtBP also directly me-diates transcriptional repression when complexed with Knirps.

Gal4-Knirps repressors function comparably to endogenousKnirps on a rho lacZ reporter. To test whether Gal4-Knirpsproteins act similarly to endogenous Knirps, we assayed chi-meric proteins on a rho element that had been previously usedto measure Knirps activity. Gal4-binding sites were inserted



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

into a rho lacZ reporter gene precisely where Knirps bindingmotifs had been introduced previously (2). In the absence ofGal4-Knirps, the lacZ reporter gene was expressed as expectedin the entire ventral region of the embryo (Fig. 5A). Strongventral repression was evident in embryos containing the Gal4-Knirps 75-429 protein expressed in ventral regions under thecontrol of a twist regulatory element (Fig. 5B), indicating thatGal4-Knirps has the same activity as endogenous Knirps on therho element. In ventrolateral regions where the Gal4-Knirpsprotein is not expressed, rho enhancer activity was apparent asa broad anterior-to-posterior band. In addition, a central cir-cumferential stripe driven by the distal eve stripe 3 element wasnot repressed, demonstrating that the Gal4-Knirps protein islimited to functioning over a short range, as expected for thisclass of repressor. The lack of repression of the eve stripe 3element is not due to inherent insensitivity of this enhancer toKnirps protein, because eve stripe 3 is a direct target of endog-enous Knirps protein (47). The 75-332 protein containing theN-terminal repression region and the 202-358 protein with thedCtBP binding motif both mediated repression of the rho el-ement in ventral regions (Fig. 5C and D). Thus, on a compa-rable lacZ target gene, Gal4-Knirps proteins have the sameactivity as endogenous Knirps protein.

Repression by Knirps proteins in dCtBP mutant embryos.We tested whether the N-terminal region of the Knirps pro-tein, which does not directly interact with dCtBP protein (Fig.3), would mediate transcriptional repression in embryos lack-

ing maternal dCtBP. Such embryos have been shown to bedefective for repression by other dCtBP-binding repressor pro-teins, such as Snail (36), and the embryos show patterningdefects reflective of disruption in pair-rule gene expression(40). The CtBP gene is expressed during oogenesis, and themessage is deposited in the egg prior to fertilization (40).Therefore, we generated embryos that lacked a maternal con-tribution of dCtBP by the dominant female sterile FLP-DFSmethod (39). An eve stripe 2 lacZ reporter (Fig. 6A) wascrossed into the dCtBP background, and somatic recombina-tion was induced in females heterozygous for ovoD1 and theCtBP mutant allele to generate oocytes lacking dCtBP. Fe-males were mated to males carrying Gal4-Knirps transgenes,and embryos were analyzed by in situ hybridization. The pat-tern of expression of the eve stripe 2 transgene is noticeablyaltered in such a genetic background (Fig. 6B), changing fromthe normal narrow stripe to a broader band, consistent with theloss of Kruppel repression activity in posterior regions (36) andpossibly loss of Giant activity in anterior regions (B. Strunk,unpublished observations). The Gal4-Knirps 75-332 transgenewas able to repress reporter gene expression in a significantnumber of embryos (Fig. 6C), while very few control embryosshowed loss of ventral expression. Repression of the transgenein the dCtBP mutant background was also observed when weassayed Gal4-Knirps 75-364mut and 75-429mut proteins thatlack the dCtBP interaction motif (Fig. 6D and E). Overalllevels of repression were higher than those observed in wild-

FIG. 3. dCtBP binding activity of Gal4-Knirps repressors. (A) In vitro-translated Knirps chimeras were tested for interaction with GST-dCtBP. Arrows indicate thesizes of the full-length products, as calculated from mobilities relative to molecular weight standards. The Gal4-Knirps 75-429, 75-340, and 202-358 proteins interactstrongly with GST-dCtBP (lanes 3, 6, and 15). Mutations changing the dCtBP binding motif from PMDLSMK to PMAAAMK abolish specific interaction (lane 9). TheGal4-Knirps 75-332 protein, which retains only the PM portion of the dCtBP binding motif, does not demonstrate specific binding to GST-dCtBP (lane 12), althoughthis protein is functional in vivo (Fig. 2). A deletion in the dCtBP interaction domain from residues 202 to 358 abolishes binding (lane 18), while deletions removingresidues 202 to 247 and 292 to 313 do not affect binding (lane 21). (B) Quantitation of binding data shown in panel A, comparing protein retained on GST (white bars)to protein retained on GST-dCtBP (black bars), normalized to the input protein. A representative experiment is shown.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

type embryos, possibly due to changes in Gal4-Knirps proteinstability or transcription complex stability.

The endogenous Knirps target eve stripe 3 is repressed in adCtBP mutant. To test whether endogenous targets of theknirps gene might also show repression in a dCtBP mutantembryo, we examined expression of a lacZ reporter gene de-rived from eve, which is a direct target of Knirps. Five bindingsites for the Knirps protein have been identified within the500-bp eve stripe 3 enhancer (47). Consistent with this picture,a lacZ transgene driven by the eve stripe 3 enhancer showsbroad posterior derepression in a kni mutant embryo (Fig. 7Aand B) (47). To test whether a similar pattern of derepressionwould be observed in the absence of dCtBP, we crossed malescarrying a 500-bp eve stripe 3 lacZ transgene (47) to femalesproducing dCtBP-deficient oocytes. Expression of the evestripe 3 transgene was not derepressed in posterior regions ofthe embryo, suggesting that Knirps is still able to repress thiselement in the absence of maternal dCtBP (Fig. 7C). Themutant embryos did show other alterations in lacZ expression,including ectopic expression in anterior regions and a broad-ening and intensifying of the posterior stripe (Fig. 7C). Asimilar pattern of repression was observed with a stripe 3 lacZreporter carrying an 800-bp enhancer (23.8 to 23 kbp) (datanot shown). The stronger derepression phenotype of the knimutant compared to the CtBP mutant suggests that Knirpscontains a repression activity separate from dCtBP, consistentwith our identification of an additional N-terminal repressionregion.

DISCUSSION

Fine-tuning Knirps repression on promoters. Knirps hasbeen shown to repress transcription when bound adjacent toeither basal promoters or activators within enhancer elements(2). Our studies of Knirps activity when the protein binds closeto the basal promoter reveals additional properties of the en-dogenous protein. First, repression by Knirps does not appearto be sensitive to phasing effects, as shown by equivalent ac-tivity of constructs with Knirps binding sites offset by 5 bp at270 and 275 bp (Fig. 1B and C). Second, in this series ofgenes, the transcriptional repression activity appears to bedirected at the basal promoter element, because the repressionweakens as the distance from Knirps sites to the basal pro-moter is increased while the distance to the enhancer elementis held constant. Third, while Knirps repression is limited to arelatively short distance, there is a measurable interval (from

FIG. 4. The Gal4-dCtBP chimeric protein acts as an autonomously actingrepressor within an enhancer. (A) Expression pattern of the eve stripe 3-rho lacZreporter gene, showing robust ventral expression directed from a rho enhancerelement lacking Snail binding sites (2) and a central stripe from the eve stripe 3enhancer. (B) Repression of rho enhancer activity in the central portion of theembryo mediated by the Gal4-dCtBP chimera (denoted by the curve underembryo). Expression of the repressor is driven by Kruppel regulatory elements(36). Gal4-binding sites were introduced in a 600-bp rho enhancer at the posi-tions previously used for targeting Knirps protein to this gene (22). The mostpromoter proximal UAS binding site is located at 2195 bp (2). Ventrolateralviews are shown, with anterior at the left.

FIG. 5. Gal4-Knirps chimeric repressors mimic the activity of endogenousKnirps protein on a rho enhancer element. Previous studies demonstrated thatKnirps represses this rho enhancer element when bound 50 bp from the Dorsal1 and Dorsal 4 activator sites (2). In this reporter gene, UAS binding sites forGal4-Knirps chimeras have been substituted for Knirps binding sites (22). (A)Expression pattern of the eve stripe 3-rho lacZ reporter gene, showing robustventral expression directed from a rho enhancer element (lacking endogenousSnail binding sites) (13) and a central stripe from the eve stripe 3 enhancer. (B)Repression in ventral regions mediated by Gal4-Knirps (75-429) repressor pro-tein expressed in ventral regions of the embryo under control of a twist promoterconstruct. (C) Repression mediated by the Gal4-Knirps (75-332) chimera, lack-ing the dCtBP interaction motif. (D) Repression mediated by the Gal4-Knirps(202-358) chimera, a protein that contains the dCtBP interaction motif. Ventro-lateral views are shown, with anterior at the left.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

100 to 130 bp) over which Knirps activity is attenuated but notentirely abolished.

This intermediate level of repression might be useful inadjusting the amount of repression imposed on a target geneor setting a target gene threshold, as we have recently demon-strated for the Drosophila Giant short-range repressor (22).With Giant, a less-than-twofold difference in posterior versusanterior protein levels is sufficient to switch a gene from on tooff. Thus, two features of short-range repressors may allow forflexibility in genetic regulatory circuits: first, short-range re-pressors allow modular enhancers to act independently, byavoiding regulatory cross talk (16), and second, the exquisitedistance dependence may contribute to the differential re-sponse of endogenous target genes to repressor gradients (22,28).

Two distinct repression activities of Knirps. Our study dem-onstrates that the Knirps protein contains two functionallydistinct repression activities. The C-terminal region appears tomediate repression through recruitment of the dCtBP protein,and based on our and others’ results (Fig. 2) (36, 37) it consistsof a region contained within residues 202 to 358 (minimally,residues 248 to 291 and 313 to 358 [Fig. 2, construct 14])including the PMDLSMK dCtBP binding motif. In contrast,the N-terminal repression region (minimally, residues 139 to330) appears to function independently of dCtBP. Althoughthis region contains some of the amino acid residues that arepresent in the dCtBP binding constructs, the two activities areclearly distinct based on dCtBP dependence. The N-terminalregion does not bind to dCtBP and it can repress in a mutantembryo that lacks maternal dCtBP (Fig. 3 and 6). Any residualamounts of dCtBP from maternal or zygotic expression arelikely to be very low, because the loss of maternal dCtBPexpression causes a loss of activity of Snail, Knirps, and Krup-pel on a number of target genes (36), producing severe em-bryonic defects and early developmental arrest.

We have defined Knirps repression domains in the contextof Gal4 fusion proteins, but several lines of evidence suggestthat the native Knirps protein can also repress target genesindependently of dCtBP. Most compellingly, an eve stripe 3lacZ reporter gene that is derepressed in a knirps mutant back-ground is not derepressed in a CtBP mutant (Fig. 7). In addi-tion, a frameshift mutation (kni14F) that produces a proteinlacking the dCtBP interaction motif retains partial activity(14), perhaps via the N-terminal repression activity that wehave defined. Finally, an earlier study of ectopically expressedKnirps protein that lacks a dCtBP binding motif noted that theprotein had weak repression on eve stripe 3 (36).

A region of the Knirps protein containing an alanine-richtract was identified earlier as a repression domain in cell cul-ture studies (14) but was neither necessary nor sufficient forrepression in the embryo (Fig. 2, construct 7; Table 1). Therepression function of 189-254 protein may be specific to trans-fection assays, similar to findings for the non-Groucho bindingregion of the Engrailed repressor protein (50).

FIG. 6. Knirps N-terminal repression activity functions in dCtBP mutantembryos. (A) eve stripe 2 lacZ reporter in a wild-type embryo. (B) eve stripe 2lacZ reporter in a mutant embryo lacking maternal dCtBP. Anterior and poste-rior boundaries of the stripe are less well defined. (C) Repression by Gal4-Knirps

75-332 in a dCtBP mutant. Ventral expression of the transgene is repressed. (D)Repression by Gal4-Knirps 75-364mut, lacking the dCtBP binding motif. (E)Repression by Gal4-Knirps 75-429mut, lacking the dCtBP binding motif. Em-bryos are oriented with anterior being to the left and dorsal being to the top.Lateral views are shown, except for the ventrolateral view in panels C and E.CtBP embryos were generally shorter and broader than wild-type embryos. In theabsence of repressor, 4% of embryos showed loss of ventral expression of the evestripe 2 lacZ stripe in the mutant embryos (versus less than 1% in wild-typeembryos [Table 1]). For the repressor shown in panel C, 31% of embryos showedloss of ventral staining (n 5 140); for panels D and E, 31% (n 5 39) and 75%(n 5 65) of embryos, respectively, showed loss of ventral staining.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

It is not yet clear whether repression by the N-terminal andC-terminal regions of Knirps contribute to quantitative orqualitative differences in repression, or if these two aspects ofrepression are indeed entirely separable. The eve stripe 3 en-hancer is clearly repressed in the region of kni expression in theabsence of maternal dCtBP (Fig. 7), yet in previous experi-ments, ectopically expressed Knirps was able to repress the evestripe 3 element effectively only when the dCtBP binding motifof the protein was still intact (36). The most likely explanationfor these apparently contradictory results is that dCtBP con-tributes to a portion of the Knirps-mediated repression ofstripe 3. Endogenous Knirps is abundant enough to repressexpression of eve stripe 3 in dCtBP mutant embryos, but thelevels of ectopically produced Knirps protein are apparentlyinsufficient to repress effectively when binding to dCtBP isabolished. dCtBP may also have an effect on Knirps proteinstability or targeting, which might contribute to the reducedactivity of the mutant protein. Previous studies indicated thatin the absence of dCtBP, repression of a synthetic rho lacZreporter gene by endogenous Knirps was reduced (36). How-ever, close examination of the data indicates that some ante-rior repression is apparently present (Fig. 3 in reference 36),consistent with the idea that Knirps retains a measurable levelof activity in the dCtBP mutant.

Autoinhibition models and activity of C-terminally trun-cated Knirps proteins. The Gal4-Knirps chimeras containingonly the N-terminal repression domain appear to have higherlevels of activity on lacZ reporters than does full-length Knirpsprotein lacking the dCtBP binding motif (Fig. 2) (36). Wetested whether this difference might be attributed to maskingof the N-terminal repression region by the C terminus in theabsence of dCtBP. Our data indicate that this model is notcorrect; Gal4-Knirps chimeras containing the N-terminal re-pression domain linked to a C-terminal region lacking a dCtBPbinding activity were highly effective repressors (Fig. 2, con-structs 21 to 23). Gal4-Knirps chimeras may be inherentlymore effective repressors if one role of dCtBP is to facilitatedimerization of Knirps proteins. With chimeras, this functionwould be provided by the Gal4 DNA binding domain, becauseGal4 binds DNA as a dimer (4). Alternatively, autoinhibitionof the Knirps DNA binding domain, similar to that seen withEts-1, AML-1, and Pitx2 (1, 15, 20, 26, 31), may be relieved bydCtBP binding, but Gal4 chimeras would not be subject to suchregulation. However, the effective regulation of eve stripe 3lacZ in a CtBP mutant argues for a simpler quantitative effectmodel. Loss of dCtBP binding might simply reduce the totalrepression activity of Knirps protein, so that the low levels ofmisexpressed Knirps would be unable to effect repression. TheGal4-Knirps repressor utilizing only one repression regionmight be more functional due to increased effectiveness ofdimerized repressor proteins or to a greater sensitivity of thelacZ reporters used.

Qualitative and quantitative effects: repressors with multi-ple repression activities. Multiple repression activities in aprotein may allow for qualitative or quantitative effects ongene expression. Qualitatively, a repressor may operate selec-tively in distinct tissue types or on different promoters. Loss ofmaternal dCtBP protein does not affect eve stripe 3 regulation(Fig. 6), but it does abolish repression of the eve stripe 416enhancer element, suggesting that this element is dCtBP de-pendent (M. Corado, E. Bajor, M. Fujioka, and S. Small,Abstr. 41st Annu. Drosophila Res. Conf., abstr. 285B, 2000).Quantitatively, dual activities may increase the overall level ofrepression, much as transcriptional activators have been sug-gested to employ multiple paths to achieve synergistic activa-tion (8, 51).

Examples of both qualitative and quantitative effects areseen with the ZEB repressor, a protein that contains two re-pression domains. One domain blocks activation by Myb andEts factors of lymphocyte-specific promoters (41), while thesecond domain, which contains a conserved CtBP binding mo-tif (52), blocks the activity of the muscle cell-specific MEF2Cfactor. In contrast to these activator-specific effects, a quanti-tative contribution of multiple repression domains was ob-served with the murine ZEB homolog dEF-1. When CtBPbinding residues are mutated in dEF-1, repression of a MyoD-activated promoter is impaired but not abolished (13).

Other repressor proteins may also possess both CtBP-de-pendent and dCtBP-independent activities. In Drosophila, theKruppel protein contains a C-terminal dCtBP binding repres-sion domain and an N-terminal repression domain. The latterdomain has only been characterized in cell culture assays (21),but genetic evidence indicates that Kruppel can repress hairy ina CtBP mutant, possibly by means of this N-terminal domain(30). The Wnt signalling pathway transcription factor Tcf-3 caninteract with both the Groucho and CtBP proteins throughseparate repression domains in Xenopus laevis, and the CtBP-binding portion of XTcf-3 has potent repression activity in thefrog embryo (6). The Rb retinoblastoma protein has beenshown to interact with both histone deacetylases and CtBP,

FIG. 7. eve stripe 3 lacZ reporter gene is repressed normally in posteriorregions in a CtBP mutant embryo. (A) Expression pattern of a 500-bp eve stripe3 reporter gene in a wild-type embryo. (B) Posterior derepression of the reportergene in a knirps mutant embryo. (C) Expression pattern of eve stripe 3 lacZ in aCtBP mutant embryo. Embryos did not show derepression in the posterior regionof the embryo but did show consistently stronger staining in eve stripe 7 regions(an activity partially contained within eve stripe 3 enhancer sequence [47]) andectopic activation in the anterior regions of the embryo. (A and B) Parasagittalview; (C) surface view. Embryos are oriented with anterior at the left and dorsalat the top.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

although the physiological relevance of the CtBP interactionsis not yet clear (34). Net, an Ets protein family member thatcan repress transcription of the c-fos promoter, has also beenshown to possess two independent repression domains, one ofwhich interacts with CtBP1. Loss of the CtBP binding motiffrom Net reduces the repression activity of the protein in cellculture assays (12). Finally, the BKLF transcription factor,which can interact with CtBP2 to repress transcription in Dro-sophila cell culture, contains an additional CtBP-independentactivity detectable in NIH 3T3 cells (52).

Mechanism of dCtBP protein in transcriptional repression.dCtBP and its homologs appear to be able to mediate repres-sion directly when recruited to promoters by a heterologousDNA binding domain, both in cell culture systems and in theembryo (Fig. 4) (13, 36, 37). The dCtBP corepressor has ho-mology to a-hydroxy acid dehydrogenases and contains a con-served NAD-binding domain. The protein binds to NAD (R.Jacobson, personal communication), but no dehydrogenase ac-tivity has been detected in vitro, and mutation of a conservedhistidine in the putative active site did not compromise therepression activity of a chimeric CtBP2 protein in cell cultureassays (52). The dCtBP protein may contain other uncharac-terized enzymatic activities. Recently it was reported that theSir2 transcriptional repressor possesses ADP ribosylation ac-tivity, and furthermore, that NAD was important for histonedeacetylase activity of the protein (23, 49). Some evidencesuggests that CtBP may function through histone deacetylasepathways (12, 48), but pair-rule gene repression by gap pro-teins such as Knirps and Kruppel was not compromised bymutations in the Rpd3 histone deacetylase (33).

The physiological relevance of CtBP binding is not yetknown for a number of proteins that were found to interact inyeast two-hybrid assays, but genetic evidence from Drosophilaclearly indicates that dCtBP is an important repression cofac-tor (36, 37, 40). Our data demonstrates that for at least oneKnirps target gene, another pathway of repression is also uti-lized. A considerable body of evidence, including genetic andbiochemical data, indicates that repressors may have multiplelines of communication with the transcriptional machinery, justas transcriptional activators have been found to contain mul-tiple activation domains that act on multiple targets (51).Further genetic and biochemical characterization of Knirpswill help elucidate the pathways utilized by this short-rangerepressor.

ACKNOWLEDGMENTS

S. Keller and Y. Mao contributed equally to this work.G. Attardo generated one of the transgenic lines assayed (Fig. 2).

We acknowledge D. Pellek, D. Kalweo, and E. Barnafo for providingtechnical assistance and Z. Burton, R. W. Henry, L. Kroos, L. Kaguni,S. Small, and S. Triezenberg for helpful comments. We thank Y. Nibuand M. Levine for GST fusion constructs and Gal4-dCtBP fly lines.

C.E.Y., A.R.A., S.B., and R.L.A. were supported by NSF under-graduate research fellowships. This work was supported by an AURIGgrant from Michigan State University and grant GM56976 from theNational Institutes of Health to D.N.A.

REFERENCES

1. Amendt, B. A., L. B. Sutherland, and A. F. Russo. 1999. Multifunctional roleof the Pitx2 homeodomain protein C-terminal tail. Mol. Cell. Biol. 19:7001–7010.

2. Arnosti, D. N., S. Gray, S. Barolo, J. Zhou, and M. Levine. 1996. The gapprotein knirps mediates both quenching and direct repression in the Dro-sophila embryo. EMBO J. 15:3659–3666.

3. Aronson, B. D., A. L. Fisher, K. Blechman, M. Caudy, and J. P. Gergen.1997. Groucho-dependent and -independent repression activities of Runtdomain proteins. Mol. Cell. Biol. 17:5581–5587.

4. Baleja, J. D., R. Marmorstein, S. C. Harrison, and G. Wagner. 1992. Solu-

tion structure of the DNA-binding domain of Cd2-GAL4 from S. cerevisiae.Nature 356:450–453.

5. Barolo, S., and M. Levine. 1997. hairy mediates dominant repression in theDrosophila embryo. EMBO J. 16:2883–2891.

6. Brannon, M., J. D. Brown, R. Bates, D. Kimelman, and R. T. Moon. 1999.XCtBP is a XTcf-3 co-repressor with roles throughout Xenopus develop-ment. Development 126:3159–3170.

7. Cai, H. N., D. N. Arnosti, and M. Levine. 1996. Long-range repression in theDrosophila embryo. Proc. Natl. Acad. Sci. USA 93:9309–9314.

8. Carey, M., Y. S. Lin, M. R. Green, and M. Ptashne. 1990. A mechanism forsynergistic activation of a mammalian gene by GAL4 derivatives. Nature345:361–364.

9. Cavallo, R. A., R. T. Cox, M. M. Moline, J. Roose, G. A. Polevoy, H. Clevers,M. Peifer, and A. Bejsovec. 1998. Drosophila Tcf and Groucho interact torepress Wingless signalling activity. Nature 395:604–608.

10. Chen, C. K., R. P. Kuhnlein, K. G. Eulenberg, S. Vincent, M. Affolter, andR. Schuh. 1998. The transcription factors KNIRPS and KNIRPS RELATEDcontrol cell migration and branch morphogenesis during Drosophila trachealdevelopment. Development 125:4959–4968.

11. Chou, T. B., and N. Perrimon. 1996. The autosomal FLP-DFS technique forgenerating germline mosaics in Drosophila melanogaster. Genetics 144:1673–1679.

12. Criqui-Filipe, P., C. Ducret, S. M. Maira, and B. Wasylyk. 1999. Net, anegative Ras-switchable TCF, contains a second inhibition domain, the CID,that mediates repression through interactions with CtBP and de-acetylation.EMBO J. 18:3392–3403.

13. Furusawa, T., H. Moribe, H. Kondoh, and Y. Higashi. 1999. Identification ofCtBP1 and CtBP2 as corepressors of zinc finger-homeodomain factor dEF1.Mol. Cell. Biol. 19:8581–8590.

14. Gerwin, N., A. La Rosee, F. Sauer, H. P. Halbritter, M. Neumann, H. Jackle,and U. Nauber. 1994. Functional and conserved domains of the Drosophilatranscription factor encoded by the segmentation gene knirps. Mol. Cell.Biol. 14:7899–7908.

15. Goetz, T. L., T. L. Gu, N. A. Speck, and B. J. Graves. 2000. Auto-inhibitionof Ets-1 is counteracted by DNA binding cooperativity with core-bindingfactor alpha2. Mol. Cell. Biol. 20:81–90.

16. Gray, S., P. Szymanski, and M. Levine. 1994. Short-range repression permitsmultiple enhancers to function autonomously within a complex promoter.Genes Dev. 8:1829–1838.

17. Gray, S., H. Cai, S. Barolo, and M. Levine. 1995. Transcriptional repressionin the Drosophila embryo. Philos. Trans. R. Soc. Lond. B Biol. Sci. 349:257–262.

18. Gray, S. and M. Levine. 1996. Short-range transcriptional repressors mediateboth quenching and direct repression within complex loci in Drosophila.Genes Dev. 10:700–710.

19. Gray, S., and M. Levine. 1996. Transcriptional repression in development.Curr. Opin. Cell Biol. 8:358–364.

20. Gu, T. L., T. L. Goetz, B. J. Graves, and N. A. Speck. 2000. Auto-inhibitionand partner proteins, core-binding factor beta (CBFbeta) and Ets-1, modu-late DNA binding by CBFalpha2 (AML1). Mol. Cell. Biol. 20:91–103.

21. Hanna-Rose, W., J. D. Licht, and U. Hansen. 1997. Two evolutionarilyconserved repression domains in the Drosophila Kruppel protein differ inactivator specificity. Mol. Cell. Biol. 17:4820–4829.

22. Hewitt, G. F., B. S. Strunk, C. Margulies, T. Priputin, X. D. Wang, R. Amey,B. A. Pabst, D. Kosman, J. Reinitz, and D. N. Arnosti. 1999. Transcriptionalrepression by the Drosophila Giant protein: cis element positioning providesan alternative means of interpreting an effector gradient. Development 126:1201–1210.

23. Imai, S.-I., C. M. Armstrong, M. Kaeberlein, and L. Guarente. 2000. Tran-scriptional silencing and longevity protein Sir2 is an NAD-dependent histonedeacetylase. Nature 403:795–800.

24. Jaynes, J. B., and P. H. O’Farrell. 1991. Active repression of transcription bythe engrailed homeodomain protein. EMBO J. 10:1427–1433.

25. Jimenez, G., Z. Paroush, and D. Ish-Horowicz. 1997. Groucho acts as acorepressor for a subset of negative regulators, including Hairy and En-grailed. Genes Dev. 11:3072–3082.

26. Jonsen, M. D., J. M. Petersen, Q. P. Xu, and B. J. Graves. 1996. Character-ization of the cooperative function of inhibitory sequences in Ets-1. Mol.Cell. Biol. 16:2065–2073.

27. Kirov, N., S. Childs, M. O’Connor, and C. Rushlow. 1994. The Drosophiladorsal morphogen represses the tolloid gene by interacting with a silencerelement. Mol. Cell. Biol. 14:713–722.

28. Kosman, D., and S. Small. 1997. Concentration-dependent patterning by anectopic expression domain of the Drosophila gap gene knirps. Development124:1343–1354.

29. Langeland, J. A., and S. B. Carroll. 1993. Conservation of regulatory ele-ments controlling hairy pair-rule stripe formation. Development 117:585–596.

30. La Rosee-Borggreve, A., T. Hader, D. Wainwright, F. Sauer, and H. Jackle.1999. hairy stripe 7 element mediates activation and repression in responseto different domains and levels of Kruppel in the Drosophila embryo. Mech.Dev. 89:133–140.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

31. Lim, F., N. Kraut, J. Framptom, and T. Graf. 1992. DNA binding by c-Ets-1,but not v-Ets, is repressed by an intramolecular mechanism. EMBO J. 11:643–652.

32. Lunde K., B. Biehs, U. Nauber, and E. Bier. 1998. The knirps and knirps-related genes organize development of the second wing vein in Drosophila.Development 125:4145–4154.

33. Mannervik, M., and M. Levine. 1999. The Rpd3 histone deacetylase isrequired for segmentation of the Drosophila embryo. Proc. Natl. Acad. Sci.USA 96:6797–6801.

34. Meloni, A. R., E. J. Smith, and J. R. Nevins. 1999. A mechanism for Rb/p130-mediated transcription repression involving recruitment of the CtBPcorepressor. Proc. Natl. Acad. Sci. USA 96:9574–9579.

35. Nauber, U., M. J. Pankratz, A. Kienlin, E. Seifert, U. Klemm, and H. Jackle.1988. Abdominal segmentation of the Drosophila embryo requires a hor-mone receptor-like protein encoded by the gap gene knirps. Nature 336:489–492.

36. Nibu, Y., H. Zhang, E. Bajor, S. Barolo, S. Small, and M. Levine. 1998.dCtBP mediates transcriptional repression by Knirps, Kruppel and Snail inthe Drosophila embryo. EMBO J. 17:7009–7020.

37. Nibu, Y., H. Zhang, and M. Levine. 1998. Interaction of short-range repres-sors with Drosophila CtBP in the embryo. Science 280:101–104.

38. Nusslein-Volhard, C., and E. Wieschaus. 1980. Mutations affecting segmentnumber and polarity in Drosophila. Nature 287:795–801.

39. Perrimon, N., A. Lanjuin, C. Arnold, and E. Noll. 1996. Zygotic lethalmutations with maternal effect phenotypes in Drosophila melanogaster. II.Loci on the second and third chromosomes identified by P-element-inducedmutations. Genetics 144:1681–1692.

40. Poortinga, G., M. Watanabe, and S. M. Parkhurst. 1998. Drosophila CtBP:a Hairy-interacting protein required for embryonic segmentation and Hairy-mediated transcriptional repression. EMBO J. 17:2067–2078.

41. Postigo, A. A., and D. C. Dean. 1999. Independent repressor domains in ZEBregulate muscle and T-cell differentiation. Mol. Cell. Biol. 19:7961–7971.

42. Rivera-Pomar, R., and H. Jackle. 1996. From gradients to stripes in Dro-sophila embryogenesis: filling in the gaps. Trends Genet. 12:478–483.

43. Schaeper, U., J. M. Boyd, S. Verma, E. Uhlmann, T. Subramanian, and G.Chinnadurai. 1995. Molecular cloning and characterization of a cellularphosphoprotein that interacts with a conserved C-terminal domain of ade-

novirus E1A involved in negative modulation of oncogenic transformation.Proc. Natl. Acad. Sci. USA 92:10467–10471.

44. Sewalt, R. G., M. J. Gunster, J. van der Vlag, D. P. Satijn, and A. P. Otte.1999. C-terminal binding protein is a transcriptional repressor that interactswith a specific class of vertebrate Polycomb proteins. Mol. Cell. Biol. 19:777–787.

45. Small, S. 1997. Mechanisms of segmental pattern formation in Drosophilamelanogaster, p. 137–178. In K. G. Adiyodi and R. G. Adiyodi (ed.), Repro-ductive biology of invertebrates, vol. VII. John Wiley and Sons, New York,N.Y.

46. Small, S., A. Blair, and M. Levine. 1992. Regulation of even-skipped stripe 2in the Drosophila embryo. EMBO J. 11:4047–4057.

47. Small, S., A. Blair, and M. Levine. 1996. Regulation of two pair-rule stripesby a single enhancer in the Drosophila embryo. Dev. Biol. 175:314–324.

48. Sundqvist, A., K. Sollerbrant, and C. Svensson. 1998. The carboxy-terminalregion of adenovirus E1A activates transcription through targeting of aC-terminal binding protein-histone deacetylase complex. FEBS Lett. 429:183–188.

49. Tanny, J. C., G. J. Dowd, J. Huang, H. Hilz, and D. Moazed. 1999. Anenzymatic activity in the yeast Sir2 protein that is essential for gene silencing.Cell 99:735–745.

50. Tolkunova E. N., M. Fujioka, M. Kobayashi, D. Deka, and J. B. Jaynes. 1998.Two distinct types of repression domain in engrailed: one interacts with thegroucho corepressor and is preferentially active on integrated target genes.Mol. Cell. Biol. 18:2804–2814.

51. Triezenberg, S. J. 1995. Structure and function of transcriptional activationdomains. Curr. Opin. Genet. Dev. 5:190–196.

52. Turner, J., and M. Crossley. 1998. Cloning and characterization of mCtBP2,a co-repressor that associates with basic Kruppel-like factor and other mam-malian transcriptional regulators. EMBO J. 17:5129–5140.

53. Wharton, K. A., Jr., and S. T. Crews. 1993. CNS midline enhancers of theDrosophila slit and Toll genes. Mech. Dev. 40:141–154.

54. White, R. A., and R. Lehmann. 1986. A gap gene, hunchback, regulates thespatial expression of Ultrabithorax. Cell 47:311–321.

55. Zhang, H., and M. Levine. 1999. Groucho and dCtBP mediate separatepathways of transcriptional repression in the Drosophila embryo. Proc. Natl.Acad. Sci. USA 96:535–540.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

dctbp-dependent and -independent repression activities of the

Documents