cyclophilins facilitate dissociation of the human papillomavirus...

Published Ahead of Print 3 July 2012. 2012, 86(18):9875. DOI: 10.1128/JVI.00980-12. J. Virol.

Kim, Robert L. Garcea and Martin SappMalgorzata Bienkowska-Haba, Carlyn Williams, Seong Man following Virus EntryProtein L1 from the L2/DNA ComplexHuman Papillomavirus Type 16 Capsid Cyclophilins Facilitate Dissociation of the

http://jvi.asm.org/content/86/18/9875Updated information and services can be found at:

These include:

REFERENCEShttp://jvi.asm.org/content/86/18/9875#ref-list-1at:

This article cites 69 articles, 38 of which can be accessed free

CONTENT ALERTS more»articles cite this article),

Receive: RSS Feeds, eTOCs, free email alerts (when new

http://journals.asm.org/site/misc/reprints.xhtmlInformation about commercial reprint orders: http://journals.asm.org/site/subscriptions/To subscribe to to another ASM Journal go to:

on August 24, 2012 by U

NIV

OF

CO

LOR

AD

Ohttp://jvi.asm

.org/D

ownloaded from

http://jvi.asm.org/cgi/alertshttp://jvi.asm.org/

Cyclophilins Facilitate Dissociation of the Human PapillomavirusType 16 Capsid Protein L1 from the L2/DNA Complex followingVirus Entry

Malgorzata Bienkowska-Haba,a,b,c Carlyn Williams,d Seong Man Kim,a,b Robert L. Garcea,d and Martin Sappa,b,c

Department of Microbiology and Immunology,a Center for Molecular Tumor Virology,b and Feist-Weiller Cancer Center,c LSU Health Shreveport, Shreveport, Louisiana,USA, and Department of Molecular, Cellular and Developmental Biology, University of Colorado, Boulder, Colorado, USAd

Human papillomaviruses (HPV) are composed of the major and minor capsid proteins, L1 and L2, that encapsidate a chromati-nized, circular double-stranded DNA genome. At the outset of infection, the interaction of HPV type 16 (HPV16) (pseudo)viri-ons with heparan sulfate proteoglycans triggers a conformational change in L2 that is facilitated by the host cell chaperone cyclo-philin B (CyPB). This conformational change results in exposure of the L2 N terminus, which is required for infectiousinternalization. Following internalization, L2 facilitates egress of the viral genome from acidified endosomes, and the L2/DNAcomplex accumulates at PML nuclear bodies. We recently described a mutant virus that bypasses the requirement for cell surfaceCyPB but remains sensitive to cyclosporine for infection, indicating an additional role for CyP following endocytic uptake ofvirions. We now report that the L1 protein dissociates from the L2/DNA complex following infectious internalization. Inhibitionand small interfering RNA (siRNA)-mediated knockdown of CyPs blocked dissociation of L1 from the L2/DNA complex. Invitro, purified CyPs facilitated the dissociation of L1 pentamers from recombinant HPV11 L1/L2 complexes in a pH-dependentmanner. Furthermore, CyPs released L1 capsomeres from partially disassembled HPV16 pseudovirions at slightly acidic pH.Taken together, these data suggest that CyPs mediate the dissociation of HPV L1 and L2 capsid proteins following acidificationof endocytic vesicles.

Human papillomaviruses (HPV) comprise a large family ofnonenveloped epitheliotropic DNA viruses. Infection withhigh-risk HPV types, especially HPV type 16 (HPV16) andHPV18, may induce lesions that progress to malignancies, themost common of which is cervical cancer. The viral capsid is com-posed of 360 copies of the major capsid protein, L1, and up to 72copies of the minor capsid protein, L2 (1, 4, 8). Seventy-two pen-tamers of L1, termed capsomeres, are the primary constituents ofthe outer capsid shell. Capsomeres are linked together by theircarboxy-terminal domains and stabilized by intercapsomeric di-sulfide bonds between highly conserved cysteine residues (39, 53).The L2 protein is inaccessible within the capsid, with the exceptionof amino acid residues 60 to 120 located near the amino terminus(40). Association of L1 and L2 inside the capsid requires hydro-phobic interactions between a small stretch of amino acids close tothe carboxy terminus of L2 (residues 390 to 430 for HPV11) andthe inner central core of capsomeres (17), similar to the structuralinteraction determined for VP1 capsomeres and the VP2/VP3proteins of the related murine polyomavirus (9). In addition, acharge-dependent interaction with L1 has been suggested to re-quire L2 residues 150 to 250 (47).

HPV16 attachment and entry comprise a slow process withhalf-times of up to 14 h. The prolonged residence of the virus onthe cell surface is accompanied by conformational changes affect-ing both capsid proteins, allowing for sequential engagement ofmultiple receptors (52). The L1 protein mediates the primary at-tachment of viral particles to the cell surface (24, 32, 59) and/orextracellular matrix (ECM) of susceptible cells (12), most proba-bly via heparan sulfate (HS) proteoglycans (HSPG) (31). The pri-mary attachment of HPV16 to HS is mediated by surface-exposedlysine residues Lys278 and Lys361 located at the rim of capsom-eres (13, 36). In addition to the primary HS attachment site, three

additional putative receptor binding sites have been identified bythe structural analysis, and two of these seem to be required atpostattachment entry steps, possibly mediating multivalent inter-actions with HS (13). These and other observations (59, 60) sug-gest that secondary HSPG interactions may play a role in infec-tion. An attachment-induced conformational change in bothcapsid proteins (15, 60, 69) seems to be required for transfer to astill elusive, putative secondary receptor and infectious internal-ization (59). HS binding-induced changes in the conformation ofthe L1 protein are not well defined as yet. However, it appears thatHPV16 attachment results in the exposure of the N terminus of L2protein (15, 49), which contains a neutralizing epitope that cross-reacts with multiple HPV serotypes (50). Accessibility of the L2amino terminus allows subsequent cleavage of 12 N-terminalamino acids catalyzed by furin convertase on the cell surface, anessential step for infectious internalization (15, 49). HPV16 inter-nalization occurs via a pathway that is independent of caveolin-1and clathrin (57, 63). Acidification of endosomes (16, 61) as wellas transport along microtubules (16, 19, 58, 61) is essential forintracellular trafficking and egress from endosomes of a complexcomposed of L2 protein and the viral genome. Accumulation ofthis complex near PML nuclear bodies (PML-NB) additionallyrequires mitosis (14, 48).

The fate of L1 protein after uncoating has not been studied in

Received 20 April 2012 Accepted 25 June 2012

Published ahead of print 3 July 2012

Address correspondence to Martin Sapp, [email protected].

Copyright © 2012, American Society for Microbiology. All Rights Reserved.

doi:10.1128/JVI.00980-12

September 2012 Volume 86 Number 18 Journal of Virology p. 9875–9887 jvi.asm.org 9875


NIV

OF

CO

LOR

AD

Ohttp://jvi.asm

.org/D

ownloaded from

http://dx.doi.org/10.1128/JVI.00980-12http://jvi.asm.orghttp://jvi.asm.org/

detail due to a lack of suitable reagents. However, it is assumedthat L1 segregates from the L2/viral genome in an endocytic com-partment and is targeted to lysosomes for degradation. Host cellfactors involved in uncoating and segregation also have not beenidentified. We recently demonstrated that an L2 conformationalchange is mediated by the host cell chaperone cyclophilin B(CyPB) residing on the cell surface (3). CyPB is a member of thecyclophilin (CyP) family and functions as peptidyl-prolyl cis/transisomerase, e.g., during nascent protein folding (18, 27). The re-quirement for cell surface-resident CyPB could be bypassed bymutating the putative CyPB binding site located near the L2amino terminus. However, despite bypassing the requirement forcell surface-resident CyPB, HPV16 infectious entry remained sen-sitive to CyP inhibitors such as cyclosporine (CsA), indicating thatCyPs are required at an additional step. Here, we provide cell-biological and -biochemical evidence that CyPs mediate the dis-sociation of L1 from the L2/viral genome complex during virusuncoating following acidification of endosomes.

MATERIALS AND METHODSCell lines. 293TT cells were cultured in Dulbecco’s modified Eagle’s me-dium (DMEM) supplemented with 10% fetal bovine serum (FBS), non-essential amino acids, and antibiotics. HaCaT cells were grown in low-glucose DMEM containing 5% FBS and antibiotics.

Antibodies. HPV16 L1-specific mouse monoclonal antibody (MAb)H16.56E, 33L1-7, and 312F and HPV16 L2-specific mouse antibody33L2-1 have been described previously (54, 59, 66). H16.E70, H16.U4,and H16.V5 were a kind gift from N. D. Christensen, Hershey MedicalCenter. PML protein- and CyPB-specific rabbit antibodies were obtainedfrom Chemicon (ab1370) and Affinity BioReagents, Inc. (PA1-027),respectively. A Click-iT EdU (5-ethynyl-2=-deoxyuridine) imaging kit,Alexa Fluor (AF)-labeled secondary antibodies, and phalloidin were pur-chased from Invitrogen. Peroxidase-conjugated AffiniPure goat anti-mouse antibodies were purchased from Jackson ImmunoResearch.

Plasmids and pseudovirions (PsV). Codon-optimized HPV16 L1 andL2 expression plasmids were a kind gift from Martin Müller, Heidelberg,Germany (37). Pseudoviruses harboring pEGFP (where EGFP is en-hanced green fluorescent protein) were generated using the 293TT cellline as described previously (5). Pseudogenomes were labeled with EdU bysupplementing the growth medium with 100 �M EdU at 6 h posttrans-fection as described previously (30). Particles were characterized by L1-and L2-specific Western blotting, and pseudovirus yield was determinedby green fluorescent protein (GFP)-specific quantitative real-time PCR(qRT-PCR).

Inhibitors and reagents. Cyclosporine was obtained from TorontoResearch Chemicals (C988900). Bafilomycin A1 (BafA1) was purchasedfrom Alexis Biochemicals (ALX 380030).

Infection assay. 293TT cells were seeded into 24-well plates, and drugsdiluted in complete DMEM were added 24 h later, together with anamount of pseudovirus yielding infection rates of between 5 and 10%.Infectivity was scored by counting GFP-expressing cells at 72 h postinfec-tion (hpi) using flow cytometry.

Enzyme linked immunosorbent assay (ELISA). Pseudovirions fromtwo preparations were diluted in phosphate-buffered saline (PBS), addedto a 96-well plate (Nunc-Immuno Module; Nunc) in replicates, andbound for 1 h at 37°C. Subsequently, wells were washed with PBS– 0.2%Tween 20 (PBST) and incubated with PBS or a Click-iT reaction cocktailwithout Alexa Fluor for 30 min at room temperature. Subsequently, theplate was washed with PBST and blocked with 0.01% bovine serum albu-min (BSA) in PBST for 1 h at 37°C. Primary antibody solutions wereadded (mouse monoclonal 33L1-7, 312F, H16.56E, H16.E70, H16.U4,and H16.V5) for 1 h at 37°C. Bound primary antibody was detected by theaddition of horseradish peroxidase-coupled secondary antibody for 30min at 37°C. The assays were developed with trimethylbenzidine (Pro-

mega) and stopped with 1 N HCl. Absorbance was measured at 450 nmusing a FLUOstar-Omega plate reader (BMG Labtech).

Infection in the presence of drugs and immunofluorescence. HaCaTcells were grown on coverslips at approximately 50% confluence and in-fected with HPV16 pseudovirus in the presence of 10 �M cyclosporine(CsA)or 100 nM bafilomycin A1 (BafA1). Approximately 5 � 105 to 10 �105 viral genome equivalents per coverslip were used. EdU staining wasperformed according to the manufacturer’s directions. In brief, at theindicated times postinfection (see below), cells were washed with PBS andfixed with 4% paraformaldehyde (PFA) for 20 min at room temperature,washed, permeabilized with 0.2% Triton X-100 or 0.1% digitonin in PBSfor 10 min, washed, and blocked with 5% goat serum in PBS for 30 min,followed by a 30-min incubation with Click-iT reaction cocktail contain-ing Alexa Fluor 555 for EdU-labeled pseudogenome detection. After ex-tensive washing, cells were incubated for 30 min with primary antibodiesat room temperature. After extensive washing, cells were incubated withAlexa Fluor-tagged secondary antibodies for 30 min. Phalloidin stainingwas not used for these samples because it is incompatible with the Click-iTdetection reaction. After extensive washing with PBS, cells were mountedin Gold Antifade containing 4=,6=-diamidino-2-phenylindole (DAPI; In-vitrogen). For the colocalization analysis of PsV interactions with theECM, particles were bound to ECM-coated coverslips (59) for 1 h at 37°C.After incubation, unbound PsV were removed by several washes withPBS. The ECM-bound pseudoviruses were then fixed and stained as de-scribed above using a Click-iT EdU imaging kit and 33L1-7 or 33L2-1antibody. All immunofluorescence (IF) images were captured by confocalmicroscopy with a 63� objective (Leica TCS SP5 Spectral Confocal Mi-croscope) and processed with Adobe Photoshop software.

The colocalization rate of 33L1-7 and DNA (33L1-1/DNA) or 33L2-1/DNA was determined using LAS AF Lite software. For quantification ofECM-bound PsV, regions of interest (ROIs) from four images were ana-lyzed for each antibody (17 by 100.9 �m2 for 33L1-7 and 17 by 101.3 �m2

for 33L2-1) (Table 1). For quantification of the colocalization rate inHaCaT cells infected with wild-type (wt) HPV16 PsV in the presence orabsence of BafA1, groups of 15 cells from three slides were analyzed foreach condition. ROIs of cytoplasmic signals only were analyzed. Resultsare presented as average colocalization rates � standard deviations (SD).

Alternatively, colocalization of individual EdU-positive dots with cap-sid proteins was quantified manually. The intensity of each channel signalwas measured using LAS AF Lite software for all individual cytoplasmicEdU-positive dots. The same thresholds were set, and 15 to 19 cells foreach group from four images were analyzed (Table 2). Results are ex-pressed as an average percentage of EdU-positive dots colocalizing

TABLE 1 Results of colocalization analysis obtained using LAS AFsoftware

Antibody/DNA complexand sample type (n)a

Colocalizationrate (avg �SD [%])

Pearson’scorrelation(avg � SD)

Overlapcoefficient(avg � SD)

33L1-7/DNAECM (17) 87.9 � 3.44 0.57 � 0.08 0.84 � 0.03Cells (15)

Control 45.2 � 6.6 0.24 � 0.06 0.34 � 0.05BafA1-treated 91.6 � 2.9 0.75 � 0.06 0.79 � 0.05

P value 2.72 � 10�19 7.15 � 10�19 5.79 � 10�19

33L2-1/DNAECM (17) 75.1 � 4.1 0.38 � 0.02 0.54 � 0.04)Cells (15)

Control 73.6 � 5.7 0.39 � 0.05 0.59 � 0.04BafA1-treated 92.6 � 4.7 0.74 � 0.08 0.80 � 0.06

P value 6.17 � 10�11 2.04 � 10�14 5.6 � 10�12

a n, number of samples.

Bienkowska-Haba et al.

9876 jvi.asm.org Journal of Virology


NIV

OF

CO

LOR

AD

Ohttp://jvi.asm

.org/D

ownloaded from

http://jvi.asm.orghttp://jvi.asm.org/

with capsid protein as a function of the total number of EdU-positivedots � SD.

Infection and immunofluorescence assay after siRNA knockdownof CyP. RNA interference was carried out using synthetic small interferingRNA (siRNA) duplexes with symmetric 3=-deoxythymidine overhangs aspreviously described (3). Briefly, HaCaT cells were transfected with 3 �gof CyP (broad) (Integrated DNA Technologies, Inc.) siRNA duplexes inserum-free medium using MATra reagent (catalog number 7-2001-100;IBA Bio TAGnology, Goettingen, Germany) according to the manufac-turer’s protocol. At 48 h posttransfection, HaCaT cells were harvestedwith trypsin and reseeded onto coverslips. When cells had attached, theywere infected with EdU-labeled 16L2-GP-N mutant pseudovirus. At 18hpi samples were fixed with 4% paraformaldehyde and stained as de-scribed above for EdU and L1 using primary 33L1-7 antibody and anti-mouse AF-tagged secondary antibody. Next, samples were fixed with 70%ethanol (EtOH) containing 50 mM glycine, pH 2.0, for 20 min, washedwith PBS, and incubated with CyPB rabbit polyclonal antibody for 30min. After extensive washing with PBS, cells were incubated with AlexaFluor-tagged secondary anti-rabbit antibodies for 30 min. Knockdown ofCyPs was readily visible in IF staining by lack of reactivity with CyPBantibody.

Expression and purification of GST fusion proteins. L1/L2 com-plexes were purified as previously described using the plasmid pET17b-HPV11 L1 cotransformed with a pXA/BN-HPV11 L2 (residues 1 to 455)plasmid into the BL21(DE3) bacterial host (17). Briefly, overnight cultureswere used to inoculate 1-liter cultures that were grown to an optical density at600 nm of �0.2 at 37°C. The cultures were then induced with 0.2 mM iso-propyl-�-D-thiogalactopyranoside (IPTG) and grown overnight (�16 h) at25°C. Cells were pelleted, resuspended in buffer L (50 mM Tris, pH 8.0, 0.2 MNaCl, 1 mM EDTA, 5% glycerol, 5 mM dithiothreitol [DTT]), lysed using aFrench press operating at 1,000 lb/in2, and centrifuged to remove cell debris.The resulting lysate was chromatographed using a glutathione-Sepharose (4BGE Healthcare) column. CyPA and CyPB were amplified from HeLa cellcDNA and cloned into pGEX4T-1 using oligonucleotides GGTGAATTCATGGTCAACCCCACCGTG (PPIA-F) and ATTCCCGGGTTATTCGAGTTGTCCACA (PPIA-R) for CyPA and ATTAGAATTCCCTGCTGCCGGGACCTTCTGC (PPIB-F) and CCCGGGATCCACTCCTTGCGCATGGCAA (PPIB-R) for CyPB (restriction enzyme sites used for cloning arehighlighted in bold). The pGEX-CyPA and pGEX-CyPB vectors weretransformed into BL21 (Stratagene) Escherichia coli for fusion proteinexpression. The glutathione S-transferase (GST) fusions of CyPA andCyPB proteins were purified as described for the L1/L2 complexes. CyPAand CyPB were enzymatically cleaved from the GST moiety by overnightincubation with thrombin (10 units at 4°C). Before use, phenylmethylsul-fonyl fluoride (PMSF) was added to a final concentration of 5 mM toinactivate residual thrombin.

L1 release assay. Immobilized HPV 11 L1/L2 complexes (50 �l ofglutathione-Sepharose beads) were resuspended in buffer R (50 mM so-

dium acetate, 0.2 M NaCl, 1 mM EDTA, 5% glycerol, 5 mM DTT) havinga pH of 5.5, 6.0, or 7.4 or in buffer L (pH 8.0) and washed three times toremove unbound protein. All subsequent steps were performed in thebuffer of the indicated pH. After the final wash, bead complexes wereresuspended in 50 �l of the same buffer. Purified CyPA or CyPB (20 �g)or a buffer control was then added to the GST-L2/L1 bead complexes, andthe volume was adjusted to 100 �l. The samples were incubated withinversion at room temperature for 1 h. Beads were collected by centrifu-gation, and supernatants were saved. The beads were washed three timeswith buffer. Aliquots of the supernatants and beads were resolved by SDS-PAGE and analyzed by Western blotting with L1 antibodies (HPV11R8363 anti-rabbit polyclonal recombinant L1).

Disassembly of pseudovirions and sucrose gradient sedimentation.HPV16 pseudovirions were purified by OptiPrep gradient centrifugationas described previously (5). Peak fractions were combined, diluted 1:6 inH2O, and adjusted to 10 mM MgCl2 and 20 mM DTT. After addition of 6units of DNase I, pseudovirions were incubated for 30 min at 37°C. Solu-tion was adjusted to pH 6.0 by adding 1/10 volume of 0.5 M phosphatebuffer, pH 6.0. Subsequently, 25 �g of purified GST-CyPA or GST wasadded and incubated for an additional 60 min at 37°C. Samples were puton ice; EDTA was added to a final concentration of 20 mM, and sampleswere loaded onto a 20 to 60% linear sucrose gradient in PBS supple-mented with 10 �g of bovine serum albumin and 1 mM DTT. After cen-trifugation for 3.5 h at 40,000 rpm (SW40 rotor at 4°C), 750-�l fractionswere collected from the top. Ten-microliter aliquots were removed forPCR amplification of the pseudogenome. The remainder was precipitatedwith 10% trichloroacetic acid as described previously (20). The resultingpellets were analyzed by Western blotting for L1 and L2 using mouseMAbs 16L2-312F and 33L2-1 as primary antibodies.

RESULTSBinding, internalization, and uncoating of HPV16 L2-GP-Npseudovirus. We recently showed that a mutant HPV16 pseudo-virus with G99A and P100A amino acid changes in L2 (16L2-GP-N) bypasses the requirement for cell surface CyPB during in-fectious entry (3). We had found that the mutant 16L2-GP-N butnot wt L2 protein exposes the amino terminus after CyP inhibi-tion. This conclusion was further supported by the observationthat internalized wt but not mutant HPV16 pseudovirus retainedreactivity with the conformation-dependent mouse monoclonalantibody (MAb) H16.56E at 18 h postinfection (hpi) in the pres-ence of the CyP inhibitor cyclosporine (CsA) and after CyPBknockdown (3). At this time point postinfection of the controlcells, wt pseudovirus is no longer recognized by H16.56E (Fig. 1A)(59). To further corroborate this finding, we tested for proteolyticcleavage of the 12 amino-terminal residues of L2 protein following

TABLE 2 Results of colocalization study of individual cytoplasmic EdU puncta with capsid proteins

Antibody and DNA localization

Median no. of EdU puncta per cell (range) by treatment and virus

Control (no drug) CsA treatment CyPB (16L2-GP-N)

wt 16L2-GP-N wt 16L2-GP-N CyPB� CyPB�

33L1-7/DNA (n � 15)a

DNA only 12 (4–25) 14 (4–23) 2 (0–9) 4 (1–8) 18 (7–29) 7 (2–16)L1/DNA 16 (9–37) 19 (10–29) 28 (17–49) 27 (16–61) 27 (14–68) 31 (9–64)DNA total 32 (15–62) 33 (14–50) 32 (17–50) 32 (17–68) 40 (31–86) 41 (13–75)

33L2-1/DNA (n � 19)DNA only 6 (0–15) 5 (2–8) 5 (2–12) 5 (1–12)L2/DNA 24 (13–38) 25 (9–38) 24 (13–47) 26 (9–39)DNA total 30 (17–47) 31 (12–46) 30 (16–56) 30 (10–51)

a For the CyPB knockdown experiment, n � 17.

Endosomal Dissociation of HPV Capsid Proteins

September 2012 Volume 86 Number 18 jvi.asm.org 9877


NIV

OF

CO

LOR

AD

Ohttp://jvi.asm

.org/D

ownloaded from


infection with wt and mutant pseudovirus. We found that, in con-trast to the wt, 16L2-GP-N is cleaved in the presence of CsA, likelyby furin convertase (15, 49), resulting in a protein with slightlyhigher mobility in SDS-PAGE (Fig. 1B). Even though 16L2-GP-Nmutant pseudovirus was obviously processed normally on the cellsurface in the presence of CyP inhibitors, it remained sensitive toCsA (Fig. 1C) and to CyP knockdown (3). These data suggestedthat CyP function is required for subsequent steps of infectiousentry.

In order to exclude the possibility that virus is lost from the cell

surface or not internalized in the presence of CyP inhibitors, weinfected HaCaT cells with mutant pseudoviruses and fixed cells at4, 8, and 18 hpi with paraformaldehyde (PFA). To detect the L1protein, we denatured the viral capsid proteins by treatment witha Click-iT reaction cocktail prior to staining with MAb 33L1-7.This mouse monoclonal antibody recognizes a conserved linearepitope of the L1 protein (HPV16 L1 residues 303 to 313) that isinaccessible in intact virions, virus-like particles, or capsomeres(51, 54) (Fig. 2A). Under these conditions reactivity is lost withconformation-dependent, neutralizing MAbs but gained with lin-ear epitope-specific MAbs in both ELISA (Fig. 2B) and IF assays(Fig. 2C). We used denaturation of capsid proteins coupled withthe use of the linear epitope-specific antibody rather than directlabeling of particles with fluorescent dyes to avoid interference ofdyes with binding and internalization events. We also wanted toexclude the possibility of labeling the L2 protein in addition to L1(see below). As shown in Fig. 3A, CsA treatment did not signifi-cantly affect binding of the 16L2-GP-N mutant pseudovirus to theECM and cell surface. Furthermore, internalization of viral parti-cles was observed at similar levels, suggesting that neither differ-ences in binding nor uptake could explain the 90% reduced infec-tion in the presence of CsA. However, the L1-specific signalstrength was reduced in control mutant pseudovirus infection at18 hpi compared to infection in the presence of CsA, suggestingthat degradation of L1 may be impaired in CsA-treated cells.Nonetheless, these data indicate that CsA blocks neither bindingnor internalization of mutant virus and, taken together with re-sults presented in Fig. 1, suggested that CyPs are required at asecond, possibly intracellular, step during infectious entry ofHPV16 pseudovirions.

To resolve the step at which infectious entry of mutant pseu-dovirus was blocked, we next investigated the effect of CsA treat-ment on uncoating and nuclear delivery of viral pseudogenomes.To test for uncoating, HaCaT cells were fixed at 18 hpi with the16L2-GP-N mutant pseudovirus and subsequently permeabilizedand stained for L1 using 33L1-7 without prior denaturation. Un-der these conditions, only those L1 molecules were detected thathad the 33L1-7 epitope exposed due to uncoating. Reactivity withMAb 33L1-7 following infectious entry is well established as ameasure of uncoating (3, 34, 63). We observed equally strong33L1-7-specific signals in control and CsA-treated cells, indicatingthat uncoating of mutant pseudovirus was not impaired by CsA(Fig. 3B). In contrast to this observation, we had previously shownthat uncoating of the wt HPV16 pseudovirus was blocked either inthe presence of CsA or after knockdown of CyPB (3). These dataconfirm that CsA blocks wt and mutant pseudovirus at differentstages during viral entry.

We next tested for delivery of viral pseudogenomes to the sub-nuclear PML-NB. In order to follow viral DNA, the pseudog-enomes were labeled in vivo using the nucleotide derivative5-ethynyl-2=-deoxyuridine (EdU) so that EdU-labeled viral pseu-dogenomes could be visualized using the Click-iT reaction cock-tail (30). We also costained for PML protein to verify delivery ofpseudogenomes to PML-NB (14). As shown in Fig. 3C, viral ge-nomes were detected at PML-NB in untreated control cells. How-ever, EdU staining was always restricted to the cytoplasm of CsA-treated cells, indicating that their nuclear delivery was blocked byCsA. Taken together, these data suggest that entry of the mutant16L2-GP-N pseudovirus is blocked by CyP inhibitors between

FIG 1 Characterization of the HPV16 L2-GP-N mutant pseudovirus. (A)HaCaT cells were fixed, permeabilized, and stained for L1 (green) using MAbH16.56E at 18 hpi with wt and 16L2-GP-N mutant pseudovirus. Nuclei (blue)and filamentous actin (magenta) were stained in addition using DAPI andfluorescently labeled phalloidin, respectively. (B) L2-specific Western blottingof HaCaT cell lysate at 18 hpi with the wt and 16L2-GP-N mutant in thepresence or absence of CsA. L2 protein was detected using a mix of RG-1 (22),anti-hemagglutinin, and 33L2-1 MAbs. (C) Sensitivity of wt and 16L2-GP-Nmutant pseudovirus infection to 10 �M CsA.




NIV

OF

CO

LOR

AD

Ohttp://jvi.asm

.org/D

ownloaded from


uncoating of the viral capsid and nuclear accumulation of the viralgenome.

Dissociation of L1 and L2 in vitro. A putative CyP binding sitecan be identified adjacent to the peptide domain of L2 that medi-ates interaction with L1 capsomeres (Fig. 4A) (3, 17, 42), suggest-ing that CyPs mediate dissociation of the L1 and L2 capsid pro-teins. To test this hypothesis, we first investigated the dissociation

of L1 and L2 in an in vitro assay format, which had previously beendeveloped to identify HPV11 L2 amino acid residues interactingwith HPV11 capsomeres. HPV11 L1 was coexpressed withGST-L2 in E. coli. The intracellular complexes between L1 cap-someres and the GST-L2 fusion protein were extracted and boundto glutathione-agarose beads as previously described (17). Thebeads were sequentially incubated with purified CyPA or CyPB at

FIG 2 Treatment of HPV16 particles with the Click-iT reaction cocktail denatures capsid protein L1. (A) RasMol-generated model of HPV16 L1 capsomeres(Protein Data Bank code 1dzl) highlighting in red the 33L1-7 antibody’s conserved linear epitope (residues 303 to 313). (B) HPV16 pseudovirions were boundto ELISA plates and left untreated or treated with the Click-iT reaction cocktail prior to detection with indicated MAbs. Note the gain of reactivity with linearepitope-specific 33L1-7 and 16L1-312F and loss of reactivity with the conformation-dependent MAbs H16.V5, H16.E70, H16.56E, and H16.U4. (C) HaCaT cellswere fixed and permeabilized at 4 hpi with wt HPV16 pseudovirions. Samples were either directly stained for conformational or linear L1 epitopes using H16.56Eor 33L1-7, respectively, or treated with the Click-iT reaction cocktail prior to incubation with L1-specific antibodies. Again, note the loss of reactivity withH16.56E and gain of reactivity with 33L1-7 after treatment with the Click-iT reaction cocktail. Nuclei are stained with DAPI.




NIV

OF

CO

LOR

AD

Ohttp://jvi.asm

.org/D

ownloaded from


different pHs. We varied the pH in this release assay because acid-ification of endosomes is an essential step for infectious entry ofHPV (16, 61). Dissociation of L1 and L2 was measured by theappearance of L1 protein in supernatants using L1-specific West-ern blotting. As shown in Fig. 4B, all beads loaded with the GST-L2fusion protein had L1 protein bound in similar amounts. Incuba-tion with both CyPA and CyPB but not with a buffer controlinduced the release of L1 from beads in a pH-dependent manner.L1 dissociation from L2 was most efficient at pH 6.0, less efficientat pH 7.4, and undetectable at pH 5.5 and 8.0. Since CyPA andCyPB differ in their intracellular localizations but not in theirenzymatic activities, it was expected that they might behave simi-larly in vitro. These data support the hypothesis that CyPs cancatalyze the dissociation of L1/L2 complexes and led us to furtherinvestigate the dissociation of capsid proteins during virus entry.Since acidification of endosomes increases during maturation,ranging from pH 6.1 to 6.8 in early endosomes to 6.0 to 4.8 in lateendosomes, these results were a first indication that dissociationmay occur in the early endosomal compartment (28, 44).

HPV16 capsid protein dissociation during pseudovirus in-ternalization. We next investigated the dissociation of capsid pro-teins following infection of HaCaT cells with wt and mutant pseu-doviruses using IF. We quantified the extent of colocalizationbetween pseudogenomes and capsid proteins using the colocaliza-tion module of the LAS AF software provided by Leica to enable aquantitative analysis and to address the inherent deficiencies ofthe IF analysis, such as nonspecific staining, differences in sensi-tivities, and presence of L1-only viral particles. EdU-labeled viralparticles were bound to ECM-coated coverslips. Following fixa-tion, capsid proteins were denatured by treatment with a Click-iTreaction cocktail and stained for L1 or L2 using 33L1-7 or 33L2-1,respectively (Fig. 5A). 33L2-1 binds to a linear epitope of theHPV16 and HPV33 L2 proteins spanning amino acid residues 163to 170 and, similar to 33L1-7, recognizes only denatured L2 pro-tein (66). The extent of colocalization reached 88% � 3.4% and75% � 4.1% for L1/DNA and L2/DNA, respectively (Fig. 5F; Ta-ble 1). That the level of L2/DNA colocalization was lower than thatof L1/DNA probably reflects the lower copy number of L2 in theviral capsid and the fact that L1 can form pseudoviral particles inthe absence of L2.

To calibrate this assay and determine the maximal and mini-mal levels of colocalization achievable under the assay conditions,we measured the extent of colocalization of L1/DNA and L2/DNAin HaCaT cells at 18 hpi with wt pseudovirus in the absence or thepresence of bafilomycin A1 (BafA1) (Fig. 5B to E). BafA1 blocksacidification of endosomes and is a well-established inhibitor ofHPV16 infection that blocks uncoating (6). We reasoned thatBafA1 treatment would block the dissociation of L1 from thepseudogenome and thus significantly change the extent of L1/DNA colocalization. Dissociation of L1 from the pseudogenomewas readily detected by IF at 18 hpi of HaCaT cells with wt HPV16pseudovirus, as evidenced by vesicles staining for either EdU or L1alone (Fig. 5B). The extent of L1/DNA colocalization was in-creased from 45.2% � 6.6% in a control infection to 91.6% �2.9% in cells treated with BafA1 (Fig. 5C and F; Table 1). In con-trast, the L2/DNA colocalization in a control infection was similarto that of ECM-bound particles; however, it increased in cellstreated with BafA1 (73.6% � 5.7% versus 92.6% � 4.7%) (Fig. 5Dto F; Table 1). The increased extent of L2/DNA colocalization inBafA1-treated cells compared to ECM-resident particles may bedue to endocytic vesicles that contain more than one viral particle,thus increasing the likelihood of detecting L2 capsid protein. Sim-ilar to CsA treatment, BafA1 treatment increases signal strengthfor L1, L2, and DNA, again indicating that this drug might inter-fere with the degradation of viral components. To restrict ourquantitative analysis to pseudogenome-containing particles andexclude the analysis of DNA-free particles present in our pseudo-virus preparations, we repeated the measurements by manuallyanalyzing all individual EdU-positive cytoplasmic puncta for thepresence of capsid proteins. For this, the intensity of each channelsignal was measured for all individual cytoplasmic EdU-positivedots. In control infections, 62.1% � 10.8% and 81.5% � 8.3% ofall EdU-positive puncta were also positive for L1 and L2 pro-tein, respectively. From these observations we conclude thatdissociation of L1 protein from the viral pseudogenome can bedetected with this methodology. A probable reason for the lowdissociation efficiency is the well-established slow internaliza-tion of HPV (half-times of up to 14 h have been reported) (10,24, 60, 62).

FIG 3 Binding, internalization, and nuclear transport of the 16L2-GP-N mu-tant pseudovirus. (A) HaCaT cells were fixed, permeabilized, and treated witha Click-iT reaction cocktail at the indicated times postinfection with mutantpseudovirus in the absence (control) or presence (�) of CsA prior to immu-nofluorescent staining using MAb 33L1-7. (B) HaCaT cells infected with mu-tant pseudovirus for 18 h in the absence or presence of CsA were stained for L1using MAb 33L1-7 without prior denaturation as a measure for uncoating. (C)Delivery of viral pseudogenomes (red) was detected at 24 hpi of HaCaT cellsinfected with the EdU-labeled mutant pseudovirus. PML protein was stainedin blue. Nuclei and filamentous actin were stained with DAPI (blue in panels Aand B; gray in panel C) and phalloidin (magenta in panel B). Note the absenceof the PML-NB-associated pseudogenome when infection was performed inthe presence of CsA.




NIV

OF

CO

LOR

AD

Ohttp://jvi.asm

.org/D

ownloaded from


CyP inhibition and knockdown block dissociation of L1from the L2/genome complex in vivo. Using manual measure-ments, we studied the effect of CsA on the dissociation of the L1protein from viral pseudogenomes. In contrast to results withcontrol infections, we found that the majority of vesicles stainingfor DNA were also positive for the L1 protein at 18 hpi with mu-tant pseudovirus (Fig. 6A and B). However, many L1-positive ves-icles appeared increased in size compared to those of the controlinfection, again indicating that CsA might have off-target effects.CsA treatment increased levels of L1/DNA colocalization from60% � 10.1% to 87.1% � 5.2% (Fig. 6E; Table 2). In contrast, therate of L2/DNA colocalization was not significantly altered by CsAtreatment (Fig. 6C to E; Table 2). As a control, we infected HaCaTcells with the wt HPV16 pseudovirus in the presence of CsA. Sim-ilar to BafA1, CsA blocks uncoating of wt HPV16 pseudovirionsdue to the inhibition of L2 conformational changes occurring onthe cell surface (3). Again, the level of L1/DNA colocalization wasincreased from 62.1% � 10.3% to 89.8% � 6.5% (Fig. 7 and Table2). As expected, the L2/DNA colocalization was not changed byCsA treatment. This result is consistent with the hypothesis that

the L1 but not the L2 protein dissociates from the viral genomeand that its dissociation requires CyP activity.

To confirm these findings and control for possible off-targeteffects of CsA, we knocked down CyPA and CyPB using an siRNAthat targets both CyPs and efficiently inhibits wt as well as mutantHPV16 pseudoinfection (3). At 48 h posttransfection of thesiRNA, HaCaT cells were infected with EdU-labeled 16L2-GP-Nmutant pseudovirus. The immunofluorescent staining was mod-ified to detect CyPB (see Materials and Methods). Cells knockeddown for CyPB were readily identified (Fig. 8A). Compared to L1levels after CsA treatment, the L1 protein levels in CyPB-deficientcells were reduced significantly, indicating that the previously ob-served increase in L1 levels (Fig. 3A) was likely due to off-targeteffects of CsA. Quantification of individual EdU-positive punctarevealed that the knockdown increased the extent of L1/DNA co-localization from 62.0% � 11.8% to 80.5% � 8.8% (Fig. 8B and C;Table 2), confirming the requirement of CyPs for efficient disso-ciation of L1 from the L2/DNA complex. Increased signal inten-sity of CyPB in EdU-positive puncta additionally indicates thepresence of CyPB in viral genome-containing vesicles. Where

FIG 4 In vitro dissociation of HPV11 L1 from complexes of L1 and GST-L2 by CyPs. (A) Sequence comparison of putative CyP binding sites. (B) Complexes ofL1 and GST-L2 bound to glutathione Sepharose beads were incubated with CyPA, CyPB, or buffer control at the indicated pH. L1 released from the complex intothe supernatant was assayed by Western blotting with anti-L1 antibody. SN supernatant; A, CyPA; B, CyPB; Con, buffer-alone control; SM, starting materialbound to the beads.




NIV

OF

CO

LOR

AD

Ohttp://jvi.asm

.org/D

ownloaded from


CyPB is derived from is unclear at the moment. However, it couldbe cointernalized with viral particles or, alternatively, be present inintracellular vesicles fusing with the virus containing early endo-somes.

CyP facilitates partial release of L1 from HPV16 pseudovirusin vitro. Finally, we investigated the effect of CyP on the L1-L2interaction in HPV16 pseudoviral particles. Since no host cell fac-tors required for uncoating have been identified as yet and since itis unknown how the critical disulfide bonds are reduced duringviral entry, we treated purified pseudovirions with DTT to reduceintercapsomeric disulfide bonds prior to incubation with purifiedCyPA. We also incubated the reduced capsid with DNase I torestrict our analysis to protein-protein interactions and avoid pos-sible interference by capsid protein interactions with encapsidatedchromatin. These partially disassembled HPV16 pseudovirionswere then incubated with a purified GST-CyPA fusion protein orGST at pH 6.0. Products were separated by sucrose gradient sed-imentation, and fractions were analyzed by L1- and L2-specific

Western blotting. Under these conditions, untreated pseudoviri-ons were mainly detected in fraction 11 of the gradient as evi-denced by the presence of L1, L2, and DNA (Fig. 9). Probably asthe result of the slightly acidic pH, some aggregated pseudoviruswas also found near the bottom of the tube. Treatment with DTT,DNase I, and GST only slightly changed the sedimentation of pseu-dovirions. DNA was no longer detectable by PCR, indicating that theDNase treatment was effective. However, incubation with a GST-CyPA fusion protein resulted in a partial release of L1 from HPV16particles; L1 was found at the top of the gradient, where capsomeresare expected to migrate under these conditions (55). All of the L2 andsome L1 protein were still present in large aggregates migrating intothe 60% sucrose cushion. A weak L1 signal was also found at the topof gradient in the GST control. This is probably due to L1-only par-ticles, which are always present at low levels in our pseudovirus prep-arations. This sedimentation profile suggests that CyPA can facilitatethe dissociation of L1 protein from partially disassembled pseudovi-rions in vitro at slightly acidic pH.

FIG 5 Colocalization of pseudogenome with capsid proteins. (A) EdU-labeled wt pseudoparticles were bound to ECM-coated coverslips and stained for DNA(red) and capsid proteins (green) using 33L1-7 and 33L2-1 for L1 and L2, respectively. Scale bar, 10 �m. (B to E) HaCaT cells were infected with EdU-labeled wtpseudovirus in the absence (B and D) or presence of bafilomycin A1 (C and E). Cells were fixed, permeabilized, and stained as above for the pseudogenome (Bto E) and L1 (B and C) or for the pseudogenome and L2 (D and E) at 18 hpi. Nuclei were stained using DAPI (in blue). Areas highlighted by rectangles aremagnified in the smaller panels shown to the right. Merged images are shown. (F) Extent of L1/DNA and L2/DNA colocalization as determined by using LAS AFsoftware.




NIV

OF

CO

LOR

AD

Ohttp://jvi.asm

.org/D

ownloaded from


DISCUSSION

We have shown that the major capsid protein L1 of HPV16 disso-ciates from the viral pseudogenome and L2 protein following un-coating in acidified endosomes. Combining capsid protein dena-turation with linear epitope-specific antibodies for detection ofcapsid proteins and EdU-labeled pseudogenomes, we were able tofollow the three components of the HPV16 particles during infec-tious entry. Our quantitative analyses for measuring the level ofcolocalization yielded significant results despite the complexities

and deficiencies of the assay system, including the asynchronousinternalization of HPV16 pseudovirions and the different limits ofdetection for L1 and L2 protein, e.g., due to differences in copynumbers. We partially accounted for the different sensitivities bycalibrating our system using ECM-bound viral particles and in-hibitors of uncoating, which yielded the maximally achievablelevel of colocalization. Asynchronous internalization was evi-denced by the observation that approximately 60% of all EdU-positive puncta were still positive for L1 at 18 hpi. We did not

FIG 6 CsA interferes with dissociation of L1 from the L2/DNA complex during infectious entry of 16L2-GP-N mutant pseudovirus. (A to D) HaCaT cells werefixed, permeabilized, and sequentially stained for DNA (red) and L1 (green) (A and B) or DNA and L2 (green) (C and D) using a Click-iT reaction cocktail andMAbs 33L1-7 or 33L2-1 at 18 hpi with EdU-labeled 16L2-GP-N mutant pseudovirus in the absence (A and C) or presence (B and D) of CsA. Areas highlightedby rectangles are magnified in the smaller panels shown to the right. (E) L1/DNA and L2/DNA colocalizations were manually quantified as outlined in Materialsand Methods. P values were determined by a Student’s t test.

FIG 7 CsA interferes with dissociation of L1 from the L2/DNA complex during infectious entry of wt pseudovirus. (A to D) HaCaT cells were fixed, permeab-ilized, and sequentially stained for DNA (red) and L1 (green) (A and B) or L2 (green) (C and D) using a Click-iT reaction cocktail and MAb 33L1-7 or 33L2-1at 18 hpi with EdU-labeled wt pseudovirus in the absence (A and C) or presence (B and D) of CsA. Areas highlighted by rectangles are magnified in the smallerpanels shown to the right. (E) L1/DNA and L2/DNA colocalizations were manually quantified as outlined in Materials and Methods. P values were determinedby a Student’s t test.




NIV

OF

CO

LOR

AD

Ohttp://jvi.asm

.org/D

ownloaded from


attempt to synchronize HPV16 entry to increase the impact ofCsA treatment and CyP knockdown because this condition re-quires the use of additional drugs or antibodies that might haveinterfered with the analysis. The continued colocalization of L2and viral pseudogenomes during infectious internalization servedas an internal control for our treatments and measurements.

We utilized the 16L2-GP-N mutant pseudovirus that has beenshown to bypass the requirement for cell surface CyPB (3) in orderto investigate the role of CyPs in dissociating the L1 protein fromthe pseudoviral genome. The CyP inhibitor CsA and knockdownof CyPA and CyPB significantly increased colocalization of L1 andDNA without altering the L2/DNA colocalization, supporting the

FIG 8 Cyclophilin knockdown interferes with dissociation of L1 from the pseudogenome. (A) HaCaT cells were transfected with CyP (broad) siRNA. At 48 hposttransfection, cells were infected with EdU-labeled 16L2-GP-N mutant pseudovirus for 18 h. Cells were sequentially stained for EdU-labeled DNA (red), L1(green), and CyPB (blue) as described in Materials and Methods. DAPI-stained nuclei are depicted in gray. (B) L1/DNA colocalization was quantified inCyPB-positive and -negative cells. (C) Representative graphs of signal intensity in a single punctum in CyPB-positive and -negative cells. Note the increased CyPBsignal in EdU-positive puncta. P values were determined by a Student’s t test.




NIV

OF

CO

LOR

AD

Ohttp://jvi.asm

.org/D

ownloaded from


view that these host cell chaperones facilitate the release of L1 fromthe L2/DNA complex. Treatment with CsA yielded higher levels ofL1/DNA colocalization than siRNA-mediated knockdown. Theincreased level of colocalization may partially be explained by theoff-target effects of CsA that impair the degradation of L1 protein,thus increasing detection of L1 protein by IF, which is not seenafter CyP knockdown. This may result in an underestimation ofthe levels of colocalization after knockdown. Furthermore, CyPfamily members that are not targeted by the siRNA may substitutefor CyPA and CyPB.

The ability of purified CyPs to catalyze the release of L1 fromthe GST-L2 fusion protein and also from partially disassembledHPV16 pseudovirions in vitro provides additional support for arole of CyPs in the uncoating process of HPV16. We utilizedHPV11 capsid proteins expressed in E. coli to investigate the effectof purified CyPA and CyPB on the integrity of L1/L2 complexes.Since HPV6 pseudoinfection is sensitive to CyP inhibitors (3) andsince the CyP binding sites are conserved in HPV6, HPV11, andHPV16, the use of an alternative HPV type was thought to bevalid, as well as extending the mechanism beyond HPV16. TheCyP-mediated dissociation was equally efficient in the presence ofeither CyPA or CyPB, presumably because in vitro the specificity islost. We also showed that CyPA induces the release of L1 capsom-eres from HPV16 pseudovirions treated with reducing agents andDNase I prior to addition of CyPA. This reaction was less efficientthan the release of L1 capsomeres from GST-L2 fusion proteins.Based on reports for other viruses, e.g., simian virus 40 (SV40) (23,25), we must assume, however, that many factors are involved inuncoating and that our partial in vitro disassembly does not fullymimic the processes occurring in vivo. The dissociation of capsidproteins in vitro required slightly acidic pH, indicating that disso-ciation may also occur after acidification of endosomes in vivo.However, this possibility cannot be tested directly since the ma-nipulation of endosomal acidification (e.g., by treatment with

BafA1, chloroquine, or NH4Cl) itself interferes with the initialuncoating. Uncoating is likely a prerequisite allowing access ofCyPs to the otherwise hidden internal carboxy terminus of L2.

The L2 protein of bovine papillomavirus type 1 (BPV-1) wasshown to escape endosomes together with the viral genome priorto their accumulation at PML-NB (14, 33). However, the fate ofthe L1 protein was not studied due to a lack of suitable reagents.Our data indicate that the L1 protein of HPV16 dissociates fromthe L2/DNA complex prior to its egress from endosomes and isretained in the endocytic compartment, where it appears targetedfor degradation. L1 degradation is suggested by the loss of the L1signal in untreated cells compared to results in CsA- or BafA1-treated cells. The continued colocalization of viral pseudog-enomes with the endosomal marker EEA-1 also suggests thatdissociation of capsid proteins is associated with sorting into dif-ferent vesicular compartments prior to endosomal egress ratherthan occurring during egress of the L2/DNA from endocytic ves-icles. The driving force for sorting is unknown at present. How-ever, the L1 and L2 proteins may interact with different uptakereceptors, thus determining the subsequent intracellular traffick-ing of L1- and L2-containing vesicles. Evidence for L1 and L2interactions with secondary non-HSPG uptake receptors has beenreported (31, 69). Sorting nexin 17, a host cell factor involved invesicular trafficking (11) and an interaction partner of HPV16 L2(2), may also be involved in the sorting of L2/DNA- and L1 pro-tein-containing vesicles.

In addition to HPV, many viruses, e.g., lentiviruses and hepa-titis C virus (HCV), depend on cyclophilin function for comple-tion of their life cycle. The interaction of CyPA and CyPB withnonstructural (NS) HCV proteins NS5A, NS5B, and NS2 is re-quired for efficient RNA replication (21, 65, 67). However, CyPsare also important for establishing infection of other viruses bycontributing to efficient entry into host cells. CyPA facilitates theentry of mouse cytomegalovirus into neural progenitor/stem cellsby unknown mechanisms (35). Both CyPA and Pin1, the latterspecific for proline residues that are preceded by a phosphorylatedserine/threonine residue, have been implicated in the uncoating ofthe HIV capsid following infectious entry (41, 45). In addition,Pin1 has been shown to facilitate HIV capsid disassembly in vitro(45). However, the CyP-mediated dissociation of viral capsid pro-teins has not been observed as yet. We have not identified thespecific CyP family member involved in HPV entry due in part tothe lack of suitable reagents for immunofluorescent detection ofCyPA. Also, CyPA and CyPB are both found on the cell surface (7,64). Therefore, they may be coendocytosed with viral particle/receptor complexes and contribute to capsid protein dissociation.This scenario is supported by the finding that knockdown of bothCyPs impairs infection to a much greater extent than individualknockdown of either CyPA or CyPB (3).

Nonenveloped viruses must shed their protein shells duringinfectious entry. Adenoviruses undergo a number of conforma-tional changes that result in shedding of minor capsid compo-nents, like fiber, and exposure of membrane-penetrating proteindomains, like pVI (26, 46, 68). However, the major capsid proteinsreach the cytosol together with the viral genome. Complete disas-sembly occurs at nuclear pores, where the viral genome is injectedinto the nucleus and the capsid remains in the cytosol (38). Sim-ilarly, the small DNA tumor viruses SV40 and mouse polyomavi-rus escape the endoplasmic reticulum and reach the cytosol asconformationally modified but largely intact virions (29, 43). Our

FIG 9 Partial dissociation of HPV16 L1 capsomeres from pseudovirions invitro by CyPA. (A) HPV16 pseudovirus was treated with DNase I and DTT orleft untreated. After adjustment to pH 6.0, samples were incubated with GSTor CyPA and analyzed by sedimentation through sucrose gradients. Gradientswere fractionated from the top, and fractions were assayed for the presence ofL1 and L2 by Western blotting following concentration of proteins by trichlo-roacetic acid precipitation. (B) GFP-specific DNA fragments were amplifiedby PCR from the indicated fractions and analyzed by agarose gel electropho-resis.




NIV

OF

CO

LOR

AD

Ohttp://jvi.asm

.org/D

ownloaded from


data suggest that HPV16, to gain access to the nucleus, has devel-oped unique strategies that involve complete shedding of the ma-jor capsid protein in the endocytic compartment prior to egressfrom endosomes in addition to a slow half-time of internalization(60), the use of a novel endocytic pathway (56), the dependence onproteolytic cleavage of capsid proteins (49), and the requirementfor nuclear envelope breakdown for establishing infection (48).

ACKNOWLEDGMENTS

We are grateful to Jia Pang for excellent technical assistance, members ofthe Sapp lab for helpful discussions, and N.D. Christensen, M. Müller,R. B. Roden, and J. T. Schiller for providing reagents.

The project described was supported by R01AI081809 from the Na-tional Institute of Allergy and Infectious Diseases to M.S. and byR01CA37667 from the National Cancer Institute to R.L.G. This projectwas also supported in part by grants from the National Center for Re-search Resources (5P20RR018724-10) and the National Institute of Gen-eral Medical Sciences (8 P20 GM103433-10) from the National Institutesof Health.

The content is solely the responsibility of the authors and does notnecessarily represent the official views of the National Institutes of Health.

REFERENCES1. Baker TS, et al. 1991. Structures of bovine and human papillomaviruses.

Analysis by cryoelectron microscopy and three-dimensional image recon-struction. Biophys. J. 60:1445–1456.

2. Bergant Marusic M, Ozbun MA, Campos SK, Myers MP, Banks L. 2012.Human papillomavirus L2 facilitates viral escape from late endosomes viasorting nexin 17. Traffic 13:455– 467.

3. Bienkowska-Haba M, Patel HD, Sapp M. 2009. Target cell cyclophilinsfacilitate human papillomavirus type 16 infection. PLoS Pathog.5:e1000524. doi:10.1371/journal.ppat.1000524.

4. Buck CB, et al. 2008. Arrangement of L2 within the papillomaviruscapsid. J. Virol. 82:5190 –5197.

5. Buck CB, Pastrana DV, Lowy DR, Schiller JT. 2004. Efficient intracel-lular assembly of papillomaviral vectors. J. Virol. 78:751–757.

6. Campos SK, Chapman JA, Deymier MJ, Bronnimann MP, Ozbun MA.2012. Opposing effects of bacitracin on human papillomavirus type 16infection: enhancement of binding and entry and inhibition of endosomalpenetration. J. Virol. 86:4169 – 4181.

7. Carpentier M, et al. 1999. Two distinct regions of cyclophilin B areinvolved in the recognition of a functional receptor and of glycosamino-glycans on T lymphocytes. J. Biol. Chem. 274:10990 –10998.

8. Chen XS, Garcea RL, Goldberg I, Casini G, Harrison SC. 2000. Struc-ture of small virus-like particles assembled from the L1 protein of humanpapillomavirus 16. Mol. Cell 5:557–567.

9. Chen XS, Stehle T, Harrison SC. 1998. Interaction of polyomavirusinternal protein VP2 with the major capsid protein VP1 and implicationsfor participation of VP2 in viral entry. EMBO J. 17:3233–3240.

10. Christensen ND, Cladel NM, Reed CA. 1995. Postattachment neutral-ization of papillomaviruses by monoclonal and polyclonal antibodies. Vi-rology 207:136 –142.

11. Cullen PJ, Korswagen HC. 2012. Sorting nexins provide diversity forretromer-dependent trafficking events. Nat. Cell Biol. 14:29 –37.

12. Culp TD, Budgeon LR, Christensen ND. 2006. Human papillomavirusesbind a basal extracellular matrix component secreted by keratinocyteswhich is distinct from a membrane-associated receptor. Virology 347:147–159.

13. Dasgupta J, et al. 2011. Structural basis of oligosaccharide receptor rec-ognition by human papillomavirus. J. Biol. Chem. 286:2617–2624.

14. Day PM, Baker CC, Lowy DR, Schiller JT. 2004. Establishment ofpapillomavirus infection is enhanced by promyelocytic leukemia protein(PML) expression. Proc. Natl. Acad. Sci. U. S. A. 101:14252–14257.

15. Day PM, Gambhira R, Roden RB, Lowy DR, Schiller JT. 2008. Mech-anisms of human papillomavirus type 16 neutralization by L2 cross-neutralizing and L1 type-specific antibodies. J. Virol. 82:4638 – 4646.

16. Day PM, Lowy DR, Schiller JT. 2003. Papillomaviruses infect cells via aclathrin-dependent pathway. Virology 307:1–11.

17. Finnen RL, Erickson KD, Chen XS, Garcea RL. 2003. Interactions

between papillomavirus L1 and L2 capsid proteins. J. Virol. 77:4818 –4826.

18. Fischer G, Wittmann-Liebold B, Lang K, Kiefhaber T, Schmid FX. 1989.Cyclophilin and peptidyl-prolyl cis-trans isomerase are probably identicalproteins. Nature 337:476 – 478.

19. Florin L, et al. 2006. Identification of a dynein interacting domain in thepapillomavirus minor capsid protein L2. J. Virol. 80:6691– 6696.

20. Florin L, et al. 2004. Nuclear translocation of papillomavirus minorcapsid protein L2 requires Hsc70. J. Virol. 78:5546 –5553.

21. Foster TL, Gallay P, Stonehouse NJ, Harris M. 2011. Cyclophilin Ainteracts with domain II of hepatitis C virus NS5A and stimulates RNAbinding in an isomerase-dependent manner. J. Virol. 85:7460 –7464.

22. Gambhira R, et al. 2007. A Protective and broadly cross-neutralizingepitope of human papillomavirus L2. J. Virol. 81:13927–13931.

23. Geiger R, et al. 2011. BAP31 and BiP are essential for dislocation of SV40from the endoplasmic reticulum to the cytosol. Nat. Cell Biol. 13:1305–1314.

24. Giroglou T, Florin L, Schäfer F, Streeck RE, Sapp M. 2001. Humanpapillomavirus infection requires cell surface heparan sulfate. J. Virol.75:1565–1570.

25. Goodwin EC, et al. 2011. BiP and multiple DNAJ molecular chaperonesin the endoplasmic reticulum are required for efficient simian virus 40infection. mBio. 2:e00101–11.

26. Greber UF, Willetts M, Webster P, Helenius A. 1993. Stepwise disman-tling of adenovirus 2 during entry into cells. Cell 75:477– 486.

27. Harding MW, Handschumacher RE, Speicher DW. 1986. Isolation andamino acid sequence of cyclophilin. J. Biol. Chem. 261:8547– 8555.

28. Huotari J, Helenius A. 2011. Endosome maturation. EMBO J. 30:3481–3500.

29. Inoue T, Tsai B. 2011. A large and intact viral particle penetrates theendoplasmic reticulum membrane to reach the cytosol. PLoS Pathog.7:e1002037. doi:10.1371/journal.ppat.1002037.

30. Ishii Y, et al. 2010. Inhibition of nuclear entry of HPV16 pseudovirus-packaged DNA by an anti-HPV16 L2 neutralizing antibody. Virology 406:181–188.

31. Johnson KM, et al. 2009. Role of heparan sulfate in attachment to andinfection of the murine female genital tract by human papillomavirus. J.Virol. 83:2067–2074.

32. Joyce JG, et al. 1999. The L1 major capsid protein of human papilloma-virus type 11 recombinant virus-like particles interacts with heparin andcell-surface glycosaminoglycans on human keratinocytes. J. Biol. Chem.274:5810 –5822.

33. Kämper N, et al. 2006. A membrane-destabilizing peptide in capsid pro-tein L2 is required for egress of papillomavirus genomes from endosomes.J. Virol. 80:759 –768.

34. Karanam B, et al. 2010. Papillomavirus infection requires gamma secre-tase. J. Virol. 84:10661–10670.

35. Kawasaki H, Mocarski ES, Kosugi I, Tsutsui Y. 2007. Cyclosporineinhibits mouse cytomegalovirus infection via a cyclophilin-dependentpathway specifically in neural stem/progenitor cells. J. Virol. 81:9013–9023.

36. Knappe M, et al. 2007. Surface-exposed amino acid residues of HPV16 L1protein mediating interaction with cell surface heparan sulfate. J. Biol.Chem. 282:27913–27922.

37. Leder C, Kleinschmidt JA, Wiethe C, Müller M. 2001. Enhancement ofcapsid gene expression: preparing the human papillomavirus type 16 ma-jor structural gene L1 for DNA vaccination purposes. J. Virol. 75:9201–9209.

38. Leopold PL, Crystal RG. 2007. Intracellular trafficking of adenovirus:many means to many ends. Adv. Drug Deliv Rev. 59:810 – 821.

39. Li M, Beard P, Estes PA, Lyon MK, Garcea RL. 1998. Intercapsomericdisulfide bonds in papillomavirus assembly and disassembly. J. Virol. 72:2160 –2167.

40. Liu WJ, et al. 1997. Sequence close to the N terminus of L2 protein isdisplayed on the surface of bovine papillomavirus type 1 virions. Virology227:474 – 483.

41. Luban J. 2007. Cyclophilin A, TRIM5, and resistance to human immu-nodeficiency virus type 1 infection. J. Virol. 81:1054 –1061.

42. Luban J, Bossolt KL, Franke EK, Kalpana GV, Goff SP. 1993. Humanimmunodeficiency virus type 1 Gag protein binds to cyclophilins A and B.Cell 73:1067–1078.

43. Magnuson B, et al. 2005. ERp29 triggers a conformational change inpolyomavirus to stimulate membrane binding. Mol. Cell 20:289 –300.




NIV

OF

CO

LOR

AD

Ohttp://jvi.asm

.org/D

ownloaded from


44. Mercer J, Schelhaas M, Helenius A. 2010. Virus entry by endocytosis.Annu. Rev. Biochem. 79:803– 833.

45. Misumi S, et al. 2010. Uncoating of human immunodeficiency virus type1 requires prolyl isomerase Pin1. J. Biol. Chem. 285:25185–25195.

46. Nakano MY, Boucke K, Suomalainen M, Stidwill RP, Greber UF. 2000.The first step of adenovirus type 2 disassembly occurs at the cell surface,independently of endocytosis and escape to the cytosol. J. Virol. 74:7085–7095.

47. Okun MM, et al. 2001. L1 interaction domains of papillomavirus L2necessary for viral genome encapsidation. J. Virol. 75:4332– 4342.

48. Pyeon D, Pearce SM, Lank SM, Ahlquist P, Lambert PF. 2009. Estab-lishment of human papillomavirus infection requires cell cycle progres-sion. PLoS Pathog. 5:e1000318. doi:10.1371/journal.ppat.1000318.

49. Richards RM, Lowy DR, Schiller JT, Day PM. 2006. Cleavage of thepapillomavirus minor capsid protein, L2, at a furin consensus site is nec-essary for infection. Proc. Natl. Acad. Sci. U. S. A. 103:1522–1527.

50. Roden RB, et al. 2000. Minor capsid protein of human genital papillo-maviruses contains subdominant, cross-neutralizing epitopes. Virology270:254 –257.

51. Rommel O, et al. 2005. Heparan sulfate proteoglycans interact exclusivelywith conformationally intact HPV L1 assemblies: basis for a virus-likeparticle ELISA. J. Med. Virol. 75:114 –121.

52. Sapp M, Bienkowska-Haba M. 2009. Viral entry mechanisms: humanpapillomavirus and a long journey from extracellular matrix to the nu-cleus. FEBS J. 276:7206 –7216.

53. Sapp M, Fligge C, Petzak I, Harris JR, Streeck RE. 1998. Papillomavirusassembly requires trimerization of the major capsid protein by disulfidesbetween two highly conserved cysteines. J. Virol. 72:6186 – 6189.

54. Sapp M, et al. 1994. Analysis of type-restricted and cross-reactive epitopeson virus-like particles of human papillomavirus type 33 and in infectedtissues using monoclonal antibodies to the major capsid protein. J. Gen.Virol. 75:3375–3383.

55. Sapp M, Volpers C, Müller M, Streeck RE. 1995. Organization of themajor and minor capsid proteins in human papillomavirus type 33 virus-like particles. J. Gen. Virol. 76:2407–2412.

56. Schelhaas M. 2010. Come in and take your coat off— how host cellsprovide endocytosis for virus entry. Cell Microbiol. 12:1378 –1388.

57. Schelhaas M, et al. 2012. Entry of human papillomavirus type 16 by

actin-dependent, clathrin- and lipid raft-independent endocytosis. PLoSPathog. 8:e1002657. doi:10.1371/journal.ppat.1002657.

58. Schneider MA, Spoden GA, Florin L, Lambert C. 2011. Identification ofthe dynein light chains required for human papillomavirus infection. CellMicrobiol. 13:32– 46.

59. Selinka HC, et al. 2007. Inhibition of transfer to secondary receptors byheparan sulfate-binding drug or antibody induces non-infectious uptakeof human papillomavirus. J. Virol. 81:10970 –10980.

60. Selinka HC, Giroglou T, Nowak T, Christensen ND, Sapp M. 2003.Further evidence that papillomavirus particles exist in two distinct con-formations. J. Virol. 77:12961–12967.

61. Selinka HC, Giroglou T, Sapp M. 2002. Analysis of the infectious entrypathway of human papillomavirus type 33 pseudovirions. Virology 299:279 –287.

62. Smith JL, Campos SK, Wandinger-Ness A, Ozbun MA. 2008. Caveo-lin-1 dependent infectious entry of human papillomavirus type 31 in hu-man keratinocytes proceeds to the endosomal pathway for pH-dependentuncoating. J. Virol. 82:9505–9512.

63. Spoden G, et al. 2008. Clathrin- and caveolin-independent entry of humanpapillomavirus type 16—involvement of tetraspanin-enriched microdo-mains (TEMs). PLoS One 3:e3313. doi:10.1371/journal.pone.0003313.

64. Suzuki J, Jin ZG, Meoli DF, Matoba T, Berk BC. 2006. Cyclophilin A issecreted by a vesicular pathway in vascular smooth muscle cells. Circ. Res.98:811– 817.

65. Verdegem D, et al. 2011. Domain 3 of NS5A protein from the hepatitis Cvirus has intrinsic -helical propensity and is a substrate of cyclophilin A.J. Biol. Chem. 286:20441–20454.

66. Volpers C, Sapp M, Snijders PJ, Walboomers JM, Streeck RE. 1995.Conformational and linear epitopes on virus-like particles of human pap-illomavirus type 33 identified by monoclonal antibodies to the minorcapsid protein L2. J. Gen. Virol. 76:2661–2667.

67. Watashi K, et al. 2005. Cyclophilin B is a functional regulator of hepatitisC virus RNA polymerase. Mol. Cell 19:111–122.

68. Wiethoff CM, Wodrich H, Gerace L, Nemerow GR. 2005. Adenovirusprotein VI mediates membrane disruption following capsid disassembly.J. Virol. 79:1992–2000.

69. Yang R, et al. 2003. Cell surface-binding motifs of L2 that facilitatepapillomavirus infection. J. Virol. 77:3531–3541.




NIV

OF

CO

LOR

AD

Ohttp://jvi.asm

.org/D

ownloaded from


Cyclophilins Facilitate Dissociation of the Human Papillomavirus Type 16 Capsid Protein L1 from the L2/DNA Complex following Virus EntryMATERIALS AND METHODSCell lines.Antibodies.Plasmids and pseudovirions (PsV).Inhibitors and reagents.Infection assay.Enzyme linked immunosorbent assay (ELISA).Infection in the presence of drugs and immunofluorescence.Infection and immunofluorescence assay after siRNA knockdown of CyP.Expression and purification of GST fusion proteins.L1 release assay.Disassembly of pseudovirions and sucrose gradient sedimentation.

RESULTSBinding, internalization, and uncoating of HPV16 L2-GP-N pseudovirus.Dissociation of L1 and L2 in vitro.HPV16 capsid protein dissociation during pseudovirus internalization.CyP inhibition and knockdown block dissociation of L1 from the L2/genome complex in vivo.CyP facilitates partial release of L1 from HPV16 pseudovirus in vitro.

DISCUSSIONACKNOWLEDGMENTSREFERENCES

cyclophilins facilitate dissociation of the human papillomavirus...

Documents