cre-lox technology and breeding schemes for research · pdf filecre-lox technology and...
TRANSCRIPT
![Page 1: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/1.jpg)
Cre - lox Technology and Breeding Schemes for Research
Emily L. Jocoy, PhDTechnical Information Scientist
GeneX
GeneX
(promoter) Cre
loxPGeneXloxP
loxPGeneXloxP
X
![Page 2: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/2.jpg)
Leading provider of genetically defined mice and services including
pre-clinical research
World renowned non-profit genetics research institute and international
training center
Bar Harbor, Maine
Sacramento, California
The Jackson Laboratory
![Page 3: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/3.jpg)
The Jackson Laboratory
Research: investigating genetics and biology of human disease
Resources: JAX® Mice & Services, bioinformatics data, technical
publications and more…
Education: world-class courses, internships and other programs
www.courses.jax.orghttp://jaxmice.jax.org/webinar/index.html
![Page 4: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/4.jpg)
• NIH funded resource • 5,000 strains and growing
– 2.7 million mice shipped annually– 16,000 investigators globally
• Unsurpassed genetic quality & animal health• Best characterized & referenced ~100 new pubs/week• Common inbred strains (C57BL/6J, BALB/cJ, DBA/2J) support
development/collection of specialty strains and other valuable community research resources
JAX® MiceThe Gold Standard for Biomedical Research
![Page 5: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/5.jpg)
Online Resources
• JAX® Mice Databasewww.jax.org/jaxmice
• Technical Support Onlinewww.jaxmice.jax.org/support
• Mouse Genome Informaticswww.informatics.jax.org
• Mouse Phenome Database www.jax.org/phenome
• And many more unique resources
![Page 6: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/6.jpg)
C57BL/6J – Most Characterized
http://phenome.jax.org/pub-cgi/phenome/mpdcgi?rtn=strains/details&stocknum=000664
![Page 7: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/7.jpg)
Baseline Blood Pressure
Strain Surveys
![Page 8: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/8.jpg)
JAX® Services
• Breeding & colony management• Revolutionary cryopreservation & recovery• Phenotyping & efficacy testing• Genetic research services• Surgical & preconditioning services• Use of innovative technologies and state-of-the-art equipment• Flexibility to develop customized approaches
JAX® Mice & Services
[email protected] • 1-800-422-6423 • 1-207-288-5845 • www.jax.org/jaxmice
![Page 9: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/9.jpg)
Presentation Overview
• Basic Cre-lox mechanism
• Strain types and breeding schemes – Tissue-specific knockouts– General knockouts– Inducible knockouts– Reporters
• Cre-lox web resources (finding mice, Cre activity data, and more)
![Page 10: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/10.jpg)
A Revolutionary Genetic Tool
Cre-lox system• Natural part of P1 bacteriophage
viral life cycle• Viral DNA injected into bacteria,
circularized using Cre-lox, and replicated for development of new viruses
Cre
Bacteriophage
![Page 11: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/11.jpg)
Cre-lox Successfully Engineered in Other Organisms
• Yeast• Plants• Mammalian cell cultures• Mice
Allows• Alteration & deletion of DNA• Regulation of location and
timing of gene recombination
![Page 12: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/12.jpg)
A Simple, Two Component System
Cre recombinase• Site-specific enzyme, catalyzes recombination
between two loxP sites
loxP site• 34 base pair DNA sequence• Location and orientation determines recombination result:
– Deletion– Inversion– Translocation
Reviewed in Nagy A. 2000. Genesis 26(2):99-109. PMID: 10686599
ATAACTTCGTATAGCATACATTATACGAAGTTAT
Cre
Abundant possibilities for genome manipulation!
![Page 13: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/13.jpg)
Cre - lox DeletionFloxed target gene
Knockout allele
X
GeneX loxP
GeneX
loxP loxPGeneX
loxP
Cre excision
![Page 14: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/14.jpg)
Cre
loxP loxPGeneX
loxP loxP
GeneX
Cre - lox Inversion
![Page 15: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/15.jpg)
Cre
Chr 3
Chr 6 loxP
loxP
Reciprocal Translocation (3;6) loxP
loxP
Cre - lox Translocation
![Page 16: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/16.jpg)
xAlb cre
GeneX
GeneX
loxPGeneXloxP
GeneXloxP loxP
Liver-specific cre transgeneEx: B6.Cg-Tg(Alb-Cre)21Mgn/J
(Stock No. 003574)
homozygous loxP (“floxed”) mouse
Cre - lox Tissue-Specific Knockout
![Page 17: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/17.jpg)
xAlb cre
GeneX
GeneX
loxPGeneXloxP
GeneXloxP loxP
Liver-specific cre transgeneEx: B6.Cg-Tg(Alb-Cre)21Mgn/J
(Stock No. 003574)
homozygous “floxed” mouse
Cre - lox Tissue-Specific Knockout
loxPGeneXloxP
Alb cre
GeneX
Cre-lox mouse: heterozygous for geneX conditional knockout after 1 generation
![Page 18: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/18.jpg)
x
GeneX
Alb cre
loxPGeneXloxP
GeneXloxP loxP
homozygous “floxed” mouse
GeneX
loxP loxP
loxPloxP
Cre - lox Tissue-Specific Knockout (cont.)
25% homozygous for geneX conditional knockout after 2 generations
Alb cre
GeneX
loxPGeneXloxP
hemizygous creheterozygous “floxed” gene
![Page 19: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/19.jpg)
Improving Conditional Knockout Efficiency
xAlb cre
GeneX
loxPGeneXloxP
loxPGeneXloxP
Alb cre
hemizygous creheterozygous “floxed” gene
12.5% conditional GeneX knockouts
heterozygous null mouse(traditional knockout)
GeneX
![Page 20: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/20.jpg)
Improving Conditional Knockout Efficiency
x
loxPGeneXloxP
Alb cre
loxPGeneXloxP
GeneXloxP loxP
homozygous “floxed” mouse
25% conditional GeneX knockouts
(cont.)
hemizygous creheterozygous null mouse
GeneX
Alb cre
![Page 21: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/21.jpg)
Cre-lox Germline Knockouts
xhomozygous
“floxed” mouse
GeneX
loxPGeneXloxP
oocyte-specific cre expression Ex: C57BL/6-Tg(Zp3-cre)93Knw/J
(Stock No. 003651)
ZP3 cre
OvaryZP3 cre
Oocytes
2 more generations to produce homozygote null mouse
![Page 22: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/22.jpg)
Cre - lox Knockout Breeding Scheme
xhomozygous loxP mouse Cre mouse – cre transgene (Tg)
early, widespread expression promoterFVB/N-Tg(EIIa-Cre)C5379Lmgd/J
(Stock No. 003314)
EIIa Cre
Offspring: 50% heterozygous knockout after 1 generation
loxPGeneXloxP
loxPGeneXloxP
GeneX
GeneX
GeneX
![Page 23: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/23.jpg)
Cre - lox Knockout Breeding Scheme
Offspring 2nd generation: 25% homozygous knockout
GeneX GeneX
X
![Page 24: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/24.jpg)
Cre-lox SummaryTissue-specific deletion• 2 generations of breeding• Cre required to maintain line
for future generations• Genotype of whole mouse:
homozygous flox; Cre• Tissue-specific genotype:
homozygous flox-deleted; Cre
loxPGeneXloxP
loxPGeneXloxP
Alb Cre
Germline/Embryonic deletion• 2-3 generations of breeding• Cre not required after germline
deletion (can breed it out)• Genotype of whole mouse,
germplasm, organs & tissues: homozygous flox-deleted (knockout) for gene of interest
![Page 25: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/25.jpg)
Inducible Cre Mouse Models
xhomozygous loxP mouse Inducible Cre mouse –
tamoxifen dependent Cre functionEx: B6.Cg-Tg(Cre/Esr1)5Amc/J
(Stock No. 004682)
Induce homozygous knockout of GeneX with tamoxifen
+ Tamoxifen
2 Generations
loxPGeneXloxP
loxPGeneXloxP
![Page 26: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/26.jpg)
Cre Considerations
• Mosaicism: some target cells may not express Cre, or loxP sites may not recombine– May be integration site specific; evaluate multiple
cre transgenic founders• loxP site recombination efficiency affected by position• Cre could be active in ectopic locations (including
germline)• Cre may produce a phenotype by itself
– Insertion site effects– “Cre toxicity”
Consider using the Cre transgenic line itself as a control
Cre mosaicism in mouse mammary
gland epithelial cells
Schmidt-Supprian M and Rajewsky K. 2007. Nat Immunol 8(7):665-8. PMID: 17579640
![Page 27: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/27.jpg)
Cre Considerations (cont.)
• Target gene may be expressed prior to Cre recombination• If possible, have cre transgene on a different chromosome
than the floxed allele• Often good idea to breed out cre transgene after germline
deletion• Consider that genetic background may affect phenotype
![Page 28: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/28.jpg)
Cre Reporter Strains
Blue(LacZ)
Green (GFP or ZsGreen)
Yellow(YFP)
Red(RFP or tdTomato)
Cyan(CFP)
![Page 29: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/29.jpg)
Cre Reporter Strains• Used to assess Cre activity in tissue(s) of interest• Only one generation of breeding needed• Ex: B6.129S4Gt(ROSA)26Sortm1Sor/J (Stock No. 003474)
Promotor loxP loxP lacZ
X
Promotor loxP lacZ
STOP
![Page 30: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/30.jpg)
Cre Reporter DataB6.129S4-Gt(ROSA)26Sortm1Sor/J (Stock No. 003474)
ControlLacZ expression following widespread Cre recombination
Soriano P. 1999. Nat Genet 21(1):70-1.
![Page 31: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/31.jpg)
Cre Reporter Breeding SchemeB6.129S4-Gt(ROSA)26Sortm1Sor/J (003474)
xB6.129S4-Gt(ROSA)26Sortm1Sor/J
Cre reporter strainEx: heart-specific cre transgenic
**Could be any Cre recombinase strain
Cre
LacZ stain confirms Cre activity in expected tissues
loxPloxP LacZ
loxPloxP LacZ
Myh6
1 Generation
loxP LacZ
CreMyh6
![Page 32: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/32.jpg)
Other Cre Reporter VariationsReporter switching
STOCK Tg(ACTB-Bgeo/GFP)21Lbe/J (Stock No. 003920)
Promotor loxP loxP GFPlacZ
Promotor loxP GFP
STOP
![Page 33: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/33.jpg)
Cre - lox Disease ModelB6.129S4-Krastm4Tyj/J (Stock No. 008179)
Promoter loxP loxP Kras G12D oncogeneSTOP
X
Promoter loxP Kras G12D oncogene
Tuveson DA et al. 2004. Cancer Cell 5(4):375-87. PMID: 15093544
![Page 34: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/34.jpg)
xMMTV Cre
Only one round of breeding needed
loxP STOP Kras G12D
STOCK Tg(MMTV-cre)4Mam/J(Stock No. 003553)
Cre - lox Disease ModelsB6.129S4-Krastm4Tyj/J (Stock No. 008179)
loxP
loxP Kras G12D
Tuveson DA et al. 2004. Cancer Cell 5(4):375-87. PMID: 15093544
![Page 35: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/35.jpg)
Other Cre - lox VariationsConditional Transgene with Reporter
Promotor loxP loxP TransgeneXLacZ
Promotor loxP TransgeneX
STOP
![Page 36: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/36.jpg)
Other Cre - lox VariationsConditional Transgene with Fusion Protein Reporter
Promotor loxP loxP TransgeneX
Promotor loxP
GFP
TransgeneX GFP
STOP
![Page 37: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/37.jpg)
Promotor loxP loxP
Promotor loxP
STOP TransgeneX GFPIRES
TransgeneX GFPIRES
Other Cre - lox VariationsConditional transgene with reporter
![Page 38: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/38.jpg)
Other Cre reporter Variations:“Brainbow” Mice
• Multiple fluorescent protein sequences
• Pairs of incompatible loxPsites
• loxP sites alternated to create mutually-exclusive recombination events
• Following cre excision, one of 3 outcomes (colors) possible in cre expressing cells/tissues
Livet J et al. 2007. Nature 450(7166):56-62. PMID: 17972876
![Page 39: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/39.jpg)
“Brainbow” Mice
• Tamoxifen-inducible CAG-Cre transgenic
• Cell autonomous expression of RFP, YFP & CFP
• Neurons & some astrocytes of the dentate gyrus in the hippocampus
Livet J et al. 2007. Nature 450(7166):56-62. PMID: 17972876
![Page 40: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/40.jpg)
“Brainbow” Mice
B6.Cg-Tg(Thy1-Brainbow1.0)HLich/J (007901)8 transgene copies & 90 color variations
B6;CBA-Tg(Thy1-Brainbow1.0)LLich/J (007910)>8 transgene copies & 166 color variations
Multiple copies & multiple integrations of the Brainbow transgene
Like pixels on a TV screen—combinations of fluorophores produce expanded color palettes
3 transgene copies & 10 color variations
Livet J et al. 2007. Nature 450(7166):56-62. PMID: 17972876
![Page 41: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/41.jpg)
Improved Fluorescent Cre Reporters
B6.Cg-Gt(ROSA)26Sortm3(CAG-EYFP)Hze/J (007903)B6.Cg-Gt(ROSA)26Sortm2(CAG-EYFP)Hze/J (007920)B6;129S6-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/J (007905)B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/J (007909)B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/J (007914)B6.Cg-Gt(ROSA)26Sortm6(CAG-ZsGreen1)Hze/J (007906)
Dr. Hongkui Zeng, Allen Institute for Brain ScienceMadisen L et al. 2010 Nat Neurosci 13(1): 133-40. PMID: 20023653
http://transgenicmouse.alleninstitute.org/
![Page 42: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/42.jpg)
Allen Institute for Brain ScienceNew cre reporters x brain-specific cre transgenics
http://transgenicmouse.alleninstitute.org/
B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/J (007909) x B6.Cg-Tg(Camk2a-cre)T29-1Stl/J (005359)
![Page 43: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/43.jpg)
Allen Institute for Brain Science
http://transgenicmouse.alleninstitute.org/
B6.Cg-Gt(ROSA)26Sortm6(CAG-ZsGreen1)Hze/J (007906) x FVB-Tg(GFAP-cre)25Mes/J (004600)
![Page 44: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/44.jpg)
JAX Cre Repository
Largest collection of Cre – lox strains • 250+ cre-expressing • 80+ inducible Cre strains• 310+ floxed genes• 60+ floxed Stop Cre reporters• Importing over 200 new neuronal specific Cre strains
http://cre.jax.org/NeuroCres.html
http://cre.jax.org
![Page 45: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/45.jpg)
http://cre.jax.org
JAX Cre Repository
![Page 46: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/46.jpg)
Search by keyword within
browser
![Page 47: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/47.jpg)
http://cre.jax.org/data
Cre Expression Data
![Page 48: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/48.jpg)
Cre Portal @ MGI
www.creportal.org
![Page 49: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/49.jpg)
Cre Portal Search ResultsLink to Phenotypic Data, Images, & References
![Page 50: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/50.jpg)
Tg(ACTA1-cre)79Jme Strain Details
![Page 51: Cre-lox technology and breeding schemes for research · PDF fileCre-lox Technology and Breeding Schemes for Research Emily L. Jocoy, PhD Technical Information Scientist. GeneX. GeneX](https://reader030.vdocuments.mx/reader030/viewer/2022013014/5a9e49ed7f8b9a75458d10de/html5/thumbnails/51.jpg)
Thank you!
Would you like to create multiple tissue-specific knockouts but lack the vivarium space to do more than one cross at a time? We can help. Contact us today.
JAX® Mice & Services
[email protected] • 1-800-422-6423 • 1-207-288-5845 • www.jax.org/jaxmice