control of cardiac-specific transcription by p300 through myocyte

Control of Cardiac-Specific Transcription by p300

Through Myocyte Enhancer Factor-2D

Tatiana I. Slepak§, Keith A. Webster§, Jie Zang§, Howard Prentice¶, Ann O’Dowd¶, Martin N.

Hicks†, and Nanette H. Bishopric§*.

§Department of Molecular and Cellular Pharmacology, University of Miami, Miami, FL, USA;

Departments of ¶Molecular Genetics and †Medical Cardiology, Glasgow Royal Infirmary,

University of Glasgow, Glasgow, UK

Running title: p300 regulates cardiac genes through MEF-2D

Key words: CREB-binding factor, heart, differentiation, adenovirus E1A, basic helix-loop-helix

proteins, muscle-specific genes

*Address correspondence to:

Nanette H. Bishopric, M.D., F.A.C.C.University of Miami Department of Molecular and Cellular PharmacologyP.O. Box 106189 (R-189)Miami, FL 33101e-mail: [email protected] (phone)305-243-6082 (fax)

Copyright 2000 by The American Society for Biochemistry and Molecular Biology, Inc.

JBC Papers in Press. Published on November 28, 2000 as Manuscript M004625200 by guest on A

pril 5, 2018http://w

ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Slepak, T.I. et al. p300 regulates cardiac genes through MEF-2D

2

SUMMARY

The transcriptional integrator p300 regulates gene expression by interaction with sequence-

specific DNA binding proteins and local remodelling of chromatin. p300 is required for cardiac-

specific gene transcription, but the molecular basis of this requirement is unknown. Here we report

that the MADS-box transcription factor MEF-2D acts as the principal conduit for cardiac

transcriptional activation by p300. p300 activation of the native 2130 bp human skeletal α-actin

promoter required a single hybrid MEF-2/GATA-4 DNA motif centered at -1256bp. Maximal

expression of the promoter in cultured myocytes and in vivo correlated with binding of both MEF-2

and p300, but not GATA-4, to this AT-rich motif. p300 and MEF-2 were co-precipitated from

cardiac nuclear extracts by an oligomer containing this element. p300 was found exclusively in a

complex with MEF-2D at this and related sites in other cardiac-restricted promoters. MEF-2D, but

not other MEFs, significantly potentiated cardiac-specific transcription by p300. No physical or

functional interaction was observed between p300 and other factors implicated in skeletal actin

transcription, including GATA-4, TEF-1, or SRF. These results show that in the intact cell, p300

interactions with its protein targets are highly selective, and that MEF-2D is the preferred channel

for p300-mediated transcriptional control in the heart.

by guest on April 5, 2018

http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


3

INTRODUCTION

Transcriptional coactivators, or integrators, are members of a class of transcription factors

that bring about tissue- and stimulus-specific changes in gene expression by coordinating groups

of signal responsive proteins in the cell. Coactivators do not bind independently to DNA, but are

thought to stabilize the formation of specific transcription factor-DNA complexes, and to cause the

local unwinding of chromatin directly or by recruitment of histone-remodelling enymes 1;2.

Specific coactivator families have been identified for regulation of steroid hormone-responsive

genes (SRC-1, SRC-3) 3-5 and fatty acid regulatory proteins (PGC-1) 6;7. Gene targeting

experiments have confirmed that the activities of these co-activators in vivo are highly tissue-

restricted, although the molecular basis of this specificity is not well understood 4;6;8-10.

An important subgroup of coactivators is represented by the closely related transcriptional

integrators p300 and CBP (CREB-Binding Protein). These large proteins share extensive sequence

homology and many structural features, and appear to have arisen as part of an ancestral gene

duplication 11-13. The cellular levels and activities of p300 and CBP are tightly regulated through

steroid, adrenergic and growth factor signals as well as during the cell cycle 14 . Critical roles for

p300 and CBP have been identified in growth, differentiation, apoptosis and tissue-specific gene

expression, reflecting their interaction with multiple cellular regulatory proteins 13 . A particular

requirement for p300 is observed in the heart. Mice deficient in p300 have an embryonic lethal

phenotype characterized by failure of cardiac myocyte proliferation and muscle-specific gene

expression 10. In the post-natal heart, adenovirus E1A selectively inhibits cardiac muscle-specific

gene expression by binding to p300 and/or related proteins 15 16 17 . Although p300 is also required

for skeletal muscle gene transcription by the tissue-specific basic helix-loop helix protein MyoD,

the heart lacks any equivalent to this transcription factor 18 {Eckner, Yao, et al. 1996 #3207}. The

molecular partners and pathways of p300-mediated transcriptional regulation in the heart are not

known.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


4

Expression of the human skeletal α-actin gene is tightly restricted to striated muscle. In the

myocardium, skeletal actin is one of a group of "fetal" genes upregulated in response to

hypertrophic stresses such as pressure overload in vivo, and during the response to adrenergic

stimulation, growth factors and other neurohormonal effectors in cell culture models 19-22. Although

skeletal actin is the predominant sarcomeric actin isoform in the human heart, it is further

upregulated during hypertrophy 23-25, and is considered an important marker of hypertrophy in the

rat 20;26-29. Regulation of skeletal actin expression in the heart involves both extracellular signal-

responsive and cardiac-specific transcription factors; the latter have not yet been identified. The -

2130 bp human skeletal actin promoter has two major transcriptional activation domains, proximal

(-153 to -87) and distal (-2130 to -710) which are required for maximal tissue-specific expression

in both skeletal and cardiac myocytes 19 . The proximal promoter contains functional binding sites

for Sp-1, SRF, and TEF-1 30. Here, we report the sequence of the distal human skeletal actin (hSA)

promoter, and demonstrate that only one DNA motif within the entire 2130 bp transcriptional unit is

capable of transmitting the p300 activation signal. This motif, centered at -1256, binds the MADS-

box transcription factor MEF-2 as well as GATA-4, and is required for maximal expression in both

neonatal and adult rat cardiac myocytes. The motif also binds endogenous cardiac nuclear p300,

and coordinates synergistic activation of the hSA promoter by p300 and MEF-2D. Remarkably,

p300-dependent activation did not involve interaction with GATA-4, SRF, or TEF-1, indicating that

p300 selectively targets MEF-2 in the context of a native promoter. Based on these findings and

on recent data showing interactions between MEF-2 and HDAC-4 31, we propose that MEF-2

governs expression of the cardiac phenotype by acting as a primary channel for chromatin

remodelling on cardiac-specific promoters.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


5

EXPERIMENTAL PROCEDURES

Materials

Expression vectors encoding MEF-2 A-D were generously provided by Dr. Eric Olson. A

p300 expression vector (pCMVp300β) was the kind gift of Dr. R. Eckner. Polyclonal antibodies

against GATA-4, MEF-2 and p300 were obtained from Santa Cruz Biotechnology. The

monoclonal antibody against p300 (NM-11) was supplied by Pharmingen, and restriction enzymes

were from New England Biolabs. All other molecular biology reagents were purchased from

Sigma except as indicated, and were of the highest grade available.

Plasmid construction

The distal hSA promoter sequence was determined by automated DNA sequencing using an

ABI 377 DNA sequencer in the Biochemistry Core Facility, University of California at San

Francisco. The resulting information was used to construct skeletal actin promoter-luciferase

chimeras. A 2335 bp HindIII genomic fragment containing the hSA promoter sequence, comprising

2130 bp 5’ and 203 bp 3’ to the start of transcription, including all of exon 1, was cloned in sense

orientation into the HindIII site of pGL-2Basic (ProMega). Truncations and point mutations were

generated by cloning and/or PCR-mediated mutagenesis as described 32. Figure 1 shows the

structure of each construct used in this paper and the specific point mutations introduced. Primers

used for introduction of point mutations are shown in Table 1. Mutated bases are shown in bold

letters. Numbering reflects the position of hSA gene sequences relative to the transcription start site.

Our numbering reflects a systematic difference of +16 bp with the sequence previously published

by Muscat et al. as nt -1282 through -1177 33; the corresponding numbers in our sequence are -

1298 through -1193.

Internal and 5’ deletions of the distal promoter were generated by digestion of the hSA at

unique restriction sites at -1787, -1656, -1298 and –1243, and internal religation or ligation to


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


6

compatible sites in the polylinker (Figure 1B). The p1787luc 1 plasmid was created by digestion at

the hSA SpeI site and the polylinker NheI site, and re-ligating. p1656 was generated by digestion at

the hSA NdeI site and religation of the proximal end to the polylinker Bgl II site. Digestion with

NdeI and partial digestion with XbaI removed a small fragment of 358 bp resulting in the dNX

plasmid. The dNP plasmid was created by double digestion with NdeI and PstI, gel purification of

the vector fragment and religation.

Introduction of point mutations to ϕGATA and ATr sites was performed as described 34

with slight modifications. Briefly, two adjacent primers were designed on opposite DNA strands

with the mutation encoded at the 5' end of one primer. Both primers were phosphorylated before

PCR. PfuTurbo DNA polymerase (Stratagene, La Jolla, CA) was used to increase fidelity of DNA

replication and create blunt-ended PCR products. The amplified plasmid with the introduced

mutation was isolated from agarose, religated and transformed to bacteria. Mutations in the

proximal promoter were made by directional cloning of double-stranded 52 bp oligomers

containing mutations in CArG I (m8, m9), a TEF-1 site (mTEF), or sequences 5’ to the CArG box

(m6), flanked by XmaIII and XhoI sites at the 5’ and 3’ ends respectively. The parental pluc1

vector was linearized with XhoI and subjected to partial digestion with XmaIII; each oligonucleotide

was then ligated into this vector to generate m6, m8, m9 and mTEF constructs. All clones were

screened by restriction analysis and sequenced to confirm the presence of each mutation.

In vivo gene transfer to rat myocardium.

Male Sprague Dawley rats (250-400g) were premedicated with a mixture of 10-20 mg/ kg

fluanisone, 0.315-0.630 mg/kg fentanyl citrate (Hypnorm, Jansen Pharmaceuticals) and 0.5-1.0

mg/kg midazolam (Hypnovel, Roche Pharmaceuticals) given intraperitoneally. Animals were

ventilated (0.04-0.06 l/min/kg) on a small animal respirator with 0.5-1.0 cm H2O of positive end-

expiratory pressure and maintained under anaesthesia with a mixture of nitrous oxide and oxygen

in a 1:1 ratio plus 0.5-1% halothane. The chest was opened by a left thoracotomy and the


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


7

pericardium removed for DNA injection. DNA was directly injected into the apex of the left

ventricle, using 100 µl per injection in a Hamilton syringe (25 µg internal control plasmid and 50

µg hSA-luciferase plasmid suspended in phosphate buffered saline). Postoperative analgesia was

administered for at least the next 24 hours with 0.2 mg/ kg intramuscular buprenorphine

(Vetergesic, Reckitt & Coleman). Seven days after surgery animals were sacrificed with a lethal

dose of pentobarbital sodium and the heart excised for assays of reporter gene expression.

Enzyme determinations in tissue extracts were performed as described previously 35. pRSV-

luciferase and pCAT3PV (SV40 promoter linked to CAT) were used as internal controls and

were obtained from ProMega Biotech (Madison, WI). All procedures were performed under

license in accordance with NIH guidelines or in accordance with the United Kingdom Animals

(Scientific Procedures) Act, 1986.

Cell Culture and Transfection.

HeLa cells were grown in MEM with Eagle's salts, penicillin, streptomycin and 10% fetal

bovine serum. Neonatal rat myocardial cells were isolated as previously described 19 by gentle

trypsinization and mechanical dissociation over a period of 4-5 hrs, and plated at a density of 3.5-4

x 106 cells per 60-mm culture dish. Cultures were enriched for myocardial cells by preplating for

30-60 min to deplete the population of non-myocardial cells. Prior to and during transfection, cells

were maintained in MEM with Eagle's salts, penicillin, streptomycin and 5% fetal bovine serum

(MEM-FBS). Following transfection, cells were incubated in a serum-free medium consisting of

MEM supplemented with insulin, transferrin, vitamin B12, penicillin and streptomycin (MEM-

TIB). All cells were maintained in 5% CO2 atmosphere at 37˚C and transfected as described below.

Cardiac myocytes were transfected with reporter plasmids and other constructs on the day

following plating, using an adaptation of the calcium phosphate method 36. Equal numbers of

myocytes were co-transfected with 10 µg of reporter plasmid and either 5 µg of p300 expression

vector, 5 µg of MEF-2 expression plasmid or an equal amount of blank CMV expression vector.

24 hours after transfection cells were washed twice with MEM-TIB and maintained in that medium


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


8

for an additional 48 hours. Cells were then washed twice with PBS, pH 7.4, and collected in 1x

reporter lysis buffer (ProMega).

HeLa and C2C12 cells were transfected at a confluence of 50-70%, also using the calcium

phosphate method. Cells were maintained prior and during transfection in MEM (HeLa) or

DMEM (C2C12) supplemented with 10% fetal bovine serum, penicillin and streptomycin. On the

day after transfection, cells were rinsed twice with fresh media and incubated for 24-48 hr before

harvesting as described above. A commercially available kit was used to measure luciferase activity

in cell lysates (ProMega).

Gel Mobility Shift Assays

For preparation of nuclear extracts, cardiac myocytes were plated in 10 cm dishes and

cultured in MEM-FBS for 2 days, then switched to MEM-TIB for 3-5 days. Nuclear extracts were

prepared essentially as previously described 37 except that the final extract was desalted on a 1-2 ml

Sephadex G-25 chromatography mini-column instead of by dialysis. Protein concentrations were

determined using the Bio-Rad Protein assay kit (Bio-Rad Laboratories, Hercules, CA). Aliquots of

nuclear extract were frozen and stored at -80˚ C.

Double-stranded oligonucleotide gel shift probes containing the wt and mutant ϕGATA and

ATr motifs were synthesized as shown in Table 2. Gel-purified oligonucleotide pairs were

annealed and end-labeled with [32P]-ATP using T4 polynucleotide kinase (NEB) and [γ-32P]-ATP

(NEN Life Science Products). Gel mobility shift assays were performed as previously described

38(69). In brief, equal amounts of radioactive probe (1.5-2.5 x 104 cpm) were added to binding

reactions that contained 6 µg of nuclear extract protein in 20 µl of a buffer containing 4 mM Tris

(pH 7.8), 12 mM HEPES (pH 7.9), 60 mM KCl, 30 mM NaCl, 0.1 mM EDTA, 1 µg/ml of

poly(dI-dC) (Amersham Pharmacia Biotech). Reactions were incubated for 20 min at 22˚C, and

then separated on a nondenaturing 5% polyacrylamide gel at 4˚C. Where indicated, antibodies (2-4

µg/reaction) were incubated with the binding reactions for 30 min at 22˚C before addition of the


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


9

probe. For determination of sequence-specific binding, a 100-fold molar excess of unlabelled

oligonucleotides was added immediately before the probe. No DNA-antibody interaction was

observed in the absence of nuclear protein (data not shown).

Immunoprecipitation.

50 µg of nuclear extract from cardiac myocytes (prepared as described above) was mixed in

equal amounts with 2x immunoprecipitation buffer (2% Triton X-100, 300 mM NaCl, 20 mM Tris

pH 7.4, 2 mM EDTA, 2 mM EGTA pH 8.0, 0.4 mM sodium orthovanadate, 0.4 mM PMSF, 1.0%

NP-40). Subsequently, 1-5 µg of either MEF-2 or p300 antibody was added. Mixtures were

incubated for 1 hour at 4˚ C. with constant agitation. Protein A-agarose (20 µl, Santa Cruz

Biotechnology) was then added to the protein-antibody mixture and tubes were incubated for an

additional 30 min at 4˚C. At the end of the incubation, agarose beads were spun down, and the

supernatant was reserved to quantitate unbound proteins. Beads were washed three times with 1x

immunoprecipitation buffer (1% Triton X-100, 150 mM NaCl, 10 mM Tris pH 7.4, 1 mM EDTA, 1

mM EGTA pH 8.0, 0.2 mM sodium orthovanadate, 0.2 mM PMSF, 0.5% NP-40), resuspended in

30 ml of 2x electrophoresis sample buffer (250 mM Tris pH 6.8, 4% SDS, 10% glycerol, 0.006%

bromphenol blue, 2% β-mercaptoethanol) and then boiled for 5 minutes. Aliquots of the original

nuclear extract, unbound proteins and wash fractions were also mixed with 2x electrophoresis

sample buffer and boiled. All protein samples were resolved on 6% SDS-polyacrylamide gels (for

p300) or 8% SDS-polyacrylamide (for detection of MEF-2 proteins). Gels were transferred

overnight to nitrocellulose membranes using a Transblot electrophoresis transfer cell (Bio-Rad,

Hercules, Calif.). Membranes were probed with polyclonal MEF-2 antibody (SC-313, Santa Cruz

Biotechnology), polyclonal p300 (N-15) (sc-584, Santa Cruz Biotechnology) and monoclonal p300

NM11 (14991A, Pharmingen). Antigen-antibody complexes were visualized by enhanced

chemiluminescence (Pierce).


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


10

Coprecipitation of MEF-2/p300 complexes using a biotinylated probe.

A biotinylated oligonucleotide containing the antisense ATr motif (5’ biotin

TTACCAGAGCCTGCTGCAGGTTCTATTTATATCA3') was annealed to the complementary

ATr (R) sense oligonucleotide (see Figure 7A) at a final concentration of 10 µM, and linked to

Dynabeads M-280 streptavidin (Dynal Inc., Lake Success, NY) as previously described 39. For co-

precipitation of MEF-2 and p300, the beads were initially washed three times with phosphate

buffered saline (PBS, pH 7.4) containing 0.1% BSA, and twice with a buffer containing 1M NaCl,

10 mM Tris, 1 mM EDTA (TE-NaCl, pH 7.5). The beads were then mixed with 10 pmol double-

stranded biotinylated probe and incubated 20 minutes at room temperature in TE-NaCl. Sequential

washes with TE-NaCl and 1x binding buffer (10mM Tris [pH 7.5], 50 mM KCl, 1 mM MgCl2 , 1

mM EDTA, 5.5 mM DTT, 5% glycerol, 0.3% Nonidet P-40) were used to remove excess unbound

oligonucleotide and to equilibrate the beads with the binding buffer. Cardiac myocyte nuclear

extract (50 µg) was mixed with 1x binding buffer for 5’ at room temperature and incubated with the

probe-linked beads for 20’. Unbound proteins were washed from the beads three times with 1x

buffer containing 0.5 µg/ml poly(dI-dC), and aliquots of each wash were retained for analysis.

Finally, proteins specifically bound to the beads were eluted with 1x binding buffer containing 1M

NaCl.

All fractions were resolved by SDS-PAGE (6% for p300 and 12% for MEF-2) and

analyzed by Western blot using antibodies to p300 and MEF-2 as described above.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


11

RESULTS

MEF-2, SRF and TEF-1 binding sites in the hSA promoter are required for maximal

cardiac expression in vivo

p300 /CBP does not bind DNA directly, but is recruited to specific gene control regions by

transcription factors that bind to these sites. Thus, we looked for binding sites for known DNA-

binding transcription factors in the hSA promoter that could represent partners or mediators of

p300-dependent transactivation. The proximal human skeletal actin promoter contains consensus

binding sites for SRF, TEF-1, and Sp-1, similar to the chick, mouse and rat skeletal actin promoters

(41, 35, 56; see Figure 1A), and additional regulatory elements have been localized to the distal

promoter (5' to -710) 19 . To characterize these elements, we sequenced the distal human skeletal

actin promoter from -710 to -2130 (not shown; GenBank accession #AF288779). Within this

sequence are two DNA elements resembling AP-1 binding sites (centered at -1494 and –1300,

Figure 1A), as well as six variant E-boxes (CANNTG, not shown). A previously described AT-

rich motif was found centered at -1256 33 (Figures 1A and 1C). This AT-rich site differs by one

nucleotide from the consensus binding site for myocyte enhancer-binding factor-2 (MEF-2)

(CTA(A/T)4TAG, 40). We also searched for GATA binding sites by BLAST screening of the hSA

promoter with the GATA binding site from the brain natriuretic peptide promoter

(CTGATAAATCAGAGATAACC). This search revealed two potential GATA binding sites, one of

which overlapped with the MEF-2 consensus sequence. For convenience, the compound MEF-

2/GATA binding motif was called “ATr”. An additional putative GATA site was centered at -

1798 (Figures 1A, 1C), and designated ϕGATA.

To test the functional relevance of these elements, the hSA promoter was subjected to serial

5' truncations and point mutagenesis (Figures 1B and 1C). The resulting constructs were assayed

for activity in adult myocardium by direct injection as described in Methods (Figure 2). These

studies showed that the ATr site at -1256 (mATr, Figure 2), as well as the TEF-1 and SRF binding


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


12

sites in the proximal promoter (mutants mTEF, m9 respectively, Figure 2), were required for

maximal expression of the human skeletal actin promoter in the adult rat heart. Deletion of

sequences upstream of -1298 did not reduce, and in fact enhanced expression, indicating that

elements in this region (including ϕGATA) do not confer tissue-specific activation in the heart. In

contrast, point mutagenesis of ATr reduced hSA promoter activity by about 50% (Figure 2),

suggesting that this element forms the core of the previously reported distal tissue-specific element

19.

A distal AT-rich site is the major p300 responsive element

We next looked for specific DNA sequences in the hSA promoter that mediate its activation

by p300. Although the full-length hSA promoter (p2130luc1) has constitutively high basal activity

in cardiac myocytes, comparable to that of beta actin 19 , co-expression of p300 further activated it by

more than 3-fold (Figure 3). Similar to our findings in vivo, two different point mutations of the

proximal SRE (CArG I) and mutagenesis of the TEF-1 binding site each reduced basal hSA

promoter activity in cardiac myocytes by > 60% (mutants m8, m9 and mTEF, Figure 3). However,

these sites were not required for transactivation by p300 (Figure 3). Mutation of the Sp-1 site in

the proximal promoter also reduced basal activity, but did not affect p300 transactivation (data not

shown). Minimal expression of the basal promoter (truncated at -87) was increased in the presence

of p300, possibly reflecting interaction of p300 with TATAA binding factors 41 . In contrast, point

mutation of the AT-rich motif centered at -1256 (ATr) not only reduced basal hSA promoter

activity, but also abrogated transactivation by p300 (Figure 3, mutants mATr and mATrϕGA).

Although in some experiments mutation of the ϕGATA site at –1798 appeared to further reduce

p300 transactivation, this effect was not reproducible and did not achieve statistical significance (p >

0.08). Deletion or mutation of other distal sites had no significant on p300 transactivation. These

findings indicated that transcriptional activation by p300 required a single tissue-specific AT-rich

enhancer element in the hSA promoter.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


13

The ATr element is a MEF-2 binding site

The ATr site is assumed to be a MEF-2 binding site based on its homology to similar sites

in other muscle-specific promoters 42 . To identify cardiac nuclear proteins binding to the p300-

responsive ATr element, we synthesized oligonucleotides containing both the wild type and mutant

sequences used for functional assays above (Table 2). Electrophoretic mobility shift assays

(EMSAs) were performed with nuclear extracts from cardiac myocytes and from endothelial cells.

Cardiac nuclear proteins interacting with the ATr element formed at least three sequence-specific

bands (labelled 1 –3 in Figure 4A). The upper two bands required the core ATr sequence, and did

not form on a mutant ATr site (Figure 4A, lane 6), or on the GATA-like sequence at –1798,

ϕGATA (Figure 4A, lane 2). The third nucleoprotein complex formed specifically on both ATr and

mATr, suggesting that it interacts with sequences flanking the core ATATA sequence (Figure 4A,

lanes 6 and 12). All three major nucleoprotein complexes were muscle-restricted, as they were

absent in endothelial cell nuclear extracts (Figure 4A, lanes 13-14).

We next confirmed that MEF-2 proteins bind to the ATr site. The same 3 nucleoprotein

complexes identified in Figure 4A were again seen forming on the ATr site, as well as on a

synthetic MEF-2 site (Figure 4B). The synthetic MEF-2 oligonucleotide also competed effectively

for the 3 complexes binding to ATr. In both cases, bands 1 and 2 were specifically and

quantitatively supershifted by a MEF-2 antibody that recognizes MEF-2 subtypes A, C and D

(Figure 4B, lanes 5 and 10), while a control MyoD antibody did not (data not shown). Thus, MEF-

2 is present in 2 of 3 tissue-specific complexes bound to the ATr site.

The ATr site has significant homology to a GATA-4 binding site from the BNP promoter

that is required for its cardiac-specific activation 43. To determine whether GATA-4 also bound to

the ATr site, we synthesized shorter oligomers representing sequences centered at -1260 ("left"), -

1252 ("right") and -1256 ("center") (Figure 5A). All 3 previously detected complexes formed on

each of these shorter oligonucleotides (Figure 5B), but with varying efficiency. Complexes 1 and 2


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


14

preferentially interacted with the right side of ATr (Figure 5B, lane 9), while complex 3

preferentially bound to the left (Figure 5B, lane 5). For all three oligonucleotides, only complexes 1

and 2 were supershifted by the MEF-2 antibody (Figure 5B, lanes 3, 7, and 11). Thus, complex 3

binds a site adjacent to and overlapping that of complexes 1 and 2, and does not contain MEF-2. In

contrast, a polyclonal anti-GATA-4 antibody selectively depleted ATr complex 3, suggesting that it

contained GATA-4 (Figure 5C, lane 4). This depletion was accompanied by appearance or

enhancement of a band co-migrating with complex 1 (lane 4). When a synthetic GATA binding

site was used as the probe (Figure 5C lanes 5-9), we observed a single cardiac nucleoprotein

complex that co-migrated with ATr complex 3 and was effectively competed by an ATr oligomer

(Figure 5C, lane 8). Incubation with the GATA-4 antibody generated a supershifted complex that

migrated roughly in tandem with complex 1 on the ATr site (Figure 5C, compare lanes 9 and 4).

Thus, the enhanced binding in lane 4 appears to be identical with a supershifted GATA-DNA

complex, although we cannot formally exclude the possibility that this represents enhanced binding

of MEF-2. In either case, it is clear that the most rapidly migrating nucleoprotein complex on the

ATr sequence contains GATA-4.

Taken together, these data show that the distal hSA cardiac-specific element is occupied by

at least three muscle-specific protein complexes: two containing MEF-2, and one with GATA-4.

Moreover, MEF-2 and GATA-4 complexes form on distinct but overlapping sites within the ATr

motif.

p300 binds specifically to the skeletal actin MEF-2 binding site

We next looked for evidence that p300 interacts directly with the MEF-2 DNA-binding

complexes. The ATr and Atr-Left oligonucleotides shown in Figure 5A were labelled and allowed

to interact with cardiac nuclear proteins in the presence or absence of specific antibodies. As in

Figures 4B and 5B, the polyspecific MEF-2 antibody completely supershifted Bands 1 and 2

(Figure 6, lane 8). A second, MEF-2D-specific antibody reacted only with Band 1 (Figure 6, lane

7.) Band 3 on both oligonucleotides was supershifted by a GATA-4 antibody (Figure 6, lanes 3 and


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


15

10). These results show that the more rapidly migrating complex is likely to contain MEF-2A,

MEF-2C or both, while the slower-moving complex (Band 1) probably contains only the MEF-2D

isoform.

Band 1, containing MEF-2D, was also the only complex that could be shown to contain

p300. A polyclonal antibody directed against the N terminus of p300 reacted very specifically with

the MEF-2D-ATr complex (Figure 6, lane 9); bands 2 and 3 were not affected. None of the

protein-DNA complexes on the Atr-Left oligomer reacted with the p300 antibody. These data show

that p300 is specifically present in a complex with MEF-2D on the ATr, and not with GATA-4 or

other MEF-2 species. Morever, 3’ flanking sequences of the ATr are required for formation of this

complex.

A MEF-2 site in the cardiac α-myosin heavy chain (α-MHC) promoter is required for

maximal activity in cardiac myocytes 44-46. We were interested in determining whether p300 could

be identified at these sites, or at a binding site for the related MADS protein, SRF, in the proximal

hSA promoter (Figure 1A). Oligonucleotide sequences used for these studies are given in Table 2.

Figure 7 shows that the AT-rich motifs from the α-MHC and M-creatine kinase (M-CK) form

complexes similar to hSA complexes 1, 2 and 3 (Figure 7, lanes 2, 7 and 12). In each case,

complexes 1 and 2 were supershifted by a MEF-2 antibody (lanes 4, 9 and 14). Furthermore, each

complex 1 was supershifted by the p300 antibody (lanes 5, 10 and 15). No other bands were

visibly affected. Neither of two distinct sequence-specific complexes formed on the hSA SRE was

supershifted by the MEF-2 or p300 antibodies. These results suggest that p300 interacts

differentially with these two MADS proteins and is selective for MEF-2 over SRF (Figure 5, lanes

19 and 20).

Endogenous cardiac MEF-2 and p300 interact on the ATr element

We next asked whether MEF-2 and p300 bound to each other directly or via contact with

DNA. Initially we attempted to co-immunoprecipitate MEF-2 and p300 from cardiac nuclear


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


16

extracts, using antibodies against both p300 and MEF-2. The polyclonal MEF-2 antibody was

able to quantitatively immunoprecipitate at least two MEF-2 species (Figure 8A, lane 4).

However, we detected no p300 protein in the MEF-2 immunoprecipitates using either

monoclonal or polyclonal p300 antibodies (Figure 8A, lane 9). Conversely, the anti-p300

monoclonal antibody (NM-11) successfully immunoprecipitated p300 from cardiac nuclear

extracts (Figure 8A, lane 10), but did not co-precipitate detectable MEF-2 species (data not

shown). This may be attributable to inaccessibility of the interaction domains in the presence of

antibody or to the lack of high affinity interaction between the two proteins in the absence of

DNA.

To determine whether MEF-2 and p300 interacted through DNA binding, we performed

DNA “pulldown” assays using Dynal beads linked to a double-stranded oligonucleotide

containing the hSA MEF-2 site (ATr) as previously described 39. Cardiac nuclear proteins binding

specifically to this oligonucleotide were eluted from the beads and characterized by Western

analysis with MEF-2 and p300 antibodies. Two MEF-2 proteins eluted from the hSA ATr site

(Figure 8B, upper panel, lane 4). Western analysis of the same blot using a MEF-2D-specific

antibody confirmed that the upper band contains MEF-2D (data not shown). Importantly, a band

corresponding to p300 was present in the same eluate (Figure 8B, lower panel, lane 4). A second

protein of smaller size (about 140 kd) was also detected by the NM-11 antibody and may represent

a degradation product. A biotinylated mutant ATr did not bind to either MEF-2 or p300 (data not

shown). These data show that endogenous cardiac MEF-2 and p300 form a specific complex with

the ATr element, and support the results of the gel mobility retardation assays shown above.

MEF-2, but not GATA-4, is synergistic with p300

To address the functional significance of the MEF-2 - p300 interaction, we asked whether


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


17

the two proteins could activate cardiac transcription synergistically. We measured the activity of the

hSA wt promoter, and the same promoter containing a point mutation in the ATr motif (p2130luc1

and mATr, Figures 1B and C) in the presence and absence of p300 and one of the four MEF-2

species. Parallel experiments were performed in cardiac myocytes and HeLa cells (Figure 9A).

Alone, none of the individual MEF-2 subtypes significantly activated either the wild type or mutant

hSA promoters in cardiac myocytes, although a small amount of activation was seen in HeLa cells

(Figure 9A, white bars). In cardiac myocytes, activation of the wt promoter by MEF-2A, B or C did

not significantly increase in the presence of p300 (Figure 9A, blue bars). However, the combination

of MEF-2D and p300 significantly activated hSA expression, compared with either blank vector or

p300 alone (p < 0.01, Figure 9A). Because it is not possible to establish the relative expression of

the different MEF-2 species from these vectors, it may be that the divergent behavior of MEF-2C

and MEF-2D is due to quantitative differences in MEF-2 delivery or expression. However, all

vectors contained the same CMV promoter, and were expressed at measurable levels in a HeLa cell

background, suggesting that transfer and expression were not qualitatively defective for the MEF-

2C vector (data not shown).

In HeLa cells, the combination of p300 and MEF-2D failed to activate hSA transcription

above 10% of its activity in cardiac myocytes, and this activation was largely independent of the ATr

site, suggesting that additional cell type-specific factors are required for maximal expression of this

promoter. As expected, neither p300 nor MEF-2 species activated an hSA mutant lacking the ATr

site (mATr) in cardiac myocytes. These results show that p300 and MEF-2D are synergistic for

cardiac transcription of the hSA promoter and that this synergy is exerted through the ATr site at -

1256.

The skeletal actin gene has not previously been shown to be a target for activation by

GATA-4. However, as shown above, GATA-4 binds to the hSA ATr site, flanking the MEF-2

binding sequences. Thus, GATA-4 might also transactivate the hSA promoter, or participate in

activation of hSA by p300 through the ATr site. To investigate these possibilities, a GATA-4


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


18

expression vector was co-transfected with the hSA wild type and ATr site mutants. The ATr

mutant was expressed at approximately 50% of wild type promoter levels, as reported above. Co-

expression of GATA-4 did not activate basal expression of the wild type promoter at any

concentration (Figure 9 and data not shown), and significantly reduced its activation by p300 in the

presence of an intact ATr (Figure 9, light bars). Together with the observed lack of physical

interaction in vivo, these observations suggest that GATA-4 is not directly involved in p300-

mediated activation of skeletal actin transcription.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


19

DISCUSSION

Studies described here identify the myogenic transcription factor MEF-2D as a specific

physical and functional target of p300 in the heart. Activation of the native 2180 bp human skeletal

actin promoter by p300 required a single short DNA sequence in the distal promoter, a hybrid

binding site for MEF-2 and GATA-4. Full myocardial expression of the skeletal actin promoter

required this same element, both in vitro and in vivo. p300 bound exclusively to this element, as part

of a complex with MEF-2D, and could not be identified in DNA complexes with GATA-4 or in a

structurally related DNA-SRF complex. Furthermore, p300 and MEF-2D displayed cooperative

transcriptional activation of the hSA promoter. This functional synergy was not observed in HeLa

cells, suggesting a requirement for additional cell type-specific factors. Taken together, these

findings identify MEF-2D as a dominant partner for p300 in the myocardium, and place p300 in

the regulatory hierarchy of the cardiac phenotype 15 10;16;17.

Our data show that p300 targeting of MEF-2D takes priority over its potential interactions

with several other proteins that bind to the 2130 bp hSA promoter, including GATA-4- and SRF.

This observation is remarkable, since other studies have shown that p300 can bind to both SRF and

members of the GATA family, and to activate transcription through their cognate binding sites 47 48

49 . In contrast, we did not observe physical or functional interaction between p300 and GATA-4 on

the hSA promoter, nor did we detect p300 at GATA-4 binding sites in the BNP, β-myosin heavy

chain50 or angiotensin type I receptor promoters 51 under equivalent conditions (data not shown).

Our results do not exclude the possibility that GATA-4 and p300 interact independently of DNA or

under defined conditions in vitro. Further work will be required to establish the relationship

between GATA-4- and MEF-2-dependent transcriptional activation in the heart.

The MEF-2 family of transcription factors belongs to the MADS (MCM-1, agamous,

deficiens, serum response factor) group of DNA binding proteins, characterized by their homology

within an amino terminal domain (“MADS box”). Although MEF-2 is widely expressed, its role


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


20

in cardiac-specific transcription been well documented. MEF-2C is required for normal cardiac

morphogenesis, and most if not all cardiac genes possess functionally important MEF-2 binding

sites 42 . MEF-2 species form DNA-binding homo- and heterodimers, and also bind to myogenic

helix-loop-helix proteins as co-regulators. In skeletal muscle, MEF-2 proteins collaborate with

MyoD and p300 to promote myogenesis and muscle-specific transcription, and are thought to act in

a positive autoregulatory loop that maintains myogenic differentiation 18;40;52;53. Other partners for

MEF-2 proteins in cardiac transcriptional activation remain to be identified.

Our data suggests that the MEF-2D isoform may be targeted by p300 in preference to other

MEF species. We were able to demonstrate cooperative transcriptional activation between p300 and

MEF-2D, but not with the other MEF-2 isoforms, and p300 was localized to the DNA complex

containing MEF-2D. Our data do not exclude limited functional interaction between p300 and other

MEF-2 species at this promoter, but it is also possible that the small positive interaction between the

other MEF species and p300 is mediated by heterodimerization with endogenous MEF-2D. This

finding is important because to date there are few examples of functional differences between the

four known MEF-2 species. All four mammalian MEF-2 species are expressed in the heart,

(reviewed in 42), and all subtypes recognize the same AT-rich consensus sequence

(YTA(A/T)4TAR). Differential recruitment of essential coactivator proteins may confer distinct

transcriptional activation properties on MEF-2D.

The observed lack of co-activation between MEF2C and p300 at this promoter was

unexpected. Several previous findings suggest that p300 and MEF-2C may act cooperatively in the

cardiovascular system; p300-deficient and MEF-2C deficient mice have overlapping defects in

vascularization, and both have defects in cardiac development, although these are dissimilar 54 .

MEF2C and D have closely parallel expression patterns throughout cardiac development, and

MEF2C expression actually precedes that of MEF2D in the cardiac mesoderm 42. Furthermore, co-

translated p300 and MEF2C have been shown to interact in vitro 18 . However, the physical and

functional data presented here suggests that MEF-2-p300 interactions may be subject to

modification by cell type-specific or promoter-specific factors. One possibility is that MEF2C-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


21

p300 interactions play critical roles in mesodermal patterning and in vasculogenesis, while MEF2D-

p300 may be more important for tissue-specific gene expression in the differentiated cardiac

myocyte. Further studies of MEF2D in gene-targeted mice will help to clarify its specific roles.

The muscle-specific actions of MEF-2 cannot be explained by tissue-restricted expression,

or by differences between MEF-2 binding sites in muscle-specific and ubiquitously expressed

genes 55 . Instead, MEF-2 activity appears to be subject to significant post-transcriptional control by

phosphorylation, and by the recruitment of additional factors 40;56-59. In support of this hypothesis,

it has been suggested that MEF-2 -dependent transcription is silenced in non-muscle cell types by

recruitment of HDAC-4, a histone deacetylase 31 . We propose that the converse is also true:

activation of MEF-2 dependent genes in cardiac muscle requires recruitment of histone

acetyltransferase via p300. These findings point to a unique role for MEF-2D in channelling both

the activation and silencing signals of chromatin-remodelling enzymes to cardiac-specific

promoters.

Our studies provide the first direct evidence that MEF-2 and p300 interact to regulate

cardiac-specific transcription. Although MEF-2 proteins and p300 have been shown to interact in

vitro 52 18 , and at artificial MEF-2-dependent promoters in non-muscle cells 18 , the significance of

these findings in tissue-specific transcription has been unclear. In skeletal muscle, the MEF-2-p300

interaction may serve to stabilize critical MyoD-p300 complexes on adjacent E boxes 52 . However,

our data indicate that the MEF-2-p300 complex can activate the tissue-specific transcription of

promoters that lack essential E-boxes, and can do so in the apparent absence of bHLH proteins

analogous to MyoD or NeuroD/Beta2 60;61. It seems likely that additional, unidentified cell type-

specific factors cooperate with MEF-2 and p300 in the cardiac myocyte.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


22

REFERENCES

1. Struhl, K. (1998) Genes Dev. 12, 599-606

2. Lee, D. Y., Hayes, J. J., Pruss, D., and Wolffe, A. P. (1993) Cell 72, 73-84

3. Yao, T. P., Ku, G., Zhou, N., Scully, R., and Livingston, D. M. (1996)Proc.Natl.Acad.Sci.U.S.A. 93, 10626-10631

4. Xu, J., Liao, L., Ning, G., Yoshida-Komiya, H., Deng, C., and O'Malley, B. W. (2000) ProcNatl Acad Sci U S A :

5. Leo, C. and Chen, J. D. (2000) Gene 245. 245, 1-11

6. Lowell, B. B. and Spiegelman, B. M. (2000) Nature 404. 404, 652-60

7. Vega, R. B., Huss, J. M., and Kelly, D. P. (2000) Mol Cell Biol 20. 20, 1868-76

8. Tanaka, Y., Naruse, I., Maekawa, T., Masuya, H., Shiroishi, T., and Ishii, S. (1997)Proc.Natl.Acad.Sci.USA 94, 10215-10220

9. Kawasaki, H., Eckner, R., Yao, T. P., Taira, K., Chiu, R., Livingston, D. M., and Yokoyama, K.K. (1998) Nature 393, 284-289

10. Yao, T. P., Oh, S. P., Fuchs, M., Zhou, N. D., Ch'ng, L. E., Newsome, D., Bronson, R. T., Li,E., Livingston, D. M., and Eckner, R. (1998) Cell 93, 361-372

11. Giles, R. H., Dauwerse, H. G., van Ommen, G. J., and Breuning, M. H. (1998) Am J HumGenet 63. 63, 1240-2

12. Arany, Z., Sellers, W. R., Livingston, D. M., and Eckner, R. (1997) Cell 77, 799-800

13. Giordano, A. and Avantaggiati, M. L. (1999) J.Cell Physiol. 181, 218-230

14. Snowden, A. W. and Perkins, N. D. (1998) Biochem.Pharmacol. 55, 1947-1954

15. Bishopric, N. H., Zeng, G.-Q., Sato, B., and Webster, K. A. (1997) J.Biol.Chem. 272, 20584-20594

16. Kirshenbaum, L. A. and Schneider, M. D. (1995) J.Biol.Chem. 270, 7791-7794

17. Hasegawa, K., Meyers, M. B., and Kitsis, R. N. (1997) J.Biol Chem. 272, 20049-20054

18. Sartorelli, V., Huang, J., Hamamori, Y., and Kedes, L. (1997) Mol.Cell Biol. 17, 1010-1026

19. Bishopric, N. H. and Kedes, L. (1991) Proc.Natl.Acad.Sci.USA 88, 2132-2136

20. Bishopric, N. H., Jayasena, V., and Webster, K. A. (1992) J.Biol.Chem. 267, 25535-25540

21. Izumo, S., Nadal-Ginard, B., and Mahdavi, V. (1988) Proc.Natl.Acad.Sci.USA 85, 339-343


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


23

22. Parker, T. G., Chow, K. L., Schwartz, R. J., and Schneider, M. D. (1990)Proc.Natl.Acad.Sci.USA 87, 7066-7070

23. Boheler, K. R., Carrier, L., de la Bastie, D., Allen, P. D., Komajda, M., Mercadier, J.-J., andSchwartz, K. (1991) J.Clin.Invest. 88, 323-330

24. Adachi, S., Ito, H., Tamamori, M., Tanaka, M., Marumo, F., and Hiroe, M. (1998) Life.Sci. 63,1779-1791

25. Tanaka, M., Hiroe, M., Ito, H., Nishikawa, T., Adachi, S., Aonuma, K., and Marumo, F. (1995)J.Am.Coll.Cardiol. 26, 85-92

26. MacLellan, W. R., Lee, T. C., Schwartz, R. J., and Schneider, M. D. (1994) J.Biol.Chem. 269,16754-16760

27. Karns, L. R., Kariya, K., and Simpson, P. C. (1995) J.Biol.Chem. 270, 410-417

28. Paradis, P., MacLellan, W. R., Belaguli, N. S., Schwartz, R. J., and Schneider, M. D. (1996)J.Biol.Chem. 271, 10827-10833

29. Sugden, P. H. and Clerk, A. (1998) J.Mol.Med. 76, 725-746

30. Taylor, A., Erba, H. P., Muscat, G. E. O., and Kedes, L. (1988) Genomics 3, 323-336

31. Miska, E. A., Karlsson, C., Langley, E., Nielsen, S. J., Pines, J., and Kouzarides, T. (1999)EMBO J. 18, 5099-5107

32. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: a LaboratoryManual., 2 Ed., Cold Spring Harbor Press, New York

33. Muscat, G. E., Perry, S., Prentice, H., and Kedes, L. (1992) Gene Expr. 2, 111-126

34. Fisher, C. L. and Pei, G. K. (1997) BioTechniques 23, 570-590

35. Prentice, H., Kloner, R. A., Prigozy, T., Christensen, T., Newman, L., Li, Y., and Kedes, L.(1994) J.Mol.Cell Cardiol. 26, 1393-1401

36. Gorman, C. M., Moffat, L. F., and Howard, B. H. (1982) Mol.Cell.Biol. 2, 1044-1051

37. Dignam, J. D., Lebovitz, R. M., and Roeder, R. (1983) Nucleic Acids Res. 11, 1475-1489

38. Semenza, G. L. and Wang, G. L. (1992) Mol.Cell Biol 12, 5447-5454

39. Ebert, B. L. and Bunn, H. F. (1998) Mol.Cell Biol 18, 4089-4096

40. Molkentin, J. D., Black, B. L., Martin, J. F., and Olson, E. N. (1995) Cell 83, 1125-1136

41. Abraham, S. E., Lobo, S., Yaciuk, P., Wang, H. G., and Moran, E. (1993) Oncogene. 8, 1639-1647

42. Black, B. L. and Olson, E. N. (1998) Annu.Rev.Cell Dev.Biol 14, 167-196

43. Grepin, C., Dagnino, L., Robitaille, L., Haberstroh, L., Antakly, T., and Nemer, M. (1994)


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


24

Mol.Cell Biol. 14, 3115-3129

44. Molkentin, J. D. and Markham, B. E. (1993) J.Biol.Chem. 268, 19512-19520

45. Molkentin, J. D., Jobe, S. M., and Markham, B. E. (1996) J.Mol.Cell Cardiol. 28, 1211-1225

46. Molkentin, J. D. and Markham, B. E. (1994) Mol.Cell Biol. 14, 5056-5065

47. Ramirez, S., Ait-Si-Ali, S., Robin, P., Trouche, D., Harel-Bellan, A., and Ait Si Ali, S. A. S. A.(1997) J.Biol Chem. 272, 31016-31021

48. Blobel, G. A., Nakajima, T., Eckner, R., Montminy, M., and Orkin, S. H. (1998)Proc.Natl.Acad.Sci.U.S.A. 95, 2061-2066

49. Kakita, T., Hasegawa, K., Morimoto, T., Kaburagi, S., Wada, H., and Sasayama, S. (1999) JBiol Chem 274. 274, 34096-102

50. Hasegawa, K., Lee, S. J., Jobe, S. M., Markham, B. E., and Kitsis, R. N. (1997) Circulation.96, 3943-3953

51. Herzig, T. C., Jobe, S. M., Aoki, H., Molkentin, J. D., Cowley, A. W., Izumo, S., andMarkham, B. E. (1997) Proc.Natl.Acad.Sci.USA 94, 7543-7548

52. Eckner, R., Yao, T. P., Oldread, E., and Livingston, D. M. (1996) Genes Dev. 10, 2478-2490

53. Puri, P. L., Avantaggiati, M. L., Balsano, C., Sang, N., Graessmann, A., Giordano, A., andLevrero, M. (1997) EMBO J. 16, 369-383

54. Lin, Q., Schwarz, J., Bucana, C., and Olson, E. N. (1997) Science 276, 1404-1407

55. Naya, F. J., Wu, C., Richardson, J. A., Overbeek, P., and Olson, E. N. (1999) Development.126, 2045-2052

56. Molkentin, J. D., Kalvakolanu, D. V., and Markham, B. E. (1994) Mol.Cell Biol. 14, 4947-4957

57. Molkentin, J. D., Li, L., and Olson, E. N. (1996) J.Biol Chem. 271, 17199-17204

58. Yang, S. H., Galanis, A., and Sharrocks, A. D. (1999) Mol.Cell.Biol. 19, 4028-4038

59. Molkentin, J. D. and Olson, E. N. (1996) Proc.Natl.Acad.Sci.U.S.A. 93, 9366-9373

60. Naya, F. J., Stellrecht, C. M., and Tsai, M. J. (1995) Genes Dev 9. 9, 1009-19

61. Lee, J. E., Hollenberg, S. M., Snider, L., Turner, D. L., Lipnick, N., and Weintraub, H. (1995)Science 268, 836-844


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


25

ACKNOWLEDGEMENTS

We would like to thank Drs. R. Eckner, D. Livingston and E. Olson for the generous gift of

cDNA clones used in this paper. Dr. G.Q. Zeng assisted in construction of several of the promoter

mutants. We especially appreciate the excellent technical support of Daryl Discher and Mary

Gardiner, and the helpful comments of Dr. Gary Grotendorst. This work was supported by grants

from the National Institutes of Health HL49891 (N.H.B.) and HL44578 (K.A.W.), by an

Established Investigator Grant from the American Heart Association (N.H.B.) and by a grant from

the Miami Heart Research Institute (N.H.B.). Additional support was provided by the British Heart

Foundation (H.P.) and a Wellcome Trust Foundation Collaborative Travel Grant (H.P., K.A.W.

and N.H.B.).


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


26

FIGURE LEGENDS

Figure 1. Diagram of the human skeletal actin (hSA) promoter and mutants. A.

Schematic diagram of the hSA promoter, showing location of major restriction sites and DNA

motifs resembling binding sites for AP-1 (white boxes), GATA-4 (ϕGATA), GATA-4/MEF-2

(ATr), serum response factor (CArG), and TEF-1 as indicated. The complete sequence has been

published in GenBank (Accession # AF288779). B. Deletion and point mutants of hSA promoter

constructs. Arrow indicates transcriptional start site. Shaded box = Exon 1. Open box: start of

luciferase sequence in pGL2Basic. “X” indicates site of point mutations illustrated in C. C.

Sequence of point mutations introduced in designated hSA promoter constructs. The targeted

DNA binding motifs are boxed. Specific mutated bases are shown below the corresponding wild

type nucleotides (in bold). Details of plasmid construction are included in Methods.

Figure 2. Expression of hSA promoter in adult rat myocardium requires proximal and

distal enhancer motifs. DNA was delivered by injection into rat myocardium as described in

Methods, and luciferase activity was measured and normalized after 1 week. p2130 = p2130luc1;

p1656 = p1656luc1; p1298 = p1298luc1; p87 = p87luc1 (please refer to Figure 1B). This graph

summarizes data from a minimum of 4 different animals and at least two different plasmid

preparations per construct.

Figure 3. Identification of a single p300 responsive element in the hSA promoter. In vitro

activity of the 2130 bp hSA promoter construct and mutants in the presence and absence of co-

transfected p300 . Transfections were performed in neonatal rat cardiac myocyte cultures as

detailed in Methods, and luciferase activity was measured 40-48 hours later. Light bars: hSA-

luciferase construct alone. Dark bars: hSA luciferase construct + pCMVp300β. For all

constructs, p ≤ 0.05 for comparison between -p300 and +p300, except mATr (p = 0.3705) and


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


27

mATrϕGA (p = 1.0) (asterisks). These data summarize a minimum of 8 different transfection

experiments and 3 separate plasmid preparations per construct.

Figure 4. Muscle-specific proteins bind to the p300-responsive element. A.

Cardiomyocyte and endothelial cell nuclear protein interactions with hSA promoter.

Oligonucleotides corresponding to ϕGATA and ATr motifs (see Figure 1C and Table 1) were

synthesized and used to define nucleoprotein interactions with these sites. A mutant ATr motif

was also used as a probe (mATr). The ATr motif forms three specific protein complexes with

cardiac myocyte nuclear proteins (Cardiomyocytes; arrows labelled 1, 2 and 3). None of these

bands are seen when endothelial cell nuclear extract (ECs) is used. (-) = labelled probe only.

(NE) = probe + nuclear extract. (S) = 100x unlabelled self probe competitor. (mϕGA) =

unlabelled mutant ϕGATA oligonucleotide competitor. (ATr) = unlabelled ATr probe

competitor. (mATr) = unlabelled mutant ATr competitor. B. MEF-2 binds to the hSA p300-

responsive element. The p300 responsive element (ATr) was labelled and used as a probe in

EMSAs as in Figure 4A. For comparison, a commercially available synthetic MEF-2

oligonucleotide (MEF-2) was also used as a probe. Cardiac nuclear proteins formed three

sequence specific bands with both of these probes (labelled 1, 2 and 3 as in Figure 4A). A MEF-

2 antibody supershifted bands 1 and 2 on both oligonucleotides; three novel supershifted bands

are seen (black arrowheads). Lane designations: (-)= probe alone. (NE) = probe + nuclear

extract. (S) 100x cold self competitor. (MEF ) = unlabelled synthetic MEF-2 oligonucleotide.

(ATr) = unlabelled ATr oligonucleotide. (Ab) = antibody against MEF-2.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


28

Figure 5. Overlapping binding sites for MEF-2 and GATA-4 on the p300-responsive

element. A. Sequences of original and truncated ATr oligonucleotides. Sequences are aligned

with a GATA consensus binding site to show the relative position of the GATA (bold) and

MEF-2 consensus sequences (boxed). The position of nucleotide –1256 in the hSA promoter

sequence is shown. B. Bands 1, 2 and 3 exhibit differential affinity for truncated ATr sites. The

oligonucleotides shown in (A) were labelled and used as probes in EMSAs with cardiac myocyte

nuclear extracts as in Figure 4. A MEF-2- specific antibody was used to confirm the presence of

MEF-2 in complexes 1 and 2 (bracket), forming at least two supershifted bands (white

arrowheads). Note that complex 3 (arrow) is enhanced on the “Left” truncated oligomer and

absent or diminished from the “Right” oligomer. As in Figure 4, complex 3 is not supershifted by

the MEF-2 antibody. (-) probe alone. (NE) probe + nuclear extract. (S) 100x cold self competitor.

(ab) = probe, nuclear extract and MEF-2-specific antibody. C. GATA-4 binds to the hSA

p300-responsive element. EMSA of cardiac nuclear extracts was performed as above using the

ATr (Left) oligonucleotide and a commercially available oligonucleotide containing two GATA

binding sites (Santa Cruz Biotechnology). A band similar to complex 3 appears on the GATA

consensus probe, and is effectively competed by ATr (black arrowheads; bar labelled “3”). Both

complexes 3 are supershifted by a GATA-4 specific antibody (white arrowheads). (-) probe

alone; (NE) probe + nuclear extract; (S) 100x cold self competitor; (ATr) 100x cold ATr

oligonucleotide competitor; (ab) GATA-4 specific antibody.

Figure 6. Both MEF-2 and p300 contact the p300 -responsive element.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


29

EMSAs were performed as above, using the original ATr (ATr-Full) and ATr (Left) motifs

as probes (please refer to Figure 5A). A polyspecific antibody against MEF-2 isoforms (MEF2)

and antibodies specific for MEF-2D (MEF2D), p300 (p300) and GATA-4 (GATA) were used to

identify these proteins in DNA-protein complexes, as indicated. The three major protein-DNA

complexes are numbered (1, 2 and 3). (ATr (Full)) As in Figures 4B and 5B, the MEF-2

antibody generated three supershifted bands (black arrows) and depleted Bands 1 and 2 (lane 8).

In contrast, the MEF-2D-specific antibody supershifted only Band 1 (lane 7, black arrowhead). The

p300 antibody also selectively depleted Band 1 and generated at least 1 supershifted band (white

arrowhead). Band 3 (white arrow) is supershifted exclusively by a GATA-4 antibody. (ATr

(Left)) The Left Atr motif was examined for interaction with p300 since this oligomer maximizes

GATA-4 binding. As with the full-length ATr, Band 3 is supershifted by a GATA-4 antibody, but

not by a p300 antibody. None of the complexes formed on the ATr (Left) motif appear to interact

with p300. NE: nuclear extract.

Figure 7. p300 is present at other cardiac promoter MEF-2 sites, but not at the hSA SRF

site. Homologous AT-rich sites in the cardiac α-myosin heavy chain (α-MHC, (48)) and muscle

creatine kinase (M-CK) promoters were synthesized as shown in Table 2 and used as probes in

EMSAs. The hSA p300 responsive element (hSA ATr) and a proximal serum response element

centered at -93, CArG I (hSA-SRE,) were used for comparison. Complexes 1, 2 and 3 can be

identified on all three MEF-2 sites but not on the SRE. Black arrowheads: MEF-2 antibody-

supershifted bands. White arrowheads: p300 antibody-supershifted bands. Lanes are labelled as in

Figure 5 except (Ab) = antibody used for supershift; (M) = MEF-2 antibody; (P) = p300 antibody.

Figure 8. Cardiac MEF-2 and p300 interact in a DNA-dependent manner. A. Independent

immunoprecipitation of MEF-2 and p300. A MEF-2 antibody recognizing MEF-2A, C and D was

used to immunoprecipitate cardiac nuclear extracts. Immunoprecipitates were subjected to Western

analysis using the same MEF-2 antibody (lanes 1-4) and a polyclonal p300 antibody (lanes 5-9).


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


30

Lane 10 shows a p300 Western analysis of cardiac nuclear proteins immunoprecipitated with a

p300 antibody for comparison. MEF-2 is nearly quantitatively precipitated from extracts by this

method and appears as a doublet at around 70 kd (black arrowhead). p300 is not detectable in the

MEF-2 immunoprecipitates, but is clearly seen in the p300 immunoprecipitates (black arrow, right).

Lanes: (T) total nuclear extract. (U) unbound proteins. (W1, W2) proteins in wash fractions 1 and

2. Positions of size markers are shown on left of autoradiogram. (E) proteins specifically eluted

from beads. B. MEF-2 and p300 associate in the presence of the ATr site. A “pulldown”

assay was performed as described in Methods, using a biotinylated hSA ATr oligonucleotide linked

to streptavidin-coated beads for affinity purification of cardiac nuclear proteins. Nuclear extracts

were incubated with the DNA-linked beads for defined intervals and samples of the total input

protein (T), unbound protein (U), wash fractions (W3) and specific eluates (E) were subjected to

Western analysis with MEF-2 and p300 antibodies as in 8A. Nuclear extracts from C2C12

myoblasts were used as positive controls (T (C2)). Upper panel: MEF-2 Western. Cardiac MEF-

2 is eluted as a narrow doublet from the beads (arrows). Note the presence of additional MEF-2

species in the C2C12 extract. Lower panel: p300 Western. A band corresponding to p300 is

visible in the total cardiac nuclear extract (T) and in the specific eluate (E). Note a second band of

smaller size also recognized by the p300 antibody and specifically eluted from the affinity beads.

The identity of this protein is not known but it may represent a degradation product of p300.

Figure 9. MEF-2 but not GATA-4 is synergistic with p300. A. Functional interaction

between MEF-2D and p300. Transcriptional activities of the intact hSA promoter (p2130luc1) and

a mutant lacking the p300 responsive site (mATr) were compared in cardiac myocytes and HeLa

cells as indicated, in the presence and absence of p300, and with or without one of the four MEF-2

isoforms (A-D). 35 mm dishes of cardiac myocytes were transfected with the indicated constructs

at a ratio of reporter: p300: MEF = 2: 1: 1. Total transfected DNA was kept constant by addition of

appropriate amounts of blank CMV expression vector. This graph summarizes three independent

experiments in which substantially similar data was obtained. B. GATA-4 and p300 are not


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


31

synergistic for skeletal actin promoter transcription. Cardiac myocytes were transfected with the

intact hSA promoter (p2130luc1, black bars) or the p300 responsive site mutant (mATr, light bars),

alone or in the presence of p300, GATA-4 or both. Transfections were performed as in 9A and

represent 3 independent determinations. *p < 0.05. **p < 0.01, both for comparison with control.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Table 1. Oligonucleotides used for point mutagenesis

Name Sequence

5'ϕGATA-BglII

3' ϕGATA

5'ATr-NheI

3'ATr

m6 sense

m6 antisense

m8 sense

m8 antisense

m9 sense

m9 antisense

mTEF sense

mTEF antisense

-1805 CCAGATCTACCCTATACTAGTC -1827

-1782 GAGGATAAAGTCTCCTATGGTTC -1804

-1445 GTGCTAGCAATAGAACCTGCAGC -1468

-1422 TGATATATGGGGCTATGCCTTCA -1444

-129 GGCCGAGGGAGGGGGCTCTAGTGCTTAAGACCCAAATATGGC-87

-83 TCGAGCCATATTTGGGTCTTAAGCACTAGAGCCCCCTCCCTC-125

-129 GGCCGAGGGAGGGGGCTCTAGTGCCCAACATCCGGATATGGC -87

-83 TCGAGCCATATCCGGATGTTGGGCAGTAGAGCCCCCTCCCTC -125

-129 GGCCGAGGGAGGGGGCTCTAGTGCCCAACACCCAACCATGGC -8

-83 TCGAGCCATGGTTGGGTGTTGGGCAGTAGAGCCCCCTCCCTC -125

-87 TCGAGAAGGGCAGCGAGGTACCTGCGGGGTGGCGCGGAGGGAA

TCGCCCGC -36

-38 GGGCGATTCCCTCCGCGCCACCCCGCAGGTACCTCGCTGCCCTTC

Table 2. Oligonucleotides used in EMSA assays.

Name Sequence

ϕGATA -sense

ϕGATA -antisense

ϕGATA -mutant-sense

ϕGATA -mutant-antisense

ATr-sense

ATr-antisense

ATr-mutant-sense

ATr--mutant-antisense

α-MHC-ATr sense

α-MHC-ATr antisense

MCK-ATr sense

MCK- ATr antisense

hSA-SRE sense

hSA-SRE antisense

5'ATCCTCACCGGATAGACCCTATAC3'

5'GTATAGGGTCTATCCGGTGAGGAT3'

5'ATCCTCACCAGATCTACCCTATAC3'

5'CTATAGGGTAGATCTGGTGAGGAT3'

5'CATATATCAGTGATATAAATAGAACCTGCA3'

5'TGCAGGTTCTATTTATATCACTGATATATG3'

5'CATATATCAGTGCTAGCAATAGAACCTGCA3'

5'TGCAGGTTCTATTGCTAGCACTGATATATG3'

5'GTAAGGGATATTTTTGCTTCACTTT3'

5'AAAGTGAAGCAAAAATATCCCTTAC3'

5'GCTCTAAAAATAACCCTG3'

5'CAGGGTTATTTTTAGAGC3'

5'CCAACACCCAAATATGG3'

5'GGTTGTGGGTTTATACC3'


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

HindIII +203SstII +38

SstII -36XhoI -87

XmaIII -129SmaI -153

SalI -662XmaIII -698

PvuII -710SmaI -781PstI -1246

XbaI -1300

NdeI -1658

HindIII -2132

Ex1

GATA

SpeI-1759

ATr-2 CArG TEF-1

-2130 -1298 -628 -153 -87 +203-781-1243-1757

p2130luc1

p1757Luc1

p1656Luc1

p1298Luc1

p87Luc1

dNX

dNP

GATA

ATr

mATr GA

m6, m8, m9, mTEF

X

X

X X

X

A.

B.

Figure 1.

AP-1


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

-1810 CCTCA CCGGA TAGAC CCTAT ..A.. .CT..

GATA

-1268 TCAGT GATAT AAATA GAACC .C..G C..

ATr

m GATA

mATr

-114 CTCTA GTGCC CAACA CCCAA ATATG GCTCG T T..G. m6 T..GG m8 CC... m9

CArG I

-84 AGAAG GGCAG CGACA TTCCT GCGGG GTGGC ...GG .A...

TEF-1 Sp-1

mTEF

Figure 1C.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

0

0.1

0.2

0.3

0.4

0.5

p2130p1298

mATrp1656 m6 m8 m9

mTEF

hSA mutant

Promoter Activity

(light units/µg protein)

p87

Figure 2.

** * *


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

0 1 2 3 4 5

Fold induction

p2130luc1

p1757luc1

p1656luc1

p1298luc1

dNX

dNP

mGATA

mATr

mATrGATA

m8

m9

mTEF

p87luc1

-p300

1

1.74 ± 0.3

1.54 ± 0.25

0.6 ± 0.12

1.08 ± 0.2

0.78 ± 0.15

0.97 ± 0.15

0.71 ± 0.12

0.96 ± 0.08

0.33 ± 0.08

0.18 ± 0.06

0.15 ± 0.05

0.05 ± 0.01

+p300

2.51 ± 0.3

2.97 ± 0.88

4.01 ± 0.9

1.61 ± 0.09

2.95 ± 0.74

2.22 ± 0.45

1.67 ± 0.19

1.05 ± 0.35

0.95 ± 0.23

1.16 ± 0.26

0.92 ± 0.32

0.44 ± 0.17

0.25 ± 0.05

2.5

1.71

2.6

2.68

2.73

2.85

1.72

1.48

0.99

3.52

5.11

2.93

5

FoldConstruct

*

Figure 3.

*


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Cardiomyocytes

GATA mATr ATr

- -mGA

SNE NE NE

Probe:

S SATr mATr

ECs

NE S

ATr

12

3

Figure 4.

A.-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

ATr

1

2

3

- NE S AbMEF - NE ATr AbS

MEF-2Probe:

Figure 4.

B.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

CATATATCAGTGATATAAATAGAACCTGCAGTATATAGTCACTATATTTATCTTGGACGT

CATATATCAGTGATATAAATAGAAGTATATAGTCACTATATTTATCTT

TGATATAAATAGAACCTGCA ACTATATTTATCTTGGACGT

ATCAGTGATATAAATAGAACCT TAGTCACTATATTTATCTTGGA

CACTTGATAACAGAA GTGAACTATTGTCTT

Wild type ATr site

Left

Right

Center

Consensus GATA binding site

Figure 5.

abNE S ab- S ab- SNE NE

Center Left RightB.

A.

TruncatedATr sites

1

2

3

-1256


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

- NE ab

ATr (Left)

- NE ab

GATA consensus

S ATrS

Figure 5C.

12

3


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

1

2

3

ATr (Left) ATr (Full)

-NEGATAAntibody

+ + + + + + + +

p300- -

-

GATAp300- -

MEF2DMEF2

Figure 6.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

hSA ATr

1

2

3

- NE S M P

M-CK

- NE S M P - NE S M P

-MHC

Ab: Ab: Ab:

- NE S M P

Ab:

hSA-SRE

Figure 7.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

200 kd

120 kd

100 kd

80 kd

MEF-2 IP

MEF-2 antibody

T U W1 E T U W1 EW2

p300 antibody

p300 IP

Figure 8.

A.

T

207 kd

123 kd

86 kd

U W3 E T (C2)

p300 antibody

T U W3 E T (C2)

44 kd

123 kd86 kd

31 kdMEF-2 antibody

B.

MEF-2

p300

MEF-2

p300


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

A.

Figure 9

hSA

ActivityPromoter

0

5

10

15

20

25

30

35

40

45

50

Control +GATA-4 +p300 +GATA-4+p300

(Light units/µg protein)

* **

hSAPromoterActivity

B.p2130luc1

mATr

(light units/µg protein)

50

40

30

20

10

0

- p300+ p300

- p300

+ p300HeLa cells

Cardiac myocytes

*

MEF-2 species: A B C D A B C D- -

p2130luc1 mATrPromoter:


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Hicks and Nanette H. BishopricTatiana I. Slepak, Keith A. Webster, Jie Zang, Howard Prentice, Ann O'Dowd, Martin N.

2-DControl of cardiac-specific transcription by p300 through myocyte enhancer factor

published online November 28, 2000J. Biol. Chem.

10.1074/jbc.M004625200Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M004625200

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;M004625200v1&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2000/11/28/jbc.M004625200.citation

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=early/2000/11/28/jbc&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2000/11/28/jbc.M004625200.citation

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/

control of cardiac-specific transcription by p300 through myocyte

Documents