contents
DESCRIPTION
Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins, remains to be discovered. This seems highly unlikely . —F. Crick (1958). Contents. Basics RNA structure Prediction RNA structure in biology - PowerPoint PPT PresentationTRANSCRIPT
![Page 1: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/1.jpg)
Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins,
remains to be discovered.
This seems highly unlikely.
—F. Crick (1958)
![Page 2: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/2.jpg)
ContentsContentsBasicsBasics
RNA structureRNA structure
PredictionPrediction
RNA structure in biologyRNA structure in biology
RNA efferencingRNA efferencing
![Page 3: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/3.jpg)
CellCell
Source: “Molecular Cell Biology” by Lodish et al.
![Page 4: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/4.jpg)
Source: “Biology” by Campbell & Reece
![Page 5: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/5.jpg)
Cellular macromoleculesCellular macromolecules
Source: “Molecular Cell Biology” by Lodish et al.
![Page 6: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/6.jpg)
All nucleotides have a common All nucleotides have a common structurestructure
Source: “Molecular Cell Biology” by Lodish et al.
![Page 7: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/7.jpg)
There are five principal bases in nucleic There are five principal bases in nucleic acidsacids
A, G, T, C are present in DNAA, G, U, C are present in RNA
Source: “Molecular Cell Biology” by Lodish et al.
![Page 8: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/8.jpg)
Nucleotide subunits are linked togethNucleotide subunits are linked together by phosphodiester bonds er by phosphodiester bonds
Source: “Molecular Cell Biology” by Lodish et al.
![Page 9: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/9.jpg)
Nucleotide terminologyNucleotide terminology
Source: “Molecular Cell Biology” by Lodish et al.
![Page 10: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/10.jpg)
Native DNA is a double helix of Native DNA is a double helix of complementary anti-parallel chains complementary anti-parallel chains
Hydrogen bonding between complementary base pairs (A-T or G-C) holds the two strands together
Source: “Molecular Cell Biology” by Lodish et al.
![Page 11: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/11.jpg)
DNADNA can undergo reversible strand can undergo reversible strand separationseparation
Source: “Molecular Cell Biology” by Lodish et al.
![Page 12: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/12.jpg)
Source: “Biology” by Campbell & Reece
![Page 13: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/13.jpg)
Source: “Molecular Cell Biology” by Lodish et al.
![Page 14: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/14.jpg)
ContentsContents
BasicsBasics
RNA structureRNA structure
PredictionPrediction
RNA 2RNA 2ndnd structure in biology structure in biology
RNA efferencingRNA efferencing
![Page 15: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/15.jpg)
Complementary sequences in RNA molecules Complementary sequences in RNA molecules maintain RNA secondary structure.maintain RNA secondary structure.
Source: “Bioinformatics” by David W. Mount
![Page 16: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/16.jpg)
Features of RNA Secondary StructureFeatures of RNA Secondary Structure
In DNA, G≡CIn DNA, G≡C AA == TT
In RNA, G≡CIn RNA, G≡C AA == UU GG == UU
![Page 17: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/17.jpg)
Features of RNA Secondary StructureFeatures of RNA Secondary Structure
Primary structurePrimary structure
↓↓
Secondary StructureSecondary Structure
↓↓
Tertiary StructureTertiary Structure
![Page 18: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/18.jpg)
Types of single- & double-stranded regions in Types of single- & double-stranded regions in RNA secondary structures.RNA secondary structures.
Source: “Bioinformatics” by David W. Mount
![Page 19: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/19.jpg)
Interaction of RNA secondary structural Interaction of RNA secondary structural elements.elements.
Source: “Bioinformatics” by David W. Mount
![Page 20: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/20.jpg)
Display of base pairs in an RNA secondary Display of base pairs in an RNA secondary structure by a circle plot.structure by a circle plot.
Source: “Bioinformatics” by David W. Mount
![Page 21: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/21.jpg)
ContentsContentsBasicsBasics
RNA structureRNA structure
PredictionPrediction
RNA structure in biologyRNA structure in biology
RNA efferencingRNA efferencing
![Page 22: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/22.jpg)
PredictionPrediction
Minimum Free-Energy Method
Sequence Co-variation
![Page 23: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/23.jpg)
Global alignmentL G P S S K Q T G K G S – S R I W D N| | | | | | |L N – I T K S A G K G A I M R L G D A
Local alignment- - - - - - - - T G K G - - - - - - - | | |- - - - - - - - A G K G - - - - - - -
Adapted from “Bioinformatics” by D W Mount
![Page 24: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/24.jpg)
DOROTHY--------HODGKINDOROTHYCROWFOOTHODGKIN
Dotplot
Adapted from “Introduction to Bioinformatics“ by A M Lesk
![Page 25: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/25.jpg)
Drosophila melanogaster SLIT protein against itself
http://www.isrec.isb-sib.ch/java/dotlet/Dotlet.html
![Page 26: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/26.jpg)
A G C T A G G A | | | | |C A C T A G G C
Dotplot
![Page 27: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/27.jpg)
5’ A C G U - - - - G C G U 3’
| | | |
3’ U G C G - - - - U G C A 5’
![Page 28: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/28.jpg)
Source: “Bioinformatics” by David W. Mount
![Page 29: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/29.jpg)
Source: “Bioinformatics” by David W. Mount
![Page 30: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/30.jpg)
RNA 2RNA 2ndnd Structure Website Structure Website
http://www.bioinfo.rpi.edu/~zukerm/rna/http://www.bioinfo.rpi.edu/~zukerm/rna/
![Page 31: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/31.jpg)
![Page 32: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/32.jpg)
![Page 33: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/33.jpg)
![Page 34: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/34.jpg)
![Page 35: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/35.jpg)
PredictionPrediction
Minimum Free-Energy Method
Sequence Co-variation
![Page 36: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/36.jpg)
Source: “Bioinformatics” by David W. Mount
![Page 37: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/37.jpg)
Source: “Bioinformatics” by David W. Mount
![Page 38: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/38.jpg)
RNA 2RNA 2ndnd Structure Website Structure Website
http://www.genebee.msu.su/services/rna2_reduced.htmlhttp://www.genebee.msu.su/services/rna2_reduced.html
![Page 39: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/39.jpg)
1 CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATAATCCTCTCCCCGCC----1 CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATAATCCTCTCCCCGCC----2 GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCGCCTCCCGGCACCA2 GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCGCCTCCCGGCACCA3 GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAATATCCGCCTCCCGGCACCA3 GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAATATCCGCCTCCCGGCACCA
![Page 40: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/40.jpg)
![Page 41: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/41.jpg)
1 C1 CGGCGGGGTAGCGGGGTAGAAGCGCAAGCCTGGTAGCGCCTGGTAGCTTCGTCGGGCTCATAATCCTCCGTCGGGCTCATAATCCTCTTCCCCGCCCCGCCC----C----2 G2 GCCC-AGGATAC-AGGATAGGCTCTCCAGTTGGTAGAAGTTGGTAGAGGCAGAGGACTGAAAATCCGCCAGAGGACTGAAAATCCGCCCTCCCGTCCCGGGCACCACACCA3 G3 GCCC-AGGATAC-AGGATAGGCTCTCCAGTTGGTAGAAGTTGGTAGAGGCAGAGGACTGAATATCCGCCAGAGGACTGAATATCCGCCCTCCCGTCCCGGGCACCACACCA
![Page 42: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/42.jpg)
Limitations of Prediction-AssumptionLimitations of Prediction-Assumption
The most likely structure is similar to the The most likely structure is similar to the energetically most stable structure.energetically most stable structure.
The energy associated with any position in The energy associated with any position in the structure is only influenced by local the structure is only influenced by local sequence and structure.sequence and structure.
The structure is assumed to be formed by The structure is assumed to be formed by folding of the chain back on itself in a folding of the chain back on itself in a manner that does not produce any knots.manner that does not produce any knots.
Source: “Bioinformatics” by David W. Mount
![Page 43: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/43.jpg)
ContentsContents
BasicsBasics
RNA structureRNA structure
PredictionPrediction
RNA structure in biologyRNA structure in biology
RNA efferencingRNA efferencing
![Page 44: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/44.jpg)
RNA 2RNA 2ndnd structure in Biology structure in Biology
Nuclear RNA splicingNuclear RNA splicing
Group I/II intron splicingGroup I/II intron splicing
RibosomeRibosome
RNA sensorRNA sensor
![Page 45: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/45.jpg)
Processing of eukaryotic mRNA Processing of eukaryotic mRNA
Source: “Molecular Cell Biology” by Lodish et al.
![Page 46: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/46.jpg)
Source: “Molecular Cell Biology” by Lodish et al.
![Page 47: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/47.jpg)
Source: “Gene VII” by Lewin
![Page 48: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/48.jpg)
Interaction of the RNP motif from U1A Interaction of the RNP motif from U1A protein and RNAprotein and RNA
Figure 11-10
Source: “Molecular Cell Biology” by Lodish et al.
![Page 49: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/49.jpg)
hnRNP proteins may assist in processinhnRNP proteins may assist in processing and transport of mRNAsg and transport of mRNAs
Figure 11-11
Source: “Molecular Cell Biology” by Lodish et al.
![Page 50: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/50.jpg)
Splicing occurs at short, conserved Splicing occurs at short, conserved sequencessequences
Figure 11-14
Consensus sequences around 5 and 3 splice sites in vertebrate pre-mRNA
Source: “Molecular Cell Biology” by Lodish et al.
![Page 51: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/51.jpg)
Splicing proceeds via two sequential Splicing proceeds via two sequential transesterfication reactionstransesterfication reactions
Figure 11-16
Source: “Molecular Cell Biology” by Lodish et al.
![Page 52: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/52.jpg)
Small nuclear RNAs (snRNAs) assist in Small nuclear RNAs (snRNAs) assist in the splicing reaction the splicing reaction
Figure 11-17
Source: “Molecular Cell Biology” by Lodish et al.
![Page 53: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/53.jpg)
Spliceosomal splicing cycleSpliceosomal splicing cycle
Figure 11-19
Source: “Molecular Cell Biology” by Lodish et al.
![Page 54: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/54.jpg)
Source: “Gene VII” by Lewin
![Page 55: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/55.jpg)
Self-splicing group II introns provide Self-splicing group II introns provide clues to the evolution of snRNPsclues to the evolution of snRNPs
Figure 11-20
Source: “Molecular Cell Biology” by Lodish et al.
![Page 56: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/56.jpg)
RNA 2RNA 2ndnd structure in Biology structure in Biology
Nuclear RNA splicingNuclear RNA splicing
Group I/II intron splicingGroup I/II intron splicing
RibosomeRibosome
RNA sensorRNA sensor
![Page 57: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/57.jpg)
Self-splicing group I introns were the firSelf-splicing group I introns were the first examples of catalytic RNAst examples of catalytic RNA
Figure 11-51
Source: “Molecular Cell Biology” by Lodish et al.
![Page 58: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/58.jpg)
A Preorganized Active Site in the Crystal Structure of the TA Preorganized Active Site in the Crystal Structure of the Tetrahymena etrahymena RibRibozyme Barbara L. Golden,* Anne R. Gooding, Elaine R. Podell,Thomas R. ozyme Barbara L. Golden,* Anne R. Gooding, Elaine R. Podell,Thomas R.
Cech*Cech*Science 282, 259~264 (1998)Science 282, 259~264 (1998)
![Page 59: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/59.jpg)
The ribozyme core is formed by the junThe ribozyme core is formed by the junction of four helicesction of four helices
![Page 60: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/60.jpg)
The model for P1’s interaction with the ribozyme juThe model for P1’s interaction with the ribozyme juxtaposes the guanosine-binding sitextaposes the guanosine-binding site
Source: “Molecular Cell Biology” by Lodish et al.
![Page 61: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/61.jpg)
Source: “Gene VII” by Lewin
![Page 62: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/62.jpg)
Source: “Gene VII” by Lewin
![Page 63: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/63.jpg)
RNA 2RNA 2ndnd structure in Biology structure in Biology
Nuclear RNA splicingNuclear RNA splicing
Group I/II intron splicingGroup I/II intron splicing
RibosomeRibosome
RNA sensorRNA sensor
![Page 64: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/64.jpg)
Source: “Gene VII” by Lewin
![Page 65: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/65.jpg)
Source: “Gene VII” by Lewin
![Page 66: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/66.jpg)
Source: “Gene VII” by Lewin
![Page 67: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/67.jpg)
The Structural Basis of Ribosome The Structural Basis of Ribosome Activity in Peptide Bond SynthesisActivity in Peptide Bond Synthesis
Poul Nissen, Jeffrey Hansen, Nenad Ban,Peter Poul Nissen, Jeffrey Hansen, Nenad Ban,Peter B. Moore and Thomas A. SteitzB. Moore and Thomas A. Steitz
Nature (2000) 289, 920~930Nature (2000) 289, 920~930
![Page 68: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/68.jpg)
The ribosome is a ribozymThe ribosome is a ribozyme.e.
![Page 69: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/69.jpg)
![Page 70: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/70.jpg)
![Page 71: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/71.jpg)
![Page 72: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/72.jpg)
RNA 2RNA 2ndnd structure in Biology structure in Biology
Nuclear RNA splicingNuclear RNA splicing
Group I/II intron splicingGroup I/II intron splicing
RibosomeRibosome
RNA sensorRNA sensor
![Page 73: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/73.jpg)
Thiamine derivatives bind messengerThiamine derivatives bind messengerRNAs directly to regulate bacterialRNAs directly to regulate bacterial
gene expressiongene expression
Wade Winkler*, Ali Nahvi† & Ronald R. Breaker*Wade Winkler*, Ali Nahvi† & Ronald R. Breaker*
Nature (2002) 419, 952~956.Nature (2002) 419, 952~956.
![Page 74: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/74.jpg)
![Page 75: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/75.jpg)
![Page 76: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/76.jpg)
http://rfam.wustl.edu/http://rfam.wustl.edu/
![Page 77: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/77.jpg)
![Page 78: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/78.jpg)
![Page 79: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/79.jpg)
![Page 80: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/80.jpg)
Sequence Alignment Scoring versus Structural Alignment Scoring Cell, 109, 137–140, 2002
![Page 81: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/81.jpg)
http://www.imb-jena.de/RNA.htmlhttp://www.imb-jena.de/RNA.html
![Page 82: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/82.jpg)
ContentsContentsBasicsBasics
RNA structureRNA structure
PredictionPrediction
RNA structure in biologyRNA structure in biology
RNA efferencingRNA efferencing
![Page 83: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/83.jpg)
2,431 pairs of sense–antisense transcripts overlapping in the exons of the sense gene by at least 20 bases.NATURE VOL 420 (2002) p563
![Page 84: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/84.jpg)
Science 296:p1263, 2002Science 296:p1263, 2002
A model for the molecular steps in RNA silencing.
![Page 85: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/85.jpg)
Science 296:p1260, 2002Science 296:p1260, 2002
![Page 86: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/86.jpg)
Science 296:p1260, 2002Science 296:p1260, 2002
![Page 87: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/87.jpg)
EMBO Report 2:p986, 2001EMBO Report 2:p986, 2001
![Page 88: Contents](https://reader030.vdocuments.mx/reader030/viewer/2022032804/56812af9550346895d8ee041/html5/thumbnails/88.jpg)