at SciVerse ScienceDirect

Placenta 33 (2012) 874e877

Contents lists available

Placenta

journal homepage: www.elsevier .com/locate/placenta

Short communication

Comparative analysis of the invasion-associated genes expression pattern in firsttrimester trophoblastic (HTR-8/SVneo) and JEG-3 choriocarcinoma cells

P. Suman, S.K. Gupta*

Reproductive Cell Biology Laboratory, National Institute of Immunology, Aruna Asaf Ali Marg, New Delhi 110067, India

a r t i c l e i n f o

Article history:Accepted 20 June 2012

Keywords:JEG-3HTR-8/SVneoTrophoblastInvasionMicroarrayMatrix metalloproteinase

Abbreviations: MMP, matrix metalloproteinase; Talloproteinase; PLAT, tissue plasminogen activator; Purokinase receptor; RASGRF2, Ras-specific guanine nIGF2, insulin-like growth factor 2; HIG2, hypoxia-indgrowth factor; CXCL1, chemokine (C-X-C motif) ligamotif) receptor 7; STAT, signal transducer and actisuppressor of cytokine signaling.* Corresponding author. Tel.: þ91 11 26741249; fax

E-mail address: skgupta@nii.ac.in (S.K. Gupta).

0143-4004/$ e see front matter � 2012 Elsevier Ltd.http://dx.doi.org/10.1016/j.placenta.2012.06.017

a b s t r a c t

Several cellular models of trophoblast have been proposed to understand their invasion. We had re-ported that JEG-3 and HTR-8/SVneo cells show differential invasive behavior in response to IL-11treatment. So, the present study aims to compare the expression of invasion-associated molecules inthese two cell lines by performing cDNA microarray followed by quantitative RT-PCR. We have observedthat HTR-8/SVneo cells have significantly higher invasiveness than JEG-3 cells, which might be due tohigher expression of proteases and signaling intermediates of JAK/STAT and MAPK signaling pathways.Like extravillous trophoblasts (EVTs), a higher expression of functionally significant proteases like MMP1,MMP2, MMP9, PLAU etc in HTR-8/SVneo cells, project them as a close mimic of EVTs under in vitroconditions.

� 2012 Elsevier Ltd. All rights reserved.

1. Introduction

Trophoblasts of human placenta undergo series of changesduring the course of establishment of pregnancy [1]. It undergoesproliferation as well as differentiation into the syncytial, invasiveand endovascular trophoblast. To understand the molecularmechanism of trophoblast invasion at the placental bed, severaltrophoblast models have been employed [2e4]. Amongst them,JEG-3 choriocarcinoma and HTR-8/SVneo (first trimester trans-formed cells) have been used by several investigators to answer thequestions related to the regulation of trophoblast invasion.Recently, we have shown that IL-11 differentially regulates theinvasiveness of JEG-3 and HTR-8/SVneo cells by increasing theinvasiveness of JEG-3 cells while reducing the invasiveness of HTR-8/SVneo cells through differentially regulating the expression ofseveral proteins like mucin 1, Fos and MMP23B [4]. In the presentmanuscript, we intend to investigate the cellular differences at theexpression of invasion-associated genes, which might contribute to

IMP, tissue inhibitor of met-LAUR, plasminogen activator,ucleotide-releasing factor 2;ucible gene 2; PGF, placentalnd 1; CCR7, chemokine (C-Cvator of transcription; SOCS,

: þ91 11 26742125.

All rights reserved.

the differential responsiveness of these cell lines towards exoge-nous treatment.

2. Materials and methods

2.1. Cell culture and invasion assay

HTR-8/SVneo cells (kindly provided by Dr. Charles Graham, Queen’s University,Canada) and JEG-3 cells (DMZO, Bramschweig, Germany) were maintained inRPMI-1640 and DMEM medium (Sigma Aldrich Inc., St. Louis, MO, USA) respec-tively, supplemented with 10% fetal bovine serum (Biological Industries, Kibbutzbeit Haemek, Israel) and an antibiotic-antimycotic cocktail [Penicillin (100 units/ml), Streptomycin (100 mg/ml) and Amphotericin B (0.25 mg/ml)] (BiologicalIndustries) under standard conditions (37 �C, 5% CO2, humidified atmosphere).Matrigel matrix based invasion assays were carried out to analyze the basalinvasiveness of JEG-3 and HTR-8/SVneo cells as described before [4]. Briefly, about0.1�106 cells/transwell were added onto the Matrigel matrix and kept for 24 hunder normal culture conditions. After 24 h, cells which came out of the transwellinserts were stained with Hoechst 33342 dye and visualized under the microscopeas described before [4].

2.2. Microarray and quantitative reverse transcriptase-polymerase chain reaction(QRT-PCR)

Cells (w105) were grown into the six-well culture plates and after 24 h, totalRNA was isolated using the Tri reagent (Sigma Aldrich Inc.) following the standardprotocol. The isolated RNA was processed for the microarray analysis using Gen-eChip� Human Exon 1.0 ST (Affymetrix, Santa Clara, CA). For normalizing andsummarizing probe-level intensity measurements from GeneChips, GCRMA wasused which converts .CEL files into expression set using the Robust Multi-arrayAverage (RMA) with the help of probe sequence and with GC-content backgroundcorrection. Statistical (Student’s t test) analysis was performed with Affymetrix DataMining Tool software. The datawere filtered on the criteria of 1.5-fold up- or 0.5-folddown-regulation taking into account the genes whose p < 0.05. Form the obtained

P. Suman, S.K. Gupta / Placenta 33 (2012) 874e877 875

result, we performed a manual analysis for the change in the expression of invasionassociated genes (based on the existing literature) and grouped into proteases,cytokines and signaling intermediates. Amongst these, expression of some of themolecules has been verified by qRT-PCR using gene specific primers (AppendixTable 1) as described before [4]. Average threshold cycle (Ct) values for 18S rRNA(run in parallel reactions to the genes of interest) were used to normalize theaverage Ct values of the gene of interest. These values were used to calculate theaverage for each group from different experiments and the relative dCt was used todetermine the change in the expression between the groups.

2.3. Statistical analysis

All experiments were performed at least three times and the results areexpressed as mean � SEM. For different sets of experiments fold change wascalculated with respect to JEG-3 control and the statistical analysis was done bycomparing the means of the control and experimental sets by using paired Student’st-test or Wilcoxon signed rank test. A value of p < 0.05 was considered to bestatistically significant.

3. Results and discussion

3.1. HTR-8/SVneo cells have higher invasive ability than that of JEG-3 cells

In vitro invasion assay showed a significantly higher invasive-ness of HTR-8/SVneo cells as compared to JEG-3 cells (Fig. 1, PanelA). This observation was intriguing as JEG-3 cells even being

Fig. 1. Invasiveness and invasion-associated gene expression in JEG-3 and HTR-8/SVneo cellplot for the gene expression following microarray analysis, showing the diversity and level ofform of different color dots placed wide away from the median line between X and Y axis. Pacells as compared to JEG-3 cells as analyzed by qRT-PCR (Y axis: before break: linear scale

choriocarcinoma in origin showed a significantly lower invasiveability as compared to the SV40 transformed trophoblast (HTR-8/SVneo) cells. A reasonable answer for this basic difference mightcome by analyzing the global gene expression pattern in thesetrophoblast cells lines.

3.2. Microarray based comparative analysis of invasion-associatedgene expression in JEG-3 and HTR-8/SVneo cells

In a recently published report, microarray based comparison ofthe trophoblastic cells lines (including JEG-3 andHTR-8/SVneocells)and primary trophoblasts have identified major differences in theirgene expression profiles, suggesting that these cell lines differhugely in their molecular phenotype [3]. While, the study givesimmense insights on the expression of trophoblast specific genesignatures in different cell lines, how these differences contributetowards different phenotypic behavior of the cells has not beenelucidated. So,wecarriedout a comparative analysis of the invasion-associated gene expression in JEG-3 and HTR-8/SVneo cells afterperforming the cDNA microarray. Here we observed that ascompared to JEG-3 cells, inHTR-8/SVneocells, therewereabout1176geneswhich showed at least 2 fold increasewhile, about 1334 genesshowed about 2 fold decrease in their expression (Fig. 1, Panel B).

s. Panel A: Basal level of invasiveness of JEG-3 and HTR-8/SVneo cells. Panel B: Scatterexpression of transcript between HTR-8/SVneo and JEG-3 cells has been depicted in thenel C: Relative expression of different proteases and protease inhibitors in HTR-8/SVneoand after break: log scale). *p < 0.05; **p < 0.001.

Table 1Primer sequences used for the real-time PCR.

Genename

Sequence Annealingtemp

Productsize (bps)

MMP1 F: 50 CCCATCGGCCCACAAACCCC 30 60 �C 146R: 50 AGCAGCTTCAAGCCCATTTGGCA 30

MMP2 F: 50 ACCGCAAGTGGGGCTTCTGC 30 60 �C 72R: 50 CGTGGCCAAACTCGTGGGCT 30

MMP9 F: 50 CCGGCATTCAGGGAGACGCC 30 61 �C 71R: 50 TGGAACCACGACGCCCTTGC 30

MMP23B F: 50 GCTGGTCGCCCTGTGCCTC 30 60 �C 177R: 50 GGAGTCAGCGTGTAGCGGCG 30

TIMP1 F: 50 TGACATCCGGTTCGTCTACA 30 62 �C 248R: 50 GTTTGCAGGGGATGGATAAA 30

P. Suman, S.K. Gupta / Placenta 33 (2012) 874e877876

Out of the thousands of differentially expressed genes (GEOdatabase accession no. GSE31608), those which could be of rele-vance to regulate the invasive behavior in these two cell lines havebeen summarized in Table 1. It was interesting to note that HTR-8/SVneo cells have a higher level of expression of most of thepotential well documented invasive molecules like MMP1, MMP2,MMP9, MMP23B, PLAU, PLAT etc as compared to JEG-3 cells whichhas higher expression of onlyMMP14 andMMP19. Further, qRT-PCRalso confirmed a significantly higher expression of MMP1, MMP2,MMP3,MMP9,MMP23B and PLAU in HTR-8/SVneo cells (Fig. 1, PanelC). Like HTR-8/SVneo cells, EVT also express high levels of proteaseslike MMP2, MMP9, PLAU etc [5e7]. A decrease in the expression ofone or the other amongst these, leads to reduction in trophoblastinvasiveness [5e7]. Additionally, a reduction in MMP1 expression(highly expressed MMP in HTR-8/SVneo cells) in EVT has beenfound to be associatedwith cases of pre-eclampsia and fetal growthrestriction [8].

These two cell liens not only show differences in the proteaseexpression but also have differences in the expression of proteaseinhibitors. We observed a significantly higher expression of TIMP1in HTR-8/SVneo cells while a higher expression of TIMP4 in JEG-3cells (Table 1 and Fig. 1, Panel C). TIMP1 and TIMP4 have remark-able differences in the regulation of proteolytic activity of prote-ases. TIMP1 inhibits the enzymatic activity of MMP1, MMP3 andMMP9 very efficiently. However, TIMP4 showing least similarity toTIMP1, is a good inhibitor for all classes of MMPs withoutremarkable preference for specific MMPs [9,10]. Proteolytic activityof MMP2, MMP19, MMP26 etc can be efficiently inhibited by thisbut not by TIMP1. There could be several ways to regulate theexpression of protease inhibitors in trophoblast cells. Amongstthem, methylation at the promoter site might be one of the reasonsfor the lower level of TIMP1 in JEG-3 cells, as in choriocarcinomacells a lower level of TIMP3 has been shown to be due to themethylation of their promoter site [11]. However, it needs furtherinvestigation. IL-12 has inhibitory effect on JEG-3 cells invasivenessby up-regulating the expression of TIMP1 [12]. Apart from these,the expression of MMPs and TIMPs is influenced by the expressionof Protein phosphatase 1A (PPM1A) in cytotrophoblast cells [13].

After looking at the expression pattern of individual molecules,we carried out pathway analysis by using DAVID functional anno-tation tool (DAVID Bioinformatics Resources 6.7, NIAID/NIH, USA)

Table 1Invasion associated genes over- or under-expressed in HTR-8/SVneo cells ascompared to JEG-3 cells.

Protease and protease inhibitors Cytokine and signaling intermediates

Over Under Over Under

MMP1 (111) MMP14 (5.3) OSMR (17.8) RASGRF2 (17.0)TIMP1 (11.6) MMP19 (2.5) TGFB2 (13.14) IGF2 (16.0)PLAU (8.2) TIMP4 (2.3) CXCL1 (8.9) HIG2 (7.3)MMP2 (8.1) IL-1 beta (5.5) IL1R1 (7.2)PLAT (6.2) IL-8 (4.8) TGFBR3 (7.2)PLAUR (4.1) CSF1 (4.0) SP6 (6.3)MMP9 (4.0) MAPKK 12 (3.8) CSF3R (5.7)MMP23B (2.0) LIFR (3.6) RASGRF1 (4.5)

IL4R (2.9) PGF (4.4)SOCS5 (2.6) CSF1R (4.3)IL11 (2.6) CCR7 (3.6)STAT3 (2.5) MAP2K1IP1 (2.6)MAPK3K5 (2.4) MAP3K4 (2.5)JAK2 (2.3) STAT1 (2.4)NOTCH2 (2.2) FOS (2.1)STAT5B (2.2) MAP3K8 (2.0)MAP3K14 (2.0)MAP3K3 (2.2)

Values in parenthesis show fold change in expression in HTR-8/SVneo cells ascompared to JEG-3 cells.

and found that molecules of several pathways are getting signifi-cantly over- or under-expressed in HTR-8/SVneo cells as comparedto JEG-3 cells [14,15]. In HTR-8/SVneo cells, molecules of MAPK,cytokineecytokine receptor interaction, chemokine signaling,calcium signaling, focal adhesion, ECMereceptor interaction etcwere over-represented whereas, molecules of p53 and ErbBsignaling were highly represented in JEG-3 cells. HTR-8/SVneo cellsalso showed higher expression of several pro-invasive cytokineslike IL-8, IL-1b, IL-11 etc, which might be contributory factor for thehigher basal level of activation of STAT3 and ERK1/2 signalingpathways in these cells [4]. But, activation of both STAT and ERK1/2dependent signaling pathways might also be a function of thetransformation of cells with SV40 large T antigen [16,17].

Taking into consideration of the expression of proteases likeMMP1, MMP2, MMP9, PLAU and protease inhibitor (TIMP1) in HTR-8/SVneo cells, it can be concluded that as compared to JEG-3 cells, ithas greater degree of similarity with the EVTs and therefore, it canbe used as a close mimic of EVTs under in vitro conditions.

Acknowledgements

Financial assistance from National Institute of Immunology,NewDelhi and the Indian Council of Medical Research, Governmentof India are greatly acknowledged.

Appendix A

TIMP4 F: 50 TGGGTGAGGCATGCAGCTGC 30 60 �C 114R: 50 GGGTCTGCACTGGCCGGAAC 30

PLAU F: 50 TGGTCGTGAGCGACTCCAAAGGCAG 30 60 �C 220R: 50 GTGTCAGTGCTGGCCTTTCCTCG 30

18S F: 50 GGAGAGGGAGCCTGAGAAAC 30 60 �C 171R: 50 CCTCCAATGGATCCTCGTTA 30

References

[1] Bischof P, Irminger-Finger I. The human cytotrophoblastic cell, a mononuclearchameleon. Int J Biochem Cell Biol 2005;37:1e16.

[2] Liu ZK, Liu HY, Fang WN, Yang Y, Wang HM, Peng JP. Insulin-like growth factorbinding protein 7 modulates estrogen-induced trophoblast proliferation andinvasion in HTR-8 and JEG-3 Cells. Cell Biochem Biophys 2012;63:73e84.

[3] Bilban M, Tauber S, Haslinger P, Pollheimer J, Saleh L, Pehamberger H, et al.Trophoblast invasion: assessment of cellular models using gene expressionsignatures. Placenta 2010;31:989e96.

[4] Suman P, Godbole G, Thakur R, Morales-Prieto DM, Modi DN, Markert UR,et al. AP-1 transcription factors, mucin-type molecules and MMPs regulate theIL-11 mediated invasiveness of JEG-3 and HTR-8/SVneo trophoblastic cells.PLoS One 2012;7:e29745.

[5] Lash GE, Otun HA, Innes BA, Bulmer JN, Searle RF, Robson SC. Low oxygenconcentrations inhibit trophoblast cell invasion from early gestation placentalexplants via alterations in levels of the urokinase plasminogen activatorsystem. Biol Reprod 2006;74:403e9.

P. Suman, S.K. Gupta / Placenta 33 (2012) 874e877 877

[6] Pang ZJ, Zhou JG, Huang LP. Interleukin-10 may participate in regulatingtrophoblast invasion in human placentae throughout gestation. Am J ReprodImmunol 2008;60:19e25.

[7] Onogi A, Naruse K, Sado T, Tsunemi T, Shigetomi H, Noguchi T, et al. Hypoxiainhibits invasion of extravillous trophoblast cells through reduction of matrixmetalloproteinase (MMP)-2 activation in the early first trimester of humanpregnancy. Placenta 2011;32:665e70.

[8] Lian IA, Toft JH, Olsen GD, Langaas M, Bjørge L, Eide IP, et al. Matrix metal-loproteinase 1 in pre-eclampsia and fetal growth restriction: reduced geneexpression in decidual tissue and protein expression in extravillous tropho-blasts. Placenta 2010;31:615e20.

[9] Stratmann B, Farr M, Tschesche H. MMP-TIMP interaction depends on residue2 in TIMP-4. FEBS Lett 2001;507:285e7.

[10] Melendez-Zajgla J, Del Pozo L, Ceballos G, Maldonado V. Tissue inhibitor ofmetalloproteinases-4. The road less traveled. Mol Cancer 2008;7:85.

[11] Feng H, Cheung AN, Xue WC, Wang Y, Wang X, Fu S, et al. Down regulationand promoter methylation of tissue inhibitor of metalloproteinase 3 inchoriocarcinoma. Gynecol Oncol 2004;94:375e82.

[12] Karmakar S, Dhar R, Das C. Inhibition of cytotrophoblastic (JEG-3) cell invasionby interleukin 12 involves an interferon gamma-mediated pathway. J BiolChem 2004;279:55297e307.

[13] Zhang B, Zhou Z, Lin H, Lv X, Fu J, Lin P, et al. Protein phosphatase 1A (PPM1A)is involved in human cytotrophoblast cell invasion and migration. HistochemCell Biol 2009;132:169e79.

[14] Dennis Jr G, Sherman BT, Hosack DA, Yang J, Gao W, Lane HC, et al. DAVID:database for annotation, visualization, and integrated discovery. Genome Biol2003;4:3.

[15] Huang da W, Sherman BT, Lempicki RA. Systematic and integrative analysis oflarge gene lists using DAVID bioinformatics resources. Nat Protoc 2009;4:44e57.

[16] Mossman BT, Gruenert DC. SV40, growth factors, and mesothelioma: anotherpiece of the puzzle. Am J Respir Cell Mol Biol 2002;26:167e70.

[17] Woetmann A, Nielsen M, Christensen ST, Brockdorff J, Kaltoft K, Engel AM,et al. Inhibition of protein phosphatase 2A induces serine/threonine phos-phorylation, subcellular redistribution, and functional inhibition of STAT3.Proc Natl Acad Sci USA 1999;96:10620e5.