Common Mutations in BRCA1 and BRCA2 DoNot Contribute to Early Prostate Cancer in

Jewish Men

Kent L. Nastiuk,1 Mahesh Mansukhani,1 Mary Beth Terry,2Piyumika Kularatne,1 Mark A. Rubin,1 Jonathan Melamed,3

Marilie D. Gammon,2 Michael Ittmann,3,4 and John J. Krolewski1*1Department of Pathology and Irving Comprehensive Cancer Center, Columbia University

College of Physicians and Surgeons, New York, New York2Division of Epidemiology, Columbia School of Public Health, New York, New York

3Department of Pathology and Kaplan Comprehensive Cancer Center, New York UniversitySchool of Medicine, New York, New York

4Department of Pathology, New York Department of Veterans Affairs Medical Center,New York, New York

BACKGROUND. Families with a high incidence of hereditary breast cancer, and subse-quently shown to have terminating mutations in BRCA1 or BRCA2, appear to have a higherincidence of prostate cancer among male relatives. We aimed to determine whether thecommon germline mutations of BRCA1 or BRCA2 in Ashkenazi Jewish men predisposedthem to prostate cancer.METHODS. We examined genomic DNA from 83 (for BRCA1 185delAG) or 82 (for BRCA26174delT) Ashkenazi Jewish prostate cancer patients, most of whom were treated at a rela-tively young age, for the most common germline mutation in each gene seen in the Ashkenazipopulation.RESULTS. Our study should have been able to detect a 4–5-fold increase in the risk ofprostate cancer due to mutation of BRCA1 or BRCA2. However, only one (1.15%; 95% con-fidence interval, 0–3.6%) of the patients was heterozygous for the BRCA1 mutant allele, andonly two were heterozygous for the BRCA2 mutation (2.4%; 95% confidence interval, 0–6.2%).CONCLUSIONS. The incidence of each of the germline mutations in these prostate cancerpatients closely matched their incidence (about 1%) in the general Ashkenazi Jewish popu-lation. This suggests that unlike cases of breast and ovarian cancers, mutations in BRCA1 orBRCA2 do not significantly predispose men to prostate cancer. Prostate 40:172–177, 1999.© 1999 Wiley-Liss, Inc.

KEY WORDS: risk; gene; breast; neoplastic; heterozygote

INTRODUCTION

Studies have suggested a linkage between breastand ovarian cancer in families carrying germline mu-tations of BRCA1 or BRCA2 and prostate cancer inmale relatives [1–4]. With the advent of genetic testingamong vulnerable populations for mutations in thesegenes, it is increasingly important to define the level ofrisk for prostate cancer for the relatives of BRCA1 andBRCA2 heterozygotes. Loss of heterozygosity (LOH),consistent with tumor suppressor gene inactivation in

Grant sponsor: Public Health Service; Grant numbers: CA 56862, CA66224.Present address of Kent L. Nastiuk is Department of Pathology,University of California at Irvine, MedSci D440, Irvine, CA 92697.Present address of Michael Ittmann is Department of Pathology,Houston Veterans Affairs Medical Center, 2002 Holcombe Ave.,Houston, TX 77030.*Correspondence to: John J. Krolewski, now at the Department ofPathology, University of California at Irvine, MedSci D440, Irvine,CA 92697. E-mail: jkrolews@uci.eduReceived 19 October 1998; Accepted 17 February 1999

The Prostate 40:172–177 (1999)

© 1999 Wiley-Liss, Inc.

somatic cells, is found in prostate cancers at both 17q,the location of BRCA1 [5–7], and 13q, the site ofBRCA2 and Rb [8–10]. In addition, the region lost on17q [11,12] suppresses the malignant phenotype of aprostate cancer cell line [13]. BRCA1 is mutated in upto 2% of Ashkenazi Jews, with a terminating mutationin exon 2 (185delAG) accounting for >50% of the del-eterious changes [1,14,15]. For BRCA2, the principaldeleterious mutation (6174delT) occurs in ∼1% of Ash-kenazim [1,15–17]. Mutation in either gene is believedto confer an 80–90% lifetime risk of breast cancer inaffected families [18,19], although a recent article sug-gests the risk may be as low as 50% [1]. To test wheth-er a germline mutation of either BRCA gene correlateswith an increased risk of prostate cancer, we examinednonneoplastic tissue from relatively young Ashkenazimen treated for prostate cancer for the presence of theBRCA1 185delAG or the BRCA2 6174delT alleles.

MATERIALS AND METHODS

Archival records from both the New York Univer-sity and Columbia Presbyterian medical centers from1991–1996 were examined for young prostate cancerpatients with traditional Eastern European Jewish sur-names. The population dynamics of Jewish New York-ers born between 1920–1950 strongly suggest thatthese individuals are of Ashkenazic heritage. Patientswith surnames which might indicate either a Sephar-dic or Ashkenazic heritage were eliminated from theanalysis. Nontumor tissue (principally lymph nodes),formalin-fixed and embedded in paraffin, was re-trieved for 83 cases of stage B prostate cancer, assignedto age bins (under 40, 40–50, 50–60, and over 60), andanonymized (Table I). Genomic DNA was isolatedfrom sections cut from the paraffin blocks by xyleneextraction, ethanol-washed, and then processed usinga tissue DNA isolation kit (Qiagen, Inc., Chatsworth,CA). The DNA was PCR-amplified by 45 cycles of94°C for 45 sec, 53–59°C for 2 min, and 72°C for 1 min.One of these cases failed to amplify using the BRCA2primers, and so was excluded from the analysis. The

primers to amplify the BRCA1 185delAG region were:primer pair A, forward: GAAGTTGTCATTTTA-TAAACCTTT, reverse: TGTATGATCCCTTC-TTTTCTG; primer pair B, forward: TTCTAATGTGT-TAAAGTTCATTGG, reverse: TACGTTTACTTGTCT-TAACTGGAA; primer pair C, forward: GGTTTG-TATCATTCTAAAACC, reverse: CCGATAACAT-TAACGACTAAA. The primers to amplify the BRCA26174delT region were: primer pair A, forward: GTC-TGGATTGGAGAAAGTTT, reverse: AAGTCTGGTC-GAGTGTTCTC; primer pair B, forward: ATCACCTT-GTGATGTTAGTTTGG, reverse: CCATAGTCTAC-G A A G T A T G T T T ; p r i m e r p a i r C , f o r w a r d :GATAATGATGAATGTAGCACGC, reverse :GCAAGTGGAAAGCAAGTTTCCA.

Presence of the mutant alleles was detected by het-eroduplex analysis (HDA) of the PCR products [20].Briefly, PCR reactions were heated to 98°C for 5 min,cooled to 30°C over 90 min, separated on gradient4–20% polyacrylamide Tris-borate-EDTA gels (Novex,San Diego, CA), and stained with ethidium bromide.The amplification products of primer pair A for eitherBRCA1 or BRCA2 from selected patient samples weresequenced from the nested (primers B, forward, seeFigs. 1, 2) primer for each on an ABI 373A sequencer(PE Applied Biosystems, Foster City, CA) at the Co-lumbia University Cancer Center.

Ninety-five percent confidence limits (CIs) werecalculated for the carrier frequencies, assuming thatthe number of positives followed a Poisson distribu-tion. The Poisson distribution was selected for statis-tical analyses due to the rarity of the mutations.

RESULTS

BRCA1

Fifty-seven young (less than 60 years at prostatec-tomy) prostate cancer patients and 26 older patientswere screened for germline deletion of 185AG inBRCA1 (Table I). Genomic DNA was PCR-amplifiedusing primers flanking exon 2 (primer pair A, Fig. 1).After HDA, only one of the samples from patientswho had undergone prostatectomy before age 60, andnone from older patients, showed heteroduplex for-mation (lane P54 in Fig. 1A). Equivalently retardedbands appeared in genomic DNA amplified from non-neoplastic tissues of an individual heterozygotic forthe 185delAG mutation [20] (lane 723, Fig. 1A), but notin DNA known to be homozygous wild-type (lane737, Fig. 1A). The retardation of the heteroduplexbands relative to the homozygous band (‘Homo” inFig. 1A) was identical for the patient samples and anequimolar mixture of PCR products amplified fromBRCA1 mutant and normal plasmids constructed pre-

TABLE I. Age and Genotype Distribution of ProstateCancer Patients

Age binTotal

BRCA1 185delAGTotal

BRCA2 6174delT

<40 1 0 1 041–50 8 0 8 051–60 48 1 47 2>60 26 0 26 0Total 83 1 82 1

BRCA1 and BRCA2 in Prostate Cancer 173

viously [20]. Heteroduplex formation was confirmedby PCR-HDA using nested primers (primer pair B,Fig. 1B). Finally, to eliminate any possibility of plas-mid or PCR product contamination, PCR-HDA wasperformed with flanking primers complementary toan area not represented in any of our cloned or pre-

viously amplified DNA. Only the positive control(723) and sample P54 generated heteroduplexes(primer pair C, Fig. 1C). The positive and an addi-tional four negative genomic DNA samples were se-quenced. Each of the negative DNAs generated an un-ambiguous sequence corresponding to that reportedin GENBANK, while the sample which gave hetero-duplex bands (P54) produced an unambiguous se-quence up to the point of the deletion, whereupon the

Fig. 1. BRCA1 185delAG mutation screen. Top: Schematic dia-gram of the region of the BRCA1 gene surrounding the 185delAGmutation, with exon 2 indicated by the box, and the site of thedeletion indicated by the inverted triangle. PCR primer pair loca-tions are indicated below (f, forward; r, reverse). Numbering re-fers to base pairs from the transcription start site of the cDNA(from GENBANK U14680). Shown below are ethidium-stainedgels of HDA using (A) primer pair A (amplicon length, 237 bp), (B)primer pair B (188 bp), and (C) primer pair C (375 bp). Each laneis labeled with the DNA sample analyzed. Sample designations aredefined in the text.

Fig. 2. BRCA2 6174delT mutation screen. Top: Schematic dia-gram of the region of the BRCA2 gene surrounding the 6174delTmutation (exon 11), with the site of the deletion indicated by theinverted triangle. PCR primer pair locations are indicated below (f,forward; r, reverse). Numbering refers to base pairs from thetranscription start site (from GENBANK U43746). Shown beloware ethidium-stained gels of HDA using (A) primer pair A (275 bp),(B) primer pair B (149 bp), and (C) primer pair C (477). Lanes arelabeled as in Figure 1.

174 Nastiuk et al.

sequence became degenerate exactly in accord withthe expected result of a 2-bp deletion in one allele and,as seen in the known heterozygote, sample 723 (datanot shown).

BRCA2

Fifty-six young (less than 60 years old at prostatec-tomy) patients and 26 older patients were screened forgermline deletions of 6174T in BRCA2 (Table I). APCR-HDA completely analogous to that employed fordetecting the BRCA1 mutation was carried out onthese 82 samples (see schematic at top of Fig. 2).Equimolar amounts of PCR products from BRCA2wild-type and 6174delT mutant plasmids were usedas standards, since we had not previously identifiedany heterozygotic patient samples to use as a control(“Std.” in Fig. 2A,C). Two samples (cases P52 and P61)showed heteroduplex formation with each primer pair(P52 is shown in Fig. 2A–C; P61 is not shown). ThePCR product from each sample was sequenced, and aswas the case for BRCA1, the resulting sequence wasunambiguous up to the point of the mutation, where-upon it showed the multiple peaks in the elec-tropherogram expected to result from a 1-bp deletionin one allele (data not shown).

DISCUSSION

Several studies have suggested an increased risk ofprostate cancer among male relatives in families witha high incidence of breast and/or ovarian cancer whoare heterozygotic for termination mutations in eitherBRCA1 or BRCA2. In 33 families with linkage toBRCA1. Ford et al. [2] found a significant increase inprostate cancer among BRCA1 heterozygotes (relativerisk, 3.33). Phelan et al. [21] reported a relative risk of4.22 for developing prostate cancer in families whohad mutations in BRCA2. In a smaller number of fami-lies, Easton et al. [22] estimated a relative risk of 2.89.Among first-degree relatives in Icelandic families witha terminating mutation in BRCA2, Sigurdsson et al.[23] estimated a relative risk of 4.6. In contrast, amongwomen with mutations in BRCA1, FitzGerald et al.[24] found a 27-fold increase in the relative risk ofearly-onset breast cancer. In their recent report,Struewing et al. [1] examined a self-identified popu-lation of Ashkenazim which had a disproportionatenumber of subjects with family histories of cancer.Among 380 reported incidences of first-degree rela-tives with prostate cancer, 5 were from subjects het-erozygotic for BRCA1 185delAG and 6 from BRCA26174delT heterozygotes. From these groups they esti-mated the risk of prostate cancer in BRCA1 andBRCA2 heterozygotes, and reported little estimated

risk before age 50, but estimated a 25% (for BRCA1heterozygotes) or 5% (for BRCA2 heterozygotes) riskat age 70, while the estimated risk for noncarriers wasonly 4%.

Cancer-prone families may have other genetic de-fects which contribute to the increase in relative risk,and the risk estimates of Struewing et al. [1] werebased on a small number of reports of relatives whohad not been directly genotyped. To avoid these con-founding influences, we examined younger Ash-kenazi prostate cancer patients, regardless of familyhistory, for evidence of an increase in the frequency ofmutant germline BRCA1 and BRCA2 alleles. A previ-ous, smaller study of BRCA1 in younger prostate can-cer patients of unknown genetic background was in-conclusive [25]. In a study of approximately 3,000 U.S.Ashkenazi individuals who were unselected for a per-sonal or family history of cancer, the carrier frequencyof the BRCA1 185delAG mutation was found to be1.15% (95% CI, based on the Poisson distribution,0.78–1.63%) [15]. The corresponding prevalence ofBRCA1 185delAG in our study was 1.2% (CI, 0–3.6%).While we have not directly estimated the frequency ofthe 185delAG mutation in the Ashkenazi populationtreated in our hospitals, we can estimate, using thegeneral Ashkenazi population value (above), that ifBRCA1 185delAG increases the relative risk fourfold,we would expect to find 4 patients among our sampleof 84. However, we found only one patient (CI, 0–3)with the 185delAG mutation among 83 with predomi-nantly early-onset prostate cancer, in line with the ex-pected value if there were no increase in the relativerisk of prostate cancer among carriers.

Inactivation of BRCA2 by the 6174delT mutationoccurs in 1.38% (CI, 0.97–1.9%) of the Ashkenazi Jew-ish population [15]. If we again use the general popu-lation values for the frequency of BRCA2 6174delT,and there were no increase in relative risk for oursample of prostate cancer cases, we would expectonly 1 (CI, 0–3) positive sample. Instead, we found 2(CI, 0–5) heterozygotes among the 83 patients ana-lyzed, a frequency of 2.4% (CI, 0–6.2%). If the 6174delTmutation increased the relative risk of prostate cancerin our sample fivefold, we would expect to see six ormore BRCA2 6174delT carriers, rather than the twoheterozygotes we observed. Among Icelanders, a ter-minating mutation (999del5) of BRCA2 occurs in 0.4%of the population. For Icelandic prostate cancer pa-tients diagnosed at less than 65 years of age, and cho-sen without regard to family history of breast andovarian cancers, 2.7% (2 of 75) had the terminatingmutation, but the authors were unable to draw firmconclusions, due in part to the small sample popula-tion used to determine the mutant allele frequencyamong the general Icelandic population [18].

BRCA1 and BRCA2 in Prostate Cancer 175

It is expected that germline terminating mutationsof BRCA1 or BRCA2 should predispose to early-onsetprostate cancer, as seen for breast cancer. For example,BRCA1 is mutant in 21% of Ashkenazi women under41 with breast cancer [24], while BRCA2 is mutant in8% of Ashkenazi women under 43 with breast cancer[26]. These values are in line with the estimates re-ported in Struewing et al. [1]. Most cases of prostatecancer are diagnosed after age 70 [27]. Since oursample was heavily skewed towards younger patientswhose incidence of prostate cancer was akin to that ofwomen under 45, our analysis should overestimatethe influence of BRCA1 and BRCA2 terminating mu-tations on the incidence of prostatic carcinoma. A re-cent, analogous examination of the influence of theATM gene on early-onset breast cancer similarlyfound no increase in relative risk [28]. Furthermore,our study strongly suggests that the LOH of theBRCA1 [5–7] and BRCA2 [8–10] loci in sporadic pros-tate cancer is likely to be related to other, nearby genesrather than the loss of either BRCA gene. For example,BRCA2 loss rarely occurs independent of Rb gene loss[9,29], and when it does occur, there does not appearto be a mutation of the other allele [30], and the lossseen on 17q appears to be slightly distal to the BRCA1locus [11]. The knowledge that germline mutations,and in particular cancer predisposition genes, do notcontribute to the pathogenesis of some cancers is es-sential for providing accurate genetic counseling tocancer-prone families.

Recently, Lehrer et al. [31] published a very similarstudy of a smaller number of prostate cancer patients.They examined 60 men with prostate cancer, who self-identified as Ashkenazim, for both BRCA1 185delAGand BRCA2 6174delT. None of the samples of normaltissue from these patients showed heterozygosity ateither locus. While the mean age of their patientsample was older than in our population (70.5 vs. ap-proximately 55), the finding of no mutations furtherreinforces our results.

In summary, we found estimates of mutant allelessimilar to those found in a general population of Ash-kenazi Jews [15]. A much larger study of young Ash-kenazi prostate cancer patients will be needed to ruleout smaller increases in relative risk for these two al-leles. Any possible influence of the next most fre-quently identified BRCA mutation among Ashken-azim, the BRCA1 5382insC mutation, would also re-quire a much larger study, since it is 3–10-fold lessfrequent than BRCA1 185delAG [15]. Even though ourpatient sample was small, we should have been able todetect a risk of fourfold or greater for BRCA1 or five-fold for BRCA2 when compared to this general Ash-kenazi population [15]. In addition, both the youngermedian age of the patients in our study population,

and the LOH dissociation of the BRCA genes in spo-radic cancers, strengthen our contention that muta-tions in either of these genes are not likely to predis-pose men to prostate cancer.

REFERENCES

1. Struewing JP, Hartge P, Wacholder S, Baker SM, Berlin M, Mc-Adams M, Timmerman MM, Brody LC, Tucker MA. The risk ofcancer associated with specific mutations of BRCA1 and BRCA2among Ashkenazi Jews. N Engl J Med 1997;336:1401–1408.

2. Ford D, Easton DF, Bishop DT, Narod SA, Goldgar DE, BreastCancer Linkage Consortium. Risks of cancer in BRCA1-mutation carriers. Lancet 1994;343:692–695.

3. Arason A, Barkardottir RB, Egilsson V. Linkage analysis of chro-mosome 17q markers and breast-ovarian cancer in Icelandicfamilies, and possible relationship to prostatic cancer. Am JHum Genet 1993;52:711–717.

4. Friedman LS, Szabo CI, Ostermeyer EA, Dowd P, Butler L, ParkT, Lee MK, Goode EL, Rowell SE, King M-C. Novel inheritedmutations and variable expressivity of BRCA1 alleles, includingthe founder mutation 185delAG in Ashkenazi Jews. Am J HumGenet 1995;57:1284–1297.

5. Brothman AR, Steele MR, Williams BJ, Jones E, Odelberg S,Albertsen HM, Jorde LB, Rohr LR, Stephenson RA. Loss of chro-mosome 17 loci in prostate cancer detected by polymerase chainreaction quantitation of allelic markers. Genes Chromosom Can-cer 1995;13:278–284.

6. Gao X, Zacharek A, Salkowski A, Grignon DJ, Sakr W, PorterAT, Honn KV. Loss of heterozygosity of the BRCA1 and otherloci on chromosome 17q in human prostate cancer. Cancer Res1995;55:1002–1005.

7. Ittmann MM. Loss of heterozygosity on chromosomes 10 and 17in clinically localized prostate carcinoma. Prostate 1996;28:275–281.

8. Gudmundsson J, Johannesdottir G, Bergthorsson JT, Arason A,Ingvarsson S, Egilsson V, Barkardottir RB. Different tumor typesfrom BRCA2 carriers show wild-type chromosome deletions on13q12–q13. Cancer Res 1995;55:4830–4832.

9. Cooney KA, Wetzel JC, Merajver SD, Macoska JA, Singelton TP,Wojno KJ. Distinct regions of allelic loss on 13q in prostate can-cer. Cancer Res 1996;56:1142–1145.

10. Ittmann MM, Wieczorek R. Alterations of the retinoblastomagene in clinically localized, stage B prostate adenocarcinomas.Hum Pathol 1996;27:28–34.

11. Williams BJ, Jones E, Zhu XL, Steele MR, Stephenson RA, RohrLR, Brothman AR. Evidence for a tumor suppressor gene distalto BRCA1 in prostate cancer. J Urol 1996;155:720–725.

12. Gao X, Zacharek A, Grignon DJ, Sakr W, Powell IJ, Porter AT,Honn KV. Localisation of potential tumor suppressor loci to a<2 Mb region on chromosome 17q in human prostate cancer.Oncogene 1995;11:1241–1247.

13. Murakami YS, Brothman AR, Leach RJ, White RL. Suppressionof malignant phenotype in a human prostate cancer cell line byfragments of normal chromosome region 17q. Cancer Res 1995;55:3389–3394.

14. Struewing JP, Abeliovich D, Peretz T, Avishai N, Kaback MM,Collins FS, Brody LC. The carrier frequency of the BRCA1185delAG mutation is approximately 1 percent in AshkenaziJewish individuals. Nat Genet 1995;11:198–200.

15. Roa BB, Boyd AA, Volcik K, Richards CS. Ashkenazi Jewishpopulation frequencies for common mutations in BRCA1 andBRCA2. Nat Genet 1996;14:185–187.

16. Wooster R, Bignell G, Lancaster J, Swift S, Seal S, Mangion J,

176 Nastiuk et al.

Collins N, Gergory S, Gumbs C, Micklem G, Barfoot R, Ham-oudi R, Patel S, Rice C, Biggs P, Hashim Y, Smith A, Connor F,Arason A, Gudmundsson J, Ficenec D, Kelsell D, Ford D, ToninP, Bishop DT, Spurr N, Ponder BAJ, Eeles R, Peto J, Devilee P,Cees C, Lynch F, Narod S, Lenoir G, Egilsson V, Barkadottir RB,Easton DF, Bentley DR, Futreal PA, Ashworth A, Stratton MR.Identification of the cancer susceptibility gene BRCA2. Nature1995;378:789–791.

17. Oddoux C, Struewing JP, Clayton CM, Neuhausen S, Brodyu L,Kaback M, Haas B, Norton L, Borgen P, Jhanwar S, Goldgar D,Ostrer H, Offit K. The carrier frequency of the BRCA2 6174delTmutation among Ashkenazi Jewish individuals is approxi-mately 1%. Nat Genet 1996;14:188–190.

18. Johannesdottir G, Gudmundsson J, Bergthorsson JT, Arason A,Agnarsson BA, Eiriksdottir G, Johansson OT, Borg A, Ingvars-son S, Easton DF, Egilsson V, Barkardottir RB. High prevalenceof the 999del5 mutation in Icelandic breast and ovarian cancerpatients. Cancer Res 1996;56:3663–3665.

19. Easton DF, Ford D, Bishop TD, Breast Cancer Linkage Consor-tium. Breast and ovarian cancer incidence in BRCA1-mutationcarriers. Am J Hum Genet 1995;56:265–271.

20. Mansukhani M, Nastiuk KL, Hibshoosh H, Kularatne P, RussoD, Krolewski JJ. Convenient, non-radioactive, heteroduplex-based methods for identifying recurrent mutations in theBRCA1 and BRCA2 genes. Diagn Mol Pathol 1997;6:229–237.

21. Phelan CM, Lancaster JA, Tonin P, Gumbs C, Cochran C, CarterR, Ghadirian P, Perret C, Moslehi R, Dion F, Faucher M-C, DoleK, Karimi S, Foulkes W, Lounis H, Warner E, Goss P, AndersonD, Larsson C, Narod SA, Futreal PA. Mutation analysis of theBRCA2 gene in 49 site-specific breast cancer families. Nat Genet1996;13:120–122.

22. Easton DF, Steele L, Fields P, Ormiston W, Averill D, Daly PA,McManus R, Neuhausen SL, Ford D, Wooster R, Cannon-Albright LA, Stratton MR, Goldgar DE. Cancer risks in twolarge breast cancer families linked to BRCA2 on chromosome13q12–13. Am J Hum Genet 1997;61:120–128.

23. Sigurdsson S, Thorlacius S, Tomasson J, Tryggvadottir L, Bene-dictsdottir K, Eyfjord JE, Johsson E. BRCA2 mutation in Icelan-dic protate cancer patients. J Mol Med 1997;75:758–761.

24. FitzGerald MG, MacDonald DJ, Krainer M, Hoover I, O’Neil E,Unsal H, Sila-Arrieto S, Finkelstein DM, Beer-Romero P, EnglertC, Scroi DC, Smith BL, Younger JW, Garber JE, Duda RB, May-zel KA, Isselbacher KJ, Friend SH, Haber DA. Germ-line BRCA1mutations in Jewish and non-Jewish women with early-onsetbreast cancer. N Engl J Med 1996;334:143–149.

25. Langston AA, Stanford JL, Wicklund KG, Thompson JD, BlazejRG, Ostrander EA. Germ-line BRCA1 mutations in selected menwith prostate cancer. Am J Hum Genet 1996;58:881–885.

26. Neuhausen S, Gilewski T, Norton L, Tran T, McGuire P,Swensen L, Hampel H, Borgen P, Brown K, Skolnick M, Shat-tuck-Eidens D, Jhanwar S, Goldgar D, Offit K. Recurrent BRCA26174delT mutations in Ashkenazi Jewish women affected bybreast cancer. Nat Genet 1996;13:126–128.

27. Gittes RF. Carcinoma of the prostate. N Engl J Med 1991;324:1892–1893.

28. FitzGerald MG, Bean JM, Hegde SR, Unsal H, MacDonald DJ,Harkin DP, Finkelstein DM, Isselbacher KJ, Haber DA. Hetero-zygous ATM mutations do not contribute to early onset ofbreast cancer. Nat Genet 1997;15:307–310.

29. Melamed J, Einhorn JM, Ittmann MM. Allelic loss on chromo-some 13q in human prostate cancer. Clin Cancer Res 1997;3:1867–1872.

30. Li C, Larsson C, Futreal A, Lancaster J, Phelan C, Aspenblad U,Sindelin B, Liu Y, Ekman P, Auer G, Bergerheim USR. Identifi-cation of two distinct deleted regions on chromosome 13 inprostate cancer. Oncogene 1998;16:481–487.

31. Lehrer S, Fodor F, Stock RG, Stone NN, Eng C, Song HK, Mc-Govern M. Absence of 185delAG mutation of the BRCA1 geneand 6174delT mutation of the BRCA2 gene in Ashkenazi Jewishmen with prostate cancer. Br J Cancer 1998;78:771–773.

BRCA1 and BRCA2 in Prostate Cancer 177