Proc. Nati. Acad. Sci. USAVol. 88, pp. 6848-6852, August 1991Genetics

Clonality in myeloproliferative disorders: Analysis by means of thepolymerase chain reaction

(somatic cell mutation/myelodysplasia/polymorphism)

D. GARY GILLILAND, KERRY L. BLANCHARD, JOANNE LEVY, STEVEN PERRIN, AND H. FRANKLIN BUNN*Hematology Division, Department of Medicine, Brigham and Women's Hospital, Harvard Medical School, Boston, MA 02115

Communicated by Y. W. Kan, May 1, 1991 (received for review October 3, 1990)

ABSTRACT The myeloproliferative syndromes are ac-quired disorders of hematopoiesis that provide insights into thetransition from somatic cell mutation to neoplasia. The clonalorigin of specific blood cells can be assessed in patients with Xchromosome-linked polymorphisms, taking advantage of ran-dom inactivation of the X chromosome. We have adapted thePCR for determination of clonality on as few as 100 cells,including individual colonies grown in culture. Amplifying apolymorphic portion of the X chromosome-linked phosphoglyc-erate kinase (PGK) gene after selective digestion of the active Xchromosome with a methylation-sensitive restriction enzymegave results fully concordant with standard Southern blotting ofDNA samples from normal (polyclonal) polymorphonuclearcells (PMN) as well as clonal PMN from patients with myelod-ysplastic syndrome and polycythemia vera (PCV). We have usedthis technique to demonstrate heterogeneity of lineage involve-ment in patients with PCV. The same clinical phenotype mayarise from clonal proliferation of different hematopoietic pro-genitors.

Fialkow and coworkers (1-3) introduced the use of isozymesof the X chromosome-linked gene product glucose-6-phosphate dehydrogenase (G6PD) as a marker for cell clon-ality and have shown that in patients with a variety ofmyeloproliferative disorders (4-8) circulating blood cells arederived from a single pluripotent stem cell that has gained agrowth advantage presumably as a result of a somatic cellmutation. Although this strategy has provided valuable anddefinitive information, it is limited by the rarity of femaleG6PD heterozygotes in many ethnic groups. Indeed, thisapproach has been utilized in only two patients with poly-cythemia vera (PCV) (4, 5), a disorder in which there isincreased proliferation of hematopoietic cells associated withincreased erythrocyte mass as well as increased polymor-phonuclear cell (PMN) and platelet production.

Vogelstein, Fearon, and coworkers (9-11) have devised ameans of determining clonality based on common restrictionfragment length polymorphisms on X chromosome-linkedgenes (PGK and HPRT) and the differential methylation ofnearby cytosine residues. Methylation of cytosines is asso-ciated with the random inactivation of one of the two Xchromosomes during female embryogenesis. Digestion witha restriction enzyme that recognizes a polymorphism inconjunction with a methylation-sensitive restriction endonu-clease such as Hpa II enables the discrimination betweenpolyclonal and clonal derivation of a given cell population inas many as 50% of female patients.We and others (12-16) have used this approach to inves-

tigate clonal derivation of blood cells from patients withmyeloproliferative disorders. The relatively large amount ofDNA required for Southern blotting (5-10 ,ug) has limited

analysis of specific cell lineages. Only nanogram amounts ofDNA can be extracted from pure cell populations obtainedfrom patients with low circulating blood counts or fromhematopoietic colonies grown in culture. To obviate thisproblem, we have devised a strategy, outlined schematicallyin Fig. 1A, which utilizes the PCR for clonal determination ofsmall numbers of cells from specific lineages.

MATERIALS AND METHODSMaterials. BstXI was purchased from New England Bio-

labs. All other restriction enzymes were purchased fromBoehringer Mannheim and were used in buffers provided bythe manufacturer. Enzymes were used at concentrations of10 units per gg of DNA unless otherwise specified. Taqpolymerase and dNTP (0.1 M preneutralized solutions)stocks were purchased from United States Biochemical.Oligonucleotide primers were synthesized by the 83-cyano-ethylphosphoramidite method on an Applied Biosystems380B automated synthesizer, and purified on NAP-10 col-umns (Pharmacia) equilibrated with water. PGK probe, gen-erously provided by Bert Vogelstein (11), was an 800-base-pair (bp) EcoRI/BamHI fragment from the pSPT/PGK vec-tor. Probes were labeled with [a-32P]dCTP to a specificactivity of 2-10 x 108 cpm/Ag using universal hexamers andthe large subunit of DNA polymerase I (Klenow fragment;BRL). Plasmid pXPGK-R1/6.0, containing an 11-kilobase(kb) fragment from the 5' end of the PGK gene, was kindlyprovided by Alan Michelson (17). Approximately 600 bp ofsequence was obtained from the end of the first exon into thefirst intron of the PGK gene by the dideoxynucleotide chain-termination technique. This sequence includes the relevantHpa II and BstXI sites.

Blood Samples and Processing. Peripheral blood sampleswere obtained from informed and consenting female patientswith PCV or myelodysplastic syndrome (MDS). All patientswith PCV met the diagnostic criteria of the PCV study group(18). Twenty milliliters of whole blood was collected intolithium/heparin tubes for immediate use or ACD tubes ifblood was to be transported or held for >24 hr. Granulocyteswere separated from mononuclear cells by density gradientcentrifugation on Ficoll/Hypaque. When necessary, granu-locytes were purified from the erythrocyte pellet by gradientcentrifugation at 1 x g (19). Nuclei were isolated by lysingcells with Triton X-100 solution (0.32 M sucrose/10 mMTris HCl, pH 7.5/5 mM MgCl2/1% Triton X-100) followed bydigestion with SDS/proteinase K and extraction with phe-nol/chloroform according to the method of Bell (20). DNAwas precipitated from ethanol twice and resuspended inwater prior to amplification or restriction enzyme digestion.

Abbreviations: Epo, erythropoietin; MDS, myelodysplastic syn-drome; PCV, polycythemia vera; PMN, polymorphonuclear cell(s);BFU-E, burst-forming unit(s), erythroid.*To whom reprint requests should be addressed at: HematologyResearch, Thorn 919, Brigham and Women's Hospital, 75 FrancisStreet, Boston, MA 02115.

6848

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Proc. Natl. Acad. Sci. USA 88 (1991) 6849

APolyclonal

ZZZsi2xP 1r l xi--- X2 0---^ X2

Clonal

=X2

Digestion with a methylation-dependent restriction enzyme

r---- 'X2 ' x1

Ai

X2 ' l x1= X2 ' J Xi

ampliflcation by P(

=::~~ X2

'CR

= X2

= X2

Digestion with the polymorphic restriction enzyme,

L 3 X2

_ 530bp 530bpmm~i433bp

Agarose gel electrophoresis

B1A 2A B_- -_XIon~~~~~~~~~~~~~~~

uHpaII Hpall

-100 bp-I

Clonal

Is v^X2

C

151

101m

g * xl 151201251301351

r | *x1 4011Z x1 451

501551

x----lX, 601651701

433 bpl 8701851'901951

lOpl1051

- 1101

2B 1B 111201

TCCACGGGGT TGGGGTTGCG CCTTTTCCAA GGCAGCCCTG GGTTTGCGCAGGGACGCGGC TGCTCTGGGC GTGGTTCCGG GAAACGCAGC GGCGCCGACCCTGGGTCTCG CACATTCTTC ACGTCCGTTC GCAGCGTCAC CCGGATCTTCGCCGCTACCC TTGTGGGCCC CCCGGCGACG CTTCCTGCTC CGCCCCTAAGTCGGGAAGGT TCCTTGCGGT TCGCGGCGTG CCGGACGTGA CAAACGGAAGCCGCACGTCT CACTAGTACC CTCGCAGACG GACAGCGCCA GGGAGCAATGGCAGCGCGCC GACCGCGATG GGCTGTGGCC MTAGCGGCT GCTCAGCGGGGCGCGCCGAG AGCAGCGGCC GGGAAGGGGC GGTGCGGGAG GCGGGGTGTGGGGCGGTAGT GTGGGCCCTG TTCCTGCCCG CGCGGTGTTC CGCATTCTGCAAGCCTCCGG AGCGCACGTC GGCAGTCGGC TCCCTCGTTG ACCGAATCACCGACCTCTCT CCCCAGCTGT ATTTCCAAAA TGTCGCTTTC TAACAAGCTGACGCTGGACA AGCTGGACGT TAAAGGGAAG CGGGTCGTTA TGAGGTAATTCtGCACGTTT GCCCGCGTGC TCTCTGTGCT CTGTCGCAAA CCTCTTTGGCCGGAGCCGAC TTGTTCTCTC GTCTGCTCTA AGTTCTTTTA GCTTTTGGCTGGGCCCCAAG GGTCCTAGGC TTGGAGGGCG AGGCTGCTCA CGGGTTTGGTGGTTTCTAGC CGCATTTTCC CCAGCCCAGA AAGCACCCGA AGTCACCCTTCGGGATGGAT CCCACTGAGG AAGGGCTGAG ATTGCCGCTG GGACCCATTTTGTGCTTTTT CCTATTGGTG AAATGCAGTT CCGTGGCCTC CAGCTCCAGTCGGCGAGATG GGACTTAATG CTTATCCTGC AAATCTCTAG GCTTCACGGAAGGGACCTTG AAAGGTCATT TTACTTTCCC TTCCCCCACG CTCCTAGACCGTCGCAGCCA AATGAGAAAC GGCCCACATC TCACAGGTTC CTGCACAAAAGGATATTTTC CAAGAGGATG TTGATTTAAC TTCAGGAGTA GACCCCCCCGCCCCCCCGCC ACTAAAGATG GGGTGGGAGG GTAGGGCGGG GCGAACTGGAGGAGGCCTGC AGAGCTTACG TAACAGGCGT TCTGCTGGCC TGCAGCGTTGCTGCCT

FIG. 1. Analysis of clonality by PCR. (A) Flow diagram showing expected PCR results in a normal individual with a polyclonal populationof cells (Left) and in patients with clonal populations of cells (Right). After the PGK gene on the active X chromosome (hatched bar) is cleavedwith the methylation-sensitive enzyme Hpa II, the inactivePGK allele is amplified and digested with BstXI. Vertical line indicates the presenceof the polymorphic BstXI restriction site. (B) Map of PGK gene in the vicinity of the variably methylated Hpa II sites and the BstXIpolymorphism. The first exon is shown as a rectangle. Arrows represent nested oligonucleotide primers. (C) DNA sequence from clone 3 (2),which contains 16 kb ofthe genomic PGK gene, beginning at bp 3471. Because the genomic insert did not change in size on digestion with BstXI,it was presumed that the allele that had been cloned lacked the polymorphic BstXI site. There are two potential BstXI sites at bp 993 and bp1067, differing from the BstXI recognition sequence by a single base pair. Amplification ofDNA from known BstXI heterozygotes followed bydigestion with BstXI showed the BstXI polymorphism was located at bp 993. The primers shown in B are underlined: 1A, bp 418-447; 2A, bp561-590; 2B, bp 1061-1090; 1B, bp 1151-1180. Note that the complementary (antisense) sequence must be used for the 3' primers (2B and 1B).

Mononuclear cells from the Ficoll/Hypaque step werewashed three times with Iscove's modified Dulbecco's me-dium (IMDM)/2% fetal calf serum and plated at a density of2 x 106 cells per ml in IMDM/20%o fetal calf serum on Luxplates at 37°C in a CO2 incubator overnight. The nonadherentcells were analyzed by fluorescence-activated cell sorting.

Erythroid Cell Culture. Mononuclear cells isolated fromperipheral blood were cultured in methylcellulose supple-mented with fetal calf serum, interleukin 3, and erythropoi-etin (Epo) as described (21). After 14 days, burst-formingcolonies (BFU-E) were plucked by hand with a drawn outmicropipette and immediately placed in 40 ,ul of H20. Afterincubation at 75°C for 10 min, clonality analysis was per-formed on 10-,ul aliquots as described below.

Southern Blot Hybridization. To identify PGK heterozy-gotes, 10 ,g of genomic DNA in 400 ,ul of buffer (50 mMTris HCl, pH 7.5/10 mM MgCI2/10 mM NaCl/1 mM dithio-threitol) was digested with Bgl I overnight at 37°C. Southernblot hybridization was performed by use of Zetabind nylonmembranes (American Lab Supply, Natick, MA) probedwith the 32P-labeled PGK fragment (107 cpm per 100-cm2filter). Heterozygotes for BgI I showed bands at 12 and 5 kbas described (9-11). To determine clonality, DNA (20 ug)was digested with Pst I and BstXI. One-half of the sample(100 Al) was further digested with Hpa II. Samples were thenprocessed for Southern blot analysis as described above.PCR. Screening for heterozygotes was performed by a

modification of a procedure for PCR from small bloodsamples (22). Blood (200 Al) was obtained by fingerstick anddrawn into a heparinized capillary tube or was obtained froma sample collected in a lithium/heparin tube. Cells were lysedwith RSB containing 0.5% Nonidet P.40 and nuclei werecollected by centrifugation in a microcentrifuge for 30 sec.

resuspended in 200 Al ofwater, and heated to 100°C for 3 min.The boiled sample was again centrifuged for 1 sec, and thesupernatant was collected. Supernatant (20 ,l) was subse-quently used for-amplification of the PGK locus by adding itto 80 Ml of a solution containing buffer (50 mM KCI/10 mMTris HCl, pH 8.3/1.5 mM MgCl2/0.1% gelatin), dNTPs (200MM each), primers 1A and lB (20 pmol each) (Fig. 1 B and C),and Taq polymerase (0.5 unit). Samples were amplified ineither a Perkin-Elmer/Cetus thermal cycler or an MJ Re-search programmable thermal controller for 60 cycles (1 min,940C; 2 min, 58°C; 3 min 72°C). One-tenth volume of thisPCR mixture was seeded into another reaction mixture.Internal ("nested") primers 2A and 2B (20 pmol each) werethen added and the amplification was repeated as describedabove. After adjustment ofthe buffer, an aliquot was digestedwith BstXI (55°C, 3-12 hr). Samples were analyzed byelectrophoresis in 2% agarose stained with ethidium bromide.Heterozygotes and homozygotes were distinguished as de-scribed below.To determine clonality by PCR, 10 pg to 1 ng of genomic

DNA-or a single colony isolated from methylcellulose wasmixed with 40 Ml ofbuffer and split into halves. Samples wereincubated at 75°C for 10 min, followed by vigorous mixing.The aliquots were incubated for 12 hr at 37°C in the presenceor absence ofHpa II and then heated to 1AM0C for 3 min. PCRamplification was then carried out as described above.

RESULTS AND DISCUSSIONWe have adapted PCR to analysis of clonality in femalesheterozygous for a PGK polymorphism. Of 364 normalindividuals and patients tested, 120 (33%6) were heterozygousfor the BstXI polymorphism. It would be technically formi-

Genetics: Gilliland et aL

3X2 ' Xxl

Proc. Natl. Acad. Sci. USA 88 (1991)

1 2 3 4

Hpa Il - + - +

Bst XI + +

Hpa II - +

-+ - +

5 6 7 8

1

';a

Southern

Blnt Pi _lon

Poi>cloxnal C'lonal (lonal

FIG. 2. Analysis of clonality of PMN. (A) Normal individual (I)and seven patients with MDS (24). Lane: -, DNA amplified withoutHpa II precutting; +, DNA amplified after Hpa II precutting. (B)Three patients with PCV. (Lower) Southern blot hybridizationdemonstrating a polyclonal pattern on patient B1 (Left) and clonalpatterns on patients B2 and B3 (Center and Right). (Upper) Use ofPCR on the same DNA samples for analysis of clonality. (Left)Polyclonal pattern (patient Bi). (Center) Clonal population of cellsfrom patient B2 in which (as in A, 2, 4, 6, and 8) the inactive allelecontains the BstXI site. (Right) Clonal population from patient B3 inwhich (as in A, 3, 5, and 7) the inactive allele lacks this polymorphicsite. Note that in the PCR of samples not precut with Hpa II, afterdigestion with BstXI, the ratio of the upper band to the lower band(allele 1/allele 2) is -3:1. This can be explained by the fact that with50 cycles of amplification, when primers or nucleotides becomerate-limiting, 50%o of the amplified strands will reanneal as hetero-duplexes. Only the predicted 25% that have the BstXI site on eachstrand of a homoduplex would be digested.

dable to extend this PCR strategy to HPRT, owing to the largedistance (4 kb) between the polymorphic (BamHI) site andthe nearest detectable site of differential methylation.A restriction map of the PGK gene in the region of the

BstXI polymorphism and the differentially methylated Hpa IIsites is shown in Fig. 1B. The DNA sequence of this region(Fig. 1C) was generated from clone 3 (2) kindly provided byAlan Michelson (17). Nested oligonucleotide primer pairs

% Allele I with methylated HpaLI sites100 90 80 60 50 40 20 10 0

0 10 20 40 50 60 80 90 100

% Allele 2 with methylated Hpaf sites

FIG. 3. PCR analysis of artificial mixtures of genomic DNAisolated from clonal populations of cells in which the inactive Xchromosome either lacks the BstXI polymorphism (allele 1, patientB3) or contains it (allele 2, patient B2). The twoDNA specimens weremixed in ratios of 0:10, 1:9, 2:8, 4:6, 5:5, 6:4, 8:2, 9:1, and 10:0. Themixtures were amplified as described in the legend to Fig. 1C.

FIG. 4. Demonstration of clonality of isolated BFU-E coloniescultured from the blood of patient B1 with PCV. Clonality analysiswas performed as described. As shown in Table 1 allele 1 wasamplified in a significant predominance of colonies.

(30-mers) flanking this region were selected, including three(1A, 1B, and 2B) in intronic DNA in order to avoid amplifi-cation of known PGK pseudogenes. Fig. 2 shows PCRanalyses of DNA from normal (polyclonal) PMN as well asfrom patients with clonal populations ofPMN in associationwith MDS (Fig. 2A) or PCV (Fig. 2B). Amplification of thePGK locus gives a single band at 530 bp. In a heterozygote,digestion ofthe PCR product with BstXI gives a 530-bp band,representing the allele that lacks the polymorphic site, and(433 + 97)-bp bands representing the allele containing thesite. These patterns are identical for polyclonal and clonalheterozygotes. Since PCR does not preserve methylation, theactive (unmethylated) and inactive (methylated) PGK allelesare distinguished by digesting DNA with a methylation-sensitive restriction enzyme (Hpa II) prior to amplification.Active (unmethylated) alleles will be cleaved and cannot beamplified, whereas inactive (methylated) alleles will not becleaved and therefore will be amplified. In a polyclonalpopulation ofcells from a heterozygote, BstXI digestion afterPKR thus yields bands of 530 as well as 433 and 97 bp. In aclonal population of cells, BstXI digestion yields either aband of 530 bp or bands of 433 and 97 bp.To assess the sensitivity of this technique, we determined

what proportion of clonally derived cells could be detectedagainst a background ofpolyclonal cells. GenomicDNA frompatient B3, a clonal heterozygote whose inactive allele lacksthe BstXI site, and from patient B2, a clonal heterozygotewhose inactive allele contains the BstXI site, were mixed inknown proportions ranging from 0%6 to 100%. As shown inFig. 3, the known proportion of each allele prior to PCRcorrelates well with digestion patterns obtained after ampli-fication. A 10% difference in band intensity ofthe two allelescan be readily detected. Accordingly, it should be possible todetect (at a minimum) a 20%/b population ofclonal cells againsta polyclonal background.PCR based clonal analyses of purified PMN DNA from

nine patients with myeloproliferative disorders and fromthree normal individuals were in full agreement with South-ern blot analyses. Fig. 2 shows results on seven patients withMDS and three patients with PCV. PMN were clonallyderived in all MDS patients and in PCV patients B2 and B3.In contrast, in patient B1, who has well documented pheno-typical PCV,t PMN sampled four times over a 14-monthperiod were consistently polyclonal, with a 50:50 distributionof the two alleles. The mean PMN count of patient B1 was9195 ± 1930/mm3, over twice normal. If these excess PMNarose from a single clone, they would have been detected byour PCR analysis of clonality (Fig. 3). Peripheral bloodlymphocytes (85% T cells) from patient B1 were also con-sistently polyclonal (data not shown). Densitometric analy-ses of Southern blot of T-lymphocyte DNA from patient B1reveal a 50:50 distribution of the two alleles, thus making

tPatient has an elevated erythrocyte mass (15% greater than theupper limit of normal), normal arterial 02 saturation, sustained (24months) increases in leukocyte (12,000-14,000 d; 2-4% basophils)and platelet count (1.0-1.5 x 106 cells per sl) and increasedleukocyte alkaline phosphatase of 192 units (normal range, 15-130).

A + +

- +

+ t

- +

I5430 hp)433 hp

B

P( R

Hpa ll - +

6850 Genetics: Gilliland et al.

Proc. Natl. Acad. Sci. USA 88 (1991) 6851

Table 1. Clonality analysis of BFU-E from patients with polycythemia vera

No. of BFU-E No. of BFU-E Clonality analysisPatient picked amplified Allele 1 Allele 2 Ambiguous PMNB3 5 5 4 0 1 Clonal-1B2 12 8 0 7 1 Clonal-2B1 71 32 19 5 8 Polyclonal

skewed Lyonization an unlikely explanation for the unex-pected result on PMN from patient B1. Our demonstration ofpolyclonal PMN in this patient agrees with similar findings in1 of 6 PCV patients reported by Lucas et al. (14) and in 1 of17 reported by Anger et al. (16). However, the clonality oferythroid cells was not established in these 2 patients.The finding that not all patients with PCV have clonal

involvement of PMN raises the possibility that in somepatients clonal expansion may be restricted to the erythroidcompartment. Because analysis by restriction fragmentlength polymorphism requires nucleated cells, it has not beenpossible to determine the clonal origin of circulating eryth-rocytes. To address this question, we sought to determineclonality from in vitro culture of erythroid precursor cellsfrom patients with PCV. Because the amount of DNA percolony was <1 ng, 10-4 below the sensitivity ofSouthern blotanalysis, PCR was used for clonal analysis. Individual colo-nies were plucked and amplified as described in the legend toFig. 4. Since each colony arises from a single cell and bydefinition is clonal, only one PGK allele either containing orlacking the BstXI allele should be active (unmethylated) ineach colony. As shown in Table 1 and Fig. 4, afterDNA fromindividual colonies was precut with Hpa II and amplified, inmost instances only one of the two alleles could be detected.In 25% of colonies, the ratio of the amplified alleles wasbetween 40:60 and 60:40 and therefore could be regarded asambiguous. This result could arise either because of contam-ination of the colony with other cells as it was plucked fromthe culture dish or because the sample contained two or morecolonies having different active alleles.

It is necessary to analyze multiple colonies to determinewhether the BFU-E contain the same inactivated allele andare therefore derived from the same clone. BFU-E were firstanalyzed in patients B2 and B3, whose PMN were clonallyderived. As shown in Table 1, all BFU-E contained the sameinactivated allele, implying clonal derivation. Furthermore,this allele was the same as that identified in the Blonal PMN,consistent with the suggestion that a somatic mutation in anearly hematopoietic progenitor gave rise to clonal growth ofboth myeloid and erythroid lineages. In patient Bi, whosePMN were polyclonal, 19 of the amplified erythroid cloneswere exclusively allele 1 while five were allele 2. The oddsthat this ratio is due to chance are <1%. Therefore thisskewed result strongly suggests a clonal population ofBFU-Eagainst a polyclonal background. The presence of someBFU-E representing the other allele may be in part related tothe inclusion of Epo in the culture medium, which may allowbetter growth of normal BFU-E in culture than in vivo (3). Inthe absence of Epo, erythroid colonies were too small andinfrequent to be analyzed. This caveat notwithstanding, aclonal population of erythroid progenitors from patient B1could be demonstrated by PCR-based clonality analysis.Our demonstration of constant erythroid clonality in con-

junction with inconstant myeloid clonality has implicationsfor the pathogenesis of PCV. In patients B2 and B3, and inother patients previously evaluated (4, 5), a pluripotentprogenitor cell begets clonally derived proliferation of eryth-roid cells and PMN [and platelets (4, 5)], while in patient B1a progenitor begets clonally derived proliferation oferythroidcells but not PMN. Therefore, lineage involvement in PCVmay sometimes be heterogeneous. Even though the majority

of PMN in patient B1 were polyclonally derived, theirproduction was increased, similar to most patients withPCV.A These data, along with a recent report on lineageheterogeneity in essential thrombocythemia (23), suggest thata proliferative response in myeloproliferative disorders can-not be construed as evidence of clonal involvement. Theremay be a "field" effect in which growth of noninvolvedlineages is influenced by the clonal population of cells.Abnormalities in the Epo receptor (24) or cytoplasmic mol-ecules that bind to it (25) may play a role in the molecularpathogenesis of PCV. Investigation of Epo receptor regula-tion and expression in PCV should focus on populations ofcells that are documented to be clonally involved in order todistinguish primary from secondary events.The broad applicability ofPCR-based analysis of clonality,

as well as its sensitivity and specificity, make it ideally suitedto study homogeneous cell populations isolated by cell sort-ing or (as reported here) by growth in culture. This strategyshould provide fresh insights into the pathogenesis of avariety of benign and malignant tumors.

tWe cannot exclude a minor population (up to 30%) of clonal PMNin patient Bi.

D.G.G. and K.L.B. contributed equally to this work and shouldboth be considered first authors. We thank Dr. William C. Moloneyfor stimulating our interest in the pathogenesis of acquired bonemarrow disorders. We also thank Dr. Andrew Feinberg, who devel-oped primers 1A and 1B and performed Southern blot analysis,which distinguished between the two putative BstXI polymorphicloci. This work was supported by the M. Larry Lawrence Founda-tion. K.L.B. was supported by a Damon Runyon-Walter WinchellCancer Research Fellowship (DRG-055).

1. Fialkow, P. J., Gartler, S. M. & Yoshida, A. (1967) Proc. Nati.Acad. Sci. USA 58, 1468-1471.

2. Fialkow, P. J. (1976) Biochim. Biophys. Acta 458, 283-321.3. Raskind, W. H. & Fialkow, P. J. (1987) Adv. Cancer Res. 49,

127-167.4. Prchal, J. F., Adamson, J. W., Murphy, S., Steinmann, L. &

Fialkow, P. J. (1978) J. Clin. Invest. 61, 1044-1047.5. Adamson, J. W., Singer, J. W., Catalano, P., Murphy, S., Lin,

N., Steinman, L., Ernst, L. & Fialkow, P. J. (1980) J. Clin.Invest. 66, 1363-1368.

6. Jacobson, R. J., Salo, A. & Fialkow, P. J. (1978) Blood 51,189-194.

7. Fialkow, P. J., Faguet, G. B., Jacobson, R. J., Vaidya, K. &Murphy, S. (1981) Blood 58, 916-919.

8. Raskind, W. H., Tirumali, N., Jacobson, R., Singer, J. &Fialkow, P. J. (1984) Blood 63, 1318-1323.

9. Vogelstein, B., Fearon, E. R., Hamilton, S. R. & Feinberg,A. P. (1985) Science 227, 642-645.

10. Fearon, E. R., Burke, P. J., Schiffer, C. A., Zehnbauer, B. A.& Vogelstein, B. (1986) N. Engl. J. Med. 315, 15-24.

11. Vogelstein, B., Fearon, E. R., Hamilton, S. R., Preisinger,A. C., Willard, H. F., Michelson, A. M., Riggs, A. D. &Orkin, S. H. (1987) Cancer Res. 47, 4806-4813.

12. Janssen, J. W. G., Buschle, M., Layton, M., Drexler, H. G.,Lyons, J., van den Berghe, H., Heimpel, H., Kubanek, B.,Kleihauer, E., Mufti, G. J. & Bartram, C. R. (1989) Blood 73,248-254.

13. Taylor, K. McD., Shetta, M., Talpaz, M., Kantarjian, H. M.,Hardikar, S., Chinault, A. C., McCredie, K. B. & Spitzer, G.(1989) Leukemia 3, 419-422.

Genetics: Gilliland et al.

6852 Genetics: Gilliland et al.

14. Lucas, G. S., Padua, R. A., Masters, G. S., Oscier, D. G. &Jacobs, A. (1989) Br. J. Haematol. 72, 530-533.

15. Tefferi, A., Thibodeau, S. N. & Solberg, L. A., Jr. (1990)Blood 75, 1770-1773.

16. Anger, B., Janssen, J. W. G., Schrezenmeier, H., Hehlmann,R., Heimpel, H. & Bartram, C. R. (1990) Leukemia 4,258-261.

17. Michelson, A. M., Blake, C. C. F., Evans, S. T. & Orkin,S. H. (1985) Proc. Nat!. Acad. Sci. USA 82, 6965-6969.

18. Berk, P. D., Goldberg, J. D., Donovan, P. B., Fruchtman,S. M., Berlin, N. I. & Wasserman, L. R. (1986) Sem. Hematol.23, 132-143.

19. Boyum, A. (1968) Scand. J. Clin. Lab. Invest. 21, Suppl. 97,77-89.

Proc. Natd. Acad. Sci. USA 88 (1991)

20. Bell, G. I., Karam, J. H. & Rutter, W. J. (1981) Proc. Natl.Acad. Sci. USA 78, 5759-5763.

21. Valtieri, M., Gabbianelli, M., Pelosi, E., Bassano, E., Petti, S.,Russo, G., Testa, U. & Peschle, C. (1989) Blood 74, 460-470.

22. Kogan, S. C., Doherty, M. & Gitschier, J. (1987) N. Engl. J.Med. 317, 985-990.

23. Janssen, J. W. G., Anger, B. R., Drexler, H. G., Bartram,C. R. & Heimpel, H. (1990) Blood 75, 1633-1636.

24. Means, R. T., Krantz, S. B., Sawyer, S. T. & Gilbert, H. S.(1989) J. Clin. Invest. 84, 1340-1344.

25. Li, J.-P., D'Andrea, A. D., Lodish, H. F. & Baltimore, D.(1990) Nature (London) 343, 762-764.