clc-3 chloride channel function as a mechanical sensitive · clc-3 chloride channel function as a...
TRANSCRIPT
Draft
ClC-3 Chloride Channel Function as a Mechanical Sensitive
Channel in Osteoblast
Journal: Biochemistry and Cell Biology
Manuscript ID: bcb-2015-0018.R1
Manuscript Type: Article
Date Submitted by the Author: 15-May-2015
Complete List of Authors: wang, huan; State Key Laboratory of Military Stomatology, School of Stomatology, The Fourth Military Medical University, Department of Oral Biology and orthodontics Wang, Rong; State Key Laboratory of Military Stomatology, School of Stomatology, The Fourth Military Medical University, Department of Oral Biology
Liu, Qian; State Key Laboratory of Military Stomatology, School of Stomatology, The Fourth Military Medical University, Department of Oral Biology Wang, Zhe; State Key Laboratory of Military Stomatology, School of Stomatology, The Fourth Military Medical University, Department of Oral Biology Mao, Yong; State Key Laboratory of Military Stomatology, School of Stomatology, The Fourth Military Medical University, Department of Prosthodontics Duan, Xiaohong; State Key Laboratory of Military Stomatology, School of Stomatology, The Fourth Military Medical University, Department of Oral Biology
Keyword: chloride channels, ClC-3, mechanical stimulation, osteodifferentiation, gene regulation
https://mc06.manuscriptcentral.com/bcb-pubs
Biochemistry and Cell Biology
Draft
1
ClC-3 Chloride Channel Function as a Mechanical Sensitive Channel in Osteoblast
Huan Wang, Rong Wang, Zhe Wang, Qian Liu, Yong Mao, and Xiaohong Duan
Huan Wang*, Rong Wang*, Zhe Wang, Qian Liu, Yong Mao, and Xiaohong Duan.
State Key Laboratory of Military Stomatology, Department of Oral Biology, School of
Stomatology, The Fourth Military Medical University, Xi’an 710032, China
Huan Wang. State Key Laboratory of Military Stomatology, Department of
Orthodontics, School of Stomatology, The Fourth Military Medical University, Xi’an
710032, China
Yong Mao. State Key Laboratory of Military Stomatology, Department of
Prosthodontics, School of Stomatology, The Fourth Military Medical University, Xi’an
710032, China
* These authors contributed equally to this work.
Corresponding author: Prof. Xiaohong Duan (E-mail address: [email protected])
There are 7 figures and 1 table in the article.
Funded by: National Natural Science Foundation (No. 31070835, No. 81200648 and
No. 31170898)
Page 1 of 32
https://mc06.manuscriptcentral.com/bcb-pubs
Biochemistry and Cell Biology
Draft
2
Abstract
Mechanical stimulation usually causes the volume changes of osteoblasts.
Whether this volume changes could be sensed by ClC-3 chloride channel, a volume
sensitive ion channel, and further promotes the osteodifferentiation in osteoblasts
remains to determine. In this study, we applied the persistent static compression on
MC3T3-E1 cells to detect the expression changes of ClC-3, osteogenic markers as well
as some molecules related with signaling transduction pathway. We tested the key
role of ClC-3 in transferring the mechanical signal to osteoinduction by ClC-3
overexpressing and siRNA technique. We found that ClC-3 level was up regulated by
mechanical stimulation in MC3T3-E1 cells. Mechanical force also up regulated the
mRNA level of osteogenic markers such as alkaline phosphatase (Alp), bone
sialoprotein (Bsp) and osteocalcin (Oc), which could be blocked or strengthened by
Clcn3 siRNA or overexpressing, and Alp expression was more sensitive to the changes
of ClC-3 level. We also found that runt-related transcription factor 2 (Runx2),
transforming growth factor-beta 1 (TGF-β1) and Wnt pathway might be involved in
ClC-3 mediated mechanical transduction in osteoblasts. The data from the current
study suggest that ClC-3 chloride channel play as a mechanical sensitive channel to
regulate osteodifferentiation in osteoblasts.
Key words::::Chloride channels, ClC-3, Mechanical stimulation, Osteodifferentiation,
Gene regulation
Page 2 of 32
https://mc06.manuscriptcentral.com/bcb-pubs
Biochemistry and Cell Biology
Draft
3
Introduction
Bone is sensitive to mechanical loading, which is one of the most important
physiological factors regulating bone mass and shape. Lack of mechanical loading
causes an acceleration of bone turnover with bone resorption overwhelming bone
formation. As we know, in dental clinic treatment, appropriate force can move teeth
by remodeling of the surrounding alveolar bones, whilst lack of the chewing force
usually causes the apparent resorption of alveolar bone in edentulous area. Bone’s
adaptive response is regulated by the ability of resident bone cells to perceive and
translate mechanical energy into a cascade of structural and biochemical changes
within the cells - a process known as mechanotransduction (Iolascon et al., 2013).
Mechanical-stress plays an important role in the Wnt/β-catenin signaling pathway
and is involved in bone formation. Flow pulsating fluid stimulation up regulated the
gene expression levels of adenomatous polyposis coli, alkaline phosphatase, LRP5,
Wnt3a and β-catenin in ROS17/2.8 osteoblasts and induced the differentiation
of osteoblasts and the activation of the Wnt/β-catenin signaling pathway (Jia et al.,
2014).
Studies have showed that there are many ion channels associated with the
osteogenic differentiation of cells, such as Ca2+
, K+, etc. (Amagai and Kasai, 1989; Gu
et al., 2001; Moreau et al., 1996). The role of voltage-gated chloride channel ClC
family in osteogenesis has been explored in our previous work. ClC-3, ClC-4 and ClC-5
belong to the same ClC branch due to the similarity of their genetic, and function as
endosomal chloride channels. We found that these three channels may regulate
Page 3 of 32
https://mc06.manuscriptcentral.com/bcb-pubs
Biochemistry and Cell Biology
Draft
4
osteoblast differentiation. Over expression of ClC-3, ClC-4 and ClC-5 could up regulate
osteogenic makers, such as Alp, Bsp, Oc, as well as the calcification ability of
MC3T3-E1 cells. We also found that ClC-3 regulate osteoblast function through Runx2
and TGF-β1 (Wang et al., 2010a; Wang et al., 2010b). According to the recent reports,
ClC-3 also participates in cell proliferation, apoptosis, intracellular acidification
regulation of osteoclast, etc (Hara-Chikuma et al., 2005; Hermoso et al., 2002; Jin et
al., 2003; Maki et al., 2007; Okamoto et al., 2008; Tang et al., 2008; Wang et al.,
2006).
ClC-3 was also defined as a volume sensitive chloride channel (Duan et al., 1997).
Its cellular volume regulation has been proved in AGS human gastric epithelial cells
(Jin et al., 2003), mouse ventricular myocytes (Wang et al., 2005), HeLa cells and
xenopuslaevis oocytes (Hermoso et al., 2002), human acute lymphoblastic leukemia
cells (Cao et al., 2011), acinar cells isolated from the rat lacrimal gland and
submandibular salivary gland (Majid et al., 2001) and atrial and ventricular tissues
(Britton et al., 2000). Volume changes are one of characteristics of osteoblast during
the mechanical stimulation (Martin and Seeman, 2008). It is not clear whether
mechanical force stimulated volume changes could be sensed by ClC-3 which might
further induces the osteogenic differentiation in osteoblasts. Here we study the role
of ClC-3 on the mechanical stimulated changes in MC3T3-E1 osteoblastic cells with
the self-made mechanical loading equipment.
Materials and methods
Page 4 of 32
https://mc06.manuscriptcentral.com/bcb-pubs
Biochemistry and Cell Biology
Draft
5
Cell culture and persistent static pressure stimulation
MC3T3-E1 cells were cultivated in alpha-minimum essential medium (α-MEM,
Gibco-Invitrogen, Grand Island, NY, USA) containing 10% fetal bovine serum (FBS,
Gibco), 100 U/ml penicillin G (Sigma, St. Louis, MO, USA) and 100 μg/ml streptomycin
(Sigma, St. Louis, MO, USA) in a humidified incubator at 37°C with 95% air and 5%
CO2. The cells were subcultured every 72 h using 0.25% trypsin plus 0.02% EDTA
(Gibco) in phosphate-buffered saline (PBS, Gibco) and loaded with static compression
using the self-designed culture chamber for 8 h and 24 h respectively. The gas phase
of the chamber was maintained at a pressure of 1 atmospheres (atm) by
continuously infusing a compressed mixed gas (O2: N
2:CO
2 = 7.0%:91.3%:1.7%).
ClC-3 plasmid and gene transfection
For gene transfection, MC3T3-E1 cells were plated at 1 x 104
cells/ml cultured in
α-MEM supplemented with 10% FBS in six-well plates overnight and were
transfected with ClC-3 plasmid or pCMV-HA plasmid as a control with Lipofectamine
2000 (Invitrogen, Carlsbad, CA, USA). The culture medium was renewed after 8 h
incubation. pCMV-Clcn3-HA carrying a full-length rat Clcn3 cDNA was a gift from Dr.
Sandra. E. Guggino of Johns Hopkins University.
ClC-3 siRNA and gene silencing
The small interfering RNA (siRNA) duplexes that target the mouse Clcn3 gene were
generated as described previously (Wang et al., 2010b). The isoforms of Clcn3 gene
have been reported in rat and mouse (Okada et al., 2014; Shimada et al., 2000), and
the sequence of Clcn3 siRNA in this study may target all the isoforms of mouse Clcn3
Page 5 of 32
https://mc06.manuscriptcentral.com/bcb-pubs
Biochemistry and Cell Biology
Draft
6
(transcript variant a, b, c, e, or X1~X8). The siRNA sequence for ClC-3 was as follows:
sense siRNA 5’-CGA GAG AAG UGU AAG GAC ATT-3’ and antisense siRNA, 5’-UGU
CCU UAC ACU UCU CUC GTT-3’. The nonsense siRNA sequence was as follows: sense
siRNA, 5'-UUC UCC GAA CGU GUC ACG UTT-3' and antisense siRNA, 5'-ACG UGA CAC
GUU CGG AGA ATT-3'. siRNAs were transfected with Lipofectamine 2000 (Invitrogen)
according to the manufacturer’s protocol.
Real-time RT-PCR assay
Total cellular RNA was extracted with TRIzol® Reagent (Invitrogen) and quantified
by ultraviolet spectroscopy at assigned time points post induction. RT-PCR was
performed using the reverse transcriptase cDNA synthesis kit (TaKaRa, Dalian, China).
Real-time RT-PCR was performed by an ABI 7500 real-time PCR system (Applied
Biosystems) using SYBR® Premix Ex Tag
TM (TaKaRa). Total cDNA (10-30 ng) was added
per 20 μl reaction. Thermo cycling conditions were set to the following: 95°C for 30 s;
45 cycles at 95°C for 5 s, 60°C for 34 s. The primers used are listed in Table 1.
Quantification of gene expression was performed using the comparative threshold
cycle (ΔΔCT) method and the relative expression levels were quantified by comparing
the ratios to the reference gene, Gapdh cycle threshold (CT).
Western blot analysis
The cells were lysed in a buffer containing 0.05 M Tris (pH 7.4), 0.15 M NaCl, 1%
Nonidet P-40, 1 mM EDTA, 1 μg/ml leupeptin, 1 μg/ml aprotinin, and 1 Mm
phenylmethylsulfonyl fluoride. The protein concentration was determined using BCA
reagent (Pierce, Rockford, IL). After this, 50 μg of the total protein lysate were
Page 6 of 32
https://mc06.manuscriptcentral.com/bcb-pubs
Biochemistry and Cell Biology
Draft
7
separated via sodium dodecyl sulfate polyacrylamide gel electrophoresis and
transferred to a PVDF membrane (Millipore, Billerica, MA, USA). The PVDF
membranes then were subjected to western blot analysis. Briefly, the membrane was
first blocked in a Tris-buffered solution (TBS) containing 5% non-fat milk for 30 min,
and in anti-HA-tag monoclonal antibody (at a dilution of 1:300, Cell Signaling
technology, Boston, MA, USA), anti-β-actin rabbit polyclonal antibody (at a dilution of
1:300, Boster, Wuhan, China) , or CLC-3 mouse monoclonal antibody (at a dilution of
1:200, LSBio, USA) overnight. After washing, the membranes were incubated at room
temperature in a fluorophore-labeled goat-anti-mouse secondary antibody
(IRDye680, LI-COR, USA). Bands were detected and quantified on the Odyssey image
system (at a dilution of 1:5000, LI-COR, Lincoln, Nebraska, USA).
Immumofluorescence analysis
MC3T3-E1 cells were grown on glass coverslips and fixed with 4% formaldehyde
for 20 min at 4°C and permeabilized with 0.03% Triton X-100 in PBS for 30 min. The
coverslips were incubated with CLC-3 mouse monoclonal antibody (at a dilution of
1:200, LSBio, USA) overnight at 4°C after blockage of nonspecific binding with 10%
rabbit serum for 30 min at room temperature. In the next day, the coverslips were
washed with PBS for three times and then incubated with fluorescein (FITC)
affinity-pure donkey anti-mouse IgG (at a dilution of 1:300, Jackson
ImmunoResearch, West Grove, PA) or goat anti-rabbit IgG polyclone antibody Cy3
labeled (at a dilution of 1:200, Jackson ImmunoResearch) for 60 min at 37°C. Nuclear
counterstaining was performed with Hoechst 33342 (at a dilution of 1:1000, Sigma).
After rinsed with PBS, the coverslips were reviewed under a FluoView FV1000 laser
Page 7 of 32
https://mc06.manuscriptcentral.com/bcb-pubs
Biochemistry and Cell Biology
Draft
8
confocal microscope (Olympus).
Statistical analysis
Data are presented as mean ± S.E.M. Comparative studies of means were
performed using one-way analysis of variance followed by a post-hoc test (projected
least significant difference Fisher). Student’s t-Tests were used when only two groups
were compared. Values of P less than 0.05 were considered to be statistically
significant.
Results
Time-course osteogenic gene expression profiles in MC3T3-E1 cells under persistent
static compression
To investigate the effects of compression on MC3T3-E1 cells, we have loaded the
persistent static pressure with self-designed culture chamber. The density of cells in
compression group was lower than the control group at 8 h and 24 h with 1 atm
static compression (Fig. 1). After application of static pressure of 1 atm for 8 and 24
h, the mRNA expressions of osteogenic related genes (Alp, Bsp, Ocn, Runx2) and
other cell transduction signaling molecules [β-catenin, low-density lipoprotein
receptor-related protein 6 (Lrp6)] were up regulated in compression group compared
to those in the control group, respectively. Transforming growth factor-beta 1 (Tgfb)
mRNA expression was down regulated with compression application, while Poliovirus
receptor-related 1 (Pvrl) mRNA level had no statistical change (Fig. 2).
Effects on ClC-3 expression in MC3T3-E1 cells under persistent static compression
Page 8 of 32
https://mc06.manuscriptcentral.com/bcb-pubs
Biochemistry and Cell Biology
Draft
9
Clcn3 mRNA expression was significant increased by 7.1-fold (at 8 h) and 9.2-fold
(at 24 h) in compression group compared to the control group, respectively (Fig. 3B).
To confirm the contribution of ClC-3 under compression application, we further
examined the effects of ClC-3 overexpression and ClC-3 siRNA transfection on Clcn3
expression under mechanic stimulation by using real-time PCR, western blot and
immumofluorescence method. The gene expression of Clcn3 was significantly
reduced (76%) in the ClC-3 gene silencing cells compared to the nonsense
transfection control cells, and then increased by 4.2-fold (at 8 h) and 5.8-fold (at 24
h) in compression loaded. Western blot data showed the positive HA-tag expression
in pCMV-Clcn3-HA-transfected cells versus mock-transfected cells (Fig. 3A). The
expression of Clcn3 was induced by 3.0-fold in ClC-3 overexpressing cells compared
to the nonsense transfection control cells, and then increased by 2.8-fold (at 8 h) and
5-fold (at 24 h) in compression loaded (Fig. 3B). The changes of CLC-3 expression in
western blot results were in good accordance with the real-time PCR data (Fig. 4).
CLC-3 expression was decreased in the ClC-3 gene silencing cells compared to the
nonsense transfection control cells using the confocal laser scanning microscope
observation. Therefore, the expression of ClC-3 was enhanced after static
compression for 8 and 24 h, respectively. After analysis of intensities of fluorescence
of anti-CLC-3 antibodies among these groups, we found that expression of ClC-3 in
cells under compression application was recovered and increased after ClC-3 gene
silencing by time-course (Fig. 5).
Persistent static compression promotion osteogenetic genes expression in
MC3T3-E1 cells through ClC-3
Page 9 of 32
https://mc06.manuscriptcentral.com/bcb-pubs
Biochemistry and Cell Biology
Draft
10
To investigate the role of ClC-3 in regulating the expression of osteogenic-related
genes under compression application in MC3T3-E1 cells, we transiently transfected a
full length Clcn3 cDNA and ClC-3 siRNA into MC3T3-E1 cells, respectively. The data
showed that compression stimulation up regulated levels of Bsp, Oc, Alp, Runx2,
β-catenin and Lrp6 mRNA compared to the control group by the time-course, and
the overexpression of ClC-3 enhanced the function of compression application in
MC3T3-E1 cells (Fig. 6 and Fig. 7). Meanwhile, Tgfb expression was decreased under
compression stimulation and ClC-3 overexpression, and Poliovirus receptor-related 1
(Pvrl) expression had no difference among the groups (Fig.7). The following data
further indicated that ClC-3 gene silencing down regulated the expression of Bsp, Oc,
Alp, Runx2, β-catenin, while the levels of these markers under compression
stimulation were less up regulated after ClC-3 gene silencing (Fig. 6 and Fig. 7). We
also found that Tgfb1 was decreased under compression stimulation, and Lrp6 mRNA
levels were increased in ClC-3 gene silencing with compression application group (Fig.
7). Therefore, all the data indicated that compression stimulation induced osteogenic
genes expression trough ClC-3.
Discussion
Bone is a dynamic tissue that responds to mechanical stimulation. Cortical as well
as trabecular bone tissue is formed and resorbed by cells known as osteoblasts and
osteoclasts, respectively. These cells are ideally located and distributed to act as
mechanosensors. In the study, we have applied the self-designed device to load
persistent static compression on MC3T3-E1 cells to explore the regulation role of
Page 10 of 32
https://mc06.manuscriptcentral.com/bcb-pubs
Biochemistry and Cell Biology
Draft
11
ClC-3 and its relationship with force stimulation in osteogenesis. Effects of
mechanical stimulation on the expression of ClC-3 indicated that ClC-3 chloride
channel functioned as an early sensitive response gene to mechanical force. The
most dramatically increase (nearly 8-fold) in Clcn3 mRNA level appeared at force
loaded for 8 h, then stabilized around 24 h. The mRNA levels of ClC-3 was knocked
down nearly 80% using Clcn3 siRNA, thus we only found minor increase in Clcn3
mRNA level in Clcn3 siRNA group with 8 hour loading which later became no longer
evident after 24 h. In ClC-3 over-expression system, we did not see a dramatically
increase of the mRNA level of ClC-3 as we expected, which might indicate that the
endogenous ClC-3 could sufficiently responded to the early mechanical stimulation,
but after 24 h force loading, both endogenous ClC-3 and over expressed ClC-3
contributed to the great increase of Clcn3 expression responding to mechanical
stimulation. The mechanical compression or stress causes cellular volume changes,
which might be sensed by volume-sensitive ClC-3 channels. Here we believed that
ClC-3 function as a sensitive target channel to mechanical stimulus in osteoblasts.
Myocyte Enhancer Factor-2 (MEF-2C) has been reported to inhibit Clcn3 promoter
activity. The mechanical strain increased the mRNA level of MEF2C during the
cardiovascular differentiation of mouse embryonic stem cells (Schmelter et al., 2006).
Thus MEF-2C might be a key signal triggered by mechanical stress that activates Clcn3
gene expression in osteoblasts, which we will further study in the future.
MC3T3-E1 is a murine osteogenitor cell line, which is considered to be immature
osteoblast for researching osteodifferentiation. Appropriate mechanical stimulation
Page 11 of 32
https://mc06.manuscriptcentral.com/bcb-pubs
Biochemistry and Cell Biology
Draft
12
can promote osteodifferentiation of osteoblasts to increase bone formation (Dodds
et al., 1993; Zaidi, 2007). Both mechanical force and ClC-3 have been demonstrated
to promote osteogenesis (Aronson et al., 1988a; Aronson et al., 1988b; Wang et al.,
2010b), thus we further hypothesized that ClC-3 could mediate mechanical
stimulation to regulate the osteogenic differentiation in osteoblasts. The expression
of the osteogenic genes (Alp, Oc, Bsp) was increased in compression group in
MC3T3-E1 cells, which has been found in other reports. In order to confirm the
mechanical force induced osteogenic differentiation is through ClC-3 channel, we
further tested the expression changes of osteogenic genes in Clcn3 siRNA group and
Clcn3 over expressing group. The mechanical force induced expression of osteogenic
genes (Alp, Oc, Bsp) was greatly reduced in Clcn3 silenced cells, indicating that
mechanical force signal could not be transferred to induce osteogenic differentiation
with the absence of ClC-3. On the other hand, because of accumulation of ClC-3 in
overexpression group including the contribution of the increased Clcn3 expression in
mechanical stimulation, the increase of osteogenic genes expression was
superimposed. As a early marker enzyme in osteoblasts, ALP participates in the early
osteodifferentiation of osteoblasts and the accumulation of mineralized phosphates
during the biocalcification (Havill et al., 2006). Here we found that the mRNA level of
Alp was greatly up regulated with both mechanical force and ClC-3 overexpresssing
stimulus comparing to the single stimulus of mechanical force or ClC-3
overexpresssing, which was more obvious than the increased expression of Bsp and
Oc induced by mechanical force and ClC-3 overexpresssing. These data suggest that
Page 12 of 32
https://mc06.manuscriptcentral.com/bcb-pubs
Biochemistry and Cell Biology
Draft
13
Alp is one of the major targets of ClC-3 to regulate osteoblast differentiation under
the mechanical compression, and Bsp and Oc are also involved in this process but
with a less response to ClC-3 mediated mechanical stimulation.
Runx2 is also required for osteodifferentiation and may induce the expression of
multiple osteogenic marker genes including type I collagen, OC, BSP, and osteopotin.
Full Runx2 gene dosage has been reported in maintaining normal function of
osteoblasts in mechanical unloading (Salingcarnboriboon et al., 2006). Our data
herein demonstrated that mechanical stimulation up regulated Runx2 expression and
the increase could be inhibited or blocked by Clcn3 siRNA, suggesting that
mechanical stress has to pass through ClC-3 channel to regulate Runx2 expression,
which in turn affecting other osteogeneic markers. The results are consistent with
our previous study that the up regulation of osteogenic markers by ClC-3 in
MC3T3-E1 cells are correlated with TGF-β1 related Runx2 activation (Wang et al.,
2010b).
TGF-β is a key factor in bone formation, or remodeling (Nielsen et al., 1994;
Pfeilschifter et al., 1990; Tang et al., 2009). It may promote the synthesizing and
secreting of bone matrix protein or proteinase, including alkaline phosphatase,
collagen I, osteocalcin, osteopontin, and matrix metalloproteinase-13
(MMP-13)(Nomura et al., 2008). TGF-β also regulates osteoprogenitor cells as a
chemoattractantor in multiple ways (Pfeilschifter et al., 1990), such as simulating
osteoprogenitor proliferation (Urano et al., 1999) and recruiting osteoprogenitors to
the site of new bone formation or the site of fracture repair(Nielsen et al., 1994). On
Page 13 of 32
https://mc06.manuscriptcentral.com/bcb-pubs
Biochemistry and Cell Biology
Draft
14
the other hand, TGF-β is also reported to inhibit terminal osteoblast differentiation
and bone matrix synthesis related with Smad3 and Runx2 pathway (Alliston et al.,
2001). TGF-β1 also regulates Runx2 expression through Smad2/3 signal, thereby
regulating the downstream genes expression and cell function (Lee et al., 2000; Lin
et al., 2011). In this study, Tgfb expression was decreased under compression
stimulation. Runx2 and TGF-β1 showed the different response to mechanical force
and ClC-3 siRNA or overexpressing, the opposite effect has also been reported in our
previous work. A complex network of Runx2 and TGF-β1 should be involved the ClC-3
mediated mechanical transduction.
Wnt pathway plays the important role in the differentiation of osteoblasts and
bone formation. Regulation of factors in Wnt pathway can impact the development
and differentiation of osteoblasts and the formation and mineralization of bone
matrix (Glass et al., 2005). Several experiments have demonstrated the involvement
of canonical Wnt signaling in mechanotransduction. Osteoblasts cultured from
transgenic mice expressing a TCF/β-catenin transcription reporter (TopGal mice)
exhibited activation of canonical Wnt signaling (β-galactosidase expression) when
subjected to mechanical strain (Hens et al., 2005). In addition, fluid shear stress and
mechanical strain both stimulate the translocation of β-catenin to the nucleus in
MC3T3-E1, UMR-106, ROS 17/2.8, and primary rodent calvarial osteoblasts
(Armstrong et al., 2007; Norvell et al., 2004). Here we showed that ClC-3 played a
positive regulatory role on Wnt related pathway on cell membrane, further regulated
the downstream Lrp6 and β-catenin. Lrp6 is an important receptor in Wnt pathway,
Page 14 of 32
https://mc06.manuscriptcentral.com/bcb-pubs
Biochemistry and Cell Biology
Draft
15
and may activate β-catenin, which regulates the coordination of cell-cell
adhesion and gene transcription (Lin et al., 2014). PVRL1 is correlated with the
growth and development of cranial bones. The gene mutation of PVRL1 was founded
in patients with non-syndromic clefts of lip, alveolus and palate (Turhani et al., 2005).
We found obvious changes of Pvrl1 expression with ClC-3 level but mechanical
stimulation. All the results suggest that mechanical stimulation can regulate the
expression of osteogenic genes through ClC-3 associated with TGF-β/Runx2 and
Wnt/β-catenin pathway.
In conclusion, the volume sensitive chloride channel ClC-3 has a relationship with
mechanical stimulation in MC3T3-E1 cells. Static compression increased ClC-3
expression that further promoted the osteogenic genes expression. Our current
study suggests that the role of mechanical stimulation in osteodifferentiation may be
through the ClC-3 chloride channel pathway, which in turn mediates bone formation
and remodeling. ClC-3 should be the key position to participate in the regulation of
the signaling pathway associated, and further investigation will elucidate the
underlying mechanisms.
Acknowledgments
We would like to thank Dr. Sandra E. Guggino of Johns Hopkins University for
providing the ClC-3 expression plasmid, Dr. Yan Zhang of the Department of
Biochemistry and Molecular Biology at the Fourth Military Medical University for
providing MC3T3-E1 cells. This study was supported by the National Natural Science
Page 15 of 32
https://mc06.manuscriptcentral.com/bcb-pubs
Biochemistry and Cell Biology
Draft
16
Foundation (No. 31070835, No. 81200648 and No. 31170898).
Page 16 of 32
https://mc06.manuscriptcentral.com/bcb-pubs
Biochemistry and Cell Biology
Draft
17
Reference
Alliston, T., Choy, L., Ducy, P., Karsenty, G., Derynck, R. 2001. TGF-beta-induced repression of CBFA1
by Smad3 decreases cbfa1 and osteocalcin expression and inhibits osteoblast differentiation. EMBO
J 20(9):2254-2272.
Amagai, Y., Kasai, S. 1989. A voltage-dependent calcium current in mouse MC3T3-E1 osteogenic cells.
Jpn J Physiol 39(5):773-777.
Armstrong, VJ., Muzylak, M., Sunters, A., Zaman, G., Saxon, LK., Price, JS., Lanyon, LE. 2007.
Wnt/beta-catenin signaling is a component of osteoblastic bone cell early responses to load-bearing
and requires estrogen receptor alpha. J Biol Chem 282(28):20715-20727.
Aronson, J., Harrison, B., Boyd, CM., Cannon, DJ., Lubansky, HJ.. 1988a. Mechanical induction of
osteogenesis: the importance of pin rigidity. J Pediatr Orthop 8(4):396-401.
Aronson, J., Harrison, B., Boyd, CM., Cannon DJ, Lubansky HJ, Stewart C. 1988b. Mechanical
induction of Osteogenesis. Preliminary studies. Ann Clin Lab Sci 18(3):195-203.
Britton, FC., Hatton, WJ., Rossow, CF., Duan, D., Hume, JR., Horowitz, B. 2000. Molecular distribution
of volume-regulated chloride channels (ClC-2 and ClC-3) in cardiac tissues. Am J Physiol Heart Circ
Physiol 279(5):H2225-2233.
Cao, G., Zuo, W., Fan, A., Zhang, H., Yang, L., Zhu, L., Ye, W., Wang, L., Chen, L. 2011.
Volume-sensitive chloride channels are involved in maintenance of basal cell volume in human
acute lymphoblastic leukemia cells. J Membr Biol 240(Glass et al.):111-119.
Duan, D., Winter, C., Cowley, S., Hume, JR., Horowitz, B. 1997. Molecular identification of a
volume-regulated chloride channel. Nature 390(6658):417-421.
Glass, DA., 2nd, Bialek, P., Ahn, JD., Starbuck, M., Patel, MS., Clevers, H., Taketo, MM., Long, F.,
Page 17 of 32
https://mc06.manuscriptcentral.com/bcb-pubs
Biochemistry and Cell Biology
Draft
18
McMahon, AP., Lang, RA., Karsenty, G. 2005. Canonical Wnt signaling in differentiated osteoblasts
controls osteoclast differentiation. Dev Cell 8(5):751-764.
Gu, Y., Preston, MR., El, Haj, AJ., Howl, JD., Publicover, SJ. 2001. Three types of K(+) currents in
murine osteocyte-like cells (MLO-Y4). Bone 28(1):29-37.
Havill, LM., Hale, LG., Newman, DE., Witte, SM., Mahaney, MC. 2006. Bone ALP and OC reference
standards in adult baboons (Papio hamadryas) by sex and age. J Med Primatol 35(Glass et
al.):97-105.
Hens, JR., Wilson, KM., Dann, P., Chen, X., Horowitz, MC., Wysolmerski JJ. 2005. TOPGAL mice show
that the canonical Wnt signaling pathway is active during bone development and growth and is
activated by mechanical loading in vitro. J Bone Miner Res 20(7):1103-1113.
Hermoso, M., Satterwhite, CM., Andrade, YN., Hidalgo, J., Wilson, SM., Horowitz, B., Hume, JR. 2002.
ClC-3 is a fundamental molecular component of volume-sensitive outwardly rectifying Cl- channels
and volume regulation in HeLa cells and Xenopus laevis oocytes. J Biol Chem 277(42):40066-40074.
Iolascon, G., Resmini, G., Tarantino, U. 2013. Mechanobiology of bone. Aging Clin Exp Res 25 Suppl
1:S3-7.
Jia, YY., Li, F., Geng, N., Gong, P., Huang, SJ., Meng, LX., Lan, J., Ban, Y. 2014. Fluid flow modulates
the expression of genes involved in the Wnt signaling pathway in osteoblasts in 3D culture
conditions. Int J Mol Med 33(5):1282-1288.
Jin, NG., Kim, JK., Yang, DK., Cho, SJ., Kim, JM., Koh, EJ., Jung, HC., So, I., Kim, KW. 2003.
Fundamental role of ClC-3 in volume-sensitive Cl- channel function and cell volume regulation in
AGS cells. Am J Physiol Gastrointest Liver Physiol 285(5):G938-948.
Lee, KS., Kim, HJ., Li, QL., Chi, XZ., Ueta, C., Komori, T., Wozney, JM., Kim, EG., Choi, JY., Ryoo, HM.,
Page 18 of 32
https://mc06.manuscriptcentral.com/bcb-pubs
Biochemistry and Cell Biology
Draft
19
Bae, SC. 2000. Runx2 is a common target of transforming growth factor beta1 and bone
morphogenetic protein 2, and cooperation between Runx2 and Smad5 induces osteoblast-specific
gene expression in the pluripotent mesenchymal precursor cell line C2C12. Mol Cell Biol
20(23):8783-8792.
Lin, PS., Chang, MC., Chan, CP., Lee, SY., Lee, JJ., Tsai, YL., Tseng, HC., Tai, TF., Lin, HJ., Jeng, JH. 2011.
Transforming growth factor beta1 down-regulates Runx-2 and alkaline phosphatase activity of
human dental pulp cells via ALK5/Smad2/3 signaling. Oral Surg Oral Med Oral Pathol Oral Radiol
Endod 111(3):394-400.
Lin, YY., Chen, CY., Chuang, TY., Lin, Y., Liu, HY., Mersmann, HJ., Wu, SC., Ding, ST. 2014. Adiponectin
receptor 1 regulates bone formation and osteoblast differentiation by GSK-3beta/beta-catenin
signaling in mice. Bone 64(5):147-154.
Majid, A., Brown, PD., Best, L., Park, K. 2001. Expression of volume-sensitive Cl(-) channels and ClC-3
in acinar cells isolated from the rat lacrimal gland and submandibular salivary gland. J Physiol
534(Glass et al.):409-421.
Martin, TJ, Seeman, E. 2008. Bone remodelling: its local regulation and the emergence of bone
fragility. Best Pract Res Clin Endocrinol Metab 22(5):701-722.
Moreau, R., Hurst, AM., Lapointe, JY., Lajeunesse, D. 1996. Activation of maxi-K channels by
parathyroid hormone and prostaglandin E2 in human osteoblast bone cells. J Membr Biol 150(Glass
et al.):175-184.
Nielsen, HM., Andreassen, TT., Ledet, T., Oxlund, H. 1994. Local injection of TGF-beta increases the
strength of tibial fractures in the rat. Acta Orthop Scand 65(1):37-41.
Nomura, T., Ueyama, T., Ashihara, E., Tateishi, K., Asada, S., Nakajima, N., Isodono, K., Takahashi, T.,
Page 19 of 32
https://mc06.manuscriptcentral.com/bcb-pubs
Biochemistry and Cell Biology
Draft
20
Matsubara, H., Oh, H. 2008. Skeletal muscle-derived progenitors capable of differentiating into
cardiomyocytes proliferate through myostatin-independent TGF-beta family signaling. Biochem
Biophys Res Commun 365(4):863-869.
Norvell, SM., Alvarez, M., Bidwell, JP., Pavalko, FM. 2004. Fluid shear stress induces beta-catenin
signaling in osteoblasts. Calcif Tissue Int 75(5):396-404.
Pfeilschifter, J., Wolf, O., Naumann, A., Minne HW, Mundy GR, Ziegler R. 1990. Chemotactic
response of osteoblastlike cells to transforming growth factor beta. J Bone Miner Res 5(8):825-830.
Salingcarnboriboon, R., Tsuji, K., Komori, T., Nakashima, K., Ezura, Y., Noda, M. 2006. Runx2 is a
target of mechanical unloading to alter osteoblastic activity and bone formation in vivo.
Endocrinology 147(5):2296-2305.
Tang, Y., Wu, X., Lei, W., Pang, L., Wan, C., Shi, Z., Zhao, L., Nagy, TR., Peng, X., Hu, J., Feng, X., Van
Hul, W., Wan, M., Cao, X. 2009. TGF-beta1-induced migration of bone mesenchymal stem cells
couples bone resorption with formation. Nat Med 15(7):757-765.
Turhani, D., Item, CB., Watzinger, E., Sinko, K., Watzinger, F., Lauer, G., Ewers, R. 2005. Mutation
analysis of CLPTM 1 and PVRL 1 genes in patients with non-syndromic clefts of lip, alveolus and
palate. J Craniomaxillofac Surg 33(5):301-306.
Urano, T., Yashiroda, H., Muraoka, M., Tanaka, K., Hosoi, T., Inoue, S., Ouchi, Y., Toyoshima, H. 1999.
p57(Kip2) is degraded through the proteasome in osteoblasts stimulated to proliferation by
transforming growth factor beta1. J Biol Chem 274(18):12197-12200.
Wang, H., Huo, N., Li, F., Fu, S., Xue, Y., Yang, T., Wen, X., Ding, Y., Duan, X. 2010a. Osteogenic role of
endosomal chloride channels in MC3T3-E1 cells. Mol Cell Biochem 342(1-2):191-199.
Wang, H., Mao, Y., Zhang, B., Wang, T., Li, F., Fu, S., Xue, Y., Yang, T., Wen, X., Ding, Y., Duan, X. 2010b.
Page 20 of 32
https://mc06.manuscriptcentral.com/bcb-pubs
Biochemistry and Cell Biology
Draft
21
Chloride channel ClC-3 promotion of osteogenic differentiation through Runx2. J Cell Biochem
111(1):49-58.
Wang, J., Xu, H., Morishima, S., Tanabe, S., Jishage, K., Uchida, S., Sasaki, S., Okada, Y., Shimizu, T.
2005. Single-channel properties of volume-sensitive Cl- channel in ClC-3-deficient cardiomyocytes.
Jpn J Physiol 55(6):379-383.
Page 21 of 32
https://mc06.manuscriptcentral.com/bcb-pubs
Biochemistry and Cell Biology
Draft
22
Figure captions
Fig 1. Morphological characteristics of MC3T3-E1 cells under static compression. The
density of spindle cells decreased under static compression. A: regular cell culture
condition for 8 h; B: static compression loading for 8 h; C: regular cell culture
condition for 24 h; D: under static compression for 24 h. Bars = 50 μm
Fig 2. Effects of static compression on osteogenic related genes expression in
MC3T3-E1 cells. Osteogenic related genes (Ocn, Alp, Bsp, Runx2, β-catenin and Lrp6)
expression increased in MC3T3-E1 cells under static compression for 8 h and 24 h.
The expression of Tgfb decreased in static compression group and the expression
levels of Pvrl has no significant changes under static compression. *P<0.05. **P <
0.01. n = 3.
Fig 3. Effects on Clcn3 expression in MC3T3-E1 cells under static compression. A:
Western blot results. MC3T3-E1 cells were grown and transiently transfected with a
pCMV-Clcn3-HA plasmid (Clcn3 O) and total cellular protein was isolated and
subjected to Western blot analysis of CLC-3 protein expression with HA-tag antibody.
B: Real-time PCR results. Clcn3 expression was increased under static compression
for 8 h and 24 h compared to the control, respectively. MC3T3-E1 cells were grown
and transiently transfected with blank plasmid-only, ClC-3 siRNA or ClC-3 cDNA, and
then the cells were cultured under static compression for 8 h or 24 h. RNA was
Page 22 of 32
https://mc06.manuscriptcentral.com/bcb-pubs
Biochemistry and Cell Biology
Draft
23
extracted from the cells and subjected to real-time RT-PCR analysis of Clcn3 gene
expression. 8 h M: mechanical stimulation for 8 h. 24 h M: mechanical stimulation for
24 h. Clcn3 S: the cells transfected with ClC-3 siRNA group. Clcn3 O: the ClC-3
overexpression group which was transfected with pCMV-Clcn3-HA plasmid. *P<0.05.
n = 3.
Fig 4. Effects on CLC-3 in MC3T3-E1 cells under static compression. A: The changes of
protein expression of CLC-3 under static compression in western blot. B: CLC-3
expression increased under static compression for 8 h and 24 h compared to the
control, respectively. MT+siRNA: the cells transfected with ClC-3 siRNA with
mechanical treatment. siRNA: the cells tranfected with ClC-3 siRNA. *P < 0.05.
Fig 5. Effects of static compression on CLC-3 expression in MC3T3-E1 cells. MC3T3-E1
cells were transfected with plasmid-only (A) or ClC-3 siRNA (C), and then the cells
were under static compression for 8 h, respectively (B and D). All the cells were
immunostained with anti-ClC-3 followed by FITC labeled donkey anti-mouse IgG
(shown as green) and viewed under a confocal laser scanning microscope. Nuclei
(blue) werestained with Hoechst 33342. Intensities of fluorescence of anti-ClC-3
decreased in ClC-3 siRNA group (C) compared to the control group (A). After static
compression application for 8 h (D), the intensities of fluorescence of anti-ClC-3 were
increased compared to the control group (A) and the ClC-3 siRNA group (C),
respectively.
Page 23 of 32
https://mc06.manuscriptcentral.com/bcb-pubs
Biochemistry and Cell Biology
Draft
24
Fig 6. Effects of ClC-3 on regulation the osteogenic genes expression under static
compression. ClC-3 overexpression positive regulated the genes expression of Alp (A),
Bsp (B) and Ocn (C) and ClC-3 siRNA negative regulated the genes expression under
static compression for 8 h or 24 h compared to the control group. 8 h M: mechanical
stimulation for 8 h. 24 h M: mechanical stimulation for 24 h. Clcn3 S: the cells
transfected with ClC-3 siRNA group. Clcn3 O: the ClC-3 overexpression group which
transfected with ClC-3 cDNA. *P<0.05. n = 3.
Fig 7. Effects of ClC-3 on regulation the osteogenesis-related signaling pathway under
static compression. ClC-3 overexpression up regulated and ClC-3 siRNA down
regulated the TGF-β/Runx2 and Wnt/β-catenin pathway related molecules expression
of Lrp6 (A), β-catenin (B), Runx2 (C), Tgf-β1 (D) and Pvrl (E) under static compression
for 8 h or 24 h compared to the control group. 8 h M: mechanical stimulation for 8 h.
24 h M: mechanical stimulation for 24 h. Clcn3 S: the cells transfected with ClC-3
siRNA group. Clcn3 O: the ClC-3 overexpression group which transfected with ClC-3
cDNA.*P<0.05. n = 3.
Page 24 of 32
https://mc06.manuscriptcentral.com/bcb-pubs
Biochemistry and Cell Biology
Draft
Table 1 Primers sequences and expected size of PCR products.
Genes Forward primer(5′--3′) Reverse primer(5′--3′)
PCR
prod
uct
size
(bp)
Clcn3 CCAAGACCCCGCTTCAATAA CGAGTCCCGCAGATTAAAGA 112
Alp CCAACTCTTTTGTGCCAGAGA GGCTACATTGGTGTTGAGCTTTT 110
Bsp CAGGGAGGCAGTGACTCTTC AGTGTGGAAAGTGTGGCGTT 158
Oc CTGACCTCACAGATCCCAAGC TGGTCTGATAGCTCGTCACAAG 187
Runx2 CGCCCCTCCCTGAACTCT TGCCTGCCTGGGATCTGTA 72
Tgfb CCGCAACAACGCCATCTATG CTCTGCACGGGACAGCAAT 118
lrp6 GCTACAAATGGCAAAGAGAATGC CAGTATACAAGCCATGACCAAACA 95
Ctnnb1 CCCACTCCTAAGAGGAGGA GGGAGACCAAAGCCTTCAT 213
Pvrl CCTACGAGAAACGAGTGGAGTT CAAAACCTTGTCATCCTGTCC 230
gapdh CATGTTCCAGTATGACTCCACTC GGCCTCACCCCATTTGATGT 136
Page 25 of 32
https://mc06.manuscriptcentral.com/bcb-pubs
Biochemistry and Cell Biology
Draft
Fig 1. Morphological characteristics of MC3T3-E1 cells under static compression. The density of spindle cells decreased under static compression. A: regular cell culture condition for 8 h; B: static compression loading
for 8 h; C: regular cell culture condition for 24 h; D: under static compression for 24 h. Bars = 50 µm 60x43mm (300 x 300 DPI)
Page 26 of 32
https://mc06.manuscriptcentral.com/bcb-pubs
Biochemistry and Cell Biology
Draft
Fig2. Effects of static compression on osteogenic related genes expression in MC3T3-E1 cells. Osteogenic related genes (Ocn, Alp, Bsp, Runx2, β-catenin and Lrp6) expression increased in MC3T3-E1 cells under
static compression for 8 h and 24 h. The expression of Tgfb decreased in static compression group and the
expression levels of Pvrl has no significant changes under static compression. *P<0.05. **P < 0.01. n = 3. 39x18mm (600 x 600 DPI)
Page 27 of 32
https://mc06.manuscriptcentral.com/bcb-pubs
Biochemistry and Cell Biology
Draft
Fig 3. Effects on Clcn3 expression in MC3T3-E1 cells under static compression. A: Western blot results. MC3T3-E1 cells were grown and transiently transfected with a pCMV-Clcn3-HA plasmid (Clcn3 O) and total cellular protein was isolated and subjected to Western blot analysis of CLC-3 protein expression with HA-tag
antibody. B: Real-time PCR results. Clcn3 expression was increased under static compression for 8 h and 24 h compared to the control, respectively. MC3T3-E1 cells were grown and transiently transfected with blank plasmid-only, ClC-3 siRNA or ClC-3 cDNA, and then the cells were cultured under static compression for 8 h
or 24 h. RNA was extracted from the cells and subjected to real-time RT-PCR analysis of Clcn3 gene expression. 8 h M: mechanical stimulation for 8 h. 24 h M: mechanical stimulation for 24 h. Clcn3 S: the cells transfected with ClC-3 siRNA group. Clcn3 O: the ClC-3 overexpression group which was transfected
with pCMV-Clcn3-HA plasmid. *P<0.05. n = 3. 169x67mm (300 x 300 DPI)
Page 28 of 32
https://mc06.manuscriptcentral.com/bcb-pubs
Biochemistry and Cell Biology
Draft
Fig 4. Effects on CLC-3 in MC3T3-E1 cells under static compression. A: The changes of protein expression of CLC-3 under static compression in western blot. B: CLC-3 expression increased under static compression for 8 h and 24 h compared to the control, respectively. MT+siRNA: the cells transfected with ClC-3 siRNA with
mechanical treatment. siRNA: the cells tranfected with ClC-3 siRNA. *P < 0.05. 53x33mm (300 x 300 DPI)
Page 29 of 32
https://mc06.manuscriptcentral.com/bcb-pubs
Biochemistry and Cell Biology
Draft
Fig 5. Effects of static compression on CLC-3 expression in MC3T3-E1 cells. MC3T3-E1 cells were transfected with plasmid-only (A) or ClC-3 siRNA (C), and then the cells were under static compression for 8 h,
respectively (B and D). All the cells were immunostained with anti-ClC-3 followed by FITC labeled donkey
anti-mouse IgG (shown as green) and viewed under a confocal laser scanning microscope. Nuclei (blue) werestained with Hoechst 33342. Intensities of fluorescence of anti-ClC-3 decreased in ClC-3 siRNA group (C) compared to the control group (A). After static compression application for 8 h (D), the intensities of
fluorescence of anti-ClC-3 were increased compared to the control group (A) and the ClC-3 siRNA group (C), respectively.
127x190mm (300 x 300 DPI)
Page 30 of 32
https://mc06.manuscriptcentral.com/bcb-pubs
Biochemistry and Cell Biology
Draft
Fig 6. Effects of ClC-3 on regulation the osteogenic genes expression under static compression. ClC-3 overexpression positive regulated the genes expression of Alp (A), Bsp (B) and Ocn (C) and ClC-3 siRNA negative regulated the genes expression under static compression for 8 h or 24 h compared to the control group. 8 h M: mechanical stimulation for 8 h. 24 h M: mechanical stimulation for 24 h. Clcn3 S: the cells transfected with ClC-3 siRNA group. Clcn3 O: the ClC-3 overexpression group which transfected with ClC-3
cDNA. *P<0.05. n = 3. 45x12mm (600 x 600 DPI)
Page 31 of 32
https://mc06.manuscriptcentral.com/bcb-pubs
Biochemistry and Cell Biology
Draft
Fig 7. Effects of ClC-3 on regulation the osteogenesis-related signaling pathway under static compression. ClC-3 overexpression up regulated and ClC-3 siRNA down regulated the TGF-β/Runx2 and Wnt/β-catenin
pathway related molecules expression of Lrp6 (A), β-catenin (B), Runx2 (C), Tgf-β1 (D) and Pvrl (E) under static compression for 8 h or 24 h compared to the control group. 8 h M: mechanical stimulation for 8 h. 24 h M: mechanical stimulation for 24 h. Clcn3 S: the cells transfected with ClC-3 siRNA group. Clcn3 O: the
ClC-3 overexpression group which transfected with ClC-3 cDNA.*P<0.05. n = 3. 95x53mm (300 x 300 DPI)
Page 32 of 32
https://mc06.manuscriptcentral.com/bcb-pubs
Biochemistry and Cell Biology