characterization of the protocatechuate 4,5-cleavage ...aem.asm.org/content/76/24/8093.full.pdf ·...

APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Dec. 2010, p. 8093–8101 Vol. 76, No. 240099-2240/10/$12.00 doi:10.1128/AEM.01863-10Copyright © 2010, American Society for Microbiology. All Rights Reserved.

Characterization of the Protocatechuate 4,5-Cleavage PathwayOperon in Comamonas sp. Strain E6 and Discovery of

a Novel Pathway Gene�

Naofumi Kamimura,1 Taichi Aoyama,1 Rieko Yoshida,1 Kenji Takahashi,1 Daisuke Kasai,1Tomokuni Abe,2 Kohei Mase,2 Yoshihiro Katayama,3 Masao Fukuda,1 and Eiji Masai1*Department of Bioengineering, Nagaoka University of Technology, Kamitomioka, Nagaoka, Niigata 940-2188,1

Toyota Industries Corporation, Obu, Aichi 474-8601,2 and College of Bioresource Sciences,Nihon University, Fujisawa, Kanagawa 252-0880,3 Japan

Received 4 August 2010/Accepted 9 October 2010

The protocatechuate (PCA) 4,5-cleavage (PCA45) pathway is the essential catabolic route for the degrada-tion of various aromatic acids in the genus Comamonas. All of the PCA45 pathway genes, orf1-pmdKEFDABC,as well as another PCA 4,5-dioxygenase gene, pmdAIIBII, were isolated from a phthalate-degrading bacterium,Comamonas sp. strain E6. Disruption of pmdB and pmdD in E6, which code for the � subunit of PCA4,5-dioxygenase and 2-pyrone-4,6-dicarboxylate (PDC) hydrolase, respectively, resulted in a growth defect onPCA, indicating that these genes are essential for the growth of E6 on PCA. On the other hand, inactivationof pmdBII did not affect the growth of E6 on PCA. Disruption of pmdK, which is related to a 4-hydroxybenzoate/PCA transporter of Pseudomonas putida, resulted in growth retardation on PCA. The insertional inactivationof orf1 in E6, whose deduced amino acid sequence has no similarity with proteins of known function, led to thecomplete loss of growth on PCA and the accumulation of PDC and 4-oxalomesaconate (OMA) from PCA. Theseresults indicated the involvement of orf1 in the PCA45 pathway, and this gene, designated pmdU, was suggestedto code for OMA tautomerase. Reverse transcription-PCR analysis suggested that the pmdUKEFDABC genesconstitute an operon. The transcription start site of the pmd operon was mapped at 167 nucleotides upstreamof the initiation codon of pmdU. The pmd promoter activity was enhanced 20-fold when the cells were grown inthe presence of PCA. Inducers of the pmd operon were found to be PCA and PDC, but PDC was the moreeffective inducer.

Protocatechuate (PCA) is a key intermediate metabolite inthe bacterial degradation pathways of various aromatic com-pounds, including phthalate isomers, vanillate, and hydroxy-benzoates. It is known that PCA is degraded via three distinctcatabolic pathways, including the PCA 2,3-cleavage (8, 18),PCA 3,4-cleavage (14), and PCA 4,5-cleavage (PCA45) (19, 26,27) pathways. Our research group has discovered that 2-py-rone-4,6-dicarboxylic acid (PDC), an intermediate of thePCA45 pathway (Fig. 1A), is useful in the production of bio-degradable and high-functional polymers, such as strong adhe-sives (15, 16, 30). The production of PDC via the PCA45pathway from lignin-derived compounds and petrochemicalaromatic compounds, including phthalates, would be worth-while for reducing the environmental load. From this aspect,the catabolic functions of Comamonas sp. strain E6, which isable to utilize phthalate isomers as sole carbon and energysources via the PCA45 pathway (11, 38), appears to be ofimportance.

The PCA45 pathway was first enzymatically characterized byKersten et al. (19) and Maruyama and colleagues (21–25). Inthis pathway (Fig. 1A), PCA is initially transformed to 4-car-boxy-2-hydroxymuconate-6-semialdehyde (CHMS) by PCA

4,5-dioxygenase (4,5-PCD). CHMS is nonenzymatically con-verted to an intramolecular hemiacetal form and then oxidizedby CHMS dehydrogenase. The resulting intermediate, PDC, ishydrolyzed by PDC hydrolase to yield the keto and enol tau-tomers of 4-oxalomesaconate (OMA), which are in equilib-rium. OMA is converted to 4-carboxy-4-hydroxy-2-oxoadipate(CHA) by OMA hydratase. Finally, CHA is cleaved by CHAaldolase to produce pyruvate and oxaloacetate.

To date, the PCA45 pathway genes have been isolated fromSphingobium sp. strain SYK-6 (32), Sphingomonas sp. strainLB126 (41), Comamonas testosteroni BR6020 (36), Pseudomo-nas straminea NGJ1 (26), and Arthrobacter keyseri 12B (9). Thegene organization of the PCA45 pathway gene cluster can bedivided into two types (27), the Sphingobium and Comamonastypes. The organization of the PCA45 pathway genes in Sphin-gobium sp. strain SYK-6 is quite similar to that in Sphingomo-nas sp. strain LB126, which appears to constitute three tran-scriptional units (Sphingobium type). On the other hand, thepatterns of organization and order for the PCA45 pathwaygenes in C. testosteroni BR6020, P. straminea NGJ1, and A.keyseri 12B are similar, and this type of gene cluster seems toconstitute an operon (Comamonas type). Recently, our re-search group characterized the transcriptional regulation ofthe PCA45 pathway genes in Sphingobium sp. strain SYK-6and demonstrated that the LysR-type transcriptional regulatorLigR activates the transcription of the ligK-orf1-ligI-lsdA andligJABC operons in the presence of PCA or gallate and re-

* Corresponding author. Mailing address: Department of Bioengi-neering, Nagaoka University of Technology, Nagaoka, Niigata 940-2188, Japan. Phone: 81-258-47-9428. Fax: 81-258-47-9450. E-mail:[email protected].

� Published ahead of print on 15 October 2010.

8093

on July 7, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

http://aem.asm.org/

presses the transcription of its own gene (17). On the otherhand, the transcriptional regulation of the Comamonas-typePCA45 pathway genes remains unknown for all the strainsmentioned above. Furthermore, the enzyme genes of thePCA45 pathway in Sphingobium sp. strain SYK-6 were exten-sively characterized; however, the other genes included in thegene clusters of this pathway (the putative transporter genespmdK of C. testosteroni BR6020 and proT of P. straminea NGJ1and the genes of unknown function orf1 of SYK-6 and proX ofNGJ1) have not yet been investigated.

In this study, we isolated and characterized the PCA45 path-way gene cluster, orf1-pmdKEFDABC, as well as another 4,5-PCD gene, pmdAIIBII, from Comamonas sp. strain E6.

MATERIALS AND METHODS

Bacterial strains, plasmids, and culture conditions. The bacterial strains andplasmids used in this study are listed in Table 1. Comamonas sp. strain E6 wasgrown in Luria-Bertani (LB) medium or in W minimal salt medium (W medium)(35) containing 10 mM PCA or 10 mM succinate (SUC) at 30°C. The E6 mutantswere grown in LB medium. When required, 50 mg of kanamycin/liter, 30 mg ofchloramphenicol/liter, and 25 mg of tetracycline/liter were added to the media.

Escherichia coli strains were grown in LB medium at 37°C. For cultures of E. colicells carrying antibiotic resistance markers, the media were supplemented with100 mg of ampicillin/liter, 25 mg of kanamycin/liter, or 12.5 mg of tetracycline/liter. PCA was purchased from Tokyo Kasei Kogyo Co. (Tokyo, Japan). PDC wasprepared as described previously (34).

DNA manipulations and nucleotide sequencing. DNA manipulations, includ-ing total DNA isolation, construction of deletion derivatives, and DNA sequenc-ing, were performed as described in a previous study (1). Sequence analysis wasperformed using the GeneWorks program (Intelligenetics, Inc., Mountain View,CA) and the MacVector program (MacVector, Inc., Cary, NC). The introductionof plasmids into E6 and its derivatives was carried out by the triparental matingprocedure with a helper plasmid, pRK2013. Homology searches were performedusing the DDBJ database with the BLAST program. A pairwise alignment wasperformed with the EMBOSS alignment tool (http://www.ebi.ac.uk/emboss/align/).

Induction. Cells of E6 and its derivatives grown in W medium containing SUCwere washed twice with W medium and resuspended in fresh W medium con-taining SUC with or without an inducer (10 mM PCA or PDC) to give anabsorbance at 600 nm (A600) of 0.2. The cells were then incubated at 30°C for 4 hwhile being shaken at 180 rpm and were used for the experiments describedbelow.

Enzyme assays. After 4 h of induction, E6 cells were harvested by centrifuga-tion (4,600 � g, 10 min, 4°C), washed twice with 50 mM Tris-HCl buffer (pH 8.5),and broken by ultrasonication. The supernatant was collected by centrifugation

FIG. 1. Proposed catabolic pathway for PCA by Comamonas sp. strain E6 and gene organization of the PCA45 pathway genes. (A) Enzymes:PmdA, small subunit of 4,5-PCD; PmdB, large subunit of 4,5-PCD; PmdC, CHMS dehydrogenase; PmdD, PDC hydrolase; PmdU, putative OMAtautomerase; PmdE, OMA hydratase; PmdF, CHA aldolase/oxaloacetate decarboxylase. Abbreviations: PCA, protocatechuate; CHMS, 4-carboxy-2-hydroxymuconate-6-semialdehyde; PDC, 2-pyrone-4,6-dicarboxylate; OMA, 4-oxalomesaconate; and CHA, 4-carboxy-4-hydroxy-2-oxoadipate.(B) Organization of the pmd gene cluster and pmdAIIBII. Restriction maps of the 9.8-kb SacI fragment carrying the pmd gene cluster and the 4.3-kbKpnI fragment carrying pmdAIIBII are shown. “deletion” and “kan” indicate the positions deleted in EME015 and EME016 and those of kan geneinsertions into EME012, EME013, and EME014, respectively. Abbreviations: A, ApaI; B, BglII; Ei, EcoRI; Ev, EcoRV; Hc, HincII; Hd, HindIII;K, KpnI; Ps, PstI; Pv, PvuII; Sa, SacI; Sc, SacII; Sl, SalI; Sp, SphI; St, StuI; Xh, XhoI.

8094 KAMIMURA ET AL. APPL. ENVIRON. MICROBIOL.


.asm.org/

Dow

nloaded from

http://aem.asm.org/

(19,000 � g, 20 min, 4°C) and used as crude enzymes. The activities of 4,5-PCDand PDC hydrolase were spectrophotometrically determined by measuring theincrease in the absorbance at 410 nm (ε410; 17,200 M�1 cm�1; pH 8.5) derivedfrom CHMS (33) and the decrease in the absorbance at 312 nm (ε312; 6,600 M�1

cm�1; pH 8.5) derived from PDC (29), respectively, with a DU-7500 spectro-photometer (Beckman Coulter, Fullerton, CA). The reaction mixture (finalvolume, 1 ml) containing 100 �M PCA or PDC and the crude extract (100 �g

protein) in 50 mM Tris-HCl buffer (pH 8.5) was preincubated without thesubstrate for 1 min at 30°C, and then the reaction was initiated by the additionof substrate. One unit of the activities of 4,5-PCD and PDC hydrolase wasdefined as the amount of enzyme that produced 1 �mol of CHMS and theamount of enzyme that degraded 1 �mol of PDC, respectively, per min at 30°C.Specific activity was expressed in units per milligram of protein. The proteinconcentration was determined by the Bradford method (6). Each measurement

TABLE 1. Strains and plasmids used in this study

Strain or plasmid Relevant characteristic(s)a Referenceor source

StrainsComamonas sp.

E6 Wild type; isophthalate� terephthalate� phthalate� 38EME012 E6 derivative; pmdB::kan; Kmr This studyEME013 E6 derivative; pmdBII::kan; Kmr This studyEME014 E6 derivative; orf1 (pmdU)::kan; Kmr This studyEME015 E6 derivative; �pmdK This studyEME016 E6 derivative; �pmdD This study

E. coliJM109 recA1 supE44 endA1 hsdR17(rK

� mK�) gyrA96 relA1 thi-1 �(lac-proAB) F� �traD36 proAB� lacIq

lacZ�M15]42

HB101 recA13 supE44 hsd20(rB� mB

�) ara-14 proA2 lacY1 galK2 rpsL20 xyl-5 mtl-1 5

PlasmidsCharomid 9-36 Apr cos 37pBluescript II KS(�) Cloning vector; Apr 40pT7Blue Cloning vector; Apr NovagenpUC19 Cloning vector; Apr 42pK19mobsacB oriT sacB Kmr 39pIK03 KS(�) with a 1.3-kb EcoRV fragment carrying kan of pUC4K; Apr Kmr 28pRK2013 Tra� Mob� Kmr 10pJB866 RK2 broad-host-range expression vector; Tcr Pm xylS 4pKT230 IncQ broad-host-range cloning vector; Kmr 3pPR9TZ RK2 broad-host-range promoter probe vector lacZ; Apr Cmr 17pCS18 Charomid 9-36 with a 9.8-kb SacI fragment carrying pmdUKEFDABC and 5� region of orf2 This studypCS2 Charomid 9-36 with a 17-kb SacI fragment carrying 3� region of orf3, pmdAIIBII, and orf4 This studypK10SAF KS(�) with a 9.8-kb SacI fragment of pCS18 This studypKN45F KS(�) with a 4.3-kb KpnI fragment of pCS2 This studypSDB36 KS(�) with a 3.7-kb SalI-EcoRV fragment carrying pmdB This studypKS78F pSDB36 with a 1.3-kb EcoRV fragment carrying kan from pIK03 into the StuI site of pmdB This studypDBKM pK19mobsacB with a 4.9-kb SalI-EcoRV fragment of pKS78F This studypT7B2F pT7Blue with a 1.6-kb EcoRV-SphI fragment carrying pmdBII This studypT7B2KF pT7B2F with a 1.3-kb EcoRV fragment carrying kan from pIK03 into the ApaI site of pmdBII This studypKB2K pK19mobsacB with a 3.0-kb SphI-BamHI fragment of pT7B2KF This studypUCS26 pUC19 with a 2.6-kb BglII-EcoRI fragment carrying pmdD This studypK1920 pK19mobsacB with a 2.0-kb HindIII-EcoRI fragment of pUCS26 This studypDPI1D pK1920 with a deletion of a 0.5-kb PstI fragment in pmdD This studypUC2F pUC19 with a 3.4-kb EcoRV fragment carrying pmdK This studypUC2FD pUC2F with a deletion of a 0.8-kb HincII fragment This studypK2FD pK19mobsacB with a 2.7-kb HindIII-EcoRI fragment of pUC2FD This studypUC1 pUC19 with a 3.0-kb SacI-SphI fragment carrying orf1 (pmdU) This studypUC1D pUC1 with a deletion of a 0.4-kb PstI fragment in pmdU This studypK1D pK19mobsacB with a 2.7-kb HindIII-EcoRI fragment of pUC1D This studypK1DKF pK1D with a 1.3-kb EcoRV fragment carrying kan from pIK03 into the PstI site This studypJBB1F pJB866 with a 1.9-kb SphI-KpnI fragment carrying pmdB This studypJBB2 pJB866 with a 1.6-kb EcoRV-XhoI fragment carrying pmdBII This studypJBEUF pJB866 with a 1.3-kb HincII fragment carrying pmdU This studypKT10SAF pKT230 with a 9.8-kb SacI fragment of pCS18 This studypZSA pPR9TZ with a 2.1-kb SacI-ApaI fragment of pK10SAF This studypZU244 pPR9TZ carrying the sequence between positions �1025 and �244 relative to the pmdU start codon This studypZU66 pPR9TZ carrying the sequence between positions �1025 and �66 relative to the pmdU start codon This studypZ285 pPR9TZ carrying the sequence between positions �285 and �253 relative to the pmdU start codon This studypZ184 pPR9TZ carrying the sequence between positions �184 and �253 relative to the pmdU start codon This studypZ78 pPR9TZ carrying the sequence between positions �78 and �253 relative to the pmdU start codon This studypZATG pPR9TZ carrying the sequence between positions 1 and 1026 relative to the pmdU start codon This study

a Kmr, Apr, Tcr, and Cmr, resistance to kanamycin, ampicillin, tetracycline, and chloramphenicol, respectively.

VOL. 76, 2010 COMAMONAS PROTOCATECHUATE 4,5-CLEAVAGE PATHWAY OPERON 8095


.asm.org/

Dow

nloaded from

http://aem.asm.org/

was carried out in triplicate, and the means and standard deviations were cal-culated.

Cloning of orf1-pmdKEFDABC and pmdAIIBII genes. The degenerated primerpair comprising bF and bR (primer sequences are available upon request) wasdesigned based on the conserved sequence in ligB from Sphingobium sp. strainSYK-6 (GenBank accession no. BAB88743), pcmA from A. keyseri 12B (GenBankaccession no. AAK16524), pmdB from C. testosteroni BR6020 (GenBank acces-sion no. AAK73573), and fldU from Sphingomonas sp. strain LB126 (GenBankaccession no. CAB87561) and subsequently used to amplify the sequence of the4,5-PCD gene in E6. A 449-bp PCR-amplified fragment was employed for colonyhybridization as a probe to isolate the PCA45 pathway genes from the E6 genelibrary, which was constructed using charomid 9-36 with SacI digests of the E6total DNA. Colony and Southern hybridization analyses were performed usingthe digoxigenin (DIG) system (Roche, Mannheim, Germany).

RNA preparation. After 4 h of induction, total RNA was isolated from E6 cellsby use of an ISOGEN (Nippon Gene Co., Ltd., Tokyo, Japan) according to themanufacturer’s instructions. In order to remove any contaminating genomicDNA, the RNA samples were treated with RNase-free DNase I (Takara Bio,Inc., Otsu, Japan).

RT-PCR and real-time qRT-PCR. Reverse transcription (RT)-PCR and real-time quantitative RT-PCR (qRT-PCR) were carried out essentially as describedin a previous study (17). After 4 h of induction, total RNA was isolated from E6cells. Single-strand cDNA was synthesized from 3 �g of total RNA utilizingPrimeScript reverse transcriptase (Takara Bio Inc.) with random 9-mer primers(Takara Bio, Inc.). The cDNA mixture was purified by phenol-chloroform ex-traction and ethanol precipitation and was dissolved in 50 �l of DNase-freewater. PCR was performed with 0.5 �l of the cDNA mixture, specific primers(primer sequences are available upon request), and ExTaq DNA polymerase(Takara Bio, Inc.). A qRT-PCR analysis was performed using a SYBR greenPCR master mix (Applied Biosystems, Foster City, CA) with an ABI Prism 7000sequence detection system (Applied Biosystems). Real-time PCR was performedusing 2 �l of the cDNA sample, gene-specific primers (18 pmol), and 10 �l ofSYBR green PCR master mix in a total reaction volume of 20 �l. To normalizethe amount of RNA in each sample, 16S rRNA was used as an internal standard.Each measurement was carried out in triplicate, and the means and standarddeviations were calculated.

Construction of mutants. The 3.7-kb SalI-EcoRV fragment carrying pmdB ofpK10SAF was cloned into pBluescript II KS(�) to generate pSDB36. The 1.3-kbEcoRV fragment carrying the kanamycin resistance gene (kan) from pIK03(kanamycin cassette) was then inserted into the StuI site in pmdB of pSDB36.The resultant plasmid, pKS78F, was digested with SalI and EcoRV, and theinsert was cloned into pK19mobsacB to generate pDBKM. The 1.6-kb EcoRV-SphI fragment carrying pmdBII of pKN45F was inserted into pT7Blue to gener-ate pT7B2F. The kanamycin cassette was cloned into the ApaI site in pmdBII ofpT7B2F. The resultant plasmid, pT7B2KF, was digested with SphI and BamHI,and the insert was cloned into pK19mobsacB to generate pKB2K. The 2.6-kbBglII-EcoRI fragment carrying pmdD of pK10SAF was cloned into pUC19 togenerate pUCS26. The 2.0-kb HindIII-EcoRI fragment was inserted intopK19mobsacB to produce pK1920. The 0.5-kb PstI fragment in pmdD of pK1920was deleted to form pDPI1D. The 3.4-kb EcoRV fragment carrying pmdK ofpK10SAF was inserted into pUC19 to generate pUC2F. The 0.8-kb HincIIfragment in pmdK of pUC2F was deleted. The resultant plasmid, pUC2FD, wasdigested with HindIII-EcoRI, and the insert was cloned to pK19mobsacB to yieldpK2FD. The 3.0-kb SacI-SphI fragment carrying orf1 was cloned into pUC19 toconstruct pUC1. The 0.4-kb PstI fragment in orf1 of pUC1 was deleted to givepUC1D. The 2.7-kb HindIII-EcoRI fragment of pUC1D was cloned intopK19mobsacB to generate pK1D. The kanamycin cassette was inserted into thePstI site in orf1 of pK1D to form pK1DKF.

In order to yield the mutants of pmdB (strain EME012), pmdBII (EME013),pmdD (EME016), pmdK (EME015), and orf1 (EME014), pDBKM, pKB2K,pDPI1D, pK2FD, and pK1DKF were independently introduced into E6 cells bytriparental mating, and then the candidates were isolated as described previously(38). Southern hybridization analyses were carried out to examine the disruptionof each gene. To confirm the disruption of pmdB, pmdBII, pmdD, pmdK, andorf1, total DNA isolated from the candidate mutants was digested with EcoRV,KpnI, BglII-EcoRI, EcoRV, and PvuII, respectively. The 3.4-kb HindIII-KpnIfragment (the probe for pmdB), the 1.3-kb SalI-XhoI fragment (pmdBII), the1.6-kb SphI fragment (pmdD), the 1.3-kb PstI fragment (pmdK), the 1.8-kb PstIfragment (orf1), and the 1.3-kb EcoRV fragment (kan) were labeled with theDIG system (Roche) and used as probes.

Growth of mutants. The mutants were preincubated in 10 ml of W mediumcontaining SUC. The cells were washed with W medium and then transferred to10 ml of W medium containing 10 mM PCA to give an A600 of 0.2. The growths

of the mutant cells on PCA were examined by monitoring the A600 values of thecultures. Complementary plasmids pJBB1F and pJBB2 were independently in-troduced into the cells of EME012 and EME013, and pJBEUF was introducedinto the EME014 cells by triparental mating. These cells were cultured in Wmedium containing 10 mM PCA, tetracycline, and 3 mM m-toluate.

Analysis of mutants. Cells of E6 and EME016 preincubated in 10 ml of Wmedium containing SUC were washed with W medium and inoculated into thesame medium containing 10 mM PCA to give an A600 of 0.2. After incubation forthe appropriate time, portions of the culture were collected and centrifuged(19,000 � g, 5 min, 4°C). The supernatant was analyzed by high-pressure liquidchromatography (HPLC) (ACQUITY ultraperformance liquid chromatography[UPLC] system; Waters, Milford, MA) using a TSKgel ODS-140HTP column(2.1 by 100 mm; Tosoh, Tokyo, Japan). The mobile phase was a mixture of water(74.5%), acetonitrile (24.5%), and phosphoric acid (1%) at a flow rate of 0.3ml/min. PDC and PCA were detected at wavelengths of 204 nm and 260 nm,respectively.

After 4 h of induction, EME014 cells were washed with 50 mM Tris-HCl buffer(pH 7.5) and resuspended in the same buffer to give an A600 of 2.0. The restingcells were incubated with 2 mM PCA at 30°C with shaking (180 rpm). Portionsof the cultures were removed at various sampling time points and centrifuged(19,000 � g, 5 min, 4°C). The supernatant was analyzed by HPLC coupled withelectrospray ionization-mass spectrometry (ESI-MS) with an ACQUITY TQdetector (Waters) as described previously (11). In the HPLC analysis, the mobilephase was a mixture of water (90%) and acetonitrile (10%) containing 0.1%formic acid at a flow rate of 0.3 ml/min. PDC was detected at a wavelength of 315nm. In the ESI-MS analysis, mass spectra were obtained by using the negative-ion mode with the following settings: capillary voltage, 3.0 kV; cone voltage, 10to 40 V; source temperature, 120°C; desolvation temperature, 350°C; desolvationgas flow rate, 650 liters/h; and cone gas flow rate, 50 liters/h.

LacZ reporter assay. After induction for 4 h, crude enzymes were prepared asdescribed above, without the use of 20 mM Tris-HCl buffer (pH 8.0). In order todetermine the lacZ expression, �-galactosidase activities were measured using4-methylumbelliferyl-�-D-galactopyranoside according to the method describedpreviously (17). One unit of �-galactosidase activity was defined as the amountof enzyme that catalyzed the production of 1 �mol of 4-methylumbelliferone permin at 30°C. Specific activity was expressed in units per milligram of protein.Each measurement was carried out in triplicate, and the means and standarddeviations were calculated.

Primer extension. After 4 h of induction, total RNAs were isolated from thecells of E6 and E6 harboring pKT10SAF. The primer extension reactions werecarried out with the Beckman dye D4 (D4)-labeled oligonucleotide pEX1primer. The primer (2 pmol) was annealed to total RNA (5 �g) after 5 min ofdenaturation at 65°C and was extended with PrimeScript reverse transcriptase(Takara Bio, Inc.) at 42°C for 45 min. The enzyme was inactivated by beingexposed to a temperature of 95°C for 5 min. The extended products were purifiedby phenol-chloroform extraction and ethanol precipitation and dissolved in 25 �lof CEQ sample loading solution (Beckman Coulter) combined with 0.5 �l ofDNA (DNA size standard kit, 400; Beckman Coulter). Samples were analyzedutilizing a CEQ2000XL fragment analysis system (Beckman Coulter).

Nucleotide sequence accession numbers. The nucleotide sequences reportedin this paper have been deposited in the DDBJ, EMBL, and GenBank nucleotidesequence databases under accession numbers AB462808 and AB462809.

RESULTS AND DISCUSSION

Cloning and sequencing of the PCA45 pathway genes. Inorder to confirm the involvement of the PCA45 pathway en-zymes in the PCA catabolism by Comamonas sp. strain E6, theactivities of 4,5-PCD and PDC hydrolase in E6 cells weremeasured. The activities of the two enzymes for the cells grownin the presence of PCA were determined to be 270 44 and670 32 mU/mg, which are 110- and 48-fold higher than thosefor the cells grown on succinate (SUC), respectively. Theseresults suggested that E6 degrades PCA through the PCA45pathway, and the pathway enzymes are induced during growthon PCA.

On the basis of the amino acid sequence similarity amongthe 4,5-PCD genes of Sphingobium sp. strain SYK-6, A. keyseri12B, C. testosteroni BR6020, and Sphingomonas sp. strain



.asm.org/

Dow

nloaded from

http://aem.asm.org/

LB126, a degenerated primer set for the amplification of aninternal region of the gene coding for the � subunit of 4,5-PCDwas designed and used to generate a 449-bp fragment from E6.Southern hybridization analysis of the E6 total DNA by use ofthe 449-bp fragment probe showed two hybridization signals(data not shown), suggesting the presence of two 4,5-PCDgenes in E6. Through colony hybridization using the 449-bpfragment probe, pCS18 and pCS2, which carry the 9.8-kb SacIfragment and the 17-kb SacI fragment, respectively, were iso-lated from the E6 charomid libraries. The nucleotide sequenceof the 9.8-kb SacI fragment was determined, and eight openreading frames (ORF) and an incomplete ORF were identified(Fig. 1B). Based on the amino acid sequence similarity, it wasfound that this fragment contained all of the PCA45 pathwayenzyme genes, pmdEFDABC, which code for OMA hydratase,CHA aldolase, PDC hydrolase, the subunit of 4,5-PCD, the� subunit of 4,5-PCD, and CHMS dehydrogenase, respectively.An ortholog (orf1) of proX from P. straminea NGJ1 whosefunction is unknown and a putative 4-hydroxybenzoate/PCAtransporter gene (pmdK) were found upstream of pmdE. The5� region of a putative aldo-keto reductase gene (orf2) waspreceded by pmdC. The gene arrangement of orf1 to pmdC wascompletely conserved between E6 and P. straminea NGJ1.There was no ORF related to the transcriptional regulatorgene in the 9.8-kb SacI fragment. On the other hand, the 4.3-kbKpnI fragment included in the 17-kb SacI fragment containedorf3-pmdAIIBII-orf4, which code for a C-terminal region of thereductase component of vanillate demethylase, the subunitof 4,5-PCD, the � subunit of 4,5-PCD, and a divergently tran-scribed LysR-type transcriptional regulator, respectively (Fig.1B). A partial nucleotide sequence upstream of the 4.3-kbKpnI fragment suggested that there were no other PCA45pathway genes proximal to pmdAIIBII. The amino acid se-quence identity between PmdA and PmdAII was 69.1%, andthat between PmdB and PmdBII was 97.9%.

Operon structure and expression of the pmd genes. Weperformed RT-PCR analysis using total RNA isolated from E6cells grown in the presence of PCA. RT-PCR amplificationproducts of the expected sizes were observed in all the regionsexcept for the region upstream of orf1 and that between pmdCand orf2 (Fig. 2A). No specific amplification was detectedwithout RT. These results suggest that the orf1-pmdKEFDABCgenes are transcribed as a single transcriptional unit.

The activities of 4,5-PCD and PDC hydrolase were induciblein E6 cells grown in the presence of PCA. To confirm thetranscriptional induction of the pmd operon, a quantitativeRT-PCR (qRT-PCR) using total RNA isolated from E6 cellsgrown in the presence or absence of PCA was performed tomeasure the mRNA levels of the pmd genes. Transcription ofthe pmd genes was induced 14- to 35-fold during the growth inthe presence of PCA (Fig. 2B). These results indicate that PCAor its metabolite(s) acts as an inducer(s) of the pmd operon.

Disruption of pmdB and pmdBII in Comamonas sp. strainE6. Inactivation of pmdB and pmdBII was carried out using thepmdB and pmdBII disruption plasmids, pDBKM and pKB2K,respectively, to determine whether these genes are involved inthe ring cleavage of PCA. The pmdB and pmdBII insertionmutations were confirmed by Southern hybridization analysiswith the 3.4-kb HindIII-KpnI fragment carrying pmdAB, the1.3-kb SalI-XhoI fragment carrying pmdBII, and the 1.3-kb

EcoRV fragment carrying kan (data not shown). Disruption ofpmdB in E6 (EME012) resulted in significant growth retarda-tion on PCA (Fig. 3A). To determine if this growth retardationwas caused by the pmdB disruption, pJBB1F, which carriespmdB in pJB866, was introduced into EME012 cells. ThepmdB gene was expressed under the control of the Pm pro-moter. The gene product of xylS coded on pJB866 activates theexpression from the Pm promoter in the presence of m-toluate,which is not a growth substrate of E6. The EME012 cellsharboring pJBB1F grew on PCA in the presence of m-toluateas well as the wild type (Fig. 3B). These results indicate thatpmdB is essential for the normal growth on PCA. On the otherhand, disruption of pmdBII (EME013) did not affect thegrowth of E6 on PCA (Fig. 3C). To verify the function ofpmdBII, pJBB2, which carries pmdBII in pJB866, was intro-duced into EME012 cells. The EME012 cells harboring pJBB2also grew on PCA in the presence of m-toluate, suggesting thatpmdBII codes for 4,5-PCD but is not expressed during thegrowth of E6 on PCA. A qRT-PCR analysis revealed that thetranscription of pmdBII was not induced in the presence ofPCA (Fig. 2B). The transcript amount of pmdBII was almostthe same as that of pmdB under the noninducing condition(data not shown). Oddly, EME012 cells, which had been grownon PCA, were able to grow normally on PCA. Even after thesubculture of the PCA-grown EME012 cells on LB, these cells

FIG. 2. RT-PCR and qRT-PCR analyses of the PCA45 pathwaygenes. (A) Agarose gel electrophoresis of RT-PCR products. TotalRNA isolated from E6 cells grown in the presence of PCA was used asa template for cDNA synthesis. Lane numbers correspond to thenumbers of the amplified regions indicated above. The sizes of molec-ular weight markers in lane M are indicated on the left. “�” and “�,”with and without reverse transcriptase, respectively. (B) qRT-PCRanalysis of the expression of the pmd genes. Total RNA was isolatedfrom E6 cells grown in the presence or absence of PCA. Expression ofthe pmd genes was measured using a qRT-PCR. Values for eachtranscript amount were normalized to the level for 16S rRNA and areshown as fold increases over the level for SUC-grown E6 cells, indi-cated by a dotted line (level of 1.0). The data are mean values standard deviations for three independent experiments.



.asm.org/

Dow

nloaded from

http://aem.asm.org/

grew on PCA like the wild type. This kind of observation wasalso seen previously in the growth on isophthalate of an E6insertion mutant of the gene that encodes the reductase com-ponent of isophthalate dioxygenase (iphD) (11). It seems thatduring the incubation of the EME012 cells on PCA, cellsexpressing pmdBII may have emerged.

Disruption of pmdD, pmdK, and orf1 in Comamonas sp.strain E6. To investigate whether pmdD, pmdK, and orf1 areinvolved in the catabolism of PCA, each of these genes in E6was disrupted. Gene inactivation was carried out using thepmdD, pmdK, and orf1 disruption plasmids, pDPI1D, pK2FD,and pK1DKF, respectively.

The pmdD mutant, EME016, completely lost the ability togrow on PCA (Fig. 4A) and accumulated PDC during thegrowth of EME016 on SUC plus PCA (Fig. 4B). These resultsindicate that pmdD is essential for the growth of E6 on PCAand encodes PDC hydrolase.

The growth of the pmdK mutant, EME015, on PCA wassignificantly retarded compared with that of E6 (Fig. 4C), whilethe growth of EME015 on SUC was identical to that of E6

(data not shown). Based on this result and the fact that thededuced amino acid sequence of PmdK shows 47% identitywith the 4-hydroxybenzoate/PCA transporter PcaK of Pseudo-monas putida (31), PmdK appears to be involved in the PCAuptake. The more PCA (pKa, 4.48) is in its undissociated format a lower pH, the more it is expected to diffuse into the cells(7). We therefore compared the growths of E6 and EME015on PCA at pH 6.0, 7.0, or 8.0. E6 and EME015 grew almostidentically on PCA at pH 6.0. At this pH, more than 2.9% ofthe substrate was expected to be of the undissociated form. Allthese results strongly suggest that pmdK encodes a PCA trans-porter.

Disruption of orf1, which showed no similarity with thegenes of known function, resulted in a complete loss of the cellgrowth on PCA (Fig. 5A). This growth defect of the orf1

FIG. 3. Disruption of pmdB and pmdBII in Comamonas sp. strainE6. (A) The cells of the pmdB mutant (EME012) were grown in Wmedium containing 10 mM PCA. Growth levels of E6 and EME012are indicated by open circles and filled circles, respectively.(B) Complementation of pmdB or pmdBII in EME012 for growth onPCA. Growth levels of E6 cells harboring pJB866 (open circles),EME012 cells harboring pJB866 (filled circles), EME012 cells harbor-ing pJBB1F, which carries pmdB (filled squares), and EME012 cellsharboring pJBB2, which carries pmdBII (filled triangles), are shown.The cells were incubated in W medium containing 10 mM PCA,tetracycline, and 3 mM m-toluate. (C) Growth of the cells of E6 (opencircles) and pmdBII mutant (EME013; filled circles) in W mediumcontaining 10 mM PCA.

FIG. 4. Growth of pmdD and pmdK mutants on PCA. (A) Growthof the cells of E6 (open circles) and the pmdD mutant (EME016; filledcircles) in W medium containing 10 mM PCA. (B) Accumulation ofPDC during the incubation of EME016 cells with PCA. The cells of E6and EME016 were grown in W medium containing 10 mM SUC andPCA. The concentrations of PDC (circles) and PCA (triangles) in theculture incubated with the cells of E6 (open symbols) and EME016(filled symbols) were monitored using HPLC. (C) Growth of the cellsof E6 (open circles) and the pmdK mutant (EME015; filled circles) onPCA under different pH conditions. The E6 and EME015 cells wereincubated in W medium containing 10 mM PCA at pH 6.0, 7.0, or 8.0.



.asm.org/

Dow

nloaded from

http://aem.asm.org/

mutant, EME014, was complemented by the introduction ofpJBEUF carrying orf1 (Fig. 5B), indicating that orf1 is neces-sary for the growth of E6 on PCA. HPLC analysis indicatedthat approximately 1 mM PDC was accumulated in the mixtureof the resting cells of EME014 incubated with 2 mM PCA at15 h (Fig. 5D and F). Such an accumulation of PDC was not

seen the E6 resting cells were used (data not shown). PDCaccumulated in the EME014 culture had finally disappeared at48 h of incubation (Fig. 5E). Furthermore, liquid chromatog-raphy-mass spectrometry (LC-MS) analysis indicated the ac-cumulation of a peak at an m/z of 203 with a retention time of1.06 min in addition to PDC (Fig. 5G and H). In a previousstudy of the OMA hydratase gene (ligJ) of Sphingobium sp.strain SYK-6, the ligJ mutant incubated with PCA primarilyaccumulated PDC that generated from OMA by the reactioncatalyzed by PDC hydrolase (reverse reaction) and a peak atan m/z of 203 assigned to the deprotonated molecular ion ofhydrogenated OMA (12). The hydrogenated OMA was as-sumed to be generated from OMA by a reaction catalyzed byan unknown NADPH-dependent reductase(s). These resultsand observations suggest that EME014 lost the ability to con-vert OMA, and orf1 is responsible for an essential role, but yethas an unknown function, in the PCA45 pathway. We desig-nated orf1 pmdU. Considering the presence of the OMA hy-dratase gene (pmdE) in the E6 pmd operon, it is thought thatpmdU encodes tautomerase involved in the conversion of theenol form of OMA into the keto form, which is thought to bethe substrate for OMA hydratase. In a previous study, ourinvestigators demonstrated that an ORF (orf1) in the ligKoperon involved in the PCA45 pathway of SYK-6 is essentialfor the growth on vanillate and syringate, but the actual func-tion of this gene remains unknown (13). Recently, 3-methylit-aconate isomerase, which catalyzes the isomerization of (R)-3-methylitaconate to 2,3-dimethylmaleate in the nicotinatecatabolism of Eubacterium barkeri (2), has appeared in a da-tabase as a protein similar to the product of SYK-6 orf1 (38%identity). These observations may suggest that orf1 of SYK-6plays the same role as pmdU in the PCA45 pathway, althoughthey have no similarity to each other. Biochemical character-ization of the products of pmdU and SYK-6 orf1 is currentlyunder investigation.

Identification of the pmd promoter region. The lacZ re-porter plasmid pZSA carrying a 1,035-bp region upstream ofthe pmdU start codon was constructed to identify the promoterregion of the pmd operon (Fig. 6A). The expression of the pmdpromoter in E6 cells harboring pZSA was determined bymeans of �-galactosidase activity assays. The pmd promoteractivity was increased 27-fold in the presence of PCA (Fig.6A), suggesting that pZSA contains the region sufficient for theinduction of the pmd promoter in the presence of PCA.

Primer extension analysis using a fluorescently labeled oli-gonucleotide, pEX1, complementary to the 5� region of pmdUand total RNA isolated from E6 cells was performed. Becauseno significant extension product was obtained, E6 cells harbor-ing pKT10SAF, which carries the entire pmd gene cluster, wereemployed to increase the transcription of the pmd operon. A196-nucleotide (nt) DNA fragment was observed only whentotal RNA from the cells grown in the presence of PCA wasused (Fig. 6B). The transcription start site of the pmd operonwas determined to be a thymine 167 nt upstream of the pmdUstart codon (Fig. 6C). A sequence containing inverted repeats(underlined), GCTATGCCTTTGCGGCATAGC, centered atposition �67 was identified; however, no obvious canonicalpromoter sequences for the �70 factor of E. coli could befound.

A set of deletion plasmids was constructed and used for the

FIG. 5. Disruption of orf1 in Comamonas sp. strain E6. (A) Growthof the cells of orf1 mutant (EME014) in W medium containing 10 mMPCA. The growth levels of the cells of E6 and EME014 are indicatedby open circles and filled circles, respectively. (B) Complementation oforf1 in the EME014 mutant. The growth levels of E6 cells harboringpJB866 (open circles), EME014 cells harboring pJB866 (filled circles),and EME014 cells harboring pJBEUF, which carries orf1 (filledsquares), are shown. The cells were incubated in W medium containing10 mM PCA, tetracycline, and 3 mM m-toluate. (C to E) Accumula-tion of PDC and OMA during the degradation of PCA by EME014.The resting cells of EME014 were incubated with 2 mM PCA, andportions of the cultures were collected at the start, at 15 h, and at 48 h.The supernatants of the cultures were analyzed by HPLC. PDC wasdetected at 315 nm. AU, absorbance units. (F and G) Negative-ionESI-MS spectra of PDC with a retention time of 1.13 min and com-pound I with a retention time of 1.06 min, respectively. (H) Extractedion chromatogram at an m/z of 203 for the supernatants of the cultureincubated at 48 h.



.asm.org/

Dow

nloaded from

http://aem.asm.org/

promoter assay (Fig. 6A and C). The inducible expression ofthe pmd promoter was observed only in PCA-grown E6 cellsharboring pZU66 and pZ285, which contain the inverted re-peat sequence. These results suggest that this inverted repeatsequence is indispensable for the induction of the pmd pro-moter in the presence of PCA.

Identification of the inducers of the pmd operon. In order toidentify the inducer(s) of the pmd operon, the pmdB mutant(EME012) and the pmdD mutant (EME016), which accumu-late PCA and PDC, respectively, during the incubation withPCA, were employed for the pmd promoter analyses. The pmdpromoter activity of EME012 cells harboring the reporter plas-mid pZSA was increased 10-fold in the presence of PCA (Ta-ble 2). This result suggests that PCA itself is an inducer of the

pmd operon. However, the pmd promoter activity of EME012cells in the presence of PCA was approximately 36% of thewild-type activity. On the other hand, the extract of EME016cells harboring pZSA grown on PCA exhibited 6.7-times-higher activity than that of the wild type in the presence ofPCA (Table 2). These results strongly suggested that not onlyPCA but also its metabolites, CHMS and PDC, have the abilityto stimulate the pmd promoter activity. When 10 mM PDC wasadded into the culture, cell extracts of E6 and EME016 har-boring pZSA showed 1.7- and 1.3-fold-higher activities thanthose of the respective strains grown on PCA. Furthermore,the induction level of the pmd promoter activity in EME012harboring pZSA was completely restored by the addition ofPDC. All these results obviously indicate that PDC is the moreeffective inducer of the pmd operon in E6. In the case ofSphingobium sp. strain SYK-6, PCA and gallate have beenidentified as inducers for the transcriptional activation of thePCA45 pathway genes controlled by LigR (17). Gallate is anintermediate metabolite of syringate and plays a role in theinduction of the genes for OMA hydratase (ligJ) and CHAaldolase (ligK) required for the syringate catabolism (17). Be-cause PDC is possibly produced in the degradation of theintermediate metabolites of syringate, 3-O-methylgallate andgallate, PDC may have an important role in the syringatecatabolism by E6 as an inducer for the pmd operon.

In the 9.8-kb SacI fragment carrying the pmd operon, wecould not find any transcriptional regulator gene. There is aLysR-type transcriptional regulator gene, orf4, in the 4.3-kbKpnI fragment carrying pmdAIIBII; however, disruption of orf4did not affect the growth on PCA and the activities of the4,5-PCD and PDC hydrolase (data not shown). In the Co-mamonas-type PCA45 pathway gene clusters reported to date,an ORF related to the transcriptional regulator has been foundonly upstream of the pmd gene cluster of a Gram-positivebacterium, A. keyseri 12B (pcmR). A database search of thegenome sequences of C. testosteroni KF-1, C. testosteroniCNB-2 (20), and C. testosteroni S44 revealed the presence ofLysR-type regulators that showed approximately 30% identitywith pcmR, but they are not in the proximity of the PCA45pathway genes. The isolation of the regulator gene(s) for thepmd operon will be essential in the future for clarification ofthe mechanism for the transcriptional regulation of the PCA45pathway genes in E6.

TABLE 2. Expression of the pmd promoter in E6 and itsderivatives harboring pZSA

Strain Growthcondition

�-Galactosidaseactivity (�U/mg

of protein)

Foldinduction

E6 SUC 4.6 0.7SUC-PCA 120 6 27SUC-PDC 200 15 44

EME012 (�pmdB) SUC 4.4 0.4SUC-PCA 43 6 10SUC-PDC 220 13 49

EME016 (�pmdD) SUC 49 1SUC-PCA 800 160 16SUC-PDC 1,000 170 20

FIG. 6. Identification of the pmd promoter region. (A) Deletionanalysis of the pmd promoter region. Schematic of the DNA regionsfused with lacZ, indicating the location of the deletion, is shown to theleft. The �-galactosidase activities of the E6 cells harboring each plas-mid grown in the presence or absence of PCA are shown to the right.“�1” indicates the transcription start site of the pmd operon.(B) Primer extension analyses of the pmd operon transcript by use ofpEX1. Fluorescent primer extensions were performed using the D4-labeled primer (pEX1) and total RNA isolated from E6 cells harboringpKT10SAF, which carries the entire pmd gene cluster, grown in thepresence (left) or absence (right) of PCA. The transcription start sitewas determined by comparing the retention time of the D4-labeledprimer extension product with those of DNA size standards. AU,arbitrary fluorescence units. (C) Nucleotide sequence of the pmd pro-moter region. The endpoints of deletions are indicated by bent arrows.The inverted repeat sequences (convergent arrows) and the transcrip-tion start site (�1) are indicated. The initiation codon of pmdU isdouble underlined. The horizontal dotted arrow indicates the positionof pEX1.



.asm.org/

Dow

nloaded from

http://aem.asm.org/

ACKNOWLEDGMENT

This work was supported in part by a grant-in-aid for scientificresearch (18208027) from the Ministry of Education, Culture, Sports,and Technology, Japan.

REFERENCES

1. Abe, T., E. Masai, K. Miyauchi, Y. Katayama, and M. Fukuda. 2005. Atetrahydrofolate-dependent O-demethylase, LigM, is crucial for catabolismof vanillate and syringate in Sphingomonas paucimobilis SYK-6. J. Bacteriol.187:2030–2037.

2. Alhapel, A., D. J. Darley, N. Wagener, E. Eckel, N. Elsner, and A. J. Pierik.2006. Molecular and functional analysis of nicotinate catabolism in Eubac-terium barkeri. Proc. Natl. Acad. Sci. U. S. A. 103:12341–12346.

3. Bagdasarian, M., R. Lurz, B. Ruckert, F. C. Franklin, M. M. Bagdasarian,J. Frey, and K. N. Timmis. 1981. Specific-purpose plasmid cloning vectors II.Broad host range, high copy number, RSF1010-derived vectors, and a host-vector system for gene cloning in Pseudomonas. Gene 16:237–247.

4. Blatny, J. M., T. Brautaset, H. C. Winther-Larsen, P. Karunakaran, and S.Valla. 1997. Improved broad-host-range RK2 vectors useful for high and lowregulated gene expression levels in gram-negative bacteria. Plasmid 38:35–51.

5. Bolivar, F., and K. Backman. 1979. Plasmids of Escherichia coli as cloningvectors. Methods Enzymol. 68:245–267.

6. Bradford, M. M. 1976. A rapid and sensitive method for the quantitation ofmicrogram quantities of protein utilizing the principle of protein-dye bind-ing. Anal. Biochem. 72:248–254.

7. Collier, L. S., N. N. Nichols, and E. L. Neidle. 1997. benK encodes a hydro-phobic permease-like protein involved in benzoate degradation by Acineto-bacter sp. strain ADP1. J. Bacteriol. 179:5943–5946.

8. Crawford, R. L. 1975. Novel pathway for degradation of protocatechuic acidin Bacillus species. J. Bacteriol. 121:531–536.

9. Eaton, R. W. 2001. Plasmid-encoded phthalate catabolic pathway in Ar-throbacter keyseri 12B. J. Bacteriol. 183:3689–3703.

10. Figurski, D. H., and D. R. Helinski. 1979. Replication of an origin-containingderivative of plasmid RK2 dependent on a plasmid function provided intrans. Proc. Natl. Acad. Sci. U. S. A. 76:1648–1652.

11. Fukuhara, Y., K. Inakazu, N. Kodama, N. Kamimura, D. Kasai, Y. Katay-ama, M. Fukuda, and E. Masai. 2010. Characterization of the isophthalatedegradation genes of Comamonas sp. strain E6. Appl. Environ. Microbiol.76:519–527.

12. Hara, H., E. Masai, Y. Katayama, and M. Fukuda. 2000. The 4-ox-alomesaconate hydratase gene, involved in the protocatechuate 4,5-cleavagepathway, is essential to vanillate and syringate degradation in Sphingomonaspaucimobilis SYK-6. J. Bacteriol. 182:6950–6957.

13. Hara, H., E. Masai, K. Miyauchi, Y. Katayama, and M. Fukuda. 2003.Characterization of the 4-carboxy-4-hydroxy-2-oxoadipate aldolase gene andoperon structure of the protocatechuate 4,5-cleavage pathway genes inSphingomonas paucimobilis SYK-6. J. Bacteriol. 185:41–50.

14. Harwood, C. S., and R. E. Parales. 1996. The �-ketoadipate pathway and thebiology of self-identity. Annu. Rev. Microbiol. 50:553–590.

15. Hasegawa, Y., K. Shikinaka, Y. Katayama, S. Kajita, E. Masai, M. Naka-mura, Y. Otsuka, S. Ohara, and K. Shigehara. 2009. Tenacious epoxy ad-hesives prepared from lignin-derived stable metabolic intermediate. SeniGakkaishi 65:359–362.

16. Hishida, M., K. Shikinaka, Y. Katayama, S. Kajita, E. Masai, M. Nakamura,Y. Otsuka, S. Ohara, and K. Shigehara. 2009. Polyesters of 2-pyrone-4,6-dicarboxylic acid (PDC) as bio-based plastics exhibiting strong adheringproperties. Polym. J. 41:297–302.

17. Kamimura, N., K. Takamura, H. Hara, D. Kasai, R. Natsume, T. Senda, Y.Katayama, M. Fukuda, and E. Masai. 2010. Regulatory system of the pro-tocatechuate 4,5-cleavage pathway genes essential for lignin downstreamcatabolism. J. Bacteriol. 192:3394–3405.

18. Kasai, D., T. Fujinami, T. Abe, K. Mase, Y. Katayama, M. Fukuda, and E.Masai. 2009. Uncovering the protocatechuate 2,3-cleavage pathway genes. J.Bacteriol. 191:6758–6768.

19. Kersten, P. J., S. Dagley, J. W. Whittaker, D. M. Arciero, and J. D. Lips-comb. 1982. 2-pyrone-4,6-dicarboxylic acid, a catabolite of gallic acids inPseudomonas species. J. Bacteriol. 152:1154–1162.

20. Ma, Y. F., Y. Zhang, J. Y. Zhang, D. W. Chen, Y. Zhu, H. Zheng, S. Y. Wang,C. Y. Jiang, G. P. Zhao, and S. J. Liu. 2009. The complete genome ofComamonas testosteroni reveals its genetic adaptations to changing environ-ments. Appl. Environ. Microbiol. 75:6812–6819.

21. Maruyama, K. 1979. Isolation and identification of the reaction product of-hydroxy-�-carboxymuconic ε-semialdehyde dehydrogenase. J. Biochem.86:1671–1677.

22. Maruyama, K. 1983. Purification and properties of 2-pyrone-4,6-dicarboxy-late hydrolase. J. Biochem. 93:557–565.

23. Maruyama, K. 1990. Purification and properties of 4-hydroxy-4-methyl-2-oxoglutarate aldolase from Pseudomonas ochraceae grown on phthalate.J. Biochem. 108:327–333.

24. Maruyama, K. 1985. Purification and properties of �-oxalomesaconate hy-dratase from Pseudomonas ochraceae grown with phthalate. Biochem. Bio-phys. Res. Commun. 128:271–277.

25. Maruyama, K., N. Ariga, M. Tsuda, and K. Deguchi. 1978. Purification andproperties of -hydroxy-�-carboxymuconic ε-semialdehyde dehydrogenase.J. Biochem. 83:1125–1134.

26. Maruyama, K., M. Miwa, N. Tsujii, T. Nagai, N. Tomita, T. Harada, H.Sobajima, and H. Sugisaki. 2001. Cloning, sequencing, and expression of thegene encoding 4-hydroxy-4-methyl-2-oxoglutarate aldolase from Pseudomo-nas ochraceae NGJ1. Biosci. Biotechnol. Biochem. 65:2701–2709.

27. Masai, E., Y. Katayama, and M. Fukuda. 2007. Genetic and biochemicalinvestigations on bacterial catabolic pathways for lignin-derived aromaticcompounds. Biosci. Biotechnol. Biochem. 71:1–15.

28. Masai, E., M. Sasaki, Y. Minakawa, T. Abe, T. Sonoki, K. Miyauchi, Y.Katayama, and M. Fukuda. 2004. A novel tetrahydrofolate-dependent O-demethylase gene is essential for growth of Sphingomonas paucimobilisSYK-6 with syringate. J. Bacteriol. 186:2757–2765.

29. Masai, E., S. Shinohara, H. Hara, S. Nishikawa, Y. Katayama, and M.Fukuda. 1999. Genetic and biochemical characterization of a 2-pyrone-4,6-dicarboxylic acid hydrolase involved in the protocatechuate 4,5-cleavagepathway of Sphingomonas paucimobilis SYK-6. J. Bacteriol. 181:55–62.

30. Michinobu, T., M. Bito, M. Tanimura, Y. Katayama, E. Masai, M. Naka-mura, Y. Otsuka, S. Ohara, and K. Shigehara. 2010. Synthesis and charac-terization of hybrid biopolymers of L-lactic acid and 2-pyrone-4,6-dicarboxy-lic acid. J. Macromol. Sci. Chem. A 47:564–570.

31. Nichols, N. N., and C. S. Harwood. 1997. PcaK, a high-affinity permease forthe aromatic compounds 4-hydroxybenzoate and protocatechuate fromPseudomonas putida. J. Bacteriol. 179:5056–5061.

32. Noda, Y., S. Nishikawa, K. Shiozuka, H. Kadokura, H. Nakajima, K. Yoda,Y. Katayama, N. Morohoshi, T. Haraguchi, and M. Yamasaki. 1990. Mo-lecular cloning of the protocatechuate 4,5-dioxygenase genes of Pseudomo-nas paucimobilis. J. Bacteriol. 172:2704–2709.

33. Ono, K., M. Nozaki, and O. Hayaishi. 1970. Purification and some propertiesof protocatechuate 4,5-dioxygenase. Biochim. Biophys. Acta 220:224–238.

34. Otsuka, Y., M. Nakamura, K. Shigehara, K. Sugimura, E. Masai, S. Ohara,and Y. Katayama. 2006. Efficient production of 2-pyrone 4,6-dicarboxylicacid as a novel polymer-based material from protocatechuate by microbialfunction. Appl. Microbiol. Biotechnol. 71:608–614.

35. Peng, X., T. Egashira, K. Hanashiro, E. Masai, S. Nishikawa, Y. Katayama,K. Kimbara, and M. Fukuda. 1998. Cloning of a Sphingomonas paucimobilisSYK-6 gene encoding a novel oxygenase that cleaves lignin-related biphenyland characterization of the enzyme. Appl. Environ. Microbiol. 64:2520–2527.

36. Providenti, M. A., J. Mampel, S. MacSween, A. M. Cook, and R. C.Wyndham. 2001. Comamonas testosteroni BR6020 possesses a single geneticlocus for extradiol cleavage of protocatechuate. Microbiology 147:2157–2167.

37. Saito, I., and G. R. Stark. 1986. Charomids: cosmid vectors for efficientcloning and mapping of large or small restriction fragments. Proc. Natl.Acad. Sci. U. S. A. 83:8664–8668.

38. Sasoh, M., E. Masai, S. Ishibashi, H. Hara, N. Kamimura, K. Miyauchi, andM. Fukuda. 2006. Characterization of the terephthalate degradation genes ofComamonas sp. strain E6. Appl. Environ. Microbiol. 72:1825–1832.

39. Schafer, A., A. Tauch, W. Jager, J. Kalinowski, G. Thierbach, and A. Puhler.1994. Small mobilizable multi-purpose cloning vectors derived from theEscherichia coli plasmids pK18 and pK19: selection of defined deletions inthe chromosome of Corynebacterium glutamicum. Gene 145:69–73.

40. Short, J. M., J. M. Fernandez, J. A. Sorge, and W. D. Huse. 1988. ZAP: abacteriophage expression vector with in vivo excision properties. NucleicAcids Res. 16:7583–7600.

41. Wattiau, P., L. Bastiaens, R. van Herwijnen, L. Daal, J. R. Parsons, M. E.Renard, D. Springael, and G. R. Cornelis. 2001. Fluorene degradation bySphingomonas sp. LB126 proceeds through protocatechuic acid: a geneticanalysis. Res. Microbiol. 152:861–872.

42. Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved M13 phagecloning vectors and host strains: nucleotide sequences of the M13mp18 andpUC19 vectors. Gene 33:103–119.



.asm.org/

Dow

nloaded from

http://aem.asm.org/

characterization of the protocatechuate 4,5-cleavage ...aem.asm.org/content/76/24/8093.full.pdf ·...

Documents