characterization of the plasmids of the
TRANSCRIPT
Characterization of the Plasmids of the
Pathogenic Plant Bacterium Erwinia amylovora
in Washington and Oregon
by
Alyssa B. Carey
A PROJECT
Submitted to
Oregon State University
University Honors College
In partial fulfillment of the requirement for the
degree of
Honors Baccalaureate of Science in Microbiology (Honors Associate)
Presented May 26, 2011
Commencement June 2011
Alyssa B. Carey for the degree of Honors Baccalaureate of Science in Microbiology presented on May 26, 2011. Title: Characterization of the
Plasmids of the Pathogenic Plant Bacterium Erwinia amylovora in Washington and Oregon
Abstract Approved: ____________________________________________
Virginia Stockwell
ABSTRACT
Erwinia amylovora is a plant pathogenic bacterium that causes the
destructive disease fire blight of apple and pear. We examined the plasmid
content of a collection of 305 isolates of E. amylovora from Washington and
Oregon with PCR assays and RFLP. Nearly all isolates of E. amylovora carried
plasmid pEA29, which is not found in other species of bacteria, but 4% of the
isolates from this region lacked pEA29. The plasmid pEU30, previously
reported in pathogen strains from western states in the USA, was detected in
28% of isolates. The RFLP patterns of plasmid preparations from a third of
isolates from an epidemic in Washington in 1988 had altered RFLP patterns,
possibly due to the presence of plasmid(s) in addition to pEA29 or pEU30.
Considering all samples, the majority of isolates in this region was typical of
E. amylovora and harbored only pEA29. Nonetheless, many of the pathogen
isolates had altered plasmid content, indicating that plasmid acquisition and
propagation in populations of E. amylovora in orchards in the Northwestern
USA is more common than previously assumed.
©Copyright by Alyssa B. Carey
May 26, 2011 All Rights Reserved
Characterization of the Plasmids of the
Pathogenic Plant Bacterium Erwinia amylovora
in Washington and Oregon
by
Alyssa B. Carey
A PROJECT
Submitted to
Oregon State University
University Honors College
In partial fulfillment of the requirement for the
degree of
Honors Baccalaureate of Science in Microbiology (Honors Associate)
Presented May 26, 2011 Commencement June 2011
Honors Baccalaureate of Science in Microbiology project of Alyssa B. Carey presented on May 26, 2011.
APPROVED:
_____________________________________________________________
Mentor, Representing Botany and Plant Pathology
Committee Member, representing Botany and Plant Pathology
Committee Member, representing Microbiology
Committee Member, representing Microbiology
Dean, University Honors College
I understand that my project will become part of the permanent collection of Oregon State University, University Honors College. My signature below authorizes release of my project to any reader upon request.
Alyssa B. Carey, Author
Acknowledgements
I would like to thank Dr. Virginia Stockwell for her willingness to help
and the guidance she has offered as a mentor. It has been a pleasure to
work with her, and without her this project would not have been possible.
Dr. Joyce Loper, Brenda Shaffer, Marcella Henkels, Dr. Teresa Kidarsa and
Sierra Hartney also cheerfully provided technical advice during this project
for which I am grateful for. In addition, I would like to thank the entire
Loper Lab for an atmosphere of support and good-nature laughter that has
made my undergraduate research experience so rewarding.
TABLE OF CONTENTS
PAGE
INTRODUCTION
1
MATERIALS AND METHODS
3
Sources of isolates of E. amylovora
3
Colony lysis
5
Multiplex
5
Singleplex
7
RFLP and alkaline lysis
10
Streptomycin and tetracycline resistance testing
13
RESULTS
15
Multiplex PCR for identification of E. amylovora and detection of pEA29 and pEU30
15
RFLP analysis
22
Streptomycin and tetracycline resistance
26
DISCUSSION
29
Isolates of E. amylovora lacking pEA29
30
Distribution of pEU30
31
Altered RFLP
32
Streptomycin and tetracycline resistance
34
CONCLUSION
35
REFERENCES
37
LIST OF FIGURES AND TABLES
FIGURE
PAGE
1. Ea AgriStrip
6
2. Targeted region for PCR identification of pEU30
11
3. Multiplex PCR
17
4. RFLP of isolate LA071
19
5. Location of Central Washington Orchards sampled in 1988
21
6. Characterization of Washington and Oregon isolates
23
7. RFLP analysis of plasmids
25
TABLE
1. Primer utilized for detection and characterization
of E. amylovora and plasmid pEU30
8
2. Incidence of streptomycin resistance
28
1
INTRODUCTION
Fire blight is a severe disease of apple and pear caused by the
pathogenic bacterium, Erwinia amylovora (Vanneste 2000). E. amylovora
was first discovered in the Hudson Valley located in New York in 1780 and
has since spread to other areas of North America, Europe, the Middle East
and New Zealand. Under favorable weather conditions for multiplication of
the bacterium and infection of flowers, this pathogen has the ability to
destroy entire orchards and cause economic devastation, with epidemics
causing millions of dollars in crop and tree losses and in reparation. Growers
have relied on applications of streptomycin and oxytetracycline during bloom
to control fire blight. With the increasing prevalence of streptomycin
resistant populations of this pathogen, there are few options for disease
control in apple and pear orchards.
The disease cycle begins in spring with canker activation and the
dissemination of E. amylovora by bees and rain to flower tissues in apple and
pear orchards (Vanneste 2000). On these tissues, the pathogen steadily
increases in numbers until early summer, when growers begin to see initial
infections of blossoms which progress into shoot and fruit infections. With
the progression of the disease into fall the pathogen kills branches to form
the characteristic “shepherd’s crook” and cankers within orchards. These
cankers serve to safely harbor the pathogen during winter until the cycle is
ready to begin again in spring. The most effective option for disease control
is to intervene before the infection of blossoms.
2
E. amylovora carries a self-replicating circular plasmid, pEA29, which
contributes to virulence and fitness of the pathogen and has been
demonstrated as such with strains cured of the plasmid in the laboratory.
pEA29 is considered near ubiquitous in E. amylovora (McGhee and Jones
2000). Strains of E. amylovora lacking pEA29 have been isolated from
orchards in Egypt, Germany, Iran, Ireland and Spain, but these strains are
considered rare (Brennan et al., 2002; Llop et al., 2006; Mohammadi et al.,
2009). There are no confirmed reports of isolates of E. amylovora lacking
pEA29 in the United States.
Plasmid acquisition, possibly by means of conjugation from other
orchard bacteria, is a method by which E. amylovora may obtain new genetic
material and traits. In addition to pEA29 another plasmid, pEU30, was
isolated from E. amylovora in Utah and detected in 11 of 29 (38%) isolates
from Washington and Oregon (Foster et al. 2004). The role this plasmid is
still to be determined. Generally, information about plasmids other than
pEA29 in E. amylovora is lacking. Besides pEU30 and pEA29, little is known
about how common extra plasmids are in the pathogen, E. amylovora.
In spite of the Pacific Northwest being one of the biggest producers of
apples and pears in the United States, little research has been done on
diversity of strains of this pathogenic bacterium in this region. The pathogen
has long been considered homogeneous, but recent findings using molecular
methods indicate that the pathogen may be more diverse than previously
believed. With few options for disease control, it is of the utmost importance
3
to understand the nature of this pathogen so as to slow the progression of
this destructive disease.
In this study we tested 305 isolates of E. amylovora, from Washington
and Oregon collected over several years, for pEU30 and pEA29 with a
multiplex PCR assay. We also used restriction fragment length polymorphism
(RFLP) analysis to examine a subset of isolates from Washington for
additional plasmids, as well as to confirm the fidelity of the multiplex PCR
assay. We hypothesized that isolates of Erwinia amylovora from the Pacific
Northwest contain extrachromosomal DNA in addition to pEA29. The purpose
of this study was to examine the diversity of plasmid content of E. amylovora
in isolates from Washington and Oregon, which represents a major pome
fruit production area of the USA.
MATERIALS AND METHODS
Sources of isolates of E. amylovora
E. amylovora was isolated from apple and pear tissues with symptoms
of fire blight from commercial pear and apple orchards in Oregon in 2009.
Branches with visible cankers or necrotic blossom clusters were selected from
orchards. In the lab, symptomatic tissues were removed with a razor blade
and placed in 5 ml sterile milliQ water. Samples were vortexed and 100 µl of
the solution and a 10-fold dilution was spread onto solidified King’s B
medium containing cycloheximide (50 µg/ml) to inhibit the growth of yeast
and fungi. Plates were incubated for 24 hours at 27°C and examined for the
4
presence of small, round white colonies indicating E. amylovora.
Characteristic colonies were selected and spread on solidified Luria broth
agar (LB) to obtain pure cultures of the bacterium. Preliminary identification
of the isolates as E. amylovora was confirmed by appearance on CCT
medium (Ishimaru et al., 1984) and pathogenicity in an immature pear fruit
assay (Steinberger and Beer, 1988). The identity of the pathogen also was
confirmed using the immunological test, Ea AgriStrip (BIOREBA, Reinach,
Switzerland), which is a lateral flow strip that was placed into a suspension of
a colony in phosphate buffered saline containing 0.002% Tween 20 to allow
for interaction between the bacterial antigen and the gold-labeled antibody
(Braun-Kiewnick et al., 2009). If an Ea AgriStrip is functional, then one band
indicating that the reagents worked properly will be visible regardless of the
bacterial isolate tested. If the bacterial isolate tested is E. amylovora, then a
second band is visible (Figure 1). Results of tested isolates were noted.
Isolates were stored in nutrient broth with 15% glycerol at -80°C.
Additional isolates of E. amylovora obtained from commercial orchards
during a fire blight epidemic in Washington in 1988 (Loper et al., 1991) were
kindly provided by Joyce Loper, USDA-ARS, Corvallis, Oregon. Isolates of
the pathogen from Washington orchards in 1991 and Oregon in 1991, 1994,
1995, 1997, 1998, 2008 were provided by Virginia Stockwell, Dept. of
Botany and Plant Pathology, Oregon State University. Isolates from
Washington in 1995, 2009 and 2010 were provided by Larry Pusey USDA-
ARS-TFRL and Timothy Smith, Washington State University, Wenatchee,
Washington.
5
Colony lysis
The method of colony lysis was employed as a quick method for DNA
extraction during the screening process of the bacterial isolates. Single
colonies from isolates were grown on solidified LB at 27°C. A loop-full of the
bacterial growth was selected and placed into 200 µl sterile milliQ water. The
suspension was vortexed then centrifuged. The supernatant was carefully
aspirated leaving the pellet. The pellet was then loosened by vortexing and
25 µl of lysis solution was added (1 ml milliQ water, 10 µl 5M NaOH, 25 µl
10% SDS). The cell suspension was boiled for 10 minutes at 100°C. After
cooling, 175 µl of sterile milliQ water was added. The resulting solution was
the template used for multiplex reactions to test the identity of the isolates
as E. amylovora and as a quick way to screen for presence of the plasmids
pEA29 and pEU30.
Multiplex PCR
Using template made by colony lysis, a multiplex PCR method was
used for quick and accurate screening of all isolates. In this study, the
Qiagen Multiplex Kit was used according to the manufacture’s guidelines
(Qiagen, Valencia, CA). In preliminary assays, I determined that Q solution
of the kit was not needed for amplification so it was not used in subsequent
assays. Three sets of primers were used in the multiplex reaction, each
targeting a unique site. One primer set was targeted to a chromosomal
marker in the ams region of E. amylovora, a PstI region of pEA29 and a
6
Figure 1. Ea AgriStrip. The immunological test of Ea AgriStrip utilizes antigen-antibody interaction to quickly identify isolates as E. amylovora
(Bioreba, Reinach, Switzerland). Bands appearing on the AgriStrip indicated a positive antigen-antibody reaction targeted specifically to E. amylovora. The upper Ea AgriStrip is from an assay in which the colony tested was not E.
amylovora. The bottom test is the reaction with a confirmed isolate of the pathogenic bacterium.
7
region of the virB10 gene of the plasmid pEU30 (Table 1). 10 µl of each
primer (100 mM) was aliquoted into a microcentrifuge tube and brought up
to a volume of 500 µl to make the required 10X primer stock. Cycling
conditions provided by manufacturer were also followed using MJ Research’s
MiniCycler (MJ Research, Watertown, MA). To visualize amplicons, 10 µl of
the PCR reaction was placed in a 1.0% agarose gel with ethidium bromide
and run at 100V for 45 minutes. After this time, amplicons in the gel were
visualized on a UV transilluminator and the sizes of bands were recorded.
Singleplex PCR
To confirm results of the multiplex it was necessary to test a few select
isolates with a singleplex reaction. The singleplex PCR ensured that each
primer set worked properly alone when mixed with another primer sets as
the primer sets did alone. For these reactions the polymerase KOD and
cycling conditions were used according to the manufacturer’s
recommendations using MJ Research’s Minicycler (EMD Chemicals,
Gibbstown, NJ; MJ Research, Watertown, MA). This same method was also
used for the detection of the low-level streptomycin resistance gene strB
using primers StrB-F/StrB-R and for the detection of pEU30 using primers
designed to target regions outside of the virB10 region (Table 1, Figure 2).
The 16S rRNA genes were amplified for a subset of isolates whose
identify as E. amylovora was unclear by both multiplex and singleplex PCR or
for isolates lacking pEA29. 16S rRNA targeted primers were used to amplif
8
Table 1. Primers utilized for detection and characterization of E.
amylovora and identification of the plasmid pEU30 (Continued on page 9)
Primer name Target Primer sequence Expected
amplicon
size
(bps)
Reference
(5’ to 3’)
AMSJ14258
(forward)
amsJ of E.
amylovora
chromosome
TTACTGCAGACGTGCTC ~600 Mohammadi et al., 2009
AMSK14892c
(reverse)
amsJ of E.
amylovora
chromosome
ATCTTCTCCGCCGGACA ~600 Mohammadi et al., 2009
AJ75
(forward)
PstI region of
pEA29
CGTATTCACGGCTTCGCAGAT 844 McManus and Jones, 1995
AJ76
(reverse)
PstI region of
pEA29
ACCCGCCAGGATAGTCGCATA 844 McManus and Jones, 1995
Ea-A
(forward)
PstI region of
pEA29
CGGTTTTTAACGCTGGG ~1000 Bereswil et al., 1992
Ea-B
(reverse)
PstI region of
pEA29
GGGCAAATACTCGGATT ~1000 Bereswil et al., 1992
AJ889
(forward)
VirB10 of
pEU30
GCCGGGGCGTGGAACAGAAG 483 Foster et al.,2004
AJ890 (reverse) VirB10 of
pEU30
TCATGCCGGAAGAGTCAAACC 483 Foster et al.,2004
StrB-F
(forward)
StrB GGAACTGCGTGGGCTACA 330 Choiu and Jones, 1991
StrB-R
(reverse)
StrB GCTAGATCGCGTTGCTCCTCT 330 Choiu and Jones, 1991
9
Table 1. Primers utilized for detection and characterization of E. amylovora and identification of the plasmid pEU30
(Continued from page 8)
Primer name Target Primer sequence
(5’-3’)
Expected
amplicon
size
(bps)
Reference
EU30orf24R pEU30 TTCCTCTTCGGAAACTCGAA ~500 Created for this study
EU30repA491F pEU30 GAGATACGCCCGGTCTACAA ~800 Created for this study
EU30repA491R pEU30 GCCATCAGCAGCATAGTTGA ~800 Created for this study
EU30repA4823F pEU30 CATAATGCGGTCAACGACAC ~700 Created for this study
EU30repA823R pEU30 CTGCTTCATCTGCCATTTCA ~700 Created for this study
VS3650F126 pEU30 GATGTGGCGAAAAGGGATAC 669 Created for this study
VS3650R795 pEU30 TGGGATGGTGTGCAATTATG 669 Created for this study
VS1581F133 pEU30 CATAATGCGGTCAACGACAC 883 Created for this study
VS1581R1016 pEU30 TAGGATCATCCCACTCTCG 883 Created for this study
VS20441F679 pEU30 ACTGTCGACACCGGTACCTC 516 Created for this study
VS20441R1195 pEU30 TAATGCGGTCGCTTTTCTCT 516 Created for this study
VS11761F74 pEU30 AGGACGCTATAAGCCAAGCA 471 Created for this study
VS11761R545 pEU30 TAGTCGGAAAGAGCCTGAGC 471 Created for this study
VS13150F57 pEU30 GCGTCAAAAATGAGCATGAA 870 Created for this study
VS13150R927 pEU30 CGCACATCTTTTCCTTTGGT 870 Created for this study
10
16S rRNA with KOD polymerase as described above. After thermocycling, 5
µl of the PCR reaction was subjected to gel electrophoresis to ensure
amplification of the 16S rRNA gene. The single amplicon was isolated from
remaining reaction material using the PCR Clean Up Kit (Qiagen, Valencia,
CA) according to the manufacturer’s recommendations. The concentration of
DNA was quantified by a NanoDrop 2000c system (Thermo Scientific,
Wilmington, DE). Final concentrations of the purified DNA were calculated,
allowing for appropriate concentrations of DNA to be mixed with water and
the selected primer according to guidelines set by the Center for Genome
Research and Biocomputing, Oregon State University. Sequence data was
analyzed using the BLASTn program and the non-redundant nucleotide
database of GenBank at the BLAST website
(http://blast.ncbi.nlm.nih.gov/Blast.cgi). An isolate was deemed as E.
amylovora based upon analysis of nucleotide base pair matching. The 16S
rRNA sequence isolates had a percent identity of 96% or higher with the 16S
rRNA of the sequenced genome of E. amylovora (NC_013971).
RFLP and alkaline lysis
Alkaline lysis and RFLP were employed to gain a deeper understanding
of the true plasmid profile of each isolate. A modified alkaline lysis method
was used to extract plasmid DNA from each isolate (Zhou et al., 1990). To
begin, 5 ml of LB broth was inoculated with E. amylovora and allowed to
grow for 18 to 24 hours. 1.5 ml of each culture was aliquoted into labeled
microcentrifuge tubes and spun at maximum speed for two minutes after
11
Targeted regions for PCR identification of pEU30
Figure 2. Areas targeted by designed primers for detection of pEU30 (Table 1). Unique areas for identification of the plasmid pEU30 were targeted to
confirm the presence of pEU30 amongst E. amylovora strains. (Plasmid map from Foster et al., 2004).
12
which time the LB broth was decanted leaving an intact cellular pellet. To the
pellet, 200 µl of lysis buffer solution was added (50 mM glucose, 25 mM Tris
pH8, 10 mM EDTA, 2 mg/ml lysozyme). The pellet was mixed though the
twirling of a flat toothpick to ensure the pellet was resuspended. The
suspension was incubated at room temperature for 10 minutes. After, 400 µl
of lysing solution was added to the bacterial suspension (0.2N NaOH, 1%
SDS) and allowed to incubate at room temperature for 10 minutes. It was
important to note at this step that the bacterial suspension was clear in
appearance to ensure proper lysing of the cells. Once the incubation period
was finished, 300 µl potassium acetate (11.5 ml glacial acetic acid in 60 ml
5M potassium acetate, then water to 100 ml) was added to the suspension
and shaken briefly using a single wrist snap to ensure thorough mixing. At
this step a white precipitate appeared which indicated the separation of
cellular debris from the DNA that remained in suspension. The labeled tubes
were incubated on ice for 10 minutes. After incubation, the microcentrifuge
tubes were spun at maximum speed for 10 minutes to pellet the precipitated
cellular matter. Upon the completion of the 10 minute centrifugation, the
supernatant was carefully aspirated and relocated into new appropriately
labeled microcentrifuge tubes. To the supernatant, 900 µl of 100%
isopropanol was added to allow for DNA precipitation. These tubes were
incubated for 10 minutes at room temperature and were gently inverted
every 2 minutes to ensure thorough mixing. The tubes were then spun again
at maximum speed for 10 minutes to pellet the precipitated DNA. Once the
10 minutes had expired, the isopropanol solution was carefully aspirated so
13
as not to disrupt any pellet formed. The pellet was then washed with 1 ml
95% ethanol and inverted to allow for drying. Once the edges of the pellet
were visibly dry, 30-50 µl 10 mM Tris with 1 mM EDTA at pH 8 was added
and mixed gently through pipetting.
Once the plasmid DNA was extracted, it was digested using DNA
restriction enzymes. The enzyme EcoRI was employed to examine RFLP
patterns of extrachomonasomal DNA of each isolate. For the restriction
digest reactions, 15 µl of the alkaline lysis template was used in combination
with 2 µl 10X React3 buffer, 2 µl 10mM RNase and 1 µl EcoRI enzyme
(Invitrogen, Carlsbad, CA). This reaction was incubated at 37°C for two
hours to allow sufficient digestion. Fragments from the digested DNA were
separated with gel electrophoresis in 1.0% agarose containing ethidium
bromide and visualized with a UV transilluminator.
Streptomycin and tetracycline resistance testing
Previously, isolates of E. amylovora from the 1988 epidemic in
Washington were tested for resistance to streptomycin or tetracycline by
placing sterile filter disks infiltrated with an antibiotic on a lawn of E.
amylovora on solidified LB medium (Loper et al., 1991). The width of the
zone of inhibition around the disc was measured and isolates capable of
growing adjacent to the filter disc were considered resistant. In this study,
all other isolates were screened for antibiotic resistance by transfer onto
solidified culture medium containing streptomycin (100 µg/ml) or tetracycline
14
(20 µg/ml). The ability of an isolate to grow on media containing an
antibiotic indicates resistance.
In addition, isolates from the 1988 Washington epidemic that were
resistant to streptomycin at concentrations of 100 µg/ml and with altered
RFLP patterns (see below) were tested for capacity to grow on solidified LB
medium containing 2000 µg/ml streptomycin. This high concentration
permits growth of isolates with a spontaneous point mutation in the rplS
gene that confers high-level resistance to streptomycin. Strains that can
only grow on streptomycin at 100 µg/ml and not higher concentrations were
shown to exhibit low-level resistance due to acquisition of a gene, generally
on a plasmid, encoding for an aminoglycoside modification enzyme (AME)
(Choiu and Jones, 1991). This method serves to distinguish strains with high-
level streptomycin resistance due to mutation in rplS from those with low-
level resistance due to acquisition of genes encoding for an aminoglycoside
modification enzyme (McGhee et al., 2011; Choiu and Jones, 1991).
The gene conferring streptomycin resistance, strB, was detected using
a singleplex PCR method, with primers StrB-F/StrB-R (Table 1). For this
singleplex PCR method KOD polymerase was used according to
manufacturer’s recommendations as were cycling conditions (EMD Chemicals,
Gibbstown, NJ). These reactions required the use of MJ Research’s
MiniCycler. (MJ Research, Watertown, MA).
15
RESULTS
Multiplex PCR for identification of an isolate as Erwinia amylovora
and detection of pEA29 and pEU30.
Validation of multiplex PCR for identification of isolates as Erwinia
amylovora. Multiplex PCR was a rapid and accurate method to confirm
identity of isolates as E. amylovora using published primers targeted to the
ams gene on the chromosome (Table 1). Isolate analysis with the multiplex
reaction could be completed within a day, including time for colony lysis to
prepare the template DNA, PCR reaction and examination of amplicons with
gel electrophoresis. The identity of a subset of ten isolates that yielded the
correct amplicon size for the chromosomal target of E. amylovora was
confirmed as the pathogen by colony morphology on King’s B medium, a
serological assay with Ea AgriStrips (Bioreba, Basel, Switzerland), ability to
cause ooze and necrosis in the immature pear fruit assay, and by sequence
analysis of 16S rRNA. Each of the isolates that were positive for ams with
the multiplex PCR assay was confirmed to be E. amylovora.
All isolates negative for the chromosomal amplicon were subjected to
further testing using the above methods. Isolates that did not yield the
chromosomal amplicon were identified as belonging to other bacterial genera
or species such as Pseudomonas syringae, but were most commonly Bacillus
spp. Another isolate, strain LA540 from Corvallis, Oregon was previously
identified as E. amylovora by Pusey et al.(2009) by colony morphology and
GC FAME analysis, but LA540 tested negative for all primers in the multiplex
16
reaction (Figure 3, Lane 14). Isolate LA540 was negative for E. amylovora in
the serological Ea AgriStrip test. Sequence analysis of the 16S rRNA
revealed that the strain actually was an isolate of Erwinia tasmaniensis, a
closely related species to E. amylovora. These results confirm that the
multiplex PCR assay was useful to identify isolates as E. amylovora.
Validation and application of multiplex PCR for detection of
pEA29. Most isolates that generated an amplicon for the chromosomal
target of E. amylovora in the multiplex PCR assay also generated an
amplicon for the targeted region on the plasmid pEA29. None of the isolates
negative for the chromosomal amplicon of E. amylovora were positive for
pEA29 by multiplex PCR.
The presence of pEA29 in ten isolates that were positive for the
plasmid in the multiplex PCR reaction was confirmed with RFLP analysis
described below. Isolates that did not generate an amplicon for pEA29 were
tested with a singleplex PCR reaction with two primer sets, AJ75/AJ76 and
EaA/EaB (Table 1). Both sets of primers target the same PstI restriction
fragment on pEA29, with AJ75/AJ76 amplifying a region internal to the region
targeted with primers EaA/EaB (Schnabel and Jones, 1998; Bereswill et al.,
1992). None of the isolates that were negative for pEA29 with the multiplex
reaction yielded a product in singleplex reactions for pEA29. Plasmid DNA
was isolated from these strains using the modified alkaline lysis method.
Plasmid DNA was not recovered from most of the isolates that were negative
for pEA29. Plasmid DNA was isolated from LA071 (PCR-negative for pEA29),
17
Figure 3. Multiplex PCR. Primer combination detects 3 potential targets in E.
amylovora in one reaction: pEA29 (top band), chromosomal region specific to E. amylovora (middle band) and pEU30 (bottom band). 13 of the 14 isolates of E. amylovora were positive for the targeted region of the chromosome and
pEA29 (Lanes 1,2,3,4,5,7,8,9,10, 11,12,13,15). Six isolates were positive for both pEA29 and pEU30 (Lanes 2,3,5,8, 9, & 15). One isolate found (lane
6) was identified as E. amylovora, but the strain lacked pEA29. All samples with an amplicon to the chromosomal region were confirmed as E. amylovora by other methods. The isolate in lane 14 (LA540) was not E. amylovora and
no amplicons were detected.
18
digested with EcoRI and examined by gel electrophoresis. The EcoRI
restriction fragments from plasmid DNA isolated from LA071 were not the
same sizes expected from digests of pEA29 suggesting that LA071 carried a
plasmid that was not pEA29 (Figure 4, Lane 2). These results indicate that
primers for amplification of pEA29 behaved similarly in singleplex and
multiplex PCR for specific detection of pEA29.
The plasmid pEA29 was detected in all isolates using the validated
multiplex reaction, except for eleven of the total 305 isolates tested from
Oregon and Washington (Table 2). In Washington, eight isolates of the 146
tested from the 1988 epidemic and two isolates of the 25 tested from the
2010 outbreak were negative for pEA29. In Oregon, only two isolates were
negative for this nearly ubiquitous plasmid; one isolate of 23 tested from
Milton Freewater in 1991 and one of 16 tested from Hood River in 1997. The
identity of the isolates as E. amylovora was confirmed with the amplification
of the chromosomal target in the multiplex PCR reaction, the Ea AgriStrip
serological assay and sequence analysis of 16S rRNA. These eleven isolates
were tested repeatedly with singleplex PCR using pEA29 specific primer sets
and RFLP analysis to confirm that these isolates lack pEA29.
The location of all eight isolates lacking pEA29 in the collection of
isolates from Washington in 1988 was examined to determine if proximity
was a factor in distribution of these isolates. Of the isolates that lacked
pEA29, the majority were clustered in the Yakima Valley of Washington with
only two outliers. (Figure 5) In each of the orchards where isolates of E.
amylovora lacked pEA29, other isolates from the same orchards had E.
19
Figure 4. Restriction fragment length polymorphism of plasmid DNA isolated from strain LA071 and the strain LA014 of E. amylovora that carries only
pEA29 and digested with EcoRI. Lane 1 contains KB+ Ladder, a molecular weight marker. The RFLP pattern of the plasmid DNA of strain LA014 (lane 3) was similar to patterns expected for strains carrying only pEA29 based on
the sequence of the plasmid. The RFLP pattern of EcoRI-digested plasmid DNA of strain LA071 (lane 2) differed from that of pEA29 (land 3). Isolate
LA071 was confirmed to lack pEA29 by RFLP analysis.
20
amylovora containing pEA29; thus the populations within a single orchard
were not homogeneous. Considering all isolates of E. amylovora from
Oregon and Washington that were tested about 4% lacked pEA29.
Validation and application of multiplex for detection of pEU30
Using similar methods, isolates of E. amylovora were tested for pEU30
using primers AJ889/AJ890 designed by Foster et al. (2004) to target the
virB10 gene in the plasmid. E. amylovora isolates testing positive for pEU30
were abundant and distributed throughout Oregon and Washington lacking
any obvious distribution pattern. A small number of isolates testing positive
by the multiplex method were subjected to further PCR investigation using
primers specific to regions other than the common virB10 gene to ensure
correct identification of isolates (Table 1, Figure 5). The presence of pEU30
was also confirmed through the use of newly designed primers which
targeted novel areas of the plasmid, such as the region of orf24. These
primers served to confirm PCR results with primers AJ889/AJ890. When
compared, results from all primers sets agreed confirming the validity of the
primers AJ889/AJ890.
The overall prevalence of pEU30 amongst all tested isolates of E.
amylovora was about 28%. All isolates that tested positive for pEU30 were
from the Yakima Valley in Washington and from Northern Oregon (Figure 5).
The incidence of detection of pEU30 varied over time, with the highest
incidence of detection in strains isolated during epidemic years and a
21
Figure 5. Map of Washington State showing locations of pear and apple
orchards sampled in 1988 during a fire blight epidemic. Colors indicate if 1) pEU30 was detected in E. amylovora in an orchard, 2) if Ea lacking pEA29
was detected, or 3) every isolate from a specific orchard had E. amylovora with pEA29 and pEU30 was not detected. Isolates of E. amylovora lacking pEA29 were generally grouped in the Yakima Valley. Isolates of E.
amylovora that tested positive for pEU30 were widespread throughout orchards in Central Washington.
22
relatively low incidence during intervening years. Most notably, during the
1988 epidemic in Washington, pEU30 was detected in 34% of all isolates. In
comparison, only 15% (2 of 13 isolates) of all tested isolates from 1995 in
Washington were positive for pEU30 and pEU30 was not detected in isolates
from Washington in other years. During 1998 in Oregon, a year with a fire
blight epidemic in the Hood River Valley of Oregon, an astounding 82% of
isolates of the pathogen were positive for this plasmid. This finding is in
great contrast to the incidence of detection of pEU30 in isolates of the
pathogen obtained during non-epidemic years in Oregon. The incidence of
detection of pEU30 in Oregon in years other than 1998 ranged from 0 to
19%. (Graph 1a and 1b)
Conclusions from the multiplex and singleplex reactions indicate a
lower incidence rate (28%) of pEU30 in all isolates of E. amylovora in
Washington and Oregon than previously reported incidence of 38% by Foster
et al. (2004). This difference in incidence is likely due to greater numbers of
strains tested for this study compared to the 18 strains examined by Foster
et al. (2004).
RFLP analysis
Plasmids extracted from isolates from Washington (1988) and
Southern Oregon in the Rogue River Valley production region (2009) were
analyzed using restriction fragment length polymorphism (RFLP) to
characterize plasmids. For this study, the enzyme EcoRI was used to analyze
the plasmid profiles of the 1988 Washington isolates and the 2009 Oregon
23
Figure 6. Incidence of detection of E. amylovora lacking pEA29, and E. amylovora
with pEU30 in Oregon (upper graph) and Washington (lower graph). The X axis
represents the year and a number of isolates tested, in parentheses. Each year was
analyzed based upon plasmid content. In isolates from Washington in 1988, isolates
with only pEA29, those lacking pEA29, those with both pEA29 and pEU30 and those
with novel RFLP patterning are reported.
24
isolates. Based on the sequence of pEA29, digestion with EcoRI would
generate six fragments that are 10358, 7016, 4075/4023, 1530, 640 and
543 base pairs in size (Figure 7, Lane 2).
All of the strains tested from southern Oregon in 2009 had an
RFLP pattern expected for strains of the pathogen that had only pEA29. In
contrast, only about one third of the 1988 Washington isolates had an RFLP
pattern consistent with isolates carrying only pEA29. As mentioned
previously, 6% of the isolates from Washington in 1988 lacked pEA29. The
remaining isolates from Washington in 1988 had RFLP patterns with
additional fragments than the expected banding pattern for pEA29.
Multiplex PCR indicated that 34% of isolates from Washington in 1988
may carry pEU30 in addition to pEA29. Based on the sequence of pEU30 and
pEA29, EcoRI digest of plasmids from strains carrying both pEU30 and pEA29
would have the banding pattern expected for pEA29 and additional bands
with the following sizes from pEU30: 6039, 3088, 2799/2861 and 1983 base
pairs (Figure 7, Lane 3). Of the 50 isolates testing positive for pEU30 by PCR,
33 isolates (66%) displayed the expected RFLP patterning for isolates with
both pEA29 and pEU30. In strains that did not have expected RFLP the
content varied from isolates that had many additional bands to those which
only contained a single band when cut with the restriction enzyme EcoRI. Of
the isolates with additional bands some had shifted patterns of known pEA29
and pEU30 patterns and some had completely distinct patterns such as
LA071 (Figure 4, Lane 2).
25
Figure 7. RFLP analysis of plasmid DNA digested with EcoRI. Lanes labeled “M” contain the molecular weight marker 1 Kb+. Expected patterns for
isolate of E. amylovora with only pEA29 (Lane 2) and an isolate with pEA29 and pEU30 (Lane 3) are shown. In lanes 4 though 6, additional bands are
detected, possibly due to the presence of additional plasmid DNA in isolates or polymorphisms within pEA29 or pEU30.
26
A third group of isolates included those which did not align with either
pEA29 and/or pEU30 resultant pattern. One isolate from this group with an
unusual RFLP pattern was the fore mentioned LA071. This isolate contained
bands at approximately 12200, 11300, 6800, 4000, 3500 and 2600 base
pairs when cut with the restriction enzyme EcoRI. It was later determined
that this strain was indeed E. amylovora and was confirmed by multiple
methods to be lacking pEA29.
Plasmid profiling by means of RFLP analysis indicates that the plasmid
content of E. amylovora in samples isolated from some commercial pear and
apple orchards in Washington and Oregon are more diverse than previously
predicted.
Streptomycin and tetracycline resistance
None of the isolates from Oregon or Washington were able to grow on
LB amended with tetracycline at 20 µg/ml.
Resistance of isolates from Oregon and Washington to streptomycin
was assessed by ability to grow on solidified LB with 100 µg/ml streptomycin.
In Washington 63% of all 1988 isolates were resistant to streptomycin and
60% of the 2010 isolates were resistant. In contrast, no isolates from 1991
were resistant to streptomycin, whereas in 1994/1995 36% of the 14 isolates
were resistant to the antibiotic. Surprisingly, eight years prior, in 2002, 0%
of >200 isolates were sensitive to streptomycin. In northern Oregon, the
incidence of resistance to streptomycin ranged from a low of 0% in 1992 to
88% in 1998. (Table 2)
27
Fifty three of the ninety two streptomycin-resistant isolates (100
µl/ml) from the 1988 Washington epidemic had unusual plasmid RFLP
patterns. An additional 35 isolates from the 1988 Washington epidemic were
streptomycin resistant and had RFLP patterns indicating that pEA29 was the
only plasmid present in the bacterium. The remaining four streptomycin-
resistant isolates from the 1988 epidemic were lacking the plasmid pEA29.
The fifty three streptomycin-resistant isolates with unusual plasmid
RFLP patterns were tested to determine if they exhibited high-level of
resistance associated with mutation of rplS or low-level resistance associated
with acquisition of genes encoding an AME. 100% of the selected isolates
from the 1988 Washington collection grew on media amended with 2000
µg/ml streptomycin. This high-level resistance to streptomycin is associated
with a spontaneous point mutation in rplS conferring insensitivity to the
antibiotic and is reported to be a common mechanism of resistance of the fire
blight pathogen to the antibiotic in the Pacific Northwest (Choiu and Jones,
1991).
The high-level resistance from a point mutation in rplS would mask the
detection of low-level resistance associated with transmissible genes
encoding for AME in the cultural assay. Currently, the only AME reported in
E. amylovora are acquired streptomycin phosphotransferases encoded by the
strA-strB gene pair (Chiou and Jones, 1995). I tested the streptomycin
resistant Washington isolates for strB in a singleplex PCR reaction. Only the
28
Table 2. Incidence of streptomycin resistant isolates of E. amylovora by year in Washington state, Northern Oregon (Hood River Valley) and Southern
Oregon (Rogue River Valley)
Location Year
Number of
isolates resistant to
streptomycin
Total
number of
isolates
Proportion of the
isolates resistant to
streptomycin
Washington 1988 92 146 0.63
1991 0 3 0.00
1994/1995 5 14 0.36
2009 3 3 1.00
2010 15 25 0.60
Northern
Oregon 1991 1 23 0.04 1992 0 4 0.00
1994 2 16 0.13
1995 3 14 0.21
1997 10 16 0.63
1998 15 17 0.88
Southern Oregon 2002 0 6 0.00
2009 6 14 0.43
29
positive control, E. amylovora strain CA11 from Michigan (Chiou and Jones,
1991) produced an amplicon for the strB gene. None of the isolates from the
1988 Washington collection were positive in the PCR assay for strB. In spite
of unusual RFLP patterns and resistance to streptomycin, there was no
evidence that any of the isolates harbored the transmissible gene strB
encoding for streptomycin resistance in E. amylovora.
Considering all of the isolates, there was no clear relationship between
streptomycin resistance and plasmid content of E. amylovora isolates. When
analyzing the distribution of streptomycin resistance a total of 63% of the
146 isolates from the 1988 Washington epidemic were resistant to the
antibiotic. Of the isolates that tested positive for streptomycin resistance,
57% had an unusual plasmid profile by RFLP analysis. Of the streptomycin
resistant strains only 38% contained the plasmid pEA29 while 5% lacked this
plasmid. These results do not support any clear relationship between
streptomycin resistance and plasmid content. It is speculated that plasmid
acquisition and maintenance was independent of streptomycin resistance in
this region.
DISCUSSION
The multiplex PCR assay proved to be a reliable and rapid method for
identifying isolates as E. amylovora while screening for the presence of the
plasmids pEA29 and pEU30 in a single reaction. With this assay, we were
able to screen hundreds of isolates and track the presence of pEA29 and
30
pEU30 in the pathogen across locations and years. As novel plasmids
associated with E. amylovora are identified, it may be possible to include
additional primer sets targeted to those plasmids in the multiplex reaction.
Overall, multiplex PCR proved to be a valuable tool to study the diversity of
plasmid content of E. amylovora isolated from orchards in the Pacific
Northwest.
Isolates of E. amylovora lacking pEA29
As determined by McGhee and Jones (2000) the plasmid pEA29 is
considered to be nearly ubiquitous amongst isolates of E. amylovora with no
confirmed reports of isolates lacking the plasmid in the United States. This is
the first confirmed report of an isolate from the US to lack pEA29. When
mapped geographically it was noted that the distribution of these isolates
was heavily localized with the exception of a few outliers. Also, isolates
which lacked the plasmid pEA29 were found to be in the same orchard as
those containing the plasmid. The isolates evaluated in this study were
obtained from infected tissues. It is unknown if the plasmid pEA29 was lost
during the rapid epiphytic growth phase of the pathogen on floral surfaces or
after infection of the tissues. Detection methods targeting pEA29 could be
used in the future to identify isolates of E. amylovora having the plasmid
even in orchards that also harbor isolates lacking the plasmid.
Using pEA29 as a method of detection may also pose a problem when
testing single isolates and may necessitate the use of alternative
31
chromosomal targets for identification of the isolate as E. amylovora and
supports the recommendations of Barionovi et al. (2005).
Distribution of pEU30
This study reports the frequency of pEU30 as lower (28%) than the
previously reported frequency of 38% by Foster et al. (2004) likely due to an
increased sample size studied in this report. In our study, pEU30 was
originally detected with the multiplex PCR reaction with primers targeted to
virB10, which is understood to participate in conjugation (Foster et al.,
2004). Importantly, the gene targeted by primers AJ889/AJ890, virB10, was
found on plasmids of bacteria other than E. amylovora (Helicobacter and
Pseudomonas spp.) which would necessitate the use of additional tests to
confirm the identity of pEU30. New primers were created (Table 1) to
confirm the results obtained by primer set AJ889/AJ890. A total of 24
isolates were tested with all noted primers to confirm positive PCR results of
primers AJ889/AJ890. All 24 tested isolates were confirmed positive by PCR
techniques which included primers from Table 1.
pEU30 is not expected to promote disease much like the nearly
ubiquitous plasmid pEA29 does, but it is suggested that it may be useful in
the characterization of strain biogeography (Foster et al., 2004). Across
Washington and Oregon no clear pattern was evident for geographical
distribution in this region; however, there was an emerging pattern amongst
epidemic versus non-epidemic years. As reported, isolates carrying pEU30
were very common throughout Washington and northern Oregon during
epidemic years. In non-epidemic years frequency was much lower. Because
32
the original source of pEU30 is unknown and little is understood about the
contribution of pEU30 to the pathogen, the reason for the variation in the
frequency of detection is not known.
Altered RFLP
Polymorphisms in plasmids have been known to exist amongst isolates
of E. amylovora and have been studied as a method for strain typing focusing
on fragment length variability due to varying number of short DNA sequence
repeats, SSR (Barionovi et al., 2005). Researchers have attempted with
some success to trace particular strains responsible for an outbreak (Lecomte
et al., 1996). Further research has led to the conclusion that some genetic
regions with variable repeat regions may be less reliable for strain typing as
demonstrated by Schnabel and Jones (1998). With this knowledge it is
believed that the changes among RFLP patterning are not simply due to
polymorphisms among pEA29, but rather are the result of additional of
extrachromosomal DNA. This speculation is supported by the research of
McGhee et al., (2002) in conjunction with experimental data.
With RFLP evidence of extrachromosomal or plasmid DNA in addition
to pEA29 or pEU30 inhabiting about one third of all tested isolates of E.
amylovora, new information can be gained about this pathogenic plant
bacterium. E. amylovora was once believed to be fairly homogeneous in
nature (Vanneste, 1995), but this study suggests that the pathogen may
acquire novel DNA from environmental bacteria and persist within a year at a
high frequency under certain conditions. By means of plasmid acquisition, a
33
bacterium may gain unique traits that contribute to its fitness. In this study,
extrachromosomal DNA or polymorphisms do not appear to increase fitness
of particular strains of E. amylovora because isolates with these traits did not
predominate amongst strains in the same orchard or region in subsequent
years. We speculate that environmental conditions may play a role in the
prevalence of plasmids in the pathogen. In years with epidemics of fire
blight, warm weather during bloom supports growth of E. amylovora and
even strains with acquired DNA may compete with wild type strains. In
years with cooler temperatures and little disease, then the wild type strain
may have a competitive advantage over strains carrying an increased
plasmid load. In this scenario, in non-epidemic years, wild type strains of
the pathogen would predominate and in epidemic years increased diversity
might be observed. Overall, if novel DNA is to be acquired and maintained
by a bacterium, then the additional DNA must bring about beneficial changes,
such as antibiotic resistance or tolerance to environmental stresses, to the
genetic composition of the pathogen. Without any added benefits
evolutionary selection will choose against the newly created strain due to the
inability of the newly strain to compete with those of the same pathogen that
are more genetically trim. The nature of this novel DNA observed in isolates
of E. amylovora from orchards in the Pacific Northwest is yet to be
determined, but further analysis is underway.
34
Streptomycin and tetracycline resistance
Growers primarily depend on applications of the antibiotics
streptomycin and oxytetracycline during bloom to suppress growth of E.
amylovora and prevent fire blight. Streptomycin controls fire blight better
than oxytetracycline if the pathogen is sensitive to both antibiotics (Stockwell
et al., 2010). As expected, no isolates were determined to be resistant to
the antibiotic tetracycline at concentrations of 20 µg/ml. This result was
expected because resistance to tetracycline has not been reported for E.
amylovora (McManus et al., 2002).
Approximately half of all tested isolates were resistant to streptomycin
(100 µg/ml). This resistance was independent of plasmid content or orchard
location. From this study, we speculate that plasmid acquisition and
maintenance was independent of streptomycin resistance in Oregon and
Washington.
In Michigan, resistance to streptomycin in E. amylovora is primarily
due to acquisition of a strA-strB gene pair that encodes for streptomycin
phosphotransferases. The resistance genes reside on a plasmid and are
transmissible to other isolates of E. amylovora (McGhee et al., 2011; Chiou
and Jones, 1995). Results from the selected 1988 Washington isolates with
altered plasmid profiles and streptomycin resistant demonstrated that the
streptomycin resistance gene strB was not present among isolates in
Washington. These results were expected because strB was not found
previously in isolates of E. amylovora in the Pacific Northwest (Chiou and
Jones, 1991) and streptomycin resistance of isolates of the pathogen from
35
this region was demonstrated to be due to point mutation in rplS (Chiou and
Jones, 1991). This mechanism of resistance to streptomycin allows the
pathogen to grow at very high concentrations of the antibiotic as
demonstrated in the culture assay. This research confirms that streptomycin
resistance is prevalent amongst isolates of E. amylovora found in orchards
across the Pacific Northwest and may hinder efforts to protect orchards in
Oregon and Washington from fire blight.
CONCLUSIONS
From this study it was determined that the pathogenic plant bacterium
Erwinia amylovora is more diverse than previously perceived in the states of
Oregon and Washington. RFLP analysis indicates the presence of novel
plasmids or polymorphisms amongst the 305 tested isolate from Washington
and Oregon in addition to plasmids pEU30 and pEA29.
In this study we see a positive correlation between high incidence of
detection of pEU30 and years with notable epidemics of fire. During the
1988 epidemic in Washington and the 1998 epidemic in Oregon, an
astounding 63% and 88% of all isolates, respectively, were positive for
pEU30. In contrast, the prevalence rate in non-epidemic years ranged from
0 to 19%. Environmental conditions impact the growth of the pathogen and
that epidemics are more likely when temperatures are warm during bloom
(Vanneste 2000). We speculate that environmental conditions also may play
an important role in supporting growth of bacteria, in addition to E.
36
amylovora, and may influence the rate of acquisition and maintenance of
foreign plasmids by the pathogen.
This study identified eleven isolates to lack the nearly ubiquitous
plasmid pEA29. Of the tested isolates from Washington eight isolates from
1988 and two from 2010 were absent of this plasmid. In Oregon, one isolate
from the years 1991 and 1997 were found to be lacking pEA29. The isolates
that tested negative for pEA29 account for 4% of the 305 tested, which is a
higher prevalence than those seen Egypt, Germany, Iran, Ireland or Spain.
This is the first account of isolates of E. amylovora from the United States to
lack this plasmid.
Lastly, there was no correlation of plasmid content and streptomycin
resistance. It appears that the acquisition and maintenance of plasmids are
not linked to streptomycin resistance; rather, test results indicate a single
chromosomal point mutation to be responsible for resistance to streptomycin
in the pathogen in this region.
37
REFERENCES
Barionovi, D., Giorgi, S., Stroeger, A. R., Ruppitsch, W. and
Scortichini, M. 2005. Characterization of Erwinia amylovora strains from
different host plants using repetitive-sequences PCR analysis, and restriction
fragment length polymorphism and short-sequence DNA repeats of plasmid
pEA29. J. Appl. Microbiol. 100:1084-1094.
Bereswill, S., Pahl, A., Bellemann, P., Zeller, W. and Geider, K. 1992.
Sensitive and species-specific detection of Erwinia amylovora by polymerase
chain reaction analysis. Appl Environ Microbiol. 58: 3522-3526.
Braun-Kiewnick, A. Vogelsanger, J. Schoch, B. Franck, L. Holliger, E.
Duffy, B. Altenbach, D. Oberhansli, T. and Bitterlin, W. 2009. Ea
AgriStrip - a new rapid test for detection of fire blight. Obst-und Weinbau
145:7-10.
Brennan, J.M., Doohan, F.M., Egan, D., Scanlan, H. and Hayes, D.
2002. Characterization and differentiation of Irish Erwinia amylovora.
150:414-422.
Chiou, C.-S. and Jones, A. L. 1991. The analysis of plasmid mediated
streptomycin resistance in Erwinia amylovora. Phytopathology. 81:710-714.
Chiou, C.-S., and Jones, A. L. 1995. Molecular analysis of high level
streptomycin resistance in Erwinia amylovora. Phytopathology. 85:324-328.
Foster, G. C., McGhee, G. C., Jones, A. L., and Sundin, G. W. 2004.
Nucleotide sequences, genetic organization and distribution of pEU30 and
pEL60 from Erwinia amylovora. Appl. Environ. Microbiol. 70:7539-7544.
38
Ishimaru, C.A. and Klos, E.J. 1984. New medium for detecting Erwinia
amylovora and its use in epidemiological studies. Phytopathology 74:1342-
1345.
Kabadjova-Hristova, P., Atanasova, I., Dousset, X., Moncheva, P.
2006. Multiplex PCR assay for identification of Erwinia amylovora – the
causative agent of fire blight. Biotechnol. & Biotechnol. 20:21-25.
Lecomte, P., Manceau, C., Paulin, J.-P. and Keck, M. 1997. Identification
by PCR analysis on plasmid pEA29 of isolates of Erwinia amylovora
responsible of an outbreak in Central Europe. European Journal of Plant
Pathology 103:91–98.
Llop, P., Donat, V., Rodríguez, M., Cabrefiga, J., Ruz, L., Palomo, J. L.,
Montesinos, E., and López, M. M. 2006. An indigenous virulent strain of
Erwinia amylovora lacking the ubiquitous plasmid pEA29. Phytopathology
96:900-907.
Loper, J. E., M. D. Henkels, R. G. Roberts, G. G. Grove, M. J. Willett
and T. J. Smith. 1991. Evaluation of streptomycin, oxytetracycline and
copper resistance of Erwinia amylovora isolated from pear orchards in
Washington State. Plant Dis. 75:287-290.
McGhee, G. C. and Jones, A. J. 2000. Complete nucleotide sequence of
ubiquitous plasmid pEA29 from Erwinia amylovora strain Ea88: gene
organization and intraspecies variation. Appl. Environ. Microbiol. 66:4897-
4907.
McGhee, G. C., Guasco, J., Bellomo, L. M., Blumer-Schuette, S. E.,
Shane, W. W., Irish-Brown, A., and Sundin, G. W. 2011. Genetic
39
analysis of streptomycin-resistant (SmR) strains of Erwinia amylovora
suggests that dissemination of two genotypes is responsible for the current
distribution of SmR E. amylovora in Michigan. Phytopathology 101:182-191.
McGhee, G.C., Schnabel, E. L., Maxson-Stein, K., Jones, B., Stromberg,
V.K., Lacy, G.H. and Jones, A. L. 2002. Relatedness of chromosomal and
plasmid DNAs of Erwinia pyrifoliae and Erwinia amylovora. Appl Environ
Microbiol. 68:6182-6192.
McManus, P. S. , Stockwell, V.O., Sundin, G.W, and Jones, A.L. 2002.
Antibiotic use in plant agriculture. Annu. Rev. Phytopathol. 40:443–465.
Mohammadi, M., Moltmann, E. Zeller, W., and Geider, K. 2009.
Characterisation of naturally occurring Erwinia amylovora strains lacking the
common plasmid pEA29 and their detection with real-time PCR. Eur J Plant
Pathol 124:293–302.
Pusey, P. L., Stockwell, V. O., and Mazzola, M. 2009. Epiphytic bacteria
and yeasts on apple blossoms and their potential as antagonists of Erwinia
amylovora. Phytopathology 99:571-581.
Schnabel, E. L., and Jones, A. L. 1998. Instability of a pEA29 marker in
Erwina amylovora previously used for strain classification. Plant Dis.
82:1334-1336.
Steinberger, E. M. and Beer, S. V. 1988. Creation and complementation of
pathogenicity mutants of Erwinia amylovora. Molecular Plant-Microbe
Interactions. 1:135-144.
Stockwell, V. O., Johnson, K. B., Sugar, D., and Loper, J. E. 2010.
Control of fire blight by Pseudomonas fluorescens A506 and Pantoea vagans
40
C9-1 applied as single strains and mixed inocula. Phytopathology 100:1330-
1339.
Vanneste, J.L. 1995. Erwinia amylovora. pp. 21-46. In: Pathogenesis and
Host Specificity in Plant Diseases: Histopathological, Biochemical, Genetic
and Molecular Bases. Vol. 1 Prokaryotes. US Signh, RP Singh, and K
Kohmoto, eds. Pergamon Press, Oxford and London.
Vanneste, J.L. 2000. What is fire blight? Who is Erwinia amylovora? How to
control it? pp. 1-6. In Fire blight. The disease and its causative agent,
Erwinia amylovora. J.L. Vanneste ed. CABI International. Wallingford, UK.
Zhou, C., Yujun, Y and Jong, A.Y. 1990. Mini-prep in ten minutes.
BioTechniques 8:172-173.