characterization of the plasmids of the

Characterization of the Plasmids of the

Pathogenic Plant Bacterium Erwinia amylovora

in Washington and Oregon

by

Alyssa B. Carey

A PROJECT

Submitted to

Oregon State University

University Honors College

In partial fulfillment of the requirement for the

degree of

Honors Baccalaureate of Science in Microbiology (Honors Associate)

Presented May 26, 2011

Commencement June 2011

Alyssa B. Carey for the degree of Honors Baccalaureate of Science in Microbiology presented on May 26, 2011. Title: Characterization of the

Plasmids of the Pathogenic Plant Bacterium Erwinia amylovora in Washington and Oregon

Abstract Approved: ____________________________________________

Virginia Stockwell

ABSTRACT

Erwinia amylovora is a plant pathogenic bacterium that causes the

destructive disease fire blight of apple and pear. We examined the plasmid

content of a collection of 305 isolates of E. amylovora from Washington and

Oregon with PCR assays and RFLP. Nearly all isolates of E. amylovora carried

plasmid pEA29, which is not found in other species of bacteria, but 4% of the

isolates from this region lacked pEA29. The plasmid pEU30, previously

reported in pathogen strains from western states in the USA, was detected in

28% of isolates. The RFLP patterns of plasmid preparations from a third of

isolates from an epidemic in Washington in 1988 had altered RFLP patterns,

possibly due to the presence of plasmid(s) in addition to pEA29 or pEU30.

Considering all samples, the majority of isolates in this region was typical of

E. amylovora and harbored only pEA29. Nonetheless, many of the pathogen

isolates had altered plasmid content, indicating that plasmid acquisition and

propagation in populations of E. amylovora in orchards in the Northwestern

USA is more common than previously assumed.

Characterization of the Plasmids of the

Pathogenic Plant Bacterium Erwinia amylovora

in Washington and Oregon

by

Alyssa B. Carey

A PROJECT

Submitted to

Oregon State University

University Honors College

In partial fulfillment of the requirement for the

degree of

Honors Baccalaureate of Science in Microbiology (Honors Associate)

Presented May 26, 2011 Commencement June 2011

Honors Baccalaureate of Science in Microbiology project of Alyssa B. Carey presented on May 26, 2011.

APPROVED:

_____________________________________________________________

Mentor, Representing Botany and Plant Pathology

Committee Member, representing Botany and Plant Pathology

Committee Member, representing Microbiology

Committee Member, representing Microbiology

Dean, University Honors College

I understand that my project will become part of the permanent collection of Oregon State University, University Honors College. My signature below authorizes release of my project to any reader upon request.

Alyssa B. Carey, Author

Acknowledgements

I would like to thank Dr. Virginia Stockwell for her willingness to help

and the guidance she has offered as a mentor. It has been a pleasure to

work with her, and without her this project would not have been possible.

Dr. Joyce Loper, Brenda Shaffer, Marcella Henkels, Dr. Teresa Kidarsa and

Sierra Hartney also cheerfully provided technical advice during this project

for which I am grateful for. In addition, I would like to thank the entire

Loper Lab for an atmosphere of support and good-nature laughter that has

made my undergraduate research experience so rewarding.

TABLE OF CONTENTS

PAGE

INTRODUCTION

1

MATERIALS AND METHODS

3

Sources of isolates of E. amylovora

3

Colony lysis

5

Multiplex

5

Singleplex

7

RFLP and alkaline lysis

10

Streptomycin and tetracycline resistance testing

13

RESULTS

15

Multiplex PCR for identification of E. amylovora and detection of pEA29 and pEU30

15

RFLP analysis

22

Streptomycin and tetracycline resistance

26

DISCUSSION

29

Isolates of E. amylovora lacking pEA29

30

Distribution of pEU30

31

Altered RFLP

32


34

CONCLUSION

35

REFERENCES

37

LIST OF FIGURES AND TABLES

FIGURE

PAGE

1. Ea AgriStrip

6

2. Targeted region for PCR identification of pEU30

11

3. Multiplex PCR

17

4. RFLP of isolate LA071

19

5. Location of Central Washington Orchards sampled in 1988

21

6. Characterization of Washington and Oregon isolates

23

7. RFLP analysis of plasmids

25

TABLE

1. Primer utilized for detection and characterization

of E. amylovora and plasmid pEU30

8

2. Incidence of streptomycin resistance

28

1

INTRODUCTION

Fire blight is a severe disease of apple and pear caused by the

pathogenic bacterium, Erwinia amylovora (Vanneste 2000). E. amylovora

was first discovered in the Hudson Valley located in New York in 1780 and

has since spread to other areas of North America, Europe, the Middle East

and New Zealand. Under favorable weather conditions for multiplication of

the bacterium and infection of flowers, this pathogen has the ability to

destroy entire orchards and cause economic devastation, with epidemics

causing millions of dollars in crop and tree losses and in reparation. Growers

have relied on applications of streptomycin and oxytetracycline during bloom

to control fire blight. With the increasing prevalence of streptomycin

resistant populations of this pathogen, there are few options for disease

control in apple and pear orchards.

The disease cycle begins in spring with canker activation and the

dissemination of E. amylovora by bees and rain to flower tissues in apple and

pear orchards (Vanneste 2000). On these tissues, the pathogen steadily

increases in numbers until early summer, when growers begin to see initial

infections of blossoms which progress into shoot and fruit infections. With

the progression of the disease into fall the pathogen kills branches to form

the characteristic “shepherd’s crook” and cankers within orchards. These

cankers serve to safely harbor the pathogen during winter until the cycle is

ready to begin again in spring. The most effective option for disease control

is to intervene before the infection of blossoms.

2

E. amylovora carries a self-replicating circular plasmid, pEA29, which

contributes to virulence and fitness of the pathogen and has been

demonstrated as such with strains cured of the plasmid in the laboratory.

pEA29 is considered near ubiquitous in E. amylovora (McGhee and Jones

2000). Strains of E. amylovora lacking pEA29 have been isolated from

orchards in Egypt, Germany, Iran, Ireland and Spain, but these strains are

considered rare (Brennan et al., 2002; Llop et al., 2006; Mohammadi et al.,

2009). There are no confirmed reports of isolates of E. amylovora lacking

pEA29 in the United States.

Plasmid acquisition, possibly by means of conjugation from other

orchard bacteria, is a method by which E. amylovora may obtain new genetic

material and traits. In addition to pEA29 another plasmid, pEU30, was

isolated from E. amylovora in Utah and detected in 11 of 29 (38%) isolates

from Washington and Oregon (Foster et al. 2004). The role this plasmid is

still to be determined. Generally, information about plasmids other than

pEA29 in E. amylovora is lacking. Besides pEU30 and pEA29, little is known

about how common extra plasmids are in the pathogen, E. amylovora.

In spite of the Pacific Northwest being one of the biggest producers of

apples and pears in the United States, little research has been done on

diversity of strains of this pathogenic bacterium in this region. The pathogen

has long been considered homogeneous, but recent findings using molecular

methods indicate that the pathogen may be more diverse than previously

believed. With few options for disease control, it is of the utmost importance

3

to understand the nature of this pathogen so as to slow the progression of

this destructive disease.

In this study we tested 305 isolates of E. amylovora, from Washington

and Oregon collected over several years, for pEU30 and pEA29 with a

multiplex PCR assay. We also used restriction fragment length polymorphism

(RFLP) analysis to examine a subset of isolates from Washington for

additional plasmids, as well as to confirm the fidelity of the multiplex PCR

assay. We hypothesized that isolates of Erwinia amylovora from the Pacific

Northwest contain extrachromosomal DNA in addition to pEA29. The purpose

of this study was to examine the diversity of plasmid content of E. amylovora

in isolates from Washington and Oregon, which represents a major pome

fruit production area of the USA.

MATERIALS AND METHODS

Sources of isolates of E. amylovora

E. amylovora was isolated from apple and pear tissues with symptoms

of fire blight from commercial pear and apple orchards in Oregon in 2009.

Branches with visible cankers or necrotic blossom clusters were selected from

orchards. In the lab, symptomatic tissues were removed with a razor blade

and placed in 5 ml sterile milliQ water. Samples were vortexed and 100 µl of

the solution and a 10-fold dilution was spread onto solidified King’s B

medium containing cycloheximide (50 µg/ml) to inhibit the growth of yeast

and fungi. Plates were incubated for 24 hours at 27°C and examined for the

4

presence of small, round white colonies indicating E. amylovora.

Characteristic colonies were selected and spread on solidified Luria broth

agar (LB) to obtain pure cultures of the bacterium. Preliminary identification

of the isolates as E. amylovora was confirmed by appearance on CCT

medium (Ishimaru et al., 1984) and pathogenicity in an immature pear fruit

assay (Steinberger and Beer, 1988). The identity of the pathogen also was

confirmed using the immunological test, Ea AgriStrip (BIOREBA, Reinach,

Switzerland), which is a lateral flow strip that was placed into a suspension of

a colony in phosphate buffered saline containing 0.002% Tween 20 to allow

for interaction between the bacterial antigen and the gold-labeled antibody

(Braun-Kiewnick et al., 2009). If an Ea AgriStrip is functional, then one band

indicating that the reagents worked properly will be visible regardless of the

bacterial isolate tested. If the bacterial isolate tested is E. amylovora, then a

second band is visible (Figure 1). Results of tested isolates were noted.

Isolates were stored in nutrient broth with 15% glycerol at -80°C.

Additional isolates of E. amylovora obtained from commercial orchards

during a fire blight epidemic in Washington in 1988 (Loper et al., 1991) were

kindly provided by Joyce Loper, USDA-ARS, Corvallis, Oregon. Isolates of

the pathogen from Washington orchards in 1991 and Oregon in 1991, 1994,

1995, 1997, 1998, 2008 were provided by Virginia Stockwell, Dept. of

Botany and Plant Pathology, Oregon State University. Isolates from

Washington in 1995, 2009 and 2010 were provided by Larry Pusey USDA-

ARS-TFRL and Timothy Smith, Washington State University, Wenatchee,

Washington.

5

Colony lysis

The method of colony lysis was employed as a quick method for DNA

extraction during the screening process of the bacterial isolates. Single

colonies from isolates were grown on solidified LB at 27°C. A loop-full of the

bacterial growth was selected and placed into 200 µl sterile milliQ water. The

suspension was vortexed then centrifuged. The supernatant was carefully

aspirated leaving the pellet. The pellet was then loosened by vortexing and

25 µl of lysis solution was added (1 ml milliQ water, 10 µl 5M NaOH, 25 µl

10% SDS). The cell suspension was boiled for 10 minutes at 100°C. After

cooling, 175 µl of sterile milliQ water was added. The resulting solution was

the template used for multiplex reactions to test the identity of the isolates

as E. amylovora and as a quick way to screen for presence of the plasmids

pEA29 and pEU30.

Multiplex PCR

Using template made by colony lysis, a multiplex PCR method was

used for quick and accurate screening of all isolates. In this study, the

Qiagen Multiplex Kit was used according to the manufacture’s guidelines

(Qiagen, Valencia, CA). In preliminary assays, I determined that Q solution

of the kit was not needed for amplification so it was not used in subsequent

assays. Three sets of primers were used in the multiplex reaction, each

targeting a unique site. One primer set was targeted to a chromosomal

marker in the ams region of E. amylovora, a PstI region of pEA29 and a

6

Figure 1. Ea AgriStrip. The immunological test of Ea AgriStrip utilizes antigen-antibody interaction to quickly identify isolates as E. amylovora

(Bioreba, Reinach, Switzerland). Bands appearing on the AgriStrip indicated a positive antigen-antibody reaction targeted specifically to E. amylovora. The upper Ea AgriStrip is from an assay in which the colony tested was not E.

amylovora. The bottom test is the reaction with a confirmed isolate of the pathogenic bacterium.

7

region of the virB10 gene of the plasmid pEU30 (Table 1). 10 µl of each

primer (100 mM) was aliquoted into a microcentrifuge tube and brought up

to a volume of 500 µl to make the required 10X primer stock. Cycling

conditions provided by manufacturer were also followed using MJ Research’s

MiniCycler (MJ Research, Watertown, MA). To visualize amplicons, 10 µl of

the PCR reaction was placed in a 1.0% agarose gel with ethidium bromide

and run at 100V for 45 minutes. After this time, amplicons in the gel were

visualized on a UV transilluminator and the sizes of bands were recorded.

Singleplex PCR

To confirm results of the multiplex it was necessary to test a few select

isolates with a singleplex reaction. The singleplex PCR ensured that each

primer set worked properly alone when mixed with another primer sets as

the primer sets did alone. For these reactions the polymerase KOD and

cycling conditions were used according to the manufacturer’s

recommendations using MJ Research’s Minicycler (EMD Chemicals,

Gibbstown, NJ; MJ Research, Watertown, MA). This same method was also

used for the detection of the low-level streptomycin resistance gene strB

using primers StrB-F/StrB-R and for the detection of pEU30 using primers

designed to target regions outside of the virB10 region (Table 1, Figure 2).

The 16S rRNA genes were amplified for a subset of isolates whose

identify as E. amylovora was unclear by both multiplex and singleplex PCR or

for isolates lacking pEA29. 16S rRNA targeted primers were used to amplif

8

Table 1. Primers utilized for detection and characterization of E.

amylovora and identification of the plasmid pEU30 (Continued on page 9)

Primer name Target Primer sequence Expected

amplicon

size

(bps)

Reference

(5’ to 3’)

AMSJ14258

(forward)

amsJ of E.

amylovora

chromosome

TTACTGCAGACGTGCTC ~600 Mohammadi et al., 2009

AMSK14892c

(reverse)

amsJ of E.

amylovora

chromosome

ATCTTCTCCGCCGGACA ~600 Mohammadi et al., 2009

AJ75

(forward)

PstI region of

pEA29

CGTATTCACGGCTTCGCAGAT 844 McManus and Jones, 1995

AJ76

(reverse)

PstI region of

pEA29

ACCCGCCAGGATAGTCGCATA 844 McManus and Jones, 1995

Ea-A

(forward)

PstI region of

pEA29

CGGTTTTTAACGCTGGG ~1000 Bereswil et al., 1992

Ea-B

(reverse)

PstI region of

pEA29

GGGCAAATACTCGGATT ~1000 Bereswil et al., 1992

AJ889

(forward)

VirB10 of

pEU30

GCCGGGGCGTGGAACAGAAG 483 Foster et al.,2004

AJ890 (reverse) VirB10 of

pEU30

TCATGCCGGAAGAGTCAAACC 483 Foster et al.,2004

StrB-F

(forward)

StrB GGAACTGCGTGGGCTACA 330 Choiu and Jones, 1991

StrB-R

(reverse)

StrB GCTAGATCGCGTTGCTCCTCT 330 Choiu and Jones, 1991

9

Table 1. Primers utilized for detection and characterization of E. amylovora and identification of the plasmid pEU30

(Continued from page 8)

Primer name Target Primer sequence

(5’-3’)

Expected

amplicon

size

(bps)

Reference

EU30orf24R pEU30 TTCCTCTTCGGAAACTCGAA ~500 Created for this study

EU30repA491F pEU30 GAGATACGCCCGGTCTACAA ~800 Created for this study

EU30repA491R pEU30 GCCATCAGCAGCATAGTTGA ~800 Created for this study

EU30repA4823F pEU30 CATAATGCGGTCAACGACAC ~700 Created for this study

EU30repA823R pEU30 CTGCTTCATCTGCCATTTCA ~700 Created for this study

VS3650F126 pEU30 GATGTGGCGAAAAGGGATAC 669 Created for this study

VS3650R795 pEU30 TGGGATGGTGTGCAATTATG 669 Created for this study

VS1581F133 pEU30 CATAATGCGGTCAACGACAC 883 Created for this study

VS1581R1016 pEU30 TAGGATCATCCCACTCTCG 883 Created for this study

VS20441F679 pEU30 ACTGTCGACACCGGTACCTC 516 Created for this study

VS20441R1195 pEU30 TAATGCGGTCGCTTTTCTCT 516 Created for this study

VS11761F74 pEU30 AGGACGCTATAAGCCAAGCA 471 Created for this study

VS11761R545 pEU30 TAGTCGGAAAGAGCCTGAGC 471 Created for this study

VS13150F57 pEU30 GCGTCAAAAATGAGCATGAA 870 Created for this study

VS13150R927 pEU30 CGCACATCTTTTCCTTTGGT 870 Created for this study

10

16S rRNA with KOD polymerase as described above. After thermocycling, 5

µl of the PCR reaction was subjected to gel electrophoresis to ensure

amplification of the 16S rRNA gene. The single amplicon was isolated from

remaining reaction material using the PCR Clean Up Kit (Qiagen, Valencia,

CA) according to the manufacturer’s recommendations. The concentration of

DNA was quantified by a NanoDrop 2000c system (Thermo Scientific,

Wilmington, DE). Final concentrations of the purified DNA were calculated,

allowing for appropriate concentrations of DNA to be mixed with water and

the selected primer according to guidelines set by the Center for Genome

Research and Biocomputing, Oregon State University. Sequence data was

analyzed using the BLASTn program and the non-redundant nucleotide

database of GenBank at the BLAST website

(http://blast.ncbi.nlm.nih.gov/Blast.cgi). An isolate was deemed as E.

amylovora based upon analysis of nucleotide base pair matching. The 16S

rRNA sequence isolates had a percent identity of 96% or higher with the 16S

rRNA of the sequenced genome of E. amylovora (NC_013971).

RFLP and alkaline lysis

Alkaline lysis and RFLP were employed to gain a deeper understanding

of the true plasmid profile of each isolate. A modified alkaline lysis method

was used to extract plasmid DNA from each isolate (Zhou et al., 1990). To

begin, 5 ml of LB broth was inoculated with E. amylovora and allowed to

grow for 18 to 24 hours. 1.5 ml of each culture was aliquoted into labeled

microcentrifuge tubes and spun at maximum speed for two minutes after

11

Targeted regions for PCR identification of pEU30

Figure 2. Areas targeted by designed primers for detection of pEU30 (Table 1). Unique areas for identification of the plasmid pEU30 were targeted to

confirm the presence of pEU30 amongst E. amylovora strains. (Plasmid map from Foster et al., 2004).

12

which time the LB broth was decanted leaving an intact cellular pellet. To the

pellet, 200 µl of lysis buffer solution was added (50 mM glucose, 25 mM Tris

pH8, 10 mM EDTA, 2 mg/ml lysozyme). The pellet was mixed though the

twirling of a flat toothpick to ensure the pellet was resuspended. The

suspension was incubated at room temperature for 10 minutes. After, 400 µl

of lysing solution was added to the bacterial suspension (0.2N NaOH, 1%

SDS) and allowed to incubate at room temperature for 10 minutes. It was

important to note at this step that the bacterial suspension was clear in

appearance to ensure proper lysing of the cells. Once the incubation period

was finished, 300 µl potassium acetate (11.5 ml glacial acetic acid in 60 ml

5M potassium acetate, then water to 100 ml) was added to the suspension

and shaken briefly using a single wrist snap to ensure thorough mixing. At

this step a white precipitate appeared which indicated the separation of

cellular debris from the DNA that remained in suspension. The labeled tubes

were incubated on ice for 10 minutes. After incubation, the microcentrifuge

tubes were spun at maximum speed for 10 minutes to pellet the precipitated

cellular matter. Upon the completion of the 10 minute centrifugation, the

supernatant was carefully aspirated and relocated into new appropriately

labeled microcentrifuge tubes. To the supernatant, 900 µl of 100%

isopropanol was added to allow for DNA precipitation. These tubes were

incubated for 10 minutes at room temperature and were gently inverted

every 2 minutes to ensure thorough mixing. The tubes were then spun again

at maximum speed for 10 minutes to pellet the precipitated DNA. Once the

10 minutes had expired, the isopropanol solution was carefully aspirated so

13

as not to disrupt any pellet formed. The pellet was then washed with 1 ml

95% ethanol and inverted to allow for drying. Once the edges of the pellet

were visibly dry, 30-50 µl 10 mM Tris with 1 mM EDTA at pH 8 was added

and mixed gently through pipetting.

Once the plasmid DNA was extracted, it was digested using DNA

restriction enzymes. The enzyme EcoRI was employed to examine RFLP

patterns of extrachomonasomal DNA of each isolate. For the restriction

digest reactions, 15 µl of the alkaline lysis template was used in combination

with 2 µl 10X React3 buffer, 2 µl 10mM RNase and 1 µl EcoRI enzyme

(Invitrogen, Carlsbad, CA). This reaction was incubated at 37°C for two

hours to allow sufficient digestion. Fragments from the digested DNA were

separated with gel electrophoresis in 1.0% agarose containing ethidium

bromide and visualized with a UV transilluminator.

Streptomycin and tetracycline resistance testing

Previously, isolates of E. amylovora from the 1988 epidemic in

Washington were tested for resistance to streptomycin or tetracycline by

placing sterile filter disks infiltrated with an antibiotic on a lawn of E.

amylovora on solidified LB medium (Loper et al., 1991). The width of the

zone of inhibition around the disc was measured and isolates capable of

growing adjacent to the filter disc were considered resistant. In this study,

all other isolates were screened for antibiotic resistance by transfer onto

solidified culture medium containing streptomycin (100 µg/ml) or tetracycline

14

(20 µg/ml). The ability of an isolate to grow on media containing an

antibiotic indicates resistance.

In addition, isolates from the 1988 Washington epidemic that were

resistant to streptomycin at concentrations of 100 µg/ml and with altered

RFLP patterns (see below) were tested for capacity to grow on solidified LB

medium containing 2000 µg/ml streptomycin. This high concentration

permits growth of isolates with a spontaneous point mutation in the rplS

gene that confers high-level resistance to streptomycin. Strains that can

only grow on streptomycin at 100 µg/ml and not higher concentrations were

shown to exhibit low-level resistance due to acquisition of a gene, generally

on a plasmid, encoding for an aminoglycoside modification enzyme (AME)

(Choiu and Jones, 1991). This method serves to distinguish strains with high-

level streptomycin resistance due to mutation in rplS from those with low-

level resistance due to acquisition of genes encoding for an aminoglycoside

modification enzyme (McGhee et al., 2011; Choiu and Jones, 1991).

The gene conferring streptomycin resistance, strB, was detected using

a singleplex PCR method, with primers StrB-F/StrB-R (Table 1). For this

singleplex PCR method KOD polymerase was used according to

manufacturer’s recommendations as were cycling conditions (EMD Chemicals,

Gibbstown, NJ). These reactions required the use of MJ Research’s

MiniCycler. (MJ Research, Watertown, MA).

15

RESULTS

Multiplex PCR for identification of an isolate as Erwinia amylovora

and detection of pEA29 and pEU30.

Validation of multiplex PCR for identification of isolates as Erwinia

amylovora. Multiplex PCR was a rapid and accurate method to confirm

identity of isolates as E. amylovora using published primers targeted to the

ams gene on the chromosome (Table 1). Isolate analysis with the multiplex

reaction could be completed within a day, including time for colony lysis to

prepare the template DNA, PCR reaction and examination of amplicons with

gel electrophoresis. The identity of a subset of ten isolates that yielded the

correct amplicon size for the chromosomal target of E. amylovora was

confirmed as the pathogen by colony morphology on King’s B medium, a

serological assay with Ea AgriStrips (Bioreba, Basel, Switzerland), ability to

cause ooze and necrosis in the immature pear fruit assay, and by sequence

analysis of 16S rRNA. Each of the isolates that were positive for ams with

the multiplex PCR assay was confirmed to be E. amylovora.

All isolates negative for the chromosomal amplicon were subjected to

further testing using the above methods. Isolates that did not yield the

chromosomal amplicon were identified as belonging to other bacterial genera

or species such as Pseudomonas syringae, but were most commonly Bacillus

spp. Another isolate, strain LA540 from Corvallis, Oregon was previously

identified as E. amylovora by Pusey et al.(2009) by colony morphology and

GC FAME analysis, but LA540 tested negative for all primers in the multiplex

16

reaction (Figure 3, Lane 14). Isolate LA540 was negative for E. amylovora in

the serological Ea AgriStrip test. Sequence analysis of the 16S rRNA

revealed that the strain actually was an isolate of Erwinia tasmaniensis, a

closely related species to E. amylovora. These results confirm that the

multiplex PCR assay was useful to identify isolates as E. amylovora.

Validation and application of multiplex PCR for detection of

pEA29. Most isolates that generated an amplicon for the chromosomal

target of E. amylovora in the multiplex PCR assay also generated an

amplicon for the targeted region on the plasmid pEA29. None of the isolates

negative for the chromosomal amplicon of E. amylovora were positive for

pEA29 by multiplex PCR.

The presence of pEA29 in ten isolates that were positive for the

plasmid in the multiplex PCR reaction was confirmed with RFLP analysis

described below. Isolates that did not generate an amplicon for pEA29 were

tested with a singleplex PCR reaction with two primer sets, AJ75/AJ76 and

EaA/EaB (Table 1). Both sets of primers target the same PstI restriction

fragment on pEA29, with AJ75/AJ76 amplifying a region internal to the region

targeted with primers EaA/EaB (Schnabel and Jones, 1998; Bereswill et al.,

1992). None of the isolates that were negative for pEA29 with the multiplex

reaction yielded a product in singleplex reactions for pEA29. Plasmid DNA

was isolated from these strains using the modified alkaline lysis method.

Plasmid DNA was not recovered from most of the isolates that were negative

for pEA29. Plasmid DNA was isolated from LA071 (PCR-negative for pEA29),

17

Figure 3. Multiplex PCR. Primer combination detects 3 potential targets in E.

amylovora in one reaction: pEA29 (top band), chromosomal region specific to E. amylovora (middle band) and pEU30 (bottom band). 13 of the 14 isolates of E. amylovora were positive for the targeted region of the chromosome and

pEA29 (Lanes 1,2,3,4,5,7,8,9,10, 11,12,13,15). Six isolates were positive for both pEA29 and pEU30 (Lanes 2,3,5,8, 9, & 15). One isolate found (lane

6) was identified as E. amylovora, but the strain lacked pEA29. All samples with an amplicon to the chromosomal region were confirmed as E. amylovora by other methods. The isolate in lane 14 (LA540) was not E. amylovora and

no amplicons were detected.

18

digested with EcoRI and examined by gel electrophoresis. The EcoRI

restriction fragments from plasmid DNA isolated from LA071 were not the

same sizes expected from digests of pEA29 suggesting that LA071 carried a

plasmid that was not pEA29 (Figure 4, Lane 2). These results indicate that

primers for amplification of pEA29 behaved similarly in singleplex and

multiplex PCR for specific detection of pEA29.

The plasmid pEA29 was detected in all isolates using the validated

multiplex reaction, except for eleven of the total 305 isolates tested from

Oregon and Washington (Table 2). In Washington, eight isolates of the 146

tested from the 1988 epidemic and two isolates of the 25 tested from the

2010 outbreak were negative for pEA29. In Oregon, only two isolates were

negative for this nearly ubiquitous plasmid; one isolate of 23 tested from

Milton Freewater in 1991 and one of 16 tested from Hood River in 1997. The

identity of the isolates as E. amylovora was confirmed with the amplification

of the chromosomal target in the multiplex PCR reaction, the Ea AgriStrip

serological assay and sequence analysis of 16S rRNA. These eleven isolates

were tested repeatedly with singleplex PCR using pEA29 specific primer sets

and RFLP analysis to confirm that these isolates lack pEA29.

The location of all eight isolates lacking pEA29 in the collection of

isolates from Washington in 1988 was examined to determine if proximity

was a factor in distribution of these isolates. Of the isolates that lacked

pEA29, the majority were clustered in the Yakima Valley of Washington with

only two outliers. (Figure 5) In each of the orchards where isolates of E.

amylovora lacked pEA29, other isolates from the same orchards had E.

19

Figure 4. Restriction fragment length polymorphism of plasmid DNA isolated from strain LA071 and the strain LA014 of E. amylovora that carries only

pEA29 and digested with EcoRI. Lane 1 contains KB+ Ladder, a molecular weight marker. The RFLP pattern of the plasmid DNA of strain LA014 (lane 3) was similar to patterns expected for strains carrying only pEA29 based on

the sequence of the plasmid. The RFLP pattern of EcoRI-digested plasmid DNA of strain LA071 (lane 2) differed from that of pEA29 (land 3). Isolate

LA071 was confirmed to lack pEA29 by RFLP analysis.

20

amylovora containing pEA29; thus the populations within a single orchard

were not homogeneous. Considering all isolates of E. amylovora from

Oregon and Washington that were tested about 4% lacked pEA29.

Validation and application of multiplex for detection of pEU30

Using similar methods, isolates of E. amylovora were tested for pEU30

using primers AJ889/AJ890 designed by Foster et al. (2004) to target the

virB10 gene in the plasmid. E. amylovora isolates testing positive for pEU30

were abundant and distributed throughout Oregon and Washington lacking

any obvious distribution pattern. A small number of isolates testing positive

by the multiplex method were subjected to further PCR investigation using

primers specific to regions other than the common virB10 gene to ensure

correct identification of isolates (Table 1, Figure 5). The presence of pEU30

was also confirmed through the use of newly designed primers which

targeted novel areas of the plasmid, such as the region of orf24. These

primers served to confirm PCR results with primers AJ889/AJ890. When

compared, results from all primers sets agreed confirming the validity of the

primers AJ889/AJ890.

The overall prevalence of pEU30 amongst all tested isolates of E.

amylovora was about 28%. All isolates that tested positive for pEU30 were

from the Yakima Valley in Washington and from Northern Oregon (Figure 5).

The incidence of detection of pEU30 varied over time, with the highest

incidence of detection in strains isolated during epidemic years and a

21

Figure 5. Map of Washington State showing locations of pear and apple

orchards sampled in 1988 during a fire blight epidemic. Colors indicate if 1) pEU30 was detected in E. amylovora in an orchard, 2) if Ea lacking pEA29

was detected, or 3) every isolate from a specific orchard had E. amylovora with pEA29 and pEU30 was not detected. Isolates of E. amylovora lacking pEA29 were generally grouped in the Yakima Valley. Isolates of E.

amylovora that tested positive for pEU30 were widespread throughout orchards in Central Washington.

22

relatively low incidence during intervening years. Most notably, during the

1988 epidemic in Washington, pEU30 was detected in 34% of all isolates. In

comparison, only 15% (2 of 13 isolates) of all tested isolates from 1995 in

Washington were positive for pEU30 and pEU30 was not detected in isolates

from Washington in other years. During 1998 in Oregon, a year with a fire

blight epidemic in the Hood River Valley of Oregon, an astounding 82% of

isolates of the pathogen were positive for this plasmid. This finding is in

great contrast to the incidence of detection of pEU30 in isolates of the

pathogen obtained during non-epidemic years in Oregon. The incidence of

detection of pEU30 in Oregon in years other than 1998 ranged from 0 to

19%. (Graph 1a and 1b)

Conclusions from the multiplex and singleplex reactions indicate a

lower incidence rate (28%) of pEU30 in all isolates of E. amylovora in

Washington and Oregon than previously reported incidence of 38% by Foster

et al. (2004). This difference in incidence is likely due to greater numbers of

strains tested for this study compared to the 18 strains examined by Foster

et al. (2004).

RFLP analysis

Plasmids extracted from isolates from Washington (1988) and

Southern Oregon in the Rogue River Valley production region (2009) were

analyzed using restriction fragment length polymorphism (RFLP) to

characterize plasmids. For this study, the enzyme EcoRI was used to analyze

the plasmid profiles of the 1988 Washington isolates and the 2009 Oregon

23

Figure 6. Incidence of detection of E. amylovora lacking pEA29, and E. amylovora

with pEU30 in Oregon (upper graph) and Washington (lower graph). The X axis

represents the year and a number of isolates tested, in parentheses. Each year was

analyzed based upon plasmid content. In isolates from Washington in 1988, isolates

with only pEA29, those lacking pEA29, those with both pEA29 and pEU30 and those

with novel RFLP patterning are reported.

24

isolates. Based on the sequence of pEA29, digestion with EcoRI would

generate six fragments that are 10358, 7016, 4075/4023, 1530, 640 and

543 base pairs in size (Figure 7, Lane 2).

All of the strains tested from southern Oregon in 2009 had an

RFLP pattern expected for strains of the pathogen that had only pEA29. In

contrast, only about one third of the 1988 Washington isolates had an RFLP

pattern consistent with isolates carrying only pEA29. As mentioned

previously, 6% of the isolates from Washington in 1988 lacked pEA29. The

remaining isolates from Washington in 1988 had RFLP patterns with

additional fragments than the expected banding pattern for pEA29.

Multiplex PCR indicated that 34% of isolates from Washington in 1988

may carry pEU30 in addition to pEA29. Based on the sequence of pEU30 and

pEA29, EcoRI digest of plasmids from strains carrying both pEU30 and pEA29

would have the banding pattern expected for pEA29 and additional bands

with the following sizes from pEU30: 6039, 3088, 2799/2861 and 1983 base

pairs (Figure 7, Lane 3). Of the 50 isolates testing positive for pEU30 by PCR,

33 isolates (66%) displayed the expected RFLP patterning for isolates with

both pEA29 and pEU30. In strains that did not have expected RFLP the

content varied from isolates that had many additional bands to those which

only contained a single band when cut with the restriction enzyme EcoRI. Of

the isolates with additional bands some had shifted patterns of known pEA29

and pEU30 patterns and some had completely distinct patterns such as

LA071 (Figure 4, Lane 2).

25

Figure 7. RFLP analysis of plasmid DNA digested with EcoRI. Lanes labeled “M” contain the molecular weight marker 1 Kb+. Expected patterns for

isolate of E. amylovora with only pEA29 (Lane 2) and an isolate with pEA29 and pEU30 (Lane 3) are shown. In lanes 4 though 6, additional bands are

detected, possibly due to the presence of additional plasmid DNA in isolates or polymorphisms within pEA29 or pEU30.

26

A third group of isolates included those which did not align with either

pEA29 and/or pEU30 resultant pattern. One isolate from this group with an

unusual RFLP pattern was the fore mentioned LA071. This isolate contained

bands at approximately 12200, 11300, 6800, 4000, 3500 and 2600 base

pairs when cut with the restriction enzyme EcoRI. It was later determined

that this strain was indeed E. amylovora and was confirmed by multiple

methods to be lacking pEA29.

Plasmid profiling by means of RFLP analysis indicates that the plasmid

content of E. amylovora in samples isolated from some commercial pear and

apple orchards in Washington and Oregon are more diverse than previously

predicted.


None of the isolates from Oregon or Washington were able to grow on

LB amended with tetracycline at 20 µg/ml.

Resistance of isolates from Oregon and Washington to streptomycin

was assessed by ability to grow on solidified LB with 100 µg/ml streptomycin.

In Washington 63% of all 1988 isolates were resistant to streptomycin and

60% of the 2010 isolates were resistant. In contrast, no isolates from 1991

were resistant to streptomycin, whereas in 1994/1995 36% of the 14 isolates

were resistant to the antibiotic. Surprisingly, eight years prior, in 2002, 0%

of >200 isolates were sensitive to streptomycin. In northern Oregon, the

incidence of resistance to streptomycin ranged from a low of 0% in 1992 to

88% in 1998. (Table 2)

27

Fifty three of the ninety two streptomycin-resistant isolates (100

µl/ml) from the 1988 Washington epidemic had unusual plasmid RFLP

patterns. An additional 35 isolates from the 1988 Washington epidemic were

streptomycin resistant and had RFLP patterns indicating that pEA29 was the

only plasmid present in the bacterium. The remaining four streptomycin-

resistant isolates from the 1988 epidemic were lacking the plasmid pEA29.

The fifty three streptomycin-resistant isolates with unusual plasmid

RFLP patterns were tested to determine if they exhibited high-level of

resistance associated with mutation of rplS or low-level resistance associated

with acquisition of genes encoding an AME. 100% of the selected isolates

from the 1988 Washington collection grew on media amended with 2000

µg/ml streptomycin. This high-level resistance to streptomycin is associated

with a spontaneous point mutation in rplS conferring insensitivity to the

antibiotic and is reported to be a common mechanism of resistance of the fire

blight pathogen to the antibiotic in the Pacific Northwest (Choiu and Jones,

1991).

The high-level resistance from a point mutation in rplS would mask the

detection of low-level resistance associated with transmissible genes

encoding for AME in the cultural assay. Currently, the only AME reported in

E. amylovora are acquired streptomycin phosphotransferases encoded by the

strA-strB gene pair (Chiou and Jones, 1995). I tested the streptomycin

resistant Washington isolates for strB in a singleplex PCR reaction. Only the

28

Table 2. Incidence of streptomycin resistant isolates of E. amylovora by year in Washington state, Northern Oregon (Hood River Valley) and Southern

Oregon (Rogue River Valley)

Location Year

Number of

isolates resistant to

streptomycin

Total

number of

isolates

Proportion of the

isolates resistant to

streptomycin

Washington 1988 92 146 0.63

1991 0 3 0.00

1994/1995 5 14 0.36

2009 3 3 1.00

2010 15 25 0.60

Northern

Oregon 1991 1 23 0.04 1992 0 4 0.00

1994 2 16 0.13

1995 3 14 0.21

1997 10 16 0.63

1998 15 17 0.88

Southern Oregon 2002 0 6 0.00

2009 6 14 0.43

29

positive control, E. amylovora strain CA11 from Michigan (Chiou and Jones,

1991) produced an amplicon for the strB gene. None of the isolates from the

1988 Washington collection were positive in the PCR assay for strB. In spite

of unusual RFLP patterns and resistance to streptomycin, there was no

evidence that any of the isolates harbored the transmissible gene strB

encoding for streptomycin resistance in E. amylovora.

Considering all of the isolates, there was no clear relationship between

streptomycin resistance and plasmid content of E. amylovora isolates. When

analyzing the distribution of streptomycin resistance a total of 63% of the

146 isolates from the 1988 Washington epidemic were resistant to the

antibiotic. Of the isolates that tested positive for streptomycin resistance,

57% had an unusual plasmid profile by RFLP analysis. Of the streptomycin

resistant strains only 38% contained the plasmid pEA29 while 5% lacked this

plasmid. These results do not support any clear relationship between

streptomycin resistance and plasmid content. It is speculated that plasmid

acquisition and maintenance was independent of streptomycin resistance in

this region.

DISCUSSION

The multiplex PCR assay proved to be a reliable and rapid method for

identifying isolates as E. amylovora while screening for the presence of the

plasmids pEA29 and pEU30 in a single reaction. With this assay, we were

able to screen hundreds of isolates and track the presence of pEA29 and

30

pEU30 in the pathogen across locations and years. As novel plasmids

associated with E. amylovora are identified, it may be possible to include

additional primer sets targeted to those plasmids in the multiplex reaction.

Overall, multiplex PCR proved to be a valuable tool to study the diversity of

plasmid content of E. amylovora isolated from orchards in the Pacific

Northwest.

Isolates of E. amylovora lacking pEA29

As determined by McGhee and Jones (2000) the plasmid pEA29 is

considered to be nearly ubiquitous amongst isolates of E. amylovora with no

confirmed reports of isolates lacking the plasmid in the United States. This is

the first confirmed report of an isolate from the US to lack pEA29. When

mapped geographically it was noted that the distribution of these isolates

was heavily localized with the exception of a few outliers. Also, isolates

which lacked the plasmid pEA29 were found to be in the same orchard as

those containing the plasmid. The isolates evaluated in this study were

obtained from infected tissues. It is unknown if the plasmid pEA29 was lost

during the rapid epiphytic growth phase of the pathogen on floral surfaces or

after infection of the tissues. Detection methods targeting pEA29 could be

used in the future to identify isolates of E. amylovora having the plasmid

even in orchards that also harbor isolates lacking the plasmid.

Using pEA29 as a method of detection may also pose a problem when

testing single isolates and may necessitate the use of alternative

31

chromosomal targets for identification of the isolate as E. amylovora and

supports the recommendations of Barionovi et al. (2005).

Distribution of pEU30

This study reports the frequency of pEU30 as lower (28%) than the

previously reported frequency of 38% by Foster et al. (2004) likely due to an

increased sample size studied in this report. In our study, pEU30 was

originally detected with the multiplex PCR reaction with primers targeted to

virB10, which is understood to participate in conjugation (Foster et al.,

2004). Importantly, the gene targeted by primers AJ889/AJ890, virB10, was

found on plasmids of bacteria other than E. amylovora (Helicobacter and

Pseudomonas spp.) which would necessitate the use of additional tests to

confirm the identity of pEU30. New primers were created (Table 1) to

confirm the results obtained by primer set AJ889/AJ890. A total of 24

isolates were tested with all noted primers to confirm positive PCR results of

primers AJ889/AJ890. All 24 tested isolates were confirmed positive by PCR

techniques which included primers from Table 1.

pEU30 is not expected to promote disease much like the nearly

ubiquitous plasmid pEA29 does, but it is suggested that it may be useful in

the characterization of strain biogeography (Foster et al., 2004). Across

Washington and Oregon no clear pattern was evident for geographical

distribution in this region; however, there was an emerging pattern amongst

epidemic versus non-epidemic years. As reported, isolates carrying pEU30

were very common throughout Washington and northern Oregon during

epidemic years. In non-epidemic years frequency was much lower. Because

32

the original source of pEU30 is unknown and little is understood about the

contribution of pEU30 to the pathogen, the reason for the variation in the

frequency of detection is not known.

Altered RFLP

Polymorphisms in plasmids have been known to exist amongst isolates

of E. amylovora and have been studied as a method for strain typing focusing

on fragment length variability due to varying number of short DNA sequence

repeats, SSR (Barionovi et al., 2005). Researchers have attempted with

some success to trace particular strains responsible for an outbreak (Lecomte

et al., 1996). Further research has led to the conclusion that some genetic

regions with variable repeat regions may be less reliable for strain typing as

demonstrated by Schnabel and Jones (1998). With this knowledge it is

believed that the changes among RFLP patterning are not simply due to

polymorphisms among pEA29, but rather are the result of additional of

extrachromosomal DNA. This speculation is supported by the research of

McGhee et al., (2002) in conjunction with experimental data.

With RFLP evidence of extrachromosomal or plasmid DNA in addition

to pEA29 or pEU30 inhabiting about one third of all tested isolates of E.

amylovora, new information can be gained about this pathogenic plant

bacterium. E. amylovora was once believed to be fairly homogeneous in

nature (Vanneste, 1995), but this study suggests that the pathogen may

acquire novel DNA from environmental bacteria and persist within a year at a

high frequency under certain conditions. By means of plasmid acquisition, a

33

bacterium may gain unique traits that contribute to its fitness. In this study,

extrachromosomal DNA or polymorphisms do not appear to increase fitness

of particular strains of E. amylovora because isolates with these traits did not

predominate amongst strains in the same orchard or region in subsequent

years. We speculate that environmental conditions may play a role in the

prevalence of plasmids in the pathogen. In years with epidemics of fire

blight, warm weather during bloom supports growth of E. amylovora and

even strains with acquired DNA may compete with wild type strains. In

years with cooler temperatures and little disease, then the wild type strain

may have a competitive advantage over strains carrying an increased

plasmid load. In this scenario, in non-epidemic years, wild type strains of

the pathogen would predominate and in epidemic years increased diversity

might be observed. Overall, if novel DNA is to be acquired and maintained

by a bacterium, then the additional DNA must bring about beneficial changes,

such as antibiotic resistance or tolerance to environmental stresses, to the

genetic composition of the pathogen. Without any added benefits

evolutionary selection will choose against the newly created strain due to the

inability of the newly strain to compete with those of the same pathogen that

are more genetically trim. The nature of this novel DNA observed in isolates

of E. amylovora from orchards in the Pacific Northwest is yet to be

determined, but further analysis is underway.

34


Growers primarily depend on applications of the antibiotics

streptomycin and oxytetracycline during bloom to suppress growth of E.

amylovora and prevent fire blight. Streptomycin controls fire blight better

than oxytetracycline if the pathogen is sensitive to both antibiotics (Stockwell

et al., 2010). As expected, no isolates were determined to be resistant to

the antibiotic tetracycline at concentrations of 20 µg/ml. This result was

expected because resistance to tetracycline has not been reported for E.

amylovora (McManus et al., 2002).

Approximately half of all tested isolates were resistant to streptomycin

(100 µg/ml). This resistance was independent of plasmid content or orchard

location. From this study, we speculate that plasmid acquisition and

maintenance was independent of streptomycin resistance in Oregon and

Washington.

In Michigan, resistance to streptomycin in E. amylovora is primarily

due to acquisition of a strA-strB gene pair that encodes for streptomycin

phosphotransferases. The resistance genes reside on a plasmid and are

transmissible to other isolates of E. amylovora (McGhee et al., 2011; Chiou

and Jones, 1995). Results from the selected 1988 Washington isolates with

altered plasmid profiles and streptomycin resistant demonstrated that the

streptomycin resistance gene strB was not present among isolates in

Washington. These results were expected because strB was not found

previously in isolates of E. amylovora in the Pacific Northwest (Chiou and

Jones, 1991) and streptomycin resistance of isolates of the pathogen from

35

this region was demonstrated to be due to point mutation in rplS (Chiou and

Jones, 1991). This mechanism of resistance to streptomycin allows the

pathogen to grow at very high concentrations of the antibiotic as

demonstrated in the culture assay. This research confirms that streptomycin

resistance is prevalent amongst isolates of E. amylovora found in orchards

across the Pacific Northwest and may hinder efforts to protect orchards in

Oregon and Washington from fire blight.

CONCLUSIONS

From this study it was determined that the pathogenic plant bacterium

Erwinia amylovora is more diverse than previously perceived in the states of

Oregon and Washington. RFLP analysis indicates the presence of novel

plasmids or polymorphisms amongst the 305 tested isolate from Washington

and Oregon in addition to plasmids pEU30 and pEA29.

In this study we see a positive correlation between high incidence of

detection of pEU30 and years with notable epidemics of fire. During the

1988 epidemic in Washington and the 1998 epidemic in Oregon, an

astounding 63% and 88% of all isolates, respectively, were positive for

pEU30. In contrast, the prevalence rate in non-epidemic years ranged from

0 to 19%. Environmental conditions impact the growth of the pathogen and

that epidemics are more likely when temperatures are warm during bloom

(Vanneste 2000). We speculate that environmental conditions also may play

an important role in supporting growth of bacteria, in addition to E.

36

amylovora, and may influence the rate of acquisition and maintenance of

foreign plasmids by the pathogen.

This study identified eleven isolates to lack the nearly ubiquitous

plasmid pEA29. Of the tested isolates from Washington eight isolates from

1988 and two from 2010 were absent of this plasmid. In Oregon, one isolate

from the years 1991 and 1997 were found to be lacking pEA29. The isolates

that tested negative for pEA29 account for 4% of the 305 tested, which is a

higher prevalence than those seen Egypt, Germany, Iran, Ireland or Spain.

This is the first account of isolates of E. amylovora from the United States to

lack this plasmid.

Lastly, there was no correlation of plasmid content and streptomycin

resistance. It appears that the acquisition and maintenance of plasmids are

not linked to streptomycin resistance; rather, test results indicate a single

chromosomal point mutation to be responsible for resistance to streptomycin

in the pathogen in this region.

37

REFERENCES

Barionovi, D., Giorgi, S., Stroeger, A. R., Ruppitsch, W. and

Scortichini, M. 2005. Characterization of Erwinia amylovora strains from

different host plants using repetitive-sequences PCR analysis, and restriction

fragment length polymorphism and short-sequence DNA repeats of plasmid

pEA29. J. Appl. Microbiol. 100:1084-1094.

Bereswill, S., Pahl, A., Bellemann, P., Zeller, W. and Geider, K. 1992.

Sensitive and species-specific detection of Erwinia amylovora by polymerase

chain reaction analysis. Appl Environ Microbiol. 58: 3522-3526.

Braun-Kiewnick, A. Vogelsanger, J. Schoch, B. Franck, L. Holliger, E.

Duffy, B. Altenbach, D. Oberhansli, T. and Bitterlin, W. 2009. Ea

AgriStrip - a new rapid test for detection of fire blight. Obst-und Weinbau

145:7-10.

Brennan, J.M., Doohan, F.M., Egan, D., Scanlan, H. and Hayes, D.

2002. Characterization and differentiation of Irish Erwinia amylovora.

150:414-422.

Chiou, C.-S. and Jones, A. L. 1991. The analysis of plasmid mediated

streptomycin resistance in Erwinia amylovora. Phytopathology. 81:710-714.

Chiou, C.-S., and Jones, A. L. 1995. Molecular analysis of high level

streptomycin resistance in Erwinia amylovora. Phytopathology. 85:324-328.

Foster, G. C., McGhee, G. C., Jones, A. L., and Sundin, G. W. 2004.

Nucleotide sequences, genetic organization and distribution of pEU30 and

pEL60 from Erwinia amylovora. Appl. Environ. Microbiol. 70:7539-7544.

http://www.cabdirect.org/search.html?q=do%3A%22Obst-+und+Weinbau%22

38

Ishimaru, C.A. and Klos, E.J. 1984. New medium for detecting Erwinia

amylovora and its use in epidemiological studies. Phytopathology 74:1342-

1345.

Kabadjova-Hristova, P., Atanasova, I., Dousset, X., Moncheva, P.

2006. Multiplex PCR assay for identification of Erwinia amylovora – the

causative agent of fire blight. Biotechnol. & Biotechnol. 20:21-25.

Lecomte, P., Manceau, C., Paulin, J.-P. and Keck, M. 1997. Identification

by PCR analysis on plasmid pEA29 of isolates of Erwinia amylovora

responsible of an outbreak in Central Europe. European Journal of Plant

Pathology 103:91–98.

Llop, P., Donat, V., Rodríguez, M., Cabrefiga, J., Ruz, L., Palomo, J. L.,

Montesinos, E., and López, M. M. 2006. An indigenous virulent strain of

Erwinia amylovora lacking the ubiquitous plasmid pEA29. Phytopathology

96:900-907.

Loper, J. E., M. D. Henkels, R. G. Roberts, G. G. Grove, M. J. Willett

and T. J. Smith. 1991. Evaluation of streptomycin, oxytetracycline and

copper resistance of Erwinia amylovora isolated from pear orchards in

Washington State. Plant Dis. 75:287-290.

McGhee, G. C. and Jones, A. J. 2000. Complete nucleotide sequence of

ubiquitous plasmid pEA29 from Erwinia amylovora strain Ea88: gene

organization and intraspecies variation. Appl. Environ. Microbiol. 66:4897-

4907.

McGhee, G. C., Guasco, J., Bellomo, L. M., Blumer-Schuette, S. E.,

Shane, W. W., Irish-Brown, A., and Sundin, G. W. 2011. Genetic

39

analysis of streptomycin-resistant (SmR) strains of Erwinia amylovora

suggests that dissemination of two genotypes is responsible for the current

distribution of SmR E. amylovora in Michigan. Phytopathology 101:182-191.

McGhee, G.C., Schnabel, E. L., Maxson-Stein, K., Jones, B., Stromberg,

V.K., Lacy, G.H. and Jones, A. L. 2002. Relatedness of chromosomal and

plasmid DNAs of Erwinia pyrifoliae and Erwinia amylovora. Appl Environ

Microbiol. 68:6182-6192.

McManus, P. S. , Stockwell, V.O., Sundin, G.W, and Jones, A.L. 2002.

Antibiotic use in plant agriculture. Annu. Rev. Phytopathol. 40:443–465.

Mohammadi, M., Moltmann, E. Zeller, W., and Geider, K. 2009.

Characterisation of naturally occurring Erwinia amylovora strains lacking the

common plasmid pEA29 and their detection with real-time PCR. Eur J Plant

Pathol 124:293–302.

Pusey, P. L., Stockwell, V. O., and Mazzola, M. 2009. Epiphytic bacteria

and yeasts on apple blossoms and their potential as antagonists of Erwinia

amylovora. Phytopathology 99:571-581.

Schnabel, E. L., and Jones, A. L. 1998. Instability of a pEA29 marker in

Erwina amylovora previously used for strain classification. Plant Dis.

82:1334-1336.

Steinberger, E. M. and Beer, S. V. 1988. Creation and complementation of

pathogenicity mutants of Erwinia amylovora. Molecular Plant-Microbe

Interactions. 1:135-144.

Stockwell, V. O., Johnson, K. B., Sugar, D., and Loper, J. E. 2010.

Control of fire blight by Pseudomonas fluorescens A506 and Pantoea vagans

40

C9-1 applied as single strains and mixed inocula. Phytopathology 100:1330-

1339.

Vanneste, J.L. 1995. Erwinia amylovora. pp. 21-46. In: Pathogenesis and

Host Specificity in Plant Diseases: Histopathological, Biochemical, Genetic

and Molecular Bases. Vol. 1 Prokaryotes. US Signh, RP Singh, and K

Kohmoto, eds. Pergamon Press, Oxford and London.

Vanneste, J.L. 2000. What is fire blight? Who is Erwinia amylovora? How to

control it? pp. 1-6. In Fire blight. The disease and its causative agent,

Erwinia amylovora. J.L. Vanneste ed. CABI International. Wallingford, UK.

Zhou, C., Yujun, Y and Jong, A.Y. 1990. Mini-prep in ten minutes.

BioTechniques 8:172-173.

characterization of the plasmids of the

Documents