Vol. 161, No. 2

Characterization of a cis-Acting Regulatory Mutation That Maps atthe Distal End of the Escherichia coli glyA Gene

MICHAEL D. PLAMANN AND GEORGE V. STAUFFER*Department of Microbiology, University of Iowa, Iowa City, Iowa 52242

Received 24 August 1984/Accepted 12 November 1984

We have isolated a phage Mu cts-generated glyA mutant with only 30% of the normal level of serinehydroxymethyltransferase activity. Genetic and physical mapping studies show that Mu cts has insertedbetween the end of the glyA structural gene and its proposed transcription termination site. The mutation is cisacting and shows that sequences distal to the glyA structural gene play an important role in the expression ofthis gene.

In Escherichia coli, the major source of C1 units is throughthe conversion of serine to glycine and 5,10-methylenetetra-hydrofolate (16). This reaction is catalyzed by serinehydroxymethyltransferase (SHMT), the glyA gene product(24). Expression of this gene is controlled by a number ofcompounds involved in C1 metabolism (purines, methionine,and folates), but the mechanism of their involvement re-mains to be elucidated (23).The glyA gene from E. coli has been cloned and its

nucleotide sequence determined (20). Of particular interestis the presence of a long region of dyad symmetry betweenthe glyA translation stop codon and the proposed transcrip-tion termination region. This region consists of two inverted30- to 35-base-pair (bp) sequences that could form a stablestructure (AG = -62.4 kcal/mol) once transcribed. Similarelements with greater than 90% homology have been identi-fied following at least 20 other genes in both E. coli andSalmonella typhimurium (5, 8, 14, 18, 20, 27). These ele-ments are found in either intercistronic regions of operons orat the end of genes not known to be part of an operon. It hasbeen proposed that these elements function to decrease theexpression of distal genes in an operon (8). In the case ofglyA, for which no cotranscribed distal gene is found, thefunction of these conserved sequences is unknown.We have isolated mutants that are defective in the glycine

cleavage (GCV) enzyme system (19). One of the mutantsisolated in this previous study, in which Mu cts phage wasused as the mutagen, had the correct phenotype of a GCVmutant but had normal GCV enzyme levels. Further studiesshowed that the mutation is 97% cotransducible with theglyA gene and that the SHMT levels in the mutant arereduced to 30% of the level found in the parent strain (19). Inthis paper, we show that the Mu cts phage in this mutantinserts between the glyA translation stop codon and theproposed transcription termination region. From these re-sults, we propose a regulatory role for the nontranslatedregion distal to the glyA structural gene.

MATERIALS AND METHODS

Bacterial strains and plasmids. The bacterial strains used inthis study are listed in Table 1. Plasmids pGS1 and pGS29 are

multicopy plasmids carrying the E. coli glyA gene and havebeen described (25).Growth and preparation of cell extracts. Media, growth of

cells, and preparation of extracts were as described previ-

* Corresponding author.

ously (25). Supplements were added as follows: vitamins, 1,ug/ml; purines and pyrimidines, 50 ,ug/ml; and amino acids,50 ,ug/ml (serine and glycine were added at 200 p.g/ml).Enzyme assays. SHMT activity was measured by the

method of Taylor and Weissbach (26). P-Galactosidase ac-tivity was measured as described by Miller (15).

Southern blot hybridization. Chromosomal DNA fromstrain GS395 or strain GS404 was isolated as describedpreviously (25). This DNA was digested with the appropriaterestriction endonuclease(s), and the fragments were sepa-rated by agarose gel electrophoresis and transferred from thegel to nitrocellulose as described by Southern (22). PlasmidpGSl DNA was 32p labeled by nick translation and used asa probe (21). The hybridization conditions used have beendescribed (12).

3' S1 nuclease mapping. The 3' S1 nuclease mappingprocedure was used to identify the 3' end of glyA mRNA(20). A 348-bp TaqI DNA fragment that spans the glyAtranscription termination region was labeled at the 3' endwith the large fragment of E. coli DNA polymerase I and[ox-32P]dCTP. The 32P-labeled coding strand was purifiedelectrophoretically and hybridized to total cellular RNA(about 15 ,ug) from either strain GS395 or strain GS404. Afterhybridization the nucleic acids were digested with 200 U ofS1 nuclease for 40 min at 30°C. The products of these tworeactions were run adjacent to a Maxam and Gilbert (13)DNA sequencing ladder of the 348-bp TaqI fragment.

Chemicals and enzymes. All chemicals and enzymes wereobtained from standard commercial sources.

RESULTS

Mutant selection. Strains blocked in serine biosynthesiscan grow on glucose minimal medium supplemented witheither serine or glycine (25). The selection for mutantsdefective in the GCV enzyme system is based on theassumption that serine auxotrophs will no longer use glycineas a serine source when the GCV enzymes are not present(17, 19). In an earlier report, we described the isolation of anumber of mutants defective in the GCV enzyme systemwith this selection procedure with phage Mu cts as themutagen (19). Among the possible gcv mutants isolated, onestrain (GS404) had the correct GCV phenotype but normallevels of GCV enzyme activity. This mutant, however, hadonly 30% of the normal level of SHMT activity. Transduc-tion experiments showed that the Mu cts phage in strainGS404 is 97% cotransducible with the glyA gene. To stabi-lize the new mutation, we selected for a temperature-resist-

650

JOURNAL OF BACTERIOLOGY, Feb. 1985, p. 650-6540021-9193/85/020650-05$02.00/0Copyright C 1985, American Society for Microbiology

on August 22, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

SERINE HYDROXYMETHYLTRANSFERASE 651

TABLE 1. Bacterial strainsStrain Relevant chromosomal markers Derivation or reference

GS395 serA25 lysA thi Xr 19GS404 serA25 lysA thi glyA::Mu cts 19

xrGS411 serA25 lysA thi glyA::Mu Xr Temperature-resistant

derivative of GS404GS464 serA25 glyA pheA905 tli zgb- This laboratory

224::TnIO XsGS605 serA25 pheA905 thi zgb- Gly+ transductant of

224::TnlO X5 GS464GS606 serA25 pheA905 thi zgb- glyA::Mu

224::TnJO glyA::Mu Xs transductant ofGS464

GS607 serA25 pheA905 thi zgb- X glyA-lac lysogen of224::TnJO (X glyA-lac) GS605

GS608 serA25 pheA905 thi zgb- X glyA-lac lysogen of224::TnIO glyA::Mu (X glyA- GS606lac)

ant derivative of strain GS404. One strain that grew well at42°C and had the same characteristics as the parent strainwas saved and designated strain GS411.

cis-trans test. To determine whether this mutation acts incis or trans, we carried out two experiments. The firstexperiment was conducted with a Kgt2 glyA-lac phage (un-published data). Strains lysogenized with this hybrid phagehave lac operon expression under control of the glyAregulatory region. Because strain GS411 is ,r, it could not belysogenized with this phage. Therefore, the new mutationwas first transduced into the Ks strain GS464 with Plclrphage grown on strain GS411 as donor. Strain GS464 is a

serA glyA mutant and requires both serine and glycine forgrowth. Transductants were selected on serine-, phenylalan-ine-, and thiamine-supplemented plates and then scored onglycine, phenylalanine, and thiamine plates. Those receivingthe glyA::Mu mutation could be easily identified becausethey grew on the serine-supplemented plates but not onglycine-supplemented plates, the same phenotype as thedonor strain. Transductants that received only the wild-typeglyA gene could grow on either serine- or glycine-supple-mented plates. One transductant carrying the wild-type glyAregion and one carrying the glyA::Mu mutation were lyso-genized with the Agt2 glyA-lac phage. The new lysogenswere designated GS607 and GS608, respectively. The activ-ities of SHMT and 3-galactosidase were then measured inthe new strains. SHMT levels were threefold lower in strainGS608 compared with strain GS607, which shows thatGS608 carries the glyA::Mu mutation (Table 2). p-Galactosidase activities in the two strains, however, wereapproximately the same. This suggests that the new muta-tion is cis acting. In the second experiment, we transformedstrains GS395 (parent strain) and GS411 with plasmid pGS29,which carries only the E. coli glyA gene (25). In the parentstrain, this plasmid resulted in 30-fold-higher levels ofSHMT.If the Mu cts phage affects a gene product that acts in trans,we should see lower levels of SHMT activity in the GS411transformant. In strain GS411, however, plasmid pGS29 stillresulted in the same 30-fold-higher levels of activity seen inthe parent strain, supporting a cis-acting effect (data notshown).SHMT regulation. There are two obvious sites near glyA

where the Mu cts phage could have inserted and causedpartial loss of SHMT activity. One site is in the promoterregion, and the other site is near the end of the structural

TABLE 2. SHMT and ,-galactosidase activity in strains GS607and GS608"

b f3-GalactosidaseStrain SHMT activity activityb

GS607 33 3,690GS608 11 3,960

a Both strains carry the serA25, pheA905, and thi mutations and weregrown in glucose minimal media supplemented with serine, phenylalanine,and thiamine. Concentrations of supplements are as stated in the text.

b Specific activities are expressed as nanomoles of HCHO generated permilligram of protein per minute for SHMT and as units of optical density at600 nm for ,3-galactosidase.

gene. If Mu cts had inserted in the glyA promoter region,either lowering its efficiency or making glyA gene expressiondependent upon a Mu cts promoter, one might expect to findabnormal regulation of SHMT activity. However, the levelsof SHMT activity in the glyA::Mu mutant, although three-fold lower, paralleled SHMT levels of the parent strainunder repressing and derepressing conditions (Table 3). Thisresult suggests that the mutant possesses a fully functionalglyA regulatory region.

Insertion of Mu cts in the distal end of the glyA structuralgene could result in only a partially active gene product dueto the loss of a number of COOH-terminal amino acids. Suchaltered gene products are often more temperature sensitivethan the native gene product (7, 24). To determine whetherthe Mu cts insertion has a direct effect on SHMT, we grewthe parent strain GS395 and the mutant strain GS404 at 30°Cand measured the SHMT activity on extracts at 28, 37, and45°C. We found the same ratio of SHMT activity in theparent strain and mutant strain at the three temperatures(data not shown). Thus, the Mu cts insertion did not result ina temperature-sensitive enzyme, supporting the idea that theMu cts phage did not insert within the glyA structural gene.Mapping studies. The data presented above suggest the

presence of a cis-acting regulatory site for controlling ormaintaining SHMT levels. Therefore, it was important toidentify the precise site of the Mu cts insertion.

P1 transduction experiments showed that the Mu ctsinsertion is 97% cotransducible with the glyA gene (19). Todetermine where Mu cts had inserted, we performed thefollowing experiment. Strain GS404 was grown to stationaryphase in L broth at 30°C, and 0.05-ml samples were spreadon L agar and incubated overnight at 42°C to induce the Mucts phage. Temperature-resistant colonies were then testedfor their ability to grow on glucose minimal plates supple-mented with lysine, adenine, and guanine and either serine,

TABLE 3. Regulation of SHMT activity in strains GS395 andGS411

Strain Additions to minimal growth SHMT enzymemedium" activityh

GS395 None 35GS395 Cl compounds 15GS395 Trimethoprim (0.25 ,ug/ml) 121GS411 None 11.9GS411 C1 compounds 4.4GS411 Trimethoprim (0.25 p.g/ml) 34

" All strains carry the serA25, lysA, and thi mutations and were grown inglucose minimal medium plus serine, lysine, thiamine, and the indicatedsupplements. The Cl compounds include glycine, methionine, adenine, gua-nine, and thymine. Concentrations of supplements are as stated in the text.

b Specific activities are expressed as nanomoles of HCHO generated permilligram of protein per minute.

VOL. 161, 1985

on August 22, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

652 PLAMANN ANDSTAUFFERB

glycine, or serine and glycine. If the glyA gene is inactivatedduring Mu excision, the strain will require both serine andglycine for growth. If it is not inactivated, the strain willgrow with a serine supplement but not with a glycinesupplement, the phenotype of strain GS404. About 5 to 6%of the temperature-resistant GS404 survivors required bothserine and glycine supplements to grow on minimal mediuni.All serine and glycine auxotrophs were nonreverting mu-tants and were presumed to be glyA deletions. These mu-tants were then tested to determine whether any requiredpurines for growth. The purL gene is known to map nearglyA (1). Of 100 glyA deletions tested, 20% required a purinesupplement in addition to serine and glycine. Since Mu, aswell as other transposable elements, deletes unidirectionallyfrom its point of insertion (4, 11), the most likely gene orderis purL-glyA-Mu cts. Previous transduction data (unpub-lished data) determined the glyA gene to be transcribedcounterclockwise on the E. coli linkage map, away frompurL. This suggests that the Mu cts phage is located on thedistal side of the glyA gene.

Southern analysis. Direct evidence to support the locationof the Mu cts insertion was obtained by Southern blothybridization. The E. coli glyA gene is located on a 13-kilobase-pair (kbp) EcoRI fragment (24; Fig. 1A and B, laneA). A unique XhoI site occurs within this fragment and cutswithin the glyA structural gene. A double digest with EcoRIand XhoI produces a 3.3-kbp fragment that camres theproximal region of the glyA gene and a 9.7-kbp fragment thatcarries the distal region of the glyA gene (Fig. 1A and B, laneC).Chromosomal DNA was isolated from strain GS395 or

strain GS404, digested with the appropriate restriction en-zymes, size fractionated by agarose gel electrophoresis,blotted to nitrocellulose, and hybridized with 32P-labeledplasmid pGS1 DNA (Fig. 1i). Plasmid pGS1 carries the13-kbp EcoRI fragment that contains the glyA gene. WhenDNA from strain GS395 was digested with EcoRI or EcoRIand XhoI, hybridization to a 13-kbp fragment or to 9.7- and3.3-kbp fragments, respectively, was observed (Fig. 13,lanes A and C). This was the expected result as explainedabove. When DNA from strain GS404 was digested withEcoRI, two fragments of 14.7 and 16.3 kbp were produced(Fig. 1B, lane B). The lack of a 13-kbp fragment is consistentwith the genetic data that show that Mu cts is tightly linkedwith the glyA gene, altering the restriction pattern of thisregion of the chromosome. Mu cts phage has two EcoRIsites, one site ca. 13 kbp from the right end of the phage andthe other about 5 kbp from the left end (10). The new 16.3-and 14.7-kbp fragments resulted from fusion of Mu cts andE. coli chromosotnal DNA (Fig. 1A). When DNA fromstrain GS404 was digested with EcoRI and XhoI, twofragments of 3.3 and 14.7 kbp were produced (Fig. 1B, ladeD). The presence of the 3.3-kbp fragment shows that Mu ctsdid not insert in either the glyA control region or theproximal three-fourths of the structural gene. The absence ofthe 9.7-kbp fragment indicates that Mu cts inserted on thedistal side of the glyA gene. These results (Fig. 1A) are inagreement with the deletion analysis.

Si nuclease mapping. Southern blot hybridization locatedthe Mu cts insertion on the distal side of the glyA gene butdid not provide the necessary resolution to map the insertionsite precisely. We used S1 nuclease mapping to identify theMu cts insertion site. S1 nuclease mapping studies hadpreviously identified the 3' end of glyA mRNA at 182 basesdownstream from the translation stop codon (20). If Mu ctsinserted within this nontranslated region, we would no

MuctsEcoR IA EcoR

\ 13--- --5-

g9yA \ _/-I U 1 1. 5

EcoRI Xhol

B A B C DB~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

41,i-

10EcoR |

---16.3- 14.7.. --- 13

_to- *9.7s:s; ~~~~3.3

FIG. 1. Location of the Mu cts insertion site. (A) Physical mapof the 13-kb EcoRI fragment carrying the E. coli glyA gene.Numbers indicate increments in kbp (Mu cts is not to scale). Thelocation and orientation of the Mu cts insertion determined bySouthern blot analysis (see B) is indicated. (B) Southern blotanalysis. See the text for details. Lane a, GS395 DNA plus EcoRI;lane b, GS404 DNA plus EcoRI; lane c, GS395 DNA plus EcoRI andXhoI; and lane d, GS404 DNA plus EcoRI and XhoI. The sizes ofthe respective fragments are indicated in kbp. The molecular Weightmarkers (tot shown) included fragmnents of 17, 13, 9.7, 8.9, 4, 3.3,and 1.1 kbp from plasmids pGS1 and pGS27 (25).

longer observe this 3' endpoint. Instead, a new 3' endpointwould be expected. Its location would indicate the site ofMucts insertion. The results of the S1 nuclease mapping exper-iments are shown in Fig. 2. Lane e shows the S1 nuclease-resistant product that was obtained when the 3'-end-labeledprobe was hybridized to RNA isolated from strain GS395,the parent strain. The 3' end of this RNA is in agreementwith our previous work (20). Lane f shows the S1 nuclease-resistant products that were obtained when the 3' end-la-beled probe was hybridized to RNA isolated from strainGS404. We no longer observed an S1 nuclease product of thesame size as that produced when the RNA was isolated fromstrain GS395. Instead a number of S1 nuclease-resistantproducts are observed, indicating that Mu cts inserted ca. 35bases downstream from the translation stop codon. Theinsertion site is shown in Fig. 3.

J. BACTERIOL.

on August 22, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

VOL. 161, 1985 SERINE HYDROXYMETHYLTRANSFERASE 653

ABCDE F

1T24

C* *ti4f

A

A

C

C,

FIG. 2. Si nuclease mapping of the 3' end of glyA mRNA fromstrains GS395 and GS404. The details are described in the text.Lanes a through d represent the DNA sequencing ladder of the348-bp TaqI fragment by the method of Maxam and Gilbert (13).Lanes e and f are the Si nuclease-resistant DNA fragments ob-served when RNA used in the hybridization was isolated from eitherstrain GS395 (lane e) or GS404 (lane f). The lengths of the protectedfragments correspond to the distance from the 3' end of glyA mRNAto the 3' end of the labeled fragment. The 3' endpoints of glyAmRNA from these strains are shown in Fig. 3.

DISCUSSION

In the process of isolating mutants defective in the GCVenzyme system, we isolated one mutant with normal GCVenzyme levels but only 30% of the normal SHMT level (19).This mutation is cis acting and maps in the nontranslatedregion distal to the structural gene, ca. 35 bp after the

GS404val tyr ala END

** *GTT TAC GCA TAAGCGAAACGGTGATTTGCTGTCAATGTGCTCGTTGTTCA

TGCCGGATGCGGCGTGAACGCCTTATCCGGCCTACAAAACTTTGCAAATTCAA

TATATTGCAATCTCCGTGTAGGCCTGATAAGCGTAGCGCATCAGGCAATTTTT

GS395

CGTTTATGATCATCAAGGCTTCCTTCGGGAAGCCTTTCTACGTTATCFIG. 3. The 3' region of the glyA gene. The sequence begins nine

bases from the translation stop codon at the end of glyA and extendsfive bases beyond the proposed transcription termination region(20). Thin arrows indicate the long regions of dyad symmetry, thickarrows indicate the proposed transcription termination region, thebar indicates the major 3' termini of glyA mRNA determinedpreviously (20), and brackets show the 3' termini of glyA mRNAdetermined from Fig. 2 for strains GS395 and GS404.

translation stop codon. These results show that the nucleo-tide sequence distal to the glyA gene plays an importantphysiological role in controlling SHMT levels.Between the translation termination codon and the tran-

scription termination region of the glyA gene, there are twonearly homologous 30- to 35-base sequences positioned ininverted orientation (Fig. 3). Similar sequences with greaterthan 90% homology with the glyA sequence have been foundin intercistronic regions of operons and postcistronic togenes not known to have distal cotranscribed genes (5, 8, 14,18, 20, 27). These elements number from one to four at agiven location and are always found in a head-to-head ortail-to-tail orientation.

It has been proposed that the intercistronic elementsfunction to decrease expression of distal genes in an operonby transcription termination or mRNA processing (8). Fur-thermore, it has been suggested that transcription termina-tion signals play an important role in the expression of genespositioned upstream (9). This proposal was based on studiesof retroregulation in lambda phage in which it was found thatmRNA lacking a 3' hairpin structure was rapidly degraded(6). Additional work on gene expression of the sigma operonof E. coli, processing of bacteriophage fl mRNA, and retro-regulation in phage T7 supports the role of 3' secondarystructure in mRNA stability and upstream gene expression(2, 3, 6).Based on the evidence presented, the most likely expla-

nation for the decreased SHMT levels in strain GS404 is thatthe 3' end of the glyA transcription unit is removed by theinsertion of 37 kbp of Mu DNA and that the loss of thissequence results in lower gene expression.We propose that the lower level of SHMT activity is due

to the decreased stability of the upstream glyA mRNA ratherthan some indirect Mu-mediated effect. In support of thisidea, we have deleted the 3' nontranslated region in vitro andfind the same decrease in gene expression as with theglyA::Mu cts insertion mutation (unpublished data). Theseresults, however, do not determine whether the long regionof dyad symmetry following the translation stop codon, thetranscription termination structure, or both are involved instabilizing glyA mRNA. We are now conducting mRNAhalf-life studies to determine whether glyA mRNA lackingthe distal dyad symmetries is less stable. IfmRNA half-life isdependent on the stability or another property of these 3'

on August 22, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

654 PLAMANN AND STAUFFER

stem-loop structures, then it is possible that they are asimportant in regulation as promoter strength.

Interestingly, the nucleotide sequence conservation of thesymmetry elements following other genes in E. coli and S.typhimurium is very pronounced. If any stem-loop structureis sufficient to stabilize upstream RNA, then it is difficult toexplain how the nucleotide sequence of these elements hasbeen conserved from one site to another. It is possible thiselement has an additional function involving RNA- or DNA-binding proteins that places strong selective pressure on theconservation of this nucleotide sequence. What this functionmight be is unknown.

ACKNOWLEDGMENTSWe thank Bill Goins for assistance with the Southern blot hybrid-

ization experiment.This investigation was supported by Public Health Service grant

GM-26878 from the National Institute of General Medical Sciences.

LITERATURE CITED1. Bachmann, B. J. 1983. Linkage map of Escherichia coli K-12,

edition 7. Microbiol. Rev. 47:180-230.2. Blumer, K. J., and D. A. Steege. 1984. mRNA processing in

Escherichia coli: an activity encoded by the host processesbacteriophage fl mRNAs. Nucleic Acids Res. 12:1847-1861.

3. Burton, Z. F., C. A. Gross, K. K. Watanabe, and R. R. Burgess.1983. The operon that encodes the sigma subunit of RNApolymerase also encodes ribosomal protein S21 and DNAprimase in E. coli K12. Cell 32:335-349.

4. Faelen, M., and A. Toussaint. 1978. Stimulation of deletions inthe Escherichia coli chromosome by partially induced Mucts62prophages. J. Bacteriol. 136:477-483.

5. Gilson, E., J.-M. Clement, D. Brutlag, and M. Hofnung. 1984. Afamily of dispersed repetitive extragenic palindromic DNAsequences in E. coli. EMBO J. 3:1417-1422.

6. Gottesman, M., A. Oppenheim, and D. Court. 1982. Retroregu-lation: control of gene expression from sites distal to the gene.Cell 29:727-728.

7. Hawkes, R., M. G. Grutter, and J. Scheliman. 1984. Thermody-namic stability and point mutations of bacteriophage T4lysozyme. J. Mol. Biol. 175:195-212.

8. Higgins, C. F., G. F.-L. Ames, W. M. Barnes, J. M. Clement,and M. Hofnung. 1982. A novel intercistronic regulatory ele-ment of prokaryotic operons. Nature (London) 298:760-762.

9. Holmes, W. M., T. Platt, and M. Rosenberg. 1983. Terminationof transcription in E. coli. Cell 32:1029-1032.

10. Kahmann, R., D. Kamp, and D. Zipser. 1977. Mapping ofrestriction sites in Mu DNA, p. 335-339. In A. I. Bukhari, J. A.Shapiro, and S. L. Adhya (ed.), DNA: insertion elements,plasmids, and episomes. Cold Spring Harbor Laboratory, ColdSpring Harbor, N.Y.

11. Kleckner, N. 1977. Translocatable elements in procaryotes. Cell11:11-23.

12. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecularcloning, p. 387-389. Cold Spring Harbor Laboratory, ColdSpring Harbor, N.Y.

13. Maxam, A. M., and W. Gilbert. 1980. Sequencing end-labeledDNA with base-specific chemical cleavages. Methods Enzymol.65:499-560.

14. McPherson, M. J., and J. C. Wootton. 1983. Complete nucleo-tide sequence of the Escherichia coli gdhA gene. Nucleic AcidsRes. 11:5257-5266.

15. Miller, J. H. 1972. Experiments in molecular genetics, p.352-355. Cold Spring Harbor Laboratory, Cold Spring Harbor,N.Y.

16. Mudd, S. H., and G. L. Cantoni. 1964. Biological transmethyla-tion, methyl-group neogenesis and other "one-carbon" meta-bolic reactions dependent upon tetrahydrofolic acid, p. 1-47. InM. Florkin and E. H. Stotz (ed.), Comprehensive biochemistry,vol. 15. Elsevier/North-Holland Publishing Co., Amsterdam.

17. Newman, E. B., B. Miller, and V. Kapoor. 1974. Biosynthesis ofsingle-carbon units in Escherichia coli K12. Biochim. Biophys.Acta 338:529-539.

18. Parsot, C., P. Cossart, I. Saint-Girons, and G. N. Cohen. 1983.Nucleotide sequence of thrC and of the transcription termina-tion region of the threonine operon in Escherichia coli K12.Nucleic Acids Res. 11:7331-7345.

19. Plamann, M. D., W. D. Rapp, and G. V. Stauffer. 1983.Escherichia coli K12 mutants defective in the glycine cleavageenzyme system. Mol. Gen. Genet. 192:15-20.

20. Plamann, M. D., L. T. Stauffer, M. L. Urbanowski, and G. V.Stauffer. 1983. Complete nucleotide sequence of the E. coli glyAgene. Nucleic Acids Res. 11:2065-2075.

21. Rigby, P. W. J., M. Dieckmann, C. Rhodes, and P. Berg. 1977.Labeling deoxyribonucleic acid to high specific activity in vitroby nick translation with DNA polymerase I. J. Mol. Biol.113:237-251.

22. Southern, E. M. 1975. Detection of specific sequences amongDNA fragments separated by gel electrophoresis. J. Mol. Biol.98:503-517.

23. Stauffer, G. V. 1983. Regulation of serine, glycine, and one-car-bon biosynthesis, p. 103-113. In K. M. Herrmann and R. L.Somerville (ed.), Amino acids: biosynthesis and genetic regula-tion. Addison-Wesley Publishing Company, Reading, Mass.

24. Stauffer, G. V., and J. E. Brenchley. 1974. Evidence for theinvolvement of serine transhydroxymethylase in serine andglycine interconversions in Salmonella typhimurium. Genetics77:185-198.

25. Stauffer, G. V., M. D. Plamann, and L. T. Stauffer. 1981.Construction and expression of hybrid plasmids containing theEscherichia coli glyA gene. Gene 14:63-72.

26. Taylor, R. T., and H. Weissbach. 1965. Radioactive assay forserine transhydroxymethylase. Anal. Biochem. 13:80-84.

27. Yazyu, H., S. Shiota-Niiya, T. Shimamoto, H. Kanazawa, M.Futai, and T. Tsuchiya. 1984. Nucleotide sequence of the melBgene and characteristics of deduced amino acid sequence of themelibiose carrier in Escherichia coli. J. Biol. Chem.259:4320-4326.

J. BACTERIOL.

on August 22, 2018 by guest

http://jb.asm.org/

Dow

nloaded from