Virus Research ELSEVIER Virus Research 37 (1995) 75-84

Characterization of 5'-upstream sequence of the latent membrane protein 1 (LMP-1) gene of an Epstein-Barr

virus identified in nasopharyngeal carcinoma tissues

Mong-Liang Chen a, Ray-Chang Wu b, Shih-Tung Liu a,b Yu-Sun Chang a,b, *

a Graduate Institute of Microbiology and Immunology, National Yang-Ming University, Shih-Pai, 11221, Taiwan

b Department of Microbiology and Immunology, Chang-Gung College of Medicine and Technology, 259 Wen-Hwa 1st Road, Kwei-Shan, Taoyuan, 33332, Taiwan

Received 29 November 1994; revised and accepted 9 February 1995

Abstract

Sequence variations of the 5'-upstream region of latent membrane protein 1 (LMP-1) in two Epstein-Barr virus (EBV) strains have been reported before (Chen et al., 1992). To investigate the effect of these variations on gene expression, we constructed a series of deletion plasmids encompassing positions - 950 to + 20 of the LMP-1 promoter region and tested for the ability to drive chloramphenicol acetyltransferase (CAT) gene expression in C33A cells. Results showed that the promoter activities of constructs from NPC strain were 3-fold lower than the corresponding constructs from the B95-8 strain. In addition, the region between - 5 4 and +20 contained the basic, constitutive promoter activity for both strains. Sequence analysis of this region indicated that an activating transcription factor (ATF) binding site, TGACGTAG, which is present in B95-8 strain was changed to TCTCGTAG in NPC strain. A chimeric plasmid study suggested that these sequence variations in the ATF binding site may contribute to the 3-fold increase of CAT activity observed for B95-8 strain. Furthermore, the activity of the promoter constructs was not activated by EBV-encoded nuclear antigen 2 (EBNA-2) in C33A cells. However, the promoter activities were upregulated in B-lymphocyte cells such as CG3 and CA46 cells.

* Corresponding author at address b. Fax: + 886 (3) 328 5683.

0168-1702/95/$09.50 © 1995 Elsevier Science B,V. All rights reserved SSDI 0168-1702(95)00021-6

76 M.-L. Chen et al. / Virus Research 37 (1995) 75-84

The biological significance of this difference in promoter activity of LMP-1 gene between two strains and the involvement of the cellular factors were discussed.

Keywords: Nasopharyngeal carcinoma; Epstein-Barr virus (EBV); Latent membrane protein 1 (LMP-1); Promoter

Eps te in-Barr virus (EBV) is a ubiquitous human herpes virus that infects both lymphocytes and epithelial cells (Sixbey et al., 1983). This virus can cause infec- tious mononucleosis (Henle et al., 1968) and is closely associated with Burkitt's lymphoma (BL), nasopharyngeal carcinoma (NPC) and B-lymphocyte proliferative diseases in immunocompromised patients (Desgranges et al., 1975; Henle and Henle, 1976; Hanto et al., 1985). NPC is a human squamous cell cancer derived from epithelial ceils of the nasopharynx. This disease is rare in most parts of the world, but highly prevalent in Southern Asia, including Southeast China and Taiwan, and relatively frequent among Eskimos and in certain regions of Africa. Virtually all the poorly differentiated or anaplastic NPCs are associated with EBV regardless of geographical or ethnic origin (Desgranges et al., 1975). Additionally, multiple copies of EBV genome were detected in NPC cells (Raab-Traub et al., 1987). Examination of the viral gene expression in NPC tissues has revealed that EBNA-1 was the only nuclear antigen detected in all specimens, and LMP-1 was detected in approximately 65% of the specimens by the immunoblotting analysis (Fahraeus et al., 1988; Young et al., 1988). Biologically, EBNA-1 is an EBV-en- coded trans-activator and maintains the viral genome in an episomal form (Lupton and Levine, 1985). On the other hand, LMP-1 exhibits a transforming activity in two established rodent cell lines (Wang et al., 1985, 1988), alters the phenotype of immortalized human keratinocytes (Fahraeus et al., 1990) and inhibits human epithelial cell differentiation (Dawson et al., 1990). These results suggest that LMP-1 is a transforming gene that may play an important role in the oncogenesis of NPC.

The LMP-1 gene of an EBV variant derived from the NPC of Taiwanese patients (NPC strain) has been cloned and characterized (Chen et al., 1992). This virus strain contained a more pathogenic LMP gene and showed distinct sequence variations in 5'-upstream region and coding region of the LMP-1 gene as compared with that of B95-8. Sequence analysis of the 5'-upstream region of LMP-1 gene to - 950 (nucleotide 170,467 of the corresponding B95-8 sequence) revealed that this region of NPC strain contained 18 base deletions, 56 base substitutions and 6 base

Fig. 1. A: nucleotide sequence of the upstream region of LMP-1 gene from NPC strain and B95-8 strain. The transcription initiation site is marked as + 1. Primers, P1-P8 were used to generate the 5'-deletion plasmids. Sequence for primer B and primer N are shown in italics. The ATF-binding site (TGACGTAG) is underlined. B: schematic representation of CAT-containing deletion plasmids. The upstream regions, - 950 to +20, -495 to +20, -413 to +20, - 3 1 0 to +20, -267 to +20, -223 to +20, - 191 to +20, - 5 4 to +20 and - 3 0 to +20 of LMP-1 gene were cloned into the pCAT-basic vector and the resulting plasmids were designated as pLMP950, pLMP495, pLMP413, pLMP310, pLMP267, pLMP223, pLMP191, pLMP54 and pLMP30, respectively.

M.-L. Chen et aL / Virus Research 37 (1995) 75-84 77

A P8(-950)

NPC CCTTC~GGGCTTi;~TGCCGCGGCCGGG - 924

B95-8 ................. G ..........

GG * * * * ACCGCCTCTCTGTCCCCGCCCCCCTGTCATTCCACCCTCCAACGGCGTGCAGCCTCCCGCGCCGC - 853

--CGCG ...................... * ........ T ................... G ............

CCCCCGCTCCCGCCCCCACCAGACACGCCCCCC* * * * * CCAGCCCCCTCCTCACGGTCACGCATGGCTGCG - 782

.......................... A-----TGCGAC--T ........ A .....................

CC * * * * * AGCGCCCCCAGACCCCCCC*ATCCCCTGAACGTCCGCCGCCGTCCAACGCCCGCAGCCCCCGGA - 711

- -CGCGCG ........ C ......... G ...... G .............. A .... C .................

GCCCGCGGACCCCGACCCCTCGCCGCCCGCCCCCCGTTGCGCCTCTCTGTGCGGGGGGGCCACCCCACCGC - 640

.................. C ............ G----A-----G ................ TG .... G----

GGGGGAAGGCCACGCCCCCTCCACTTTTTCCAGGAATGCGCGGCCC* * * ATGCCCCACGCCAGCAAGCCGC - 569

............................................. CCC ....... ***** ..........

AGCGACTTTCCGCGCCTGCCTCATGACACTTGCACAGCCCACACCCTTTTCGCCGGAATCCGCCACCTCAT - 498

............................ C ....................... T ................

P7 (-495)

TCTGAAATTCCCATATCCCCCGTCTGCTGCTTCGTCACCCGCCGACCCTTAGCCCTCTTATCCGCCTCACC - 427

. . . . . . . . . . . . . . . . . . G . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . g . . . . . . . . . .

CGCCTCCCCTACGGTTACCCCACAGCCTTGCCTCACCTGAACCCCCCTAAAGCACAGCCTCCCGCCTGCCG - 356

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . g . . . . . . . . . . . . . .

P6 (-310)

ACAACGACCTCC CAACGTTGCGCGCCCTACGC CTCTTTGTGTGGATTACACTGCCGCTTCCCACAACAC TG 285

C .......................... CG ............ CA ........................... A

P5 (-267) P4 (-223)

CTCACTCCCCCTTGTGATTGCCGCACTGCCTTTCCATTTCCTCGTACGCTTTACCACCGCATTCCCACAGC - 214

-G .......... C ........................... GT-G-A---GG ..................

P3 (-191)

TTGCCCCTCGGGGACTCGCTTTTCTAACACAAACACACGCTTTCTACTTCCTCTTTTAACGCTTACATGCA - 143

....... C ....... C ................................... C .... CT .............

CACACACTACGCCGCTTTCGGGAAAGCGGCGCCCGTACCCTGTCCGGCAGACCCCGCAAATCCCCCCGGGC - 72

....... AC ................ T-T-TA ....... TGCC ...........................

N P2 (-30)

C T C C A T C C C C A G A A A C A C G C G T T A C T C T C T C G T A G G C G G C C T A C A T A A G C C T C T G T C A C T G C T C T G T C A G C - 1

- - A ...... A . . . . . . C G C G T T A C T C T ~ A C G T A G C C G C C C T A .......... CA .......... C- CC-

B ATF-binding site

> PI(+20)

TTCTTTCC TCAGTTGCCTTGCTC CTGCCACACTACCCTGACCATGGAACGCGAC CTTGAGAGGGGCCCACC +71

. . . . . . . . . AC . . . . . . . . . . . A ...... G------GG ....... A ....................

B

3LMP950

~LMP495

~LMP413

~LMP310

)LMP267

3LMP223

)LMP191

)LMP54

pLMP30

-950 -495 -413 -267 -54 I I I I I

Fmm-]

Fmm-]

Fmm-] Fmm]

78 M.-L. Chen et al. / Virus Research 37 (1995) 75-84

insertions and was approximately 91% homologous with that of B95-8 (Fig. 1A). To determine if the sequence variations in the promoter region affected the level of gene expression, the promoter activity of the 5'-upstream sequences of LMP-1

A

100

90

80

,- 70 ._o -~ 6O > ,

® 50 o

o~ 40

3O

2O

10

B

e- .o

u

o~

100 91

9O

8O

70

60

5O

40

3O

2O

10

• pCAT-control [ ] pCAT-basic [ ] pLMP950 [ ] pLMP495

12 12 10.8 11.4 12 14 m l-I

Fig. 2. The CAT activities of the LMP-1 promoter-containing plasmids in C33A cells. Five micrograms of the 5'-deletion mutants of the promoter region of LMP-1 gene from the B95-8 strain (A) or the NPC strain (B) shown in Fig. 1 was transfected into C33A cells (ATCC HTB 31) by calcium phosphate precipitation method (Graham and van der Eb, 1973). Cells were then harvested after 48 h and the CAT activity was examined as follows. Cell extracts were prepared by 3 cycles of f reeze- thawing t reatment in 0.25 M Tris buffer (pH 7.5) and the supernatants were assayed for CAT activity described previously (Gorman et al., 1982). Acetylated reaction products were separated by thin layer chromatog- raphy, visualized by autoradiography, and quanti tated by scintillation counting. The percent of acetyla- tion was calculated as the ratio of counts per minute (cpm) in the acetylated products to cpm in the entire sample. The pCAT-basic vector containing an enhancerless and promoterless CAT gene and pCAT-control vector containing both SV40 early promoter and enhancer elements and were used in each set of reactions as controls. All results are the mean value of at least 6 independent experiments.

M.-L. Chen et al. / Virus Research 37 (1995) 75-84 79

gene from both strains was examined in C33A cells using chloramphenicol acetyl- transferase (CAT) as a reporter. Deletion plasmids of this 5'-upstream region were also constructed to determine the minimal promoter region required for the basic level of LMP-1 gene expression.

DNA fragments covering the 5'-upstream region of LMP-1 gene were inserted in the pCAT-basic vector (Promega, USA). As shown in Fig. 1, plasmid pLMP950 was constructed by insertion of the DNA fragment spanning the upstream - 950 to +20 region of LMP-1 gene into the Klenow-treated A c c I site of the pCAT-basic vector. This 970-bp DNA insert was generated with sequence-specific primers, P1 and P8 and PCR method (Saiki et al., 1988) using pT7 and pEcoD4 (Chen et al., 1992) as DNA templates. Similarly, the PCR products generated with 5'-primers, P2 to P7, and 3'-primer P1 were also inserted into the pCAT-basic vector. The sequences and locations of primers are listed in Fig. 1A. The resulting plasmids are designated as pLMP495, pLMP310, pLMP267, pLMP223, pLMP191 and pLMP30, respectively. Furthermore, the PCR product ( - 495 to + 20) generated with P1 and P7 was digested with B s t E I I and M l u I . Two DNA fragments, -413 to +20, and - 5 4 to +20 were obtained and then inserted into pCAT-basic to generate pLMP413 and pLMP54. These plasmid constructs are summarized in Fig. lB. Primer B (5'-CGCGTTACTCTCTCGTAGGCGGCCTA-3') and primer N (5'- C G C G T T A C T C T G A C G T A G C C G C C C T A - 3 ' ) corresponding to - 5 4 to - 2 8 of LMP-1 gene from B95-8 and NPC strain, individually, were used to generate the chimeric constructs. For example, plasmid pLMP54 (B-ATF) was generated by inserting the PCR product amplified with primers N and P1, using pEcoD4 as DNA template. Plasmid pLMP54 (N + ATF) was generated by inserting the PCR product amplified with primers B and P1, using pT7 DNA as the template. The sequences of inserts were confirmed by the Sanger's dideoxy chain-termination sequencing analysis method (Sanger et al., 1977).

To test the effect of the sequence variations on the expression of LMP-1 gene and to localize the minimal c/s-acting element required for its promoter activity, the CAT activities of the plasmid constructs of both strains were determined in C33A ceils. As shown in Fig. 2, plasmid constructs derived from NPC strain were 3-fold lower than those from B95-8. For example, the CAT activity, measured as the percent of acetylation, of pLMP 495(B) is 39% and that of pLMP 495(N) is 12%. In addition, the CAT activities of pLMP950(B) and pLMP950(N) constructs were 3-fold lower than those of pLMP495(B) and pLMP495(N). Promoter activity of pLMP223(B) dropped to 45% of the activity of pLMP495(B), and pLMP223(N) dropped to 20% of that of pLMP495(N). Thus, it suggested that sequences between -950 to -495 and -223 to -191 seem to exert negative effect in the promoter activity and the latter one could be compensated by the upstream sequences ( - 4 9 5 to -223). This effect is not cell-type-specific because the same effect was also seen in both B95-8 (EBV-positive) and CA46 (EBV-negative) cells (data not shown). Further deletion to position - 191 (pLMP191) or - 54 (pLMP54) brought the CAT activity back to the minimal promoter activity. Additional deletion to - 3 0 (pLMP30) resulted in the total loss of the activity, indicated that the minimal promoter activity is not due to the read-through CAT activity in

80 M.-L. Chen et al. / Virus Research 37 (1995) 75-84

100

90

80

c 70 o m 60 >,

~ so

~ 40

30

20

10

83

27

• pCAT-eontrol [ ] peAT-basic [ ] pLMP54(B) [ ] pLMP(B-ATF) [ ] pLMP(N+ATF) [ ] pLMP54(N)

23

10

Fig. 3. The effect of AT F binding sequence on the promoter activity of LMP-1 gene in C-33A cells. Two chimeric plasmids were used. The plasmid, pLMP54(B-ATF) contains the - 54 to + 20 region of B95-8 strain with the substitution of sequences between - 44 and - 37 with those of NPC strain. The plasmid, p L M P ( N + A T F ) has the basic sequence of NPC strain with the - 4 4 to - 3 7 region that has been replaced with the ATF recognition site from B95-8 strain. The CAT activities (see Fig. 2 legend for details) are the average of at least 6 independent experiments.

promoter constructs. Thus, the region between - 5 4 and +20 represents the shortest fragment that contained the minimal promoter activity of LMP-1 gene. In this study, both promoters exhibited similar activity pattern. Our data ruled out the possibility that the dominant transforming activity of NPC-LMP-1 is due to the significant change of the level of LMP-1 gene expression.

The CAT activity driven by - 5 4 to + 20 of B95-8 strain is 3-fold higher than that of NPC strain, indicating the variations in this region were sufficient to differentiate this difference. Analysis of the - 5 4 to + 20 showed that there were 11 base variations between B95-8 and NPC strains including a 2-base change in ATF binding site ( - 4 4 to -37) . We substituted the sequence between - 4 4 and - 3 7 of NPC strain with the ATF sequence of B95-8 strain and then tested its

Fig. 4. The effect of EBNA-2 on the activity of LMP-1 promoters from two EBV strains, B95-8 and NPC. Plasmid constructs, pLMP495(B) covering - 4 9 5 to + 20 of the B95-8 LMP-I promoter region and pLMP495(N) covering the corresponding region of the NPC strain were cotransfected with a eukaryotic expression vector pSG5 (Stratagene, USA) or the pEBNA2 which contains the EBNA-2 gene of EBV (nucleotides 48,040-50,505 of B95-8 sequence) inserted at the Bgll l site that is located downstream from the SV40 promoter of pSG5. The activities were examined in 3 different cell lines, CA46 (A, the top panel), CG3 (B, the middle panel) and C33A (C, the bottom panel) cells. The percent of acetylation is indicated below each lane. The similar results were obtained in at least 6 independent experiments. C, pCAT-control; B, pCAT-basic; - , eotransfected with pSG5; + , cotransfected with pEBNA2.

M.-L. Chen et al. / Virus Research 37 (1995) 75-84 81

A

%Acety l 65 1.5 9.2 27 3.5 12

EBNA2 - - + + pCAT C B -495/+20 -495/+20

(B95-8) (NPC)

B

%Acety l 78 0.3 24 90 5.6 20

EBNA2 - - + - + pCAT C B -495/+20 -495/+20

(B95-8) (NPC)

c

%Acety l 94 5.0 23 31 15 10

EBNA2 + + pCAT C B -495/+20 -495/+20

(B95-8) (NPC)

82 M.-L. Chen et al. / Virus Research 37 (1995) 75-84

promoter activity as mentioned above, and vice versa. The chimeric plasmid, pLMP54 (N + ATF) restored the CAT activity to 85%. The other plasmid, pLMP54(B-ATF) with NPC sequence reduced the CAT activity to the level of NPC strain (Fig. 3). This suggested that ATF probably is the factor that was responsible for the higher level of the constitutive expression for LMP-1 gene in B95-8 strain. ATF is a common transcription factor. Its binding sequence has been shown in the regulatory region of a wide variety of viral and cellular genes. For example, the two best characterized classes of genes that contain ATF sites are E1A-inducible adenoviral genes and cAMP-inducible cellular genes (Hai et al., 1989). Furthermore, the point mutations in this recognition sequence were found in the human retinoblastoma gene that prevents the ATF to bind to the mutant sequence and in turn causes the hereditary retinoblastoma (Sakai et al., 1991). To further confirm the control of LMP-1 gene expression by the ATF transactivation, experiments such as gel retardation assays with the purified ATF and D N A fragment containing the - 54 to + 20 region may be helpful. Our finding is the first report to suggest that A T F was also involved in the control of EBV gene expression. The overexpression of LMP-1 had a toxic effect on cells (Ham- merschmidt et al., 1989). Therefore, EBV in NPC cells may have evolved to make sure that the level of LMP-I is below the toxic level. The alternation of the binding sites for A T F may be sufficient to serve this purpose.

The cellular mechanism involved in the LMP-1 gene activation is very complex. It has been reported that the LMP promoter activity is greatly affected by cellular factors. Wang et al. (1990) reported that the region from - 5 4 2 to - 1 4 7 had approximately the same basal CAT activity as the negative control plasmid, pCAT-3M in B JAB cells. Further deletion of the sequence to - 5 4 resulted in a 4-fold increase of the CAT activity. However, the promoter activities progressively decreased with those deletion mutants in EBV-positive lymphoblastoid cell line, IB4 (Tsang et al., 1991). The constructs described in their study were different from ours, which were extended to +40 instead of +20. Their studies have also shown that the constitutive activity of LMP-1 gene was too low to be demonstrated without the transactivation by EBNA-2. Recently, Ling et al. (1994) and Henkel et al. (1994) reported that EBNA-2 transactivation requires a specific interaction with CBF1, a B-cell factor, or RBPJ k, a homologue purified from Hela cells. This interaction is mediated through the core sequence, G T G G G A A of the EBNA2-re- sponsive element located in Cp and LMP promoter of EBV as well as the promoter for CD23. Analysis of the LMP promoter indicated that the G T G G G A A sequence was located between nucleotide - 2 2 3 and nucleotide -217 , which was conserved in both B95-8 and NPC strains. Therefore, to test if the EBNA-2 upregulates the promoter constructs, we eotransfected an expression vector, pEBNA2 with pLMP495(B) into C33A (epithelial type), CG3 (EBV-positive LCL) (Chang et al., 1990) and CA46 (EBV-negative BL) cells, respectively. We also cotransfected pEBNA2 with pLMP495(N) into those cell lines. As shown in Fig. 4A and B, EBNA-2 activated the LMP promoter constructs by 3- to 4-fold in cells of the B-lymphocyte origin. However, no upregulation by EBNA-2 was observed in C33A cells (Fig. 4C). This cel l-phenotype-dependent control of LMP-1 gene

M.-L. Chen et aL / Virus Research 37 (1995) 75-84 83

expression has b e e n previously repor ted by Fahraeus et al. (1993). This suggested that cel lular factor(s) such as CBF1 might not be presen t in the epi thel ial cell l ines inc luding C33A. Therefore , the LMP-1 p romote r activity in these cells stayed at the const i tut ive level.

Data p resen ted in this paper suggested that the genera l proper ty of LMP-1 p romote r sequences of the B95-8 and NPC strains seems to be very similar. Thus, the t r ans format ion activity of LMP-1 from two EBV strains canno t be explained at the p romote r level. Fu tu re exper iments should try to correlate the t rans format ion ability with the amino acid changes of the coding region of these two LMP-1

proteins.

Acknowledgements

This work was suppor ted by the C h a n g - G u n g College of Medic ine and Technol - ogy, the C h a n g - G u n g Memor ia l Hospi ta l ( C M R P 373) and the Nat iona l Science Council , Republ ic of China (NSC83-0412-B-182-029).

References

Chang, Y.S., Shih, L.Y., Peng, C.L.. Chen, S.H. and Liu, S.T. (1990) Characterization of two newly established EBV-containing lymphoblastoid cell lines from patients with myeloid leukemias. Leukemia Res. 14, 309-320.

Chen, M.L., Tsai, C.N., Liang, C.L., Shu, C.H., Huang, C.R., Sulitzeanu, D., Liu, S.T. and Chang, Y.S. (1992) Cloning and characterization of the latent membrane protein (LMP) of a specific Epstein-Barr virus variant derived from the nasopharyngeal carcinoma in the Taiwanese population. Oncogene 7, 2131-2140.

Dawson, C.W., Rickinson, A.B. and Young, L.S. (1990) Epstein-Barr virus latent membrane protein inhibits human epithelial cell differentiation. Nature 344, 777-780.

Desgranges, C., Wolf, H., de The, G., Shanmugaratnam, K., Ellouz, R., Cammoun, N., Klein, G. and zur Hausen, H. (1975) Nasopharyngeal carcinoma. X. Presence of Epstein-Barr virus genomes in epithelial cells of tumors from high and medium risk areas. Int. J. Cancer 16, 7-15.

Fahraeus, R., Fu, H.L., Ernberg, I., Finke, I., Rowe, M., Falk, K., Klein, G., Nilsson, E., Yadav, M., Busson, P., Tursz, T. and Kallin, B. (1988) Expression of Epstein-Barr virus-encoded proteins in nasopharyngeal carcinoma. Int. J. Cancer 42, 329-338.

Fahraeus, R., Rymo, L., Rhim, J.S. and Klein, G. (1990) Morphological transformation of human keratinocytes expressing the LMP gene of Epstein-Barr virus. Nature 345, 447-449.

Fahraeus, R., Jansson, A., Sjoblom, A., Nilsson, T., Klein, G. and Rymo, L. (1993) Cell phenotype-de- pendent control of Epstein-Barr virus latent membrane protein 1 gene regulatory sequences. Virology 195, 71-80.

Gorman, C.M., Moffat, L.F. and Howard, B.H. (1982) Recombinant genomes which express chloram- phenicol acetyltransferase in mammalian cells. Mol. Cell. Biol. 2, 1044-1051.

Graham, F.L. and van der Eb, A.J. (1973) A new technique for the assay of infectivity of adenovirus type 5 DNA. Virology 52, 456-467.

Hal, T.W., Liu, F., Coukos, W.J. and Green, M.R. (1989) Transcription factor ATF cDNA clones: an extensive family of leucine zipper proteins able to selectively form DNA-binding heterodimers. Genes Dev. 3, 2083-2090.

84 M.-L. Chen et aL / Virus Research 37 (1995) 75-84

Hammerschmidt, W., Sugden, B. and Baichwal, V.R. (1989) The transforming domain alone of the latent membrane protein of Epstein-Barr virus is toxic to cells when expressed at high levels. J. Virol. 63, 2469-2475.

Hanto, D.W., Frizzera, G., Gajl-Peczalska, K.J., Balfour, H.H. Jr., Simmons, R.L. and Najarian, J.S. (1985) Acyclovir therapy of Epstein-Barr virus-induced posttransplant lymphoproliferative diseases. Transplant Proc. 17, 89-92.

Henle, G. and Henle, W. (1976) Epstein-Barr virus-specific IgA serum antibodies as an outstanding feature of nasopharyngeal carcinoma. Int. J. Cancer 17, 1-17.

Henle, W., Henle, G. and Diehl, V. (1968) Relation of Burkitt's tumor-associated herpes-type virus to infectious mononucleosis. Proc. Natl. Acad. Sci. U.S.A. 59, 94-101.

Henkel, T., Ling, P., Hayward, S.D. and Peterson, M.G. (1994) Mediation of Epstein-Barr virus EBNA 2 transactivation by recombination signal-binding protein Jk. Science 265, 92-95.

Ling, P.D., Hsieh, J.J.-D., Ruf, I.K., Rawlins, D.R. and Hayward, S.D. (1994) EBNA-2 upregulation of Epstein-Barr virus latency promoters and the cellular CD23 promoter utilizes a common targeting intermediate, CBF1. J. Virol. 68, 5375-5383.

Lupton, S. and Levine, A.J. (1985) Mapping genetic elements of Epstein-Barr virus that facilitate extrachromosomal persistence of Epstein-Barr virus-derived plasmids in human cells. Mol. Cell. Biol. 5, 2533-2542.

Raab-Traub, N., Flynn, K., Pearson, G., Huang, A., Levine, P., Lainer, A. and Pagano, J. (1987) The differentiated form of nasopharyngeal carcinoma contains Epstein-Barr virus DNA. Int. J. Cancer 39, 25-29.

Saiki, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R., Horn, G.T., Mullis, K.B. and Erlich, H.A. (1988) Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239, 487-491.

Sakai, T., Ohtani, N., McGee, T.L., Robbins, P.D. and Dryja, T.P. (1991) Oncogenic germ-line mutations in Spl and ATF sites in the human retinoblastoma gene. Nature 353, 83-86.

Sanger, R., Nicklen, S. and Coulson, A. (1977) DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. U.S.A. 74, 5463-5467.

Sixbey, J.W., Vesterinen, E.H., Nedrud, J.G., Raab-Traub, N., Walton, L.A. and Pagano, J.S. (1983) Replication of Epstein-Barr virus in human epithelial cells infected in vitro. Nature 306, 480-483.

Tsang, S.F., Wang, F., Izumi, K.M. and Kieff, E. (1991) Delineation of the cis-acting element mediating EBNA-2 transactivation of latent infection membrane protein expression. J. Virol. 65, 6765-6771.

Wang, D., Liebowitz, D. and Kieff, E. (1985) An EBV membrane protein expressed in immortalized lymphocytes transforms established rodent cells. Cell 43, 831-840.

Wang, D., Liebowitz, D. and Kieff, E. (1988) The truncated form of the Epstein-Barr virus latent-infec- tion membrane protein expressed in virus replication does not transform rodent fibroblasts. J. Virol. 62, 2337-2346.

Wang, F., Tsang, S.F., Kurilla, M.G., Cohen, J.I. and Kieff, E. (1990) Epstein-Barr virus nuclear antigen 2 trans-activates the latent membrane protein (LMP1). J. Virol. 64, 3407-3416.

Young, L.S., Dawson, C., Clark, D., Rupani, H., Busson, P., Tursz, T., Johnson, A. and Rickinson, A. (1988) Epstein-Barr virus gene expression in nasopharyngeal carcinoma. J. Gen. Virol. 69, 1051- 1065.